Merge "Revert "CHA for abstract methods.""
diff --git a/build/Android.common_build.mk b/build/Android.common_build.mk
index 4c82506..f5a95fa 100644
--- a/build/Android.common_build.mk
+++ b/build/Android.common_build.mk
@@ -46,6 +46,9 @@
 $(info Disabling ART_BUILD_HOST_DEBUG)
 endif
 
+# Enable the read barrier by default.
+ART_USE_READ_BARRIER ?= true
+
 ART_CPP_EXTENSION := .cc
 
 ifndef LIBART_IMG_HOST_BASE_ADDRESS
diff --git a/build/Android.gtest.mk b/build/Android.gtest.mk
index 5bdfbc7..d8b780a 100644
--- a/build/Android.gtest.mk
+++ b/build/Android.gtest.mk
@@ -107,6 +107,7 @@
 ART_GTEST_reflection_test_DEX_DEPS := Main NonStaticLeafMethods StaticLeafMethods
 ART_GTEST_profile_assistant_test_DEX_DEPS := ProfileTestMultiDex
 ART_GTEST_profile_compilation_info_test_DEX_DEPS := ProfileTestMultiDex
+ART_GTEST_runtime_callbacks_test_DEX_DEPS := XandY
 ART_GTEST_stub_test_DEX_DEPS := AllFields
 ART_GTEST_transaction_test_DEX_DEPS := Transaction
 ART_GTEST_type_lookup_table_test_DEX_DEPS := Lookup
@@ -120,14 +121,14 @@
 ART_GTEST_dex2oat_environment_tests_HOST_DEPS := \
   $(HOST_CORE_IMAGE_optimizing_pic_64) \
   $(HOST_CORE_IMAGE_optimizing_pic_32) \
-  $(HOST_CORE_IMAGE_optimizing_no-pic_64) \
-  $(HOST_CORE_IMAGE_optimizing_no-pic_32) \
+  $(HOST_CORE_IMAGE_interpreter_pic_64) \
+  $(HOST_CORE_IMAGE_interpreter_pic_32) \
   $(HOST_OUT_EXECUTABLES)/patchoatd
 ART_GTEST_dex2oat_environment_tests_TARGET_DEPS := \
   $(TARGET_CORE_IMAGE_optimizing_pic_64) \
   $(TARGET_CORE_IMAGE_optimizing_pic_32) \
-  $(TARGET_CORE_IMAGE_optimizing_no-pic_64) \
-  $(TARGET_CORE_IMAGE_optimizing_no-pic_32) \
+  $(TARGET_CORE_IMAGE_interpreter_pic_64) \
+  $(TARGET_CORE_IMAGE_interpreter_pic_32) \
   $(TARGET_OUT_EXECUTABLES)/patchoatd
 
 ART_GTEST_oat_file_assistant_test_HOST_DEPS := \
diff --git a/build/art.go b/build/art.go
index e6e0544..84269c3 100644
--- a/build/art.go
+++ b/build/art.go
@@ -58,7 +58,7 @@
 		asflags = append(asflags, "-DART_HEAP_POISONING=1")
 	}
 
-	if envTrue(ctx, "ART_USE_READ_BARRIER") || ctx.AConfig().ArtUseReadBarrier() {
+	if !envFalse(ctx, "ART_USE_READ_BARRIER") || ctx.AConfig().ArtUseReadBarrier() {
 		// Used to change the read barrier type. Valid values are BAKER, BROOKS, TABLELOOKUP.
 		// The default is BAKER.
 		barrierType := envDefault(ctx, "ART_READ_BARRIER_TYPE", "BAKER")
diff --git a/compiler/common_compiler_test.h b/compiler/common_compiler_test.h
index f4838c1..0d45a50 100644
--- a/compiler/common_compiler_test.h
+++ b/compiler/common_compiler_test.h
@@ -23,7 +23,7 @@
 
 #include "common_runtime_test.h"
 #include "compiler.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "oat_file.h"
 
 namespace art {
diff --git a/compiler/driver/compiler_driver.h b/compiler/driver/compiler_driver.h
index 6bfdd4d..503fe3a 100644
--- a/compiler/driver/compiler_driver.h
+++ b/compiler/driver/compiler_driver.h
@@ -33,7 +33,7 @@
 #include "dex_file.h"
 #include "dex_file_types.h"
 #include "driver/compiled_method_storage.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "invoke_type.h"
 #include "method_reference.h"
 #include "mirror/class.h"  // For mirror::Class::Status.
diff --git a/compiler/driver/compiler_driver_test.cc b/compiler/driver/compiler_driver_test.cc
index 12684c0..1e4ca16 100644
--- a/compiler/driver/compiler_driver_test.cc
+++ b/compiler/driver/compiler_driver_test.cc
@@ -32,7 +32,7 @@
 #include "mirror/object_array-inl.h"
 #include "mirror/object-inl.h"
 #include "handle_scope-inl.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "scoped_thread_state_change-inl.h"
 
 namespace art {
diff --git a/compiler/verifier_deps_test.cc b/compiler/verifier_deps_test.cc
index 4f06a91..5fc9972 100644
--- a/compiler/verifier_deps_test.cc
+++ b/compiler/verifier_deps_test.cc
@@ -1414,7 +1414,14 @@
       ASSERT_FALSE(decoded_deps.ValidateDependencies(new_class_loader, soa.Self()));
     }
 
-    {
+    // The two tests below make sure that fiddling with the method kind
+    // (static, virtual, interface) is detected by `ValidateDependencies`.
+
+    // An interface method lookup can succeed with a virtual method lookup on the same class.
+    // That's OK, as we only want to make sure there is a method being defined with the right
+    // flags. Therefore, polluting the interface methods with virtual methods does not have
+    // to fail verification.
+    if (resolution_kind != kVirtualMethodResolution) {
       VerifierDeps decoded_deps(dex_files_, ArrayRef<const uint8_t>(buffer));
       VerifierDeps::DexFileDeps* deps = decoded_deps.GetDexFileDeps(*primary_dex_file_);
       bool found = false;
@@ -1433,7 +1440,8 @@
       ASSERT_FALSE(decoded_deps.ValidateDependencies(new_class_loader, soa.Self()));
     }
 
-    {
+    // See comment above that applies the same way.
+    if (resolution_kind != kInterfaceMethodResolution) {
       VerifierDeps decoded_deps(dex_files_, ArrayRef<const uint8_t>(buffer));
       VerifierDeps::DexFileDeps* deps = decoded_deps.GetDexFileDeps(*primary_dex_file_);
       bool found = false;
diff --git a/dex2oat/dex2oat.cc b/dex2oat/dex2oat.cc
index 3fbdb89..e8a92c1 100644
--- a/dex2oat/dex2oat.cc
+++ b/dex2oat/dex2oat.cc
@@ -64,7 +64,7 @@
 #include "gc/space/space-inl.h"
 #include "image_writer.h"
 #include "interpreter/unstarted_runtime.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "leb128.h"
 #include "linker/buffered_output_stream.h"
 #include "linker/file_output_stream.h"
diff --git a/dex2oat/dex2oat_test.cc b/dex2oat/dex2oat_test.cc
index cdb3b9f..e86e560 100644
--- a/dex2oat/dex2oat_test.cc
+++ b/dex2oat/dex2oat_test.cc
@@ -30,7 +30,7 @@
 #include "base/macros.h"
 #include "dex_file-inl.h"
 #include "dex2oat_environment_test.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "oat.h"
 #include "oat_file.h"
 #include "utils.h"
diff --git a/dexlayout/dex_visualize.cc b/dexlayout/dex_visualize.cc
index 02274b2..75d47e4 100644
--- a/dexlayout/dex_visualize.cc
+++ b/dexlayout/dex_visualize.cc
@@ -31,7 +31,7 @@
 
 #include "dex_ir.h"
 #include "dexlayout.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 
 namespace art {
 
diff --git a/dexlayout/dexlayout.cc b/dexlayout/dexlayout.cc
index cac6090..1add6bf 100644
--- a/dexlayout/dexlayout.cc
+++ b/dexlayout/dexlayout.cc
@@ -37,7 +37,7 @@
 #include "dex_instruction-inl.h"
 #include "dex_visualize.h"
 #include "dex_writer.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "mem_map.h"
 #include "os.h"
 #include "utils.h"
diff --git a/dexlayout/dexlayout_main.cc b/dexlayout/dexlayout_main.cc
index 5f8a118..ad599ae 100644
--- a/dexlayout/dexlayout_main.cc
+++ b/dexlayout/dexlayout_main.cc
@@ -30,7 +30,7 @@
 #include <fcntl.h>
 
 #include "base/logging.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "runtime.h"
 #include "mem_map.h"
 
diff --git a/profman/profile_assistant.h b/profman/profile_assistant.h
index d3c75b8..be703ab 100644
--- a/profman/profile_assistant.h
+++ b/profman/profile_assistant.h
@@ -21,7 +21,7 @@
 #include <vector>
 
 #include "base/scoped_flock.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 
 namespace art {
 
diff --git a/profman/profile_assistant_test.cc b/profman/profile_assistant_test.cc
index 776c31a..2f40fef 100644
--- a/profman/profile_assistant_test.cc
+++ b/profman/profile_assistant_test.cc
@@ -19,7 +19,7 @@
 #include "base/unix_file/fd_file.h"
 #include "common_runtime_test.h"
 #include "profile_assistant.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "utils.h"
 
 namespace art {
diff --git a/profman/profman.cc b/profman/profman.cc
index e538407..ffebb6a 100644
--- a/profman/profman.cc
+++ b/profman/profman.cc
@@ -34,7 +34,7 @@
 #include "base/time_utils.h"
 #include "base/unix_file/fd_file.h"
 #include "dex_file.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "runtime.h"
 #include "utils.h"
 #include "zip_archive.h"
diff --git a/runtime/Android.bp b/runtime/Android.bp
index 86019bf..81f174e 100644
--- a/runtime/Android.bp
+++ b/runtime/Android.bp
@@ -112,7 +112,7 @@
         "jit/debugger_interface.cc",
         "jit/jit.cc",
         "jit/jit_code_cache.cc",
-        "jit/offline_profiling_info.cc",
+        "jit/profile_compilation_info.cc",
         "jit/profiling_info.cc",
         "jit/profile_saver.cc",
         "jni_internal.cc",
@@ -184,6 +184,7 @@
         "reference_table.cc",
         "reflection.cc",
         "runtime.cc",
+        "runtime_callbacks.cc",
         "runtime_options.cc",
         "signal_catcher.cc",
         "stack.cc",
@@ -563,6 +564,7 @@
         "parsed_options_test.cc",
         "prebuilt_tools_test.cc",
         "reference_table_test.cc",
+        "runtime_callbacks_test.cc",
         "thread_pool_test.cc",
         "transaction_test.cc",
         "type_lookup_table_test.cc",
diff --git a/runtime/class_linker.cc b/runtime/class_linker.cc
index 49cffed..14918df 100644
--- a/runtime/class_linker.cc
+++ b/runtime/class_linker.cc
@@ -65,7 +65,7 @@
 #include "interpreter/interpreter.h"
 #include "jit/jit.h"
 #include "jit/jit_code_cache.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "jni_internal.h"
 #include "leb128.h"
 #include "linear_alloc.h"
@@ -96,6 +96,7 @@
 #include "object_lock.h"
 #include "os.h"
 #include "runtime.h"
+#include "runtime_callbacks.h"
 #include "ScopedLocalRef.h"
 #include "scoped_thread_state_change-inl.h"
 #include "thread-inl.h"
@@ -2678,6 +2679,11 @@
     return nullptr;
   }
   CHECK(klass->IsLoaded());
+
+  // At this point the class is loaded. Publish a ClassLoad even.
+  // Note: this may be a temporary class. It is a listener's responsibility to handle this.
+  Runtime::Current()->GetRuntimeCallbacks()->ClassLoad(klass);
+
   // Link the class (if necessary)
   CHECK(!klass->IsResolved());
   // TODO: Use fast jobjects?
@@ -2718,7 +2724,7 @@
    * The class has been prepared and resolved but possibly not yet verified
    * at this point.
    */
-  Dbg::PostClassPrepare(h_new_class.Get());
+  Runtime::Current()->GetRuntimeCallbacks()->ClassPrepare(klass, h_new_class);
 
   // Notify native debugger of the new class and its layout.
   jit::Jit::NewTypeLoadedIfUsingJit(h_new_class.Get());
diff --git a/runtime/class_linker.h b/runtime/class_linker.h
index 9b98671..8da979b 100644
--- a/runtime/class_linker.h
+++ b/runtime/class_linker.h
@@ -34,6 +34,7 @@
 #include "dex_file.h"
 #include "dex_file_types.h"
 #include "gc_root.h"
+#include "handle.h"
 #include "jni.h"
 #include "mirror/class.h"
 #include "object_callbacks.h"
@@ -1194,6 +1195,21 @@
   DISALLOW_COPY_AND_ASSIGN(ClassLinker);
 };
 
+class ClassLoadCallback {
+ public:
+  virtual ~ClassLoadCallback() {}
+
+  // A class has been loaded.
+  // Note: the class may be temporary, in which case a following ClassPrepare event will be a
+  //       different object. It is the listener's responsibility to handle this.
+  virtual void ClassLoad(Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+
+  // A class has been prepared, i.e., resolved. As the ClassLoad event might have been for a
+  // temporary class, provide both the former and the current class.
+  virtual void ClassPrepare(Handle<mirror::Class> temp_klass,
+                            Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
 }  // namespace art
 
 #endif  // ART_RUNTIME_CLASS_LINKER_H_
diff --git a/runtime/common_runtime_test.cc b/runtime/common_runtime_test.cc
index 743fcc8..fc82264 100644
--- a/runtime/common_runtime_test.cc
+++ b/runtime/common_runtime_test.cc
@@ -133,7 +133,9 @@
 
 static bool unstarted_initialized_ = false;
 
-CommonRuntimeTestImpl::CommonRuntimeTestImpl() {}
+CommonRuntimeTestImpl::CommonRuntimeTestImpl()
+    : class_linker_(nullptr), java_lang_dex_file_(nullptr) {
+}
 
 CommonRuntimeTestImpl::~CommonRuntimeTestImpl() {
   // Ensure the dex files are cleaned up before the runtime.
@@ -425,7 +427,9 @@
   TearDownAndroidData(android_data_, true);
   dalvik_cache_.clear();
 
-  Runtime::Current()->GetHeap()->VerifyHeap();  // Check for heap corruption after the test
+  if (runtime_ != nullptr) {
+    runtime_->GetHeap()->VerifyHeap();  // Check for heap corruption after the test
+  }
 }
 
 static std::string GetDexFileName(const std::string& jar_prefix, bool host) {
diff --git a/runtime/debugger.cc b/runtime/debugger.cc
index 006476b..22a3163 100644
--- a/runtime/debugger.cc
+++ b/runtime/debugger.cc
@@ -320,6 +320,9 @@
 size_t Dbg::exception_catch_event_ref_count_ = 0;
 uint32_t Dbg::instrumentation_events_ = 0;
 
+Dbg::DbgThreadLifecycleCallback Dbg::thread_lifecycle_callback_;
+Dbg::DbgClassLoadCallback Dbg::class_load_callback_;
+
 // Breakpoints.
 static std::vector<Breakpoint> gBreakpoints GUARDED_BY(Locks::breakpoint_lock_);
 
@@ -5135,4 +5138,20 @@
   }
 }
 
+void Dbg::DbgThreadLifecycleCallback::ThreadStart(Thread* self) {
+  Dbg::PostThreadStart(self);
+}
+
+void Dbg::DbgThreadLifecycleCallback::ThreadDeath(Thread* self) {
+  Dbg::PostThreadDeath(self);
+}
+
+void Dbg::DbgClassLoadCallback::ClassLoad(Handle<mirror::Class> klass ATTRIBUTE_UNUSED) {
+  // Ignore ClassLoad;
+}
+void Dbg::DbgClassLoadCallback::ClassPrepare(Handle<mirror::Class> temp_klass ATTRIBUTE_UNUSED,
+                                             Handle<mirror::Class> klass) {
+  Dbg::PostClassPrepare(klass.Get());
+}
+
 }  // namespace art
diff --git a/runtime/debugger.h b/runtime/debugger.h
index 3b4a5e1..a7fd160 100644
--- a/runtime/debugger.h
+++ b/runtime/debugger.h
@@ -28,6 +28,8 @@
 #include <vector>
 
 #include "gc_root.h"
+#include "class_linker.h"
+#include "handle.h"
 #include "jdwp/jdwp.h"
 #include "jni.h"
 #include "jvalue.h"
@@ -502,12 +504,6 @@
       REQUIRES_SHARED(Locks::mutator_lock_);
   static void PostException(mirror::Throwable* exception)
       REQUIRES_SHARED(Locks::mutator_lock_);
-  static void PostThreadStart(Thread* t)
-      REQUIRES_SHARED(Locks::mutator_lock_);
-  static void PostThreadDeath(Thread* t)
-      REQUIRES_SHARED(Locks::mutator_lock_);
-  static void PostClassPrepare(mirror::Class* c)
-      REQUIRES_SHARED(Locks::mutator_lock_);
 
   static void UpdateDebugger(Thread* thread, mirror::Object* this_object,
                              ArtMethod* method, uint32_t new_dex_pc,
@@ -707,6 +703,13 @@
     return instrumentation_events_;
   }
 
+  static ThreadLifecycleCallback* GetThreadLifecycleCallback() {
+    return &thread_lifecycle_callback_;
+  }
+  static ClassLoadCallback* GetClassLoadCallback() {
+    return &class_load_callback_;
+  }
+
  private:
   static void ExecuteMethodWithoutPendingException(ScopedObjectAccess& soa, DebugInvokeReq* pReq)
       REQUIRES_SHARED(Locks::mutator_lock_);
@@ -725,9 +728,17 @@
       REQUIRES(!Locks::thread_list_lock_) REQUIRES_SHARED(Locks::mutator_lock_);
 
   static void DdmBroadcast(bool connect) REQUIRES_SHARED(Locks::mutator_lock_);
+
+  static void PostThreadStart(Thread* t)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+  static void PostThreadDeath(Thread* t)
+      REQUIRES_SHARED(Locks::mutator_lock_);
   static void PostThreadStartOrStop(Thread*, uint32_t)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
+  static void PostClassPrepare(mirror::Class* c)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+
   static void PostLocationEvent(ArtMethod* method, int pcOffset,
                                 mirror::Object* thisPtr, int eventFlags,
                                 const JValue* return_value)
@@ -789,6 +800,22 @@
   static size_t exception_catch_event_ref_count_ GUARDED_BY(Locks::deoptimization_lock_);
   static uint32_t instrumentation_events_ GUARDED_BY(Locks::mutator_lock_);
 
+  class DbgThreadLifecycleCallback : public ThreadLifecycleCallback {
+   public:
+    void ThreadStart(Thread* self) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+    void ThreadDeath(Thread* self) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+  };
+
+  class DbgClassLoadCallback : public ClassLoadCallback {
+   public:
+    void ClassLoad(Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+    void ClassPrepare(Handle<mirror::Class> temp_klass,
+                      Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+  };
+
+  static DbgThreadLifecycleCallback thread_lifecycle_callback_;
+  static DbgClassLoadCallback class_load_callback_;
+
   DISALLOW_COPY_AND_ASSIGN(Dbg);
 };
 
diff --git a/runtime/dex2oat_environment_test.h b/runtime/dex2oat_environment_test.h
index b0c4597..7ae9f03 100644
--- a/runtime/dex2oat_environment_test.h
+++ b/runtime/dex2oat_environment_test.h
@@ -160,7 +160,7 @@
   // image at GetImageLocation(). This is used for testing mismatched
   // image checksums in the oat_file_assistant_tests.
   std::string GetImageLocation2() const {
-    return GetImageDirectory() + "/core-npic.art";
+    return GetImageDirectory() + "/core-interpreter.art";
   }
 
   std::string GetDexSrc1() const {
diff --git a/runtime/gc/space/large_object_space.cc b/runtime/gc/space/large_object_space.cc
index e71a397..4c6b5bf 100644
--- a/runtime/gc/space/large_object_space.cc
+++ b/runtime/gc/space/large_object_space.cc
@@ -141,16 +141,6 @@
     return nullptr;
   }
   mirror::Object* const obj = reinterpret_cast<mirror::Object*>(mem_map->Begin());
-  if (kIsDebugBuild) {
-    ReaderMutexLock mu2(Thread::Current(), *Locks::heap_bitmap_lock_);
-    auto* heap = Runtime::Current()->GetHeap();
-    auto* live_bitmap = heap->GetLiveBitmap();
-    auto* space_bitmap = live_bitmap->GetContinuousSpaceBitmap(obj);
-    CHECK(space_bitmap == nullptr) << obj << " overlaps with bitmap " << *space_bitmap;
-    auto* obj_end = reinterpret_cast<mirror::Object*>(mem_map->End());
-    space_bitmap = live_bitmap->GetContinuousSpaceBitmap(obj_end - 1);
-    CHECK(space_bitmap == nullptr) << obj_end << " overlaps with bitmap " << *space_bitmap;
-  }
   MutexLock mu(self, lock_);
   large_objects_.Put(obj, LargeObject {mem_map, false /* not zygote */});
   const size_t allocation_size = mem_map->BaseSize();
diff --git a/runtime/interpreter/interpreter_common.cc b/runtime/interpreter/interpreter_common.cc
index 76777d9..28bcb97 100644
--- a/runtime/interpreter/interpreter_common.cc
+++ b/runtime/interpreter/interpreter_common.cc
@@ -596,7 +596,7 @@
     // Get the register arguments for the invoke.
     inst->GetVarArgs(args, inst_data);
     // Drop the first register which is the method handle performing the invoke.
-    memcpy(args, args + 1, sizeof(args[0]) * (Instruction::kMaxVarArgRegs - 1));
+    memmove(args, args + 1, sizeof(args[0]) * (Instruction::kMaxVarArgRegs - 1));
     args[Instruction::kMaxVarArgRegs - 1] = 0;
     return DoInvokePolymorphic<is_range, do_access_check>(self,
                                                           invoke_method,
diff --git a/runtime/jit/jit.cc b/runtime/jit/jit.cc
index b7125a8..2bb8819 100644
--- a/runtime/jit/jit.cc
+++ b/runtime/jit/jit.cc
@@ -26,7 +26,7 @@
 #include "jit_code_cache.h"
 #include "oat_file_manager.h"
 #include "oat_quick_method_header.h"
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
 #include "profile_saver.h"
 #include "runtime.h"
 #include "runtime_options.h"
diff --git a/runtime/jit/jit.h b/runtime/jit/jit.h
index 05c3905..4112142 100644
--- a/runtime/jit/jit.h
+++ b/runtime/jit/jit.h
@@ -25,7 +25,7 @@
 #include "jit/profile_saver_options.h"
 #include "obj_ptr.h"
 #include "object_callbacks.h"
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
 #include "thread_pool.h"
 
 namespace art {
diff --git a/runtime/jit/offline_profiling_info.cc b/runtime/jit/profile_compilation_info.cc
similarity index 99%
rename from runtime/jit/offline_profiling_info.cc
rename to runtime/jit/profile_compilation_info.cc
index 6f2a8c6..1405c40 100644
--- a/runtime/jit/offline_profiling_info.cc
+++ b/runtime/jit/profile_compilation_info.cc
@@ -14,7 +14,7 @@
  * limitations under the License.
  */
 
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
 
 #include "errno.h"
 #include <limits.h>
diff --git a/runtime/jit/offline_profiling_info.h b/runtime/jit/profile_compilation_info.h
similarity index 97%
rename from runtime/jit/offline_profiling_info.h
rename to runtime/jit/profile_compilation_info.h
index 53d0eea..f8061bc 100644
--- a/runtime/jit/offline_profiling_info.h
+++ b/runtime/jit/profile_compilation_info.h
@@ -14,8 +14,8 @@
  * limitations under the License.
  */
 
-#ifndef ART_RUNTIME_JIT_OFFLINE_PROFILING_INFO_H_
-#define ART_RUNTIME_JIT_OFFLINE_PROFILING_INFO_H_
+#ifndef ART_RUNTIME_JIT_PROFILE_COMPILATION_INFO_H_
+#define ART_RUNTIME_JIT_PROFILE_COMPILATION_INFO_H_
 
 #include <set>
 #include <vector>
@@ -29,7 +29,6 @@
 
 namespace art {
 
-// TODO: rename file.
 /**
  * Profile information in a format suitable to be queried by the compiler and
  * performing profile guided compilation.
@@ -187,4 +186,4 @@
 
 }  // namespace art
 
-#endif  // ART_RUNTIME_JIT_OFFLINE_PROFILING_INFO_H_
+#endif  // ART_RUNTIME_JIT_PROFILE_COMPILATION_INFO_H_
diff --git a/runtime/jit/profile_compilation_info_test.cc b/runtime/jit/profile_compilation_info_test.cc
index 1dd1e36..835a5f3 100644
--- a/runtime/jit/profile_compilation_info_test.cc
+++ b/runtime/jit/profile_compilation_info_test.cc
@@ -25,7 +25,7 @@
 #include "mirror/class-inl.h"
 #include "mirror/class_loader.h"
 #include "handle_scope-inl.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "scoped_thread_state_change-inl.h"
 
 namespace art {
diff --git a/runtime/jit/profile_saver.h b/runtime/jit/profile_saver.h
index 59e2c94..9c5e41f 100644
--- a/runtime/jit/profile_saver.h
+++ b/runtime/jit/profile_saver.h
@@ -19,7 +19,7 @@
 
 #include "base/mutex.h"
 #include "jit_code_cache.h"
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
 #include "profile_saver_options.h"
 #include "safe_map.h"
 
diff --git a/runtime/oat.h b/runtime/oat.h
index 3b3ab5a..953b445 100644
--- a/runtime/oat.h
+++ b/runtime/oat.h
@@ -32,7 +32,7 @@
 class PACKED(4) OatHeader {
  public:
   static constexpr uint8_t kOatMagic[] = { 'o', 'a', 't', '\n' };
-  static constexpr uint8_t kOatVersion[] = { '1', '0', '1', '\0' };  // Array entrypoints change
+  static constexpr uint8_t kOatVersion[] = { '1', '0', '2', '\0' };  // Enabling CC
 
   static constexpr const char* kImageLocationKey = "image-location";
   static constexpr const char* kDex2OatCmdLineKey = "dex2oat-cmdline";
diff --git a/runtime/oat_file_assistant_test.cc b/runtime/oat_file_assistant_test.cc
index afa804c..84eacde 100644
--- a/runtime/oat_file_assistant_test.cc
+++ b/runtime/oat_file_assistant_test.cc
@@ -152,15 +152,17 @@
       }
     }
 
-    if (CompilerFilter::IsBytecodeCompilationEnabled(filter)) {
-      if (relocate) {
-        EXPECT_EQ(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
-            oat_header.GetImageFileLocationOatDataBegin());
-        EXPECT_EQ(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
-      } else {
-        EXPECT_NE(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
-            oat_header.GetImageFileLocationOatDataBegin());
-        EXPECT_NE(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
+    if (!with_alternate_image) {
+      if (CompilerFilter::IsBytecodeCompilationEnabled(filter)) {
+        if (relocate) {
+          EXPECT_EQ(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
+              oat_header.GetImageFileLocationOatDataBegin());
+          EXPECT_EQ(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
+        } else {
+          EXPECT_NE(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
+              oat_header.GetImageFileLocationOatDataBegin());
+          EXPECT_NE(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
+        }
       }
     }
   }
diff --git a/runtime/openjdkjvmti/Android.bp b/runtime/openjdkjvmti/Android.bp
index d5c6520..acdd0d3 100644
--- a/runtime/openjdkjvmti/Android.bp
+++ b/runtime/openjdkjvmti/Android.bp
@@ -27,6 +27,7 @@
            "ti_method.cc",
            "ti_monitor.cc",
            "ti_object.cc",
+           "ti_phase.cc",
            "ti_properties.cc",
            "ti_search.cc",
            "ti_stack.cc",
diff --git a/runtime/openjdkjvmti/OpenjdkJvmTi.cc b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
index 90467db..fcedd4e 100644
--- a/runtime/openjdkjvmti/OpenjdkJvmTi.cc
+++ b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
@@ -55,6 +55,7 @@
 #include "ti_method.h"
 #include "ti_monitor.h"
 #include "ti_object.h"
+#include "ti_phase.h"
 #include "ti_properties.h"
 #include "ti_redefine.h"
 #include "ti_search.h"
@@ -194,15 +195,15 @@
                                    jvmtiStartFunction proc,
                                    const void* arg,
                                    jint priority) {
-    return ERR(NOT_IMPLEMENTED);
+    return ThreadUtil::RunAgentThread(env, thread, proc, arg, priority);
   }
 
   static jvmtiError SetThreadLocalStorage(jvmtiEnv* env, jthread thread, const void* data) {
-    return ERR(NOT_IMPLEMENTED);
+    return ThreadUtil::SetThreadLocalStorage(env, thread, data);
   }
 
   static jvmtiError GetThreadLocalStorage(jvmtiEnv* env, jthread thread, void** data_ptr) {
-    return ERR(NOT_IMPLEMENTED);
+    return ThreadUtil::GetThreadLocalStorage(env, thread, data_ptr);
   }
 
   static jvmtiError GetTopThreadGroups(jvmtiEnv* env,
@@ -593,7 +594,7 @@
                                            jclass klass,
                                            jint* minor_version_ptr,
                                            jint* major_version_ptr) {
-    return ERR(NOT_IMPLEMENTED);
+    return ClassUtil::GetClassVersionNumbers(env, klass, minor_version_ptr, major_version_ptr);
   }
 
   static jvmtiError GetConstantPool(jvmtiEnv* env,
@@ -631,7 +632,17 @@
   }
 
   static jvmtiError RetransformClasses(jvmtiEnv* env, jint class_count, const jclass* classes) {
-    return ERR(NOT_IMPLEMENTED);
+    std::string error_msg;
+    jvmtiError res = Transformer::RetransformClasses(ArtJvmTiEnv::AsArtJvmTiEnv(env),
+                                                     art::Runtime::Current(),
+                                                     art::Thread::Current(),
+                                                     class_count,
+                                                     classes,
+                                                     &error_msg);
+    if (res != OK) {
+      LOG(WARNING) << "FAILURE TO RETRANFORM " << error_msg;
+    }
+    return res;
   }
 
   static jvmtiError RedefineClasses(jvmtiEnv* env,
@@ -1089,11 +1100,12 @@
   }
 
   static jvmtiError GetPhase(jvmtiEnv* env, jvmtiPhase* phase_ptr) {
-    return ERR(NOT_IMPLEMENTED);
+    return PhaseUtil::GetPhase(env, phase_ptr);
   }
 
   static jvmtiError DisposeEnvironment(jvmtiEnv* env) {
     ENSURE_VALID_ENV(env);
+    gEventHandler.RemoveArtJvmTiEnv(ArtJvmTiEnv::AsArtJvmTiEnv(env));
     delete env;
     return OK;
   }
@@ -1255,78 +1267,6 @@
     *format_ptr = jvmtiJlocationFormat::JVMTI_JLOCATION_JVMBCI;
     return ERR(NONE);
   }
-
-  // TODO Remove this once events are working.
-  static jvmtiError RetransformClassWithHook(jvmtiEnv* env,
-                                             jclass klass,
-                                             jvmtiEventClassFileLoadHook hook) {
-    std::vector<jclass> classes;
-    classes.push_back(klass);
-    return RetransformClassesWithHook(reinterpret_cast<ArtJvmTiEnv*>(env), classes, hook);
-  }
-
-  // TODO This will be called by the event handler for the art::ti Event Load Event
-  static jvmtiError RetransformClassesWithHook(ArtJvmTiEnv* env,
-                                               const std::vector<jclass>& classes,
-                                               jvmtiEventClassFileLoadHook hook) {
-    if (!IsValidEnv(env)) {
-      return ERR(INVALID_ENVIRONMENT);
-    }
-    jvmtiError res = OK;
-    std::string error;
-    for (jclass klass : classes) {
-      JNIEnv* jni_env = nullptr;
-      jobject loader = nullptr;
-      std::string name;
-      jobject protection_domain = nullptr;
-      jint data_len = 0;
-      unsigned char* dex_data = nullptr;
-      jvmtiError ret = OK;
-      std::string location;
-      if ((ret = GetTransformationData(env,
-                                       klass,
-                                       /*out*/&location,
-                                       /*out*/&jni_env,
-                                       /*out*/&loader,
-                                       /*out*/&name,
-                                       /*out*/&protection_domain,
-                                       /*out*/&data_len,
-                                       /*out*/&dex_data)) != OK) {
-        // TODO Do something more here? Maybe give log statements?
-        return ret;
-      }
-      jint new_data_len = 0;
-      unsigned char* new_dex_data = nullptr;
-      hook(env,
-           jni_env,
-           klass,
-           loader,
-           name.c_str(),
-           protection_domain,
-           data_len,
-           dex_data,
-           /*out*/&new_data_len,
-           /*out*/&new_dex_data);
-      // Check if anything actually changed.
-      if ((new_data_len != 0 || new_dex_data != nullptr) && new_dex_data != dex_data) {
-        jvmtiClassDefinition def = { klass, new_data_len, new_dex_data };
-        res = Redefiner::RedefineClasses(env,
-                                         art::Runtime::Current(),
-                                         art::Thread::Current(),
-                                         1,
-                                         &def,
-                                         &error);
-        env->Deallocate(new_dex_data);
-      }
-      // Deallocate the old dex data.
-      env->Deallocate(dex_data);
-      if (res != OK) {
-        LOG(ERROR) << "FAILURE TO REDEFINE " << error;
-        return res;
-      }
-    }
-    return OK;
-  }
 };
 
 static bool IsJvmtiVersion(jint version) {
@@ -1362,17 +1302,23 @@
 // The plugin initialization function. This adds the jvmti environment.
 extern "C" bool ArtPlugin_Initialize() {
   art::Runtime* runtime = art::Runtime::Current();
+
+  if (runtime->IsStarted()) {
+    PhaseUtil::SetToLive();
+  } else {
+    PhaseUtil::SetToOnLoad();
+  }
+  PhaseUtil::Register(&gEventHandler);
+
   runtime->GetJavaVM()->AddEnvironmentHook(GetEnvHandler);
   runtime->AddSystemWeakHolder(&gObjectTagTable);
+
   return true;
 }
 
 // The actual struct holding all of the entrypoints into the jvmti interface.
 const jvmtiInterface_1 gJvmtiInterface = {
-  // SPECIAL FUNCTION: RetransformClassWithHook Is normally reserved1
-  // TODO Remove once we have events working.
-  reinterpret_cast<void*>(JvmtiFunctions::RetransformClassWithHook),
-  // nullptr,  // reserved1
+  nullptr,  // reserved1
   JvmtiFunctions::SetEventNotificationMode,
   nullptr,  // reserved3
   JvmtiFunctions::GetAllThreads,
diff --git a/runtime/openjdkjvmti/art_jvmti.h b/runtime/openjdkjvmti/art_jvmti.h
index 5eadc5a..1c84d4d 100644
--- a/runtime/openjdkjvmti/art_jvmti.h
+++ b/runtime/openjdkjvmti/art_jvmti.h
@@ -47,6 +47,7 @@
 namespace openjdkjvmti {
 
 extern const jvmtiInterface_1 gJvmtiInterface;
+extern EventHandler gEventHandler;
 
 // A structure that is a jvmtiEnv with additional information for the runtime.
 struct ArtJvmTiEnv : public jvmtiEnv {
@@ -124,6 +125,29 @@
   return ret;
 }
 
+struct ArtClassDefinition {
+  jclass klass;
+  jobject loader;
+  std::string name;
+  jobject protection_domain;
+  jint dex_len;
+  JvmtiUniquePtr dex_data;
+  bool modified;
+
+  ArtClassDefinition() = default;
+  ArtClassDefinition(ArtClassDefinition&& o) = default;
+
+  void SetNewDexData(ArtJvmTiEnv* env, jint new_dex_len, unsigned char* new_dex_data) {
+    if (new_dex_data == nullptr) {
+      return;
+    } else if (new_dex_data != dex_data.get() || new_dex_len != dex_len) {
+      modified = true;
+      dex_len = new_dex_len;
+      dex_data = MakeJvmtiUniquePtr(env, new_dex_data);
+    }
+  }
+};
+
 const jvmtiCapabilities kPotentialCapabilities = {
     .can_tag_objects                                 = 1,
     .can_generate_field_modification_events          = 0,
@@ -134,7 +158,7 @@
     .can_get_current_contended_monitor               = 0,
     .can_get_monitor_info                            = 0,
     .can_pop_frame                                   = 0,
-    .can_redefine_classes                            = 0,
+    .can_redefine_classes                            = 1,
     .can_signal_thread                               = 0,
     .can_get_source_file_name                        = 0,
     .can_get_line_numbers                            = 0,
@@ -162,7 +186,7 @@
     .can_get_owned_monitor_stack_depth_info          = 0,
     .can_get_constant_pool                           = 0,
     .can_set_native_method_prefix                    = 0,
-    .can_retransform_classes                         = 0,
+    .can_retransform_classes                         = 1,
     .can_retransform_any_class                       = 0,
     .can_generate_resource_exhaustion_heap_events    = 0,
     .can_generate_resource_exhaustion_threads_events = 0,
diff --git a/runtime/openjdkjvmti/events-inl.h b/runtime/openjdkjvmti/events-inl.h
index 1e07bc6..21ec731 100644
--- a/runtime/openjdkjvmti/events-inl.h
+++ b/runtime/openjdkjvmti/events-inl.h
@@ -115,9 +115,95 @@
 }
 
 template <typename ...Args>
+inline void EventHandler::DispatchClassFileLoadHookEvent(art::Thread*,
+                                                         ArtJvmtiEvent event,
+                                                         Args... args ATTRIBUTE_UNUSED) const {
+  CHECK(event == ArtJvmtiEvent::kClassFileLoadHookRetransformable ||
+        event == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable);
+  LOG(FATAL) << "Incorrect arguments to ClassFileLoadHook!";
+}
+
+// TODO Locking of some type!
+template <>
+inline void EventHandler::DispatchClassFileLoadHookEvent(art::Thread* thread,
+                                                         ArtJvmtiEvent event,
+                                                         JNIEnv* jnienv,
+                                                         jclass class_being_redefined,
+                                                         jobject loader,
+                                                         const char* name,
+                                                         jobject protection_domain,
+                                                         jint class_data_len,
+                                                         const unsigned char* class_data,
+                                                         jint* new_class_data_len,
+                                                         unsigned char** new_class_data) const {
+  CHECK(event == ArtJvmtiEvent::kClassFileLoadHookRetransformable ||
+        event == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable);
+  using FnType = void(jvmtiEnv*            /* jvmti_env */,
+                      JNIEnv*              /* jnienv */,
+                      jclass               /* class_being_redefined */,
+                      jobject              /* loader */,
+                      const char*          /* name */,
+                      jobject              /* protection_domain */,
+                      jint                 /* class_data_len */,
+                      const unsigned char* /* class_data */,
+                      jint*                /* new_class_data_len */,
+                      unsigned char**      /* new_class_data */);
+  jint current_len = class_data_len;
+  unsigned char* current_class_data = const_cast<unsigned char*>(class_data);
+  ArtJvmTiEnv* last_env = nullptr;
+  for (ArtJvmTiEnv* env : envs) {
+    if (ShouldDispatch(event, env, thread)) {
+      jint new_len;
+      unsigned char* new_data;
+      FnType* callback = GetCallback<FnType>(env, event);
+      callback(env,
+               jnienv,
+               class_being_redefined,
+               loader,
+               name,
+               protection_domain,
+               current_len,
+               current_class_data,
+               &new_len,
+               &new_data);
+      if (new_data != nullptr && new_data != current_class_data) {
+        // Destroy the data the last transformer made. We skip this if the previous state was the
+        // initial one since we don't know here which jvmtiEnv allocated it.
+        // NB Currently this doesn't matter since all allocations just go to malloc but in the
+        // future we might have jvmtiEnv's keep track of their allocations for leak-checking.
+        if (last_env != nullptr) {
+          last_env->Deallocate(current_class_data);
+        }
+        last_env = env;
+        current_class_data = new_data;
+        current_len = new_len;
+      }
+    }
+  }
+  if (last_env != nullptr) {
+    *new_class_data_len = current_len;
+    *new_class_data = current_class_data;
+  }
+}
+
+template <typename ...Args>
 inline void EventHandler::DispatchEvent(art::Thread* thread,
                                         ArtJvmtiEvent event,
                                         Args... args) const {
+  switch (event) {
+    case ArtJvmtiEvent::kClassFileLoadHookRetransformable:
+    case ArtJvmtiEvent::kClassFileLoadHookNonRetransformable:
+      return DispatchClassFileLoadHookEvent(thread, event, args...);
+    default:
+      return GenericDispatchEvent(thread, event, args...);
+  }
+}
+
+// TODO Locking of some type!
+template <typename ...Args>
+inline void EventHandler::GenericDispatchEvent(art::Thread* thread,
+                                               ArtJvmtiEvent event,
+                                               Args... args) const {
   using FnType = void(jvmtiEnv*, Args...);
   for (ArtJvmTiEnv* env : envs) {
     if (ShouldDispatch(event, env, thread)) {
diff --git a/runtime/openjdkjvmti/events.cc b/runtime/openjdkjvmti/events.cc
index f38aa86..7182055 100644
--- a/runtime/openjdkjvmti/events.cc
+++ b/runtime/openjdkjvmti/events.cc
@@ -144,6 +144,18 @@
   envs.push_back(env);
 }
 
+void EventHandler::RemoveArtJvmTiEnv(ArtJvmTiEnv* env) {
+  auto it = std::find(envs.begin(), envs.end(), env);
+  if (it != envs.end()) {
+    envs.erase(it);
+    for (size_t i = static_cast<size_t>(ArtJvmtiEvent::kMinEventTypeVal);
+         i <= static_cast<size_t>(ArtJvmtiEvent::kMaxEventTypeVal);
+         ++i) {
+      RecalculateGlobalEventMask(static_cast<ArtJvmtiEvent>(i));
+    }
+  }
+}
+
 static bool IsThreadControllable(ArtJvmtiEvent event) {
   switch (event) {
     case ArtJvmtiEvent::kVmInit:
diff --git a/runtime/openjdkjvmti/events.h b/runtime/openjdkjvmti/events.h
index 7990141..8e246de 100644
--- a/runtime/openjdkjvmti/events.h
+++ b/runtime/openjdkjvmti/events.h
@@ -141,6 +141,9 @@
   // enabled, yet.
   void RegisterArtJvmTiEnv(ArtJvmTiEnv* env);
 
+  // Remove an env.
+  void RemoveArtJvmTiEnv(ArtJvmTiEnv* env);
+
   bool IsEventEnabledAnywhere(ArtJvmtiEvent event) const {
     if (!EventMask::EventIsInRange(event)) {
       return false;
@@ -178,6 +181,15 @@
   ALWAYS_INLINE
   inline void RecalculateGlobalEventMask(ArtJvmtiEvent event);
 
+  template <typename ...Args>
+  ALWAYS_INLINE inline void GenericDispatchEvent(art::Thread* thread,
+                                                 ArtJvmtiEvent event,
+                                                 Args... args) const;
+  template <typename ...Args>
+  ALWAYS_INLINE inline void DispatchClassFileLoadHookEvent(art::Thread* thread,
+                                                           ArtJvmtiEvent event,
+                                                           Args... args) const;
+
   void HandleEventType(ArtJvmtiEvent event, bool enable);
 
   // List of all JvmTiEnv objects that have been created, in their creation order.
diff --git a/runtime/openjdkjvmti/ti_class.cc b/runtime/openjdkjvmti/ti_class.cc
index d1324bc..abcc849 100644
--- a/runtime/openjdkjvmti/ti_class.cc
+++ b/runtime/openjdkjvmti/ti_class.cc
@@ -417,4 +417,35 @@
   return ERR(NONE);
 }
 
+jvmtiError ClassUtil::GetClassVersionNumbers(jvmtiEnv* env ATTRIBUTE_UNUSED,
+                                             jclass jklass,
+                                             jint* minor_version_ptr,
+                                             jint* major_version_ptr) {
+  art::ScopedObjectAccess soa(art::Thread::Current());
+  if (jklass == nullptr) {
+    return ERR(INVALID_CLASS);
+  }
+  art::ObjPtr<art::mirror::Object> jklass_obj = soa.Decode<art::mirror::Object>(jklass);
+  if (!jklass_obj->IsClass()) {
+    return ERR(INVALID_CLASS);
+  }
+  art::ObjPtr<art::mirror::Class> klass = jklass_obj->AsClass();
+  if (klass->IsPrimitive() || klass->IsArrayClass()) {
+    return ERR(INVALID_CLASS);
+  }
+
+  if (minor_version_ptr == nullptr || major_version_ptr == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  // Note: proxies will show the dex file version of java.lang.reflect.Proxy, as that is
+  //       what their dex cache copies from.
+  uint32_t version = klass->GetDexFile().GetHeader().GetVersion();
+
+  *major_version_ptr = static_cast<jint>(version);
+  *minor_version_ptr = 0;
+
+  return ERR(NONE);
+}
+
 }  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_class.h b/runtime/openjdkjvmti/ti_class.h
index 7a0fafb..9558894 100644
--- a/runtime/openjdkjvmti/ti_class.h
+++ b/runtime/openjdkjvmti/ti_class.h
@@ -72,6 +72,11 @@
 
   static jvmtiError IsInterface(jvmtiEnv* env, jclass klass, jboolean* is_interface_ptr);
   static jvmtiError IsArrayClass(jvmtiEnv* env, jclass klass, jboolean* is_array_class_ptr);
+
+  static jvmtiError GetClassVersionNumbers(jvmtiEnv* env,
+                                           jclass klass,
+                                           jint* minor_version_ptr,
+                                           jint* major_version_ptr);
 };
 
 }  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_phase.cc b/runtime/openjdkjvmti/ti_phase.cc
new file mode 100644
index 0000000..85d6b72
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_phase.cc
@@ -0,0 +1,129 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_phase.h"
+
+#include "art_jvmti.h"
+#include "base/macros.h"
+#include "events-inl.h"
+#include "runtime.h"
+#include "runtime_callbacks.h"
+#include "ScopedLocalRef.h"
+#include "scoped_thread_state_change-inl.h"
+#include "thread-inl.h"
+#include "thread_list.h"
+
+namespace openjdkjvmti {
+
+jvmtiPhase PhaseUtil::current_phase_ = static_cast<jvmtiPhase>(0);
+
+struct PhaseUtil::PhaseCallback : public art::RuntimePhaseCallback {
+  inline static JNIEnv* GetJniEnv() {
+    return reinterpret_cast<JNIEnv*>(art::Thread::Current()->GetJniEnv());
+  }
+
+  inline static jthread GetCurrentJThread() {
+    art::ScopedObjectAccess soa(art::Thread::Current());
+    return soa.AddLocalReference<jthread>(soa.Self()->GetPeer());
+  }
+
+  void NextRuntimePhase(RuntimePhase phase) OVERRIDE {
+    // TODO: Events.
+    switch (phase) {
+      case RuntimePhase::kInitialAgents:
+        PhaseUtil::current_phase_ = JVMTI_PHASE_PRIMORDIAL;
+        break;
+      case RuntimePhase::kStart:
+        event_handler->DispatchEvent(nullptr, ArtJvmtiEvent::kVmStart, GetJniEnv());
+        PhaseUtil::current_phase_ = JVMTI_PHASE_START;
+        break;
+      case RuntimePhase::kInit:
+        {
+          ScopedLocalRef<jthread> thread(GetJniEnv(), GetCurrentJThread());
+          event_handler->DispatchEvent(nullptr,
+                                       ArtJvmtiEvent::kVmInit,
+                                       GetJniEnv(),
+                                       thread.get());
+          PhaseUtil::current_phase_ = JVMTI_PHASE_LIVE;
+        }
+        break;
+      case RuntimePhase::kDeath:
+        event_handler->DispatchEvent(nullptr, ArtJvmtiEvent::kVmDeath, GetJniEnv());
+        PhaseUtil::current_phase_ = JVMTI_PHASE_DEAD;
+        // TODO: Block events now.
+        break;
+    }
+  }
+
+  EventHandler* event_handler = nullptr;
+};
+
+PhaseUtil::PhaseCallback gPhaseCallback;
+
+jvmtiError PhaseUtil::GetPhase(jvmtiEnv* env ATTRIBUTE_UNUSED, jvmtiPhase* phase_ptr) {
+  if (phase_ptr == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+  jvmtiPhase now = PhaseUtil::current_phase_;
+  DCHECK(now == JVMTI_PHASE_ONLOAD ||
+         now == JVMTI_PHASE_PRIMORDIAL ||
+         now == JVMTI_PHASE_START ||
+         now == JVMTI_PHASE_LIVE ||
+         now == JVMTI_PHASE_DEAD);
+  *phase_ptr = now;
+  return ERR(NONE);
+}
+
+void PhaseUtil::SetToOnLoad() {
+  DCHECK_EQ(0u, static_cast<size_t>(PhaseUtil::current_phase_));
+  PhaseUtil::current_phase_ = JVMTI_PHASE_ONLOAD;
+}
+
+void PhaseUtil::SetToPrimordial() {
+  DCHECK_EQ(static_cast<size_t>(JVMTI_PHASE_ONLOAD), static_cast<size_t>(PhaseUtil::current_phase_));
+  PhaseUtil::current_phase_ = JVMTI_PHASE_ONLOAD;
+}
+
+void PhaseUtil::SetToLive() {
+  DCHECK_EQ(static_cast<size_t>(0), static_cast<size_t>(PhaseUtil::current_phase_));
+  PhaseUtil::current_phase_ = JVMTI_PHASE_LIVE;
+}
+
+void PhaseUtil::Register(EventHandler* handler) {
+  gPhaseCallback.event_handler = handler;
+  art::ScopedThreadStateChange stsc(art::Thread::Current(),
+                                    art::ThreadState::kWaitingForDebuggerToAttach);
+  art::ScopedSuspendAll ssa("Add phase callback");
+  art::Runtime::Current()->GetRuntimeCallbacks()->AddRuntimePhaseCallback(&gPhaseCallback);
+}
+
+
+}  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_phase.h b/runtime/openjdkjvmti/ti_phase.h
new file mode 100644
index 0000000..054652a
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_phase.h
@@ -0,0 +1,65 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_PHASE_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_PHASE_H_
+
+#include "jni.h"
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+class EventHandler;
+
+class PhaseUtil {
+ public:
+  static jvmtiError GetPhase(jvmtiEnv* env, jvmtiPhase* phase_ptr);
+
+  static void Register(EventHandler* event_handler);
+
+  // Move the phase from unitialized to LOAD.
+  static void SetToOnLoad();
+
+  // Move the phase from LOAD to PRIMORDIAL.
+  static void SetToPrimordial();
+
+  // Move the phase from unitialized to LIVE.
+  static void SetToLive();
+
+  struct PhaseCallback;
+
+ private:
+  static jvmtiPhase current_phase_;
+};
+
+}  // namespace openjdkjvmti
+
+#endif  // ART_RUNTIME_OPENJDKJVMTI_TI_PHASE_H_
diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc
index 6af51c4..2db8a40 100644
--- a/runtime/openjdkjvmti/ti_redefine.cc
+++ b/runtime/openjdkjvmti/ti_redefine.cc
@@ -242,14 +242,12 @@
   }
 }
 
-// TODO This should handle doing multiple classes at once so we need to do less cleanup when things
-// go wrong.
 jvmtiError Redefiner::RedefineClasses(ArtJvmTiEnv* env,
                                       art::Runtime* runtime,
                                       art::Thread* self,
                                       jint class_count,
                                       const jvmtiClassDefinition* definitions,
-                                      std::string* error_msg) {
+                                      /*out*/std::string* error_msg) {
   if (env == nullptr) {
     *error_msg = "env was null!";
     return ERR(INVALID_ENVIRONMENT);
@@ -263,46 +261,95 @@
     *error_msg = "null definitions!";
     return ERR(NULL_POINTER);
   }
+  std::vector<ArtClassDefinition> def_vector;
+  def_vector.reserve(class_count);
+  for (jint i = 0; i < class_count; i++) {
+    // We make a copy of the class_bytes to pass into the retransformation.
+    // This makes cleanup easier (since we unambiguously own the bytes) and also is useful since we
+    // will need to keep the original bytes around unaltered for subsequent RetransformClasses calls
+    // to get the passed in bytes.
+    // TODO Implement saving the original bytes.
+    unsigned char* class_bytes_copy = nullptr;
+    jvmtiError res = env->Allocate(definitions[i].class_byte_count, &class_bytes_copy);
+    if (res != OK) {
+      return res;
+    }
+    memcpy(class_bytes_copy, definitions[i].class_bytes, definitions[i].class_byte_count);
+
+    ArtClassDefinition def;
+    def.dex_len = definitions[i].class_byte_count;
+    def.dex_data = MakeJvmtiUniquePtr(env, class_bytes_copy);
+    // We are definitely modified.
+    def.modified = true;
+    res = Transformer::FillInTransformationData(env, definitions[i].klass, &def);
+    if (res != OK) {
+      return res;
+    }
+    def_vector.push_back(std::move(def));
+  }
+  // Call all the transformation events.
+  jvmtiError res = Transformer::RetransformClassesDirect(env,
+                                                         self,
+                                                         &def_vector);
+  if (res != OK) {
+    // Something went wrong with transformation!
+    return res;
+  }
+  return RedefineClassesDirect(env, runtime, self, def_vector, error_msg);
+}
+
+jvmtiError Redefiner::RedefineClassesDirect(ArtJvmTiEnv* env,
+                                            art::Runtime* runtime,
+                                            art::Thread* self,
+                                            const std::vector<ArtClassDefinition>& definitions,
+                                            std::string* error_msg) {
+  DCHECK(env != nullptr);
+  if (definitions.size() == 0) {
+    // We don't actually need to do anything. Just return OK.
+    return OK;
+  }
   // Stop JIT for the duration of this redefine since the JIT might concurrently compile a method we
   // are going to redefine.
   art::jit::ScopedJitSuspend suspend_jit;
   // Get shared mutator lock so we can lock all the classes.
   art::ScopedObjectAccess soa(self);
   std::vector<Redefiner::ClassRedefinition> redefinitions;
-  redefinitions.reserve(class_count);
+  redefinitions.reserve(definitions.size());
   Redefiner r(runtime, self, error_msg);
-  for (jint i = 0; i < class_count; i++) {
-    jvmtiError res = r.AddRedefinition(env, definitions[i]);
-    if (res != OK) {
-      return res;
+  for (const ArtClassDefinition& def : definitions) {
+    // Only try to transform classes that have been modified.
+    if (def.modified) {
+      jvmtiError res = r.AddRedefinition(env, def);
+      if (res != OK) {
+        return res;
+      }
     }
   }
   return r.Run();
 }
 
-jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefinition& def) {
+jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def) {
   std::string original_dex_location;
   jvmtiError ret = OK;
   if ((ret = GetClassLocation(env, def.klass, &original_dex_location))) {
     *error_msg_ = "Unable to get original dex file location!";
     return ret;
   }
-  std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location,
-                                                    def.class_byte_count,
-                                                    def.class_bytes,
-                                                    error_msg_));
-  std::ostringstream os;
   char* generic_ptr_unused = nullptr;
   char* signature_ptr = nullptr;
-  if (env->GetClassSignature(def.klass, &signature_ptr, &generic_ptr_unused) != OK) {
-    *error_msg_ = "A jclass passed in does not seem to be valid";
-    return ERR(INVALID_CLASS);
+  if ((ret = env->GetClassSignature(def.klass, &signature_ptr, &generic_ptr_unused)) != OK) {
+    *error_msg_ = "Unable to get class signature!";
+    return ret;
   }
-  // These will make sure we deallocate the signature.
-  JvmtiUniquePtr sig_unique_ptr(MakeJvmtiUniquePtr(env, signature_ptr));
   JvmtiUniquePtr generic_unique_ptr(MakeJvmtiUniquePtr(env, generic_ptr_unused));
+  JvmtiUniquePtr signature_unique_ptr(MakeJvmtiUniquePtr(env, signature_ptr));
+  std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location,
+                                                    def.dex_len,
+                                                    def.dex_data.get(),
+                                                    error_msg_));
+  std::ostringstream os;
   if (map.get() == nullptr) {
-    os << "Failed to create anonymous mmap for modified dex file of class " << signature_ptr
+    os << "Failed to create anonymous mmap for modified dex file of class " << def.name
        << "in dex file " << original_dex_location << " because: " << *error_msg_;
     *error_msg_ = os.str();
     return ERR(OUT_OF_MEMORY);
@@ -319,7 +366,7 @@
                                                                   /*verify_checksum*/true,
                                                                   error_msg_));
   if (dex_file.get() == nullptr) {
-    os << "Unable to load modified dex file for " << signature_ptr << ": " << *error_msg_;
+    os << "Unable to load modified dex file for " << def.name << ": " << *error_msg_;
     *error_msg_ = os.str();
     return ERR(INVALID_CLASS_FORMAT);
   }
@@ -989,17 +1036,16 @@
 // Performs updates to class that will allow us to verify it.
 void Redefiner::ClassRedefinition::UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
                                                art::ObjPtr<art::mirror::DexCache> new_dex_cache) {
-  const art::DexFile::ClassDef* class_def = art::OatFile::OatDexFile::FindClassDef(
-      *dex_file_, class_sig_.c_str(), art::ComputeModifiedUtf8Hash(class_sig_.c_str()));
-  DCHECK(class_def != nullptr);
-  UpdateMethods(mclass, new_dex_cache, *class_def);
+  DCHECK_EQ(dex_file_->NumClassDefs(), 1u);
+  const art::DexFile::ClassDef& class_def = dex_file_->GetClassDef(0);
+  UpdateMethods(mclass, new_dex_cache, class_def);
   UpdateFields(mclass);
 
   // Update the class fields.
   // Need to update class last since the ArtMethod gets its DexFile from the class (which is needed
   // to call GetReturnTypeDescriptor and GetParameterTypeList above).
   mclass->SetDexCache(new_dex_cache.Ptr());
-  mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(*class_def));
+  mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(class_def));
   mclass->SetDexTypeIndex(dex_file_->GetIndexForTypeId(*dex_file_->FindTypeId(class_sig_.c_str())));
 }
 
diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h
index 8626bc5..f8d51ad 100644
--- a/runtime/openjdkjvmti/ti_redefine.h
+++ b/runtime/openjdkjvmti/ti_redefine.h
@@ -72,13 +72,25 @@
  public:
   // Redefine the given classes with the given dex data. Note this function does not take ownership
   // of the dex_data pointers. It is not used after this call however and may be freed if desired.
+  // The caller is responsible for freeing it. The runtime makes its own copy of the data. This
+  // function does not call the transformation events.
+  // TODO Check modified flag of the definitions.
+  static jvmtiError RedefineClassesDirect(ArtJvmTiEnv* env,
+                                          art::Runtime* runtime,
+                                          art::Thread* self,
+                                          const std::vector<ArtClassDefinition>& definitions,
+                                          /*out*/std::string* error_msg);
+
+  // Redefine the given classes with the given dex data. Note this function does not take ownership
+  // of the dex_data pointers. It is not used after this call however and may be freed if desired.
   // The caller is responsible for freeing it. The runtime makes its own copy of the data.
+  // TODO This function should call the transformation events.
   static jvmtiError RedefineClasses(ArtJvmTiEnv* env,
                                     art::Runtime* runtime,
                                     art::Thread* self,
                                     jint class_count,
                                     const jvmtiClassDefinition* definitions,
-                                    std::string* error_msg);
+                                    /*out*/std::string* error_msg);
 
   static jvmtiError IsModifiableClass(jvmtiEnv* env, jclass klass, jboolean* is_redefinable);
 
@@ -209,7 +221,7 @@
         redefinitions_(),
         error_msg_(error_msg) { }
 
-  jvmtiError AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefinition& def)
+  jvmtiError AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def)
       REQUIRES_SHARED(art::Locks::mutator_lock_);
 
   static jvmtiError GetClassRedefinitionError(art::Handle<art::mirror::Class> klass,
diff --git a/runtime/openjdkjvmti/ti_thread.cc b/runtime/openjdkjvmti/ti_thread.cc
index 2bcdd8c..970cc24 100644
--- a/runtime/openjdkjvmti/ti_thread.cc
+++ b/runtime/openjdkjvmti/ti_thread.cc
@@ -443,4 +443,80 @@
   return ERR(NONE);
 }
 
+struct AgentData {
+  const void* arg;
+  jvmtiStartFunction proc;
+  jthread thread;
+  JavaVM* java_vm;
+  jvmtiEnv* jvmti_env;
+  jint priority;
+};
+
+static void* AgentCallback(void* arg) {
+  std::unique_ptr<AgentData> data(reinterpret_cast<AgentData*>(arg));
+  CHECK(data->thread != nullptr);
+
+  // We already have a peer. So call our special Attach function.
+  art::Thread* self = art::Thread::Attach("JVMTI Agent thread", true, data->thread);
+  CHECK(self != nullptr);
+  // The name in Attach() is only for logging. Set the thread name. This is important so
+  // that the thread is no longer seen as starting up.
+  {
+    art::ScopedObjectAccess soa(self);
+    self->SetThreadName("JVMTI Agent thread");
+  }
+
+  // Release the peer.
+  JNIEnv* env = self->GetJniEnv();
+  env->DeleteGlobalRef(data->thread);
+  data->thread = nullptr;
+
+  // Run the agent code.
+  data->proc(data->jvmti_env, env, const_cast<void*>(data->arg));
+
+  // Detach the thread.
+  int detach_result = data->java_vm->DetachCurrentThread();
+  CHECK_EQ(detach_result, 0);
+
+  return nullptr;
+}
+
+jvmtiError ThreadUtil::RunAgentThread(jvmtiEnv* jvmti_env,
+                                      jthread thread,
+                                      jvmtiStartFunction proc,
+                                      const void* arg,
+                                      jint priority) {
+  if (priority < JVMTI_THREAD_MIN_PRIORITY || priority > JVMTI_THREAD_MAX_PRIORITY) {
+    return ERR(INVALID_PRIORITY);
+  }
+  JNIEnv* env = art::Thread::Current()->GetJniEnv();
+  if (thread == nullptr || !env->IsInstanceOf(thread, art::WellKnownClasses::java_lang_Thread)) {
+    return ERR(INVALID_THREAD);
+  }
+  if (proc == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  std::unique_ptr<AgentData> data(new AgentData);
+  data->arg = arg;
+  data->proc = proc;
+  // We need a global ref for Java objects, as local refs will be invalid.
+  data->thread = env->NewGlobalRef(thread);
+  data->java_vm = art::Runtime::Current()->GetJavaVM();
+  data->jvmti_env = jvmti_env;
+  data->priority = priority;
+
+  pthread_t pthread;
+  int pthread_create_result = pthread_create(&pthread,
+                                             nullptr,
+                                             &AgentCallback,
+                                             reinterpret_cast<void*>(data.get()));
+  if (pthread_create_result != 0) {
+    return ERR(INTERNAL);
+  }
+  data.release();
+
+  return ERR(NONE);
+}
+
 }  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_thread.h b/runtime/openjdkjvmti/ti_thread.h
index 290e9d4..5aaec58 100644
--- a/runtime/openjdkjvmti/ti_thread.h
+++ b/runtime/openjdkjvmti/ti_thread.h
@@ -49,6 +49,12 @@
 
   static jvmtiError SetThreadLocalStorage(jvmtiEnv* env, jthread thread, const void* data);
   static jvmtiError GetThreadLocalStorage(jvmtiEnv* env, jthread thread, void** data_ptr);
+
+  static jvmtiError RunAgentThread(jvmtiEnv* env,
+                                   jthread thread,
+                                   jvmtiStartFunction proc,
+                                   const void* arg,
+                                   jint priority);
 };
 
 }  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc
index f545125..2809cb6 100644
--- a/runtime/openjdkjvmti/transform.cc
+++ b/runtime/openjdkjvmti/transform.cc
@@ -38,6 +38,7 @@
 #include "class_linker.h"
 #include "dex_file.h"
 #include "dex_file_types.h"
+#include "events-inl.h"
 #include "gc_root-inl.h"
 #include "globals.h"
 #include "jni_env_ext-inl.h"
@@ -52,12 +53,76 @@
 #include "scoped_thread_state_change-inl.h"
 #include "stack.h"
 #include "thread_list.h"
+#include "ti_redefine.h"
 #include "transform.h"
 #include "utf.h"
 #include "utils/dex_cache_arrays_layout-inl.h"
 
 namespace openjdkjvmti {
 
+jvmtiError Transformer::RetransformClassesDirect(
+      ArtJvmTiEnv* env,
+      art::Thread* self,
+      /*in-out*/std::vector<ArtClassDefinition>* definitions) {
+  for (ArtClassDefinition& def : *definitions) {
+    jint new_len = -1;
+    unsigned char* new_data = nullptr;
+    // Static casts are so that we get the right template initialization for the special event
+    // handling code required by the ClassFileLoadHooks.
+    gEventHandler.DispatchEvent(self,
+                                ArtJvmtiEvent::kClassFileLoadHookRetransformable,
+                                GetJniEnv(env),
+                                static_cast<jclass>(def.klass),
+                                static_cast<jobject>(def.loader),
+                                static_cast<const char*>(def.name.c_str()),
+                                static_cast<jobject>(def.protection_domain),
+                                static_cast<jint>(def.dex_len),
+                                static_cast<const unsigned char*>(def.dex_data.get()),
+                                static_cast<jint*>(&new_len),
+                                static_cast<unsigned char**>(&new_data));
+    def.SetNewDexData(env, new_len, new_data);
+  }
+  return OK;
+}
+
+jvmtiError Transformer::RetransformClasses(ArtJvmTiEnv* env,
+                                           art::Runtime* runtime,
+                                           art::Thread* self,
+                                           jint class_count,
+                                           const jclass* classes,
+                                           /*out*/std::string* error_msg) {
+  if (env == nullptr) {
+    *error_msg = "env was null!";
+    return ERR(INVALID_ENVIRONMENT);
+  } else if (class_count < 0) {
+    *error_msg = "class_count was less then 0";
+    return ERR(ILLEGAL_ARGUMENT);
+  } else if (class_count == 0) {
+    // We don't actually need to do anything. Just return OK.
+    return OK;
+  } else if (classes == nullptr) {
+    *error_msg = "null classes!";
+    return ERR(NULL_POINTER);
+  }
+  // A holder that will Deallocate all the class bytes buffers on destruction.
+  std::vector<ArtClassDefinition> definitions;
+  jvmtiError res = OK;
+  for (jint i = 0; i < class_count; i++) {
+    ArtClassDefinition def;
+    res = FillInTransformationData(env, classes[i], &def);
+    if (res != OK) {
+      return res;
+    }
+    definitions.push_back(std::move(def));
+  }
+  res = RetransformClassesDirect(env, self, &definitions);
+  if (res != OK) {
+    return res;
+  }
+  return Redefiner::RedefineClassesDirect(env, runtime, self, definitions, error_msg);
+}
+
+// TODO Move this somewhere else, ti_class?
 jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location) {
   JNIEnv* jni_env = nullptr;
   jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(&jni_env), JNI_VERSION_1_1);
@@ -73,42 +138,61 @@
   return OK;
 }
 
-// TODO Move this function somewhere more appropriate.
-// Gets the data surrounding the given class.
-jvmtiError GetTransformationData(ArtJvmTiEnv* env,
-                                 jclass klass,
-                                 /*out*/std::string* location,
-                                 /*out*/JNIEnv** jni_env_ptr,
-                                 /*out*/jobject* loader,
-                                 /*out*/std::string* name,
-                                 /*out*/jobject* protection_domain,
-                                 /*out*/jint* data_len,
-                                 /*out*/unsigned char** dex_data) {
-  jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(jni_env_ptr), JNI_VERSION_1_1);
-  if (ret != JNI_OK) {
-    // TODO Different error might be better?
-    return ERR(INTERNAL);
-  }
-  JNIEnv* jni_env = *jni_env_ptr;
-  art::ScopedObjectAccess soa(jni_env);
-  art::StackHandleScope<3> hs(art::Thread::Current());
-  art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class>(klass)));
-  *loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader());
-  *name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8();
-  // TODO is this always null?
-  *protection_domain = nullptr;
-  const art::DexFile& dex = hs_klass->GetDexFile();
-  *location = dex.GetLocation();
-  *data_len = static_cast<jint>(dex.Size());
-  // TODO We should maybe change env->Allocate to allow us to mprotect this memory and stop writes.
-  jvmtiError alloc_error = env->Allocate(*data_len, dex_data);
+// TODO Implement this for real once transformed dex data is actually saved.
+jvmtiError Transformer::GetDexDataForRetransformation(ArtJvmTiEnv* env,
+                                                      art::Handle<art::mirror::Class> klass,
+                                                      /*out*/jint* dex_data_len,
+                                                      /*out*/unsigned char** dex_data) {
+  // TODO De-quicken the dex file before passing it to the agents.
+  LOG(WARNING) << "Dex file is not de-quickened yet! Quickened dex instructions might be present";
+  LOG(WARNING) << "Caching of initial dex data is not yet performed! Dex data might have been "
+               << "transformed by agent already";
+  const art::DexFile& dex = klass->GetDexFile();
+  *dex_data_len = static_cast<jint>(dex.Size());
+  unsigned char* new_dex_data = nullptr;
+  jvmtiError alloc_error = env->Allocate(*dex_data_len, &new_dex_data);
   if (alloc_error != OK) {
     return alloc_error;
   }
   // Copy the data into a temporary buffer.
-  memcpy(reinterpret_cast<void*>(*dex_data),
-          reinterpret_cast<const void*>(dex.Begin()),
-          *data_len);
+  memcpy(reinterpret_cast<void*>(new_dex_data),
+         reinterpret_cast<const void*>(dex.Begin()),
+         *dex_data_len);
+  *dex_data = new_dex_data;
+  return OK;
+}
+
+// TODO Move this function somewhere more appropriate.
+// Gets the data surrounding the given class.
+// TODO Make this less magical.
+jvmtiError Transformer::FillInTransformationData(ArtJvmTiEnv* env,
+                                                 jclass klass,
+                                                 ArtClassDefinition* def) {
+  JNIEnv* jni_env = GetJniEnv(env);
+  if (jni_env == nullptr) {
+    // TODO Different error might be better?
+    return ERR(INTERNAL);
+  }
+  art::ScopedObjectAccess soa(jni_env);
+  art::StackHandleScope<3> hs(art::Thread::Current());
+  art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class>(klass)));
+  if (hs_klass.IsNull()) {
+    return ERR(INVALID_CLASS);
+  }
+  def->klass = klass;
+  def->loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader());
+  def->name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8();
+  // TODO is this always null?
+  def->protection_domain = nullptr;
+  if (def->dex_data.get() == nullptr) {
+    unsigned char* new_data;
+    jvmtiError res = GetDexDataForRetransformation(env, hs_klass, &def->dex_len, &new_data);
+    if (res == OK) {
+      def->dex_data = MakeJvmtiUniquePtr(env, new_data);
+    } else {
+      return res;
+    }
+  }
   return OK;
 }
 
diff --git a/runtime/openjdkjvmti/transform.h b/runtime/openjdkjvmti/transform.h
index 0ad5099..0ff2bd1 100644
--- a/runtime/openjdkjvmti/transform.h
+++ b/runtime/openjdkjvmti/transform.h
@@ -43,16 +43,30 @@
 
 jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location);
 
-// Gets the data surrounding the given class.
-jvmtiError GetTransformationData(ArtJvmTiEnv* env,
-                                 jclass klass,
-                                 /*out*/std::string* location,
-                                 /*out*/JNIEnv** jni_env_ptr,
-                                 /*out*/jobject* loader,
-                                 /*out*/std::string* name,
-                                 /*out*/jobject* protection_domain,
-                                 /*out*/jint* data_len,
-                                 /*out*/unsigned char** dex_data);
+class Transformer {
+ public:
+  static jvmtiError RetransformClassesDirect(
+      ArtJvmTiEnv* env, art::Thread* self, /*in-out*/std::vector<ArtClassDefinition>* definitions);
+
+  static jvmtiError RetransformClasses(ArtJvmTiEnv* env,
+                                       art::Runtime* runtime,
+                                       art::Thread* self,
+                                       jint class_count,
+                                       const jclass* classes,
+                                       /*out*/std::string* error_msg);
+
+  // Gets the data surrounding the given class.
+  static jvmtiError FillInTransformationData(ArtJvmTiEnv* env,
+                                             jclass klass,
+                                             ArtClassDefinition* def);
+
+ private:
+  static jvmtiError GetDexDataForRetransformation(ArtJvmTiEnv* env,
+                                                  art::Handle<art::mirror::Class> klass,
+                                                  /*out*/jint* dex_data_length,
+                                                  /*out*/unsigned char** dex_data)
+      REQUIRES_SHARED(art::Locks::mutator_lock_);
+};
 
 }  // namespace openjdkjvmti
 
diff --git a/runtime/reflection.cc b/runtime/reflection.cc
index 75176f9..a2b4cb3 100644
--- a/runtime/reflection.cc
+++ b/runtime/reflection.cc
@@ -216,43 +216,54 @@
   }
 
   bool BuildArgArrayFromObjectArray(ObjPtr<mirror::Object> receiver,
-                                    ObjPtr<mirror::ObjectArray<mirror::Object>> args,
-                                    ArtMethod* m)
+                                    ObjPtr<mirror::ObjectArray<mirror::Object>> raw_args,
+                                    ArtMethod* m,
+                                    Thread* self)
       REQUIRES_SHARED(Locks::mutator_lock_) {
     const DexFile::TypeList* classes = m->GetParameterTypeList();
     // Set receiver if non-null (method is not static)
     if (receiver != nullptr) {
       Append(receiver);
     }
+    StackHandleScope<2> hs(self);
+    MutableHandle<mirror::Object> arg(hs.NewHandle<mirror::Object>(nullptr));
+    Handle<mirror::ObjectArray<mirror::Object>> args(
+        hs.NewHandle<mirror::ObjectArray<mirror::Object>>(raw_args));
     for (size_t i = 1, args_offset = 0; i < shorty_len_; ++i, ++args_offset) {
-      ObjPtr<mirror::Object> arg(args->Get(args_offset));
-      if (((shorty_[i] == 'L') && (arg != nullptr)) || ((arg == nullptr && shorty_[i] != 'L'))) {
-        // Note: The method's parameter's type must have been previously resolved.
+      arg.Assign(args->Get(args_offset));
+      if (((shorty_[i] == 'L') && (arg.Get() != nullptr)) ||
+          ((arg.Get() == nullptr && shorty_[i] != 'L'))) {
+        // TODO: The method's parameter's type must have been previously resolved, yet
+        // we've seen cases where it's not b/34440020.
         ObjPtr<mirror::Class> dst_class(
             m->GetClassFromTypeIndex(classes->GetTypeItem(args_offset).type_idx_,
-                                     false /* resolve */));
-        DCHECK(dst_class != nullptr) << m->PrettyMethod() << " arg #" << i;
-        if (UNLIKELY(arg == nullptr || !arg->InstanceOf(dst_class))) {
+                                     true /* resolve */));
+        if (dst_class.Ptr() == nullptr) {
+          CHECK(self->IsExceptionPending());
+          return false;
+        }
+        if (UNLIKELY(arg.Get() == nullptr || !arg->InstanceOf(dst_class))) {
           ThrowIllegalArgumentException(
               StringPrintf("method %s argument %zd has type %s, got %s",
                   m->PrettyMethod(false).c_str(),
                   args_offset + 1,  // Humans don't count from 0.
                   mirror::Class::PrettyDescriptor(dst_class).c_str(),
-                  mirror::Object::PrettyTypeOf(arg).c_str()).c_str());
+                  mirror::Object::PrettyTypeOf(arg.Get()).c_str()).c_str());
           return false;
         }
       }
 
 #define DO_FIRST_ARG(match_descriptor, get_fn, append) { \
-          if (LIKELY(arg != nullptr && arg->GetClass()->DescriptorEquals(match_descriptor))) { \
+          if (LIKELY(arg.Get() != nullptr && \
+              arg->GetClass()->DescriptorEquals(match_descriptor))) { \
             ArtField* primitive_field = arg->GetClass()->GetInstanceField(0); \
-            append(primitive_field-> get_fn(arg));
+            append(primitive_field-> get_fn(arg.Get()));
 
 #define DO_ARG(match_descriptor, get_fn, append) \
-          } else if (LIKELY(arg != nullptr && \
+          } else if (LIKELY(arg.Get() != nullptr && \
                             arg->GetClass<>()->DescriptorEquals(match_descriptor))) { \
             ArtField* primitive_field = arg->GetClass()->GetInstanceField(0); \
-            append(primitive_field-> get_fn(arg));
+            append(primitive_field-> get_fn(arg.Get()));
 
 #define DO_FAIL(expected) \
           } else { \
@@ -266,14 +277,14 @@
                       ArtMethod::PrettyMethod(m, false).c_str(), \
                       args_offset + 1, \
                       expected, \
-                      mirror::Object::PrettyTypeOf(arg).c_str()).c_str()); \
+                      mirror::Object::PrettyTypeOf(arg.Get()).c_str()).c_str()); \
             } \
             return false; \
           } }
 
       switch (shorty_[i]) {
         case 'L':
-          Append(arg);
+          Append(arg.Get());
           break;
         case 'Z':
           DO_FIRST_ARG("Ljava/lang/Boolean;", GetBoolean, Append)
@@ -646,7 +657,7 @@
   uint32_t shorty_len = 0;
   const char* shorty = np_method->GetShorty(&shorty_len);
   ArgArray arg_array(shorty, shorty_len);
-  if (!arg_array.BuildArgArrayFromObjectArray(receiver, objects, np_method)) {
+  if (!arg_array.BuildArgArrayFromObjectArray(receiver, objects, np_method, soa.Self())) {
     CHECK(soa.Self()->IsExceptionPending());
     return nullptr;
   }
diff --git a/runtime/runtime.cc b/runtime/runtime.cc
index 55e1852..4936a2f 100644
--- a/runtime/runtime.cc
+++ b/runtime/runtime.cc
@@ -137,6 +137,7 @@
 #include "jit/profile_saver.h"
 #include "quick/quick_method_frame_info.h"
 #include "reflection.h"
+#include "runtime_callbacks.h"
 #include "runtime_options.h"
 #include "ScopedLocalRef.h"
 #include "scoped_thread_state_change-inl.h"
@@ -253,10 +254,12 @@
       pruned_dalvik_cache_(false),
       // Initially assume we perceive jank in case the process state is never updated.
       process_state_(kProcessStateJankPerceptible),
-      zygote_no_threads_(false) {
+      zygote_no_threads_(false),
+      cha_(nullptr) {
   CheckAsmSupportOffsetsAndSizes();
   std::fill(callee_save_methods_, callee_save_methods_ + arraysize(callee_save_methods_), 0u);
   interpreter::CheckInterpreterAsmConstants();
+  callbacks_.reset(new RuntimeCallbacks());
 }
 
 Runtime::~Runtime() {
@@ -301,6 +304,13 @@
 
   Trace::Shutdown();
 
+  // Report death. Clients me require a working thread, still, so do it before GC completes and
+  // all non-daemon threads are done.
+  {
+    ScopedObjectAccess soa(self);
+    callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kDeath);
+  }
+
   if (attach_shutdown_thread) {
     DetachCurrentThread();
     self = nullptr;
@@ -703,6 +713,13 @@
 
   Thread::FinishStartup();
 
+  // Send the start phase event. We have to wait till here as this is when the main thread peer
+  // has just been generated, important root clinits have been run and JNI is completely functional.
+  {
+    ScopedObjectAccess soa(self);
+    callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kStart);
+  }
+
   system_class_loader_ = CreateSystemClassLoader(this);
 
   if (!is_zygote_) {
@@ -739,6 +756,12 @@
                  0);
   }
 
+  // Send the initialized phase event.
+  {
+    ScopedObjectAccess soa(self);
+    callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kInit);
+  }
+
   return true;
 }
 
@@ -1100,6 +1123,8 @@
   if (runtime_options.Exists(Opt::JdwpOptions)) {
     Dbg::ConfigureJdwp(runtime_options.GetOrDefault(Opt::JdwpOptions));
   }
+  callbacks_->AddThreadLifecycleCallback(Dbg::GetThreadLifecycleCallback());
+  callbacks_->AddClassLoadCallback(Dbg::GetClassLoadCallback());
 
   jit_options_.reset(jit::JitOptions::CreateFromRuntimeArguments(runtime_options));
   if (IsAotCompiler()) {
@@ -1358,6 +1383,10 @@
       LOG(ERROR) << "Unable to load an agent: " << err;
     }
   }
+  {
+    ScopedObjectAccess soa(self);
+    callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kInitialAgents);
+  }
 
   VLOG(startup) << "Runtime::Init exiting";
 
@@ -1370,7 +1399,7 @@
   constexpr const char* plugin_name = kIsDebugBuild ? "libopenjdkjvmtid.so" : "libopenjdkjvmti.so";
 
   // Is the plugin already loaded?
-  for (Plugin p : *plugins) {
+  for (const Plugin& p : *plugins) {
     if (p.GetLibrary() == plugin_name) {
       return true;
     }
@@ -1547,6 +1576,12 @@
 
   thread_list_->DumpForSigQuit(os);
   BaseMutex::DumpAll(os);
+
+  // Inform anyone else who is interested in SigQuit.
+  {
+    ScopedObjectAccess soa(Thread::Current());
+    callbacks_->SigQuit();
+  }
 }
 
 void Runtime::DumpLockHolders(std::ostream& os) {
@@ -2253,4 +2288,8 @@
   Runtime::Abort(abort_message);
 }
 
+RuntimeCallbacks* Runtime::GetRuntimeCallbacks() {
+  return callbacks_.get();
+}
+
 }  // namespace art
diff --git a/runtime/runtime.h b/runtime/runtime.h
index cf23d05..f7d6810 100644
--- a/runtime/runtime.h
+++ b/runtime/runtime.h
@@ -28,6 +28,7 @@
 
 #include "arch/instruction_set.h"
 #include "base/macros.h"
+#include "base/mutex.h"
 #include "dex_file_types.h"
 #include "experimental_flags.h"
 #include "gc_root.h"
@@ -89,6 +90,7 @@
 class OatFileManager;
 class Plugin;
 struct RuntimeArgumentMap;
+class RuntimeCallbacks;
 class SignalCatcher;
 class StackOverflowHandler;
 class SuspensionHandler;
@@ -659,6 +661,8 @@
 
   void AttachAgent(const std::string& agent_arg);
 
+  RuntimeCallbacks* GetRuntimeCallbacks();
+
  private:
   static void InitPlatformSignalHandlers();
 
@@ -916,6 +920,8 @@
 
   ClassHierarchyAnalysis* cha_;
 
+  std::unique_ptr<RuntimeCallbacks> callbacks_;
+
   DISALLOW_COPY_AND_ASSIGN(Runtime);
 };
 std::ostream& operator<<(std::ostream& os, const Runtime::CalleeSaveType& rhs);
diff --git a/runtime/runtime_callbacks.cc b/runtime/runtime_callbacks.cc
new file mode 100644
index 0000000..7b15a4f
--- /dev/null
+++ b/runtime/runtime_callbacks.cc
@@ -0,0 +1,104 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "runtime_callbacks.h"
+
+#include <algorithm>
+
+#include "base/macros.h"
+#include "class_linker.h"
+#include "thread.h"
+
+namespace art {
+
+void RuntimeCallbacks::AddThreadLifecycleCallback(ThreadLifecycleCallback* cb) {
+  thread_callbacks_.push_back(cb);
+}
+
+template <typename T>
+ALWAYS_INLINE
+static inline void Remove(T* cb, std::vector<T*>* data) {
+  auto it = std::find(data->begin(), data->end(), cb);
+  if (it != data->end()) {
+    data->erase(it);
+  }
+}
+
+void RuntimeCallbacks::RemoveThreadLifecycleCallback(ThreadLifecycleCallback* cb) {
+  Remove(cb, &thread_callbacks_);
+}
+
+void RuntimeCallbacks::ThreadStart(Thread* self) {
+  for (ThreadLifecycleCallback* cb : thread_callbacks_) {
+    cb->ThreadStart(self);
+  }
+}
+
+void RuntimeCallbacks::ThreadDeath(Thread* self) {
+  for (ThreadLifecycleCallback* cb : thread_callbacks_) {
+    cb->ThreadDeath(self);
+  }
+}
+
+void RuntimeCallbacks::AddClassLoadCallback(ClassLoadCallback* cb) {
+  class_callbacks_.push_back(cb);
+}
+
+void RuntimeCallbacks::RemoveClassLoadCallback(ClassLoadCallback* cb) {
+  Remove(cb, &class_callbacks_);
+}
+
+void RuntimeCallbacks::ClassLoad(Handle<mirror::Class> klass) {
+  for (ClassLoadCallback* cb : class_callbacks_) {
+    cb->ClassLoad(klass);
+  }
+}
+
+void RuntimeCallbacks::ClassPrepare(Handle<mirror::Class> temp_klass, Handle<mirror::Class> klass) {
+  for (ClassLoadCallback* cb : class_callbacks_) {
+    cb->ClassPrepare(temp_klass, klass);
+  }
+}
+
+void RuntimeCallbacks::AddRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb) {
+  sigquit_callbacks_.push_back(cb);
+}
+
+void RuntimeCallbacks::RemoveRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb) {
+  Remove(cb, &sigquit_callbacks_);
+}
+
+void RuntimeCallbacks::SigQuit() {
+  for (RuntimeSigQuitCallback* cb : sigquit_callbacks_) {
+    cb->SigQuit();
+  }
+}
+
+void RuntimeCallbacks::AddRuntimePhaseCallback(RuntimePhaseCallback* cb) {
+  phase_callbacks_.push_back(cb);
+}
+
+void RuntimeCallbacks::RemoveRuntimePhaseCallback(RuntimePhaseCallback* cb) {
+  Remove(cb, &phase_callbacks_);
+}
+
+void RuntimeCallbacks::NextRuntimePhase(RuntimePhaseCallback::RuntimePhase phase) {
+  for (RuntimePhaseCallback* cb : phase_callbacks_) {
+    cb->NextRuntimePhase(phase);
+  }
+}
+
+}  // namespace art
diff --git a/runtime/runtime_callbacks.h b/runtime/runtime_callbacks.h
new file mode 100644
index 0000000..e580e78
--- /dev/null
+++ b/runtime/runtime_callbacks.h
@@ -0,0 +1,115 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_RUNTIME_RUNTIME_CALLBACKS_H_
+#define ART_RUNTIME_RUNTIME_CALLBACKS_H_
+
+#include <vector>
+
+#include "base/macros.h"
+#include "base/mutex.h"
+#include "handle.h"
+
+namespace art {
+
+namespace mirror {
+class Class;
+}  // namespace mirror
+
+class ClassLoadCallback;
+class Thread;
+class ThreadLifecycleCallback;
+
+// Note: RuntimeCallbacks uses the mutator lock to synchronize the callback lists. A thread must
+//       hold the exclusive lock to add or remove a listener. A thread must hold the shared lock
+//       to dispatch an event. This setup is chosen as some clients may want to suspend the
+//       dispatching thread or all threads.
+//
+//       To make this safe, the following restrictions apply:
+//       * Only the owner of a listener may ever add or remove said listener.
+//       * A listener must never add or remove itself or any other listener while running.
+//       * It is the responsibility of the owner to not remove the listener while it is running
+//         (and suspended).
+//
+//       The simplest way to satisfy these restrictions is to never remove a listener, and to do
+//       any state checking (is the listener enabled) in the listener itself. For an example, see
+//       Dbg.
+
+class RuntimeSigQuitCallback {
+ public:
+  virtual ~RuntimeSigQuitCallback() {}
+
+  virtual void SigQuit() REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
+class RuntimePhaseCallback {
+ public:
+  enum RuntimePhase {
+    kInitialAgents,   // Initial agent loading is done.
+    kStart,           // The runtime is started.
+    kInit,            // The runtime is initialized (and will run user code soon).
+    kDeath,           // The runtime just died.
+  };
+
+  virtual ~RuntimePhaseCallback() {}
+
+  virtual void NextRuntimePhase(RuntimePhase phase) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
+class RuntimeCallbacks {
+ public:
+  void AddThreadLifecycleCallback(ThreadLifecycleCallback* cb) REQUIRES(Locks::mutator_lock_);
+  void RemoveThreadLifecycleCallback(ThreadLifecycleCallback* cb) REQUIRES(Locks::mutator_lock_);
+
+  void ThreadStart(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_);
+  void ThreadDeath(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_);
+
+  void AddClassLoadCallback(ClassLoadCallback* cb) REQUIRES(Locks::mutator_lock_);
+  void RemoveClassLoadCallback(ClassLoadCallback* cb) REQUIRES(Locks::mutator_lock_);
+
+  void ClassLoad(Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_);
+  void ClassPrepare(Handle<mirror::Class> temp_klass, Handle<mirror::Class> klass)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+
+  void AddRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb)
+      REQUIRES(Locks::mutator_lock_);
+  void RemoveRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb)
+      REQUIRES(Locks::mutator_lock_);
+
+  void SigQuit() REQUIRES_SHARED(Locks::mutator_lock_);
+
+  void AddRuntimePhaseCallback(RuntimePhaseCallback* cb)
+      REQUIRES(Locks::mutator_lock_);
+  void RemoveRuntimePhaseCallback(RuntimePhaseCallback* cb)
+      REQUIRES(Locks::mutator_lock_);
+
+  void NextRuntimePhase(RuntimePhaseCallback::RuntimePhase phase)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+
+ private:
+  std::vector<ThreadLifecycleCallback*> thread_callbacks_
+      GUARDED_BY(Locks::mutator_lock_);
+  std::vector<ClassLoadCallback*> class_callbacks_
+      GUARDED_BY(Locks::mutator_lock_);
+  std::vector<RuntimeSigQuitCallback*> sigquit_callbacks_
+      GUARDED_BY(Locks::mutator_lock_);
+  std::vector<RuntimePhaseCallback*> phase_callbacks_
+        GUARDED_BY(Locks::mutator_lock_);
+};
+
+}  // namespace art
+
+#endif  // ART_RUNTIME_RUNTIME_CALLBACKS_H_
diff --git a/runtime/runtime_callbacks_test.cc b/runtime/runtime_callbacks_test.cc
new file mode 100644
index 0000000..8974b59
--- /dev/null
+++ b/runtime/runtime_callbacks_test.cc
@@ -0,0 +1,410 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "runtime_callbacks.h"
+
+#include "jni.h"
+#include <signal.h>
+#include <sys/types.h>
+#include <unistd.h>
+
+#include <initializer_list>
+#include <memory>
+#include <string>
+
+#include "art_method-inl.h"
+#include "base/mutex.h"
+#include "class_linker.h"
+#include "common_runtime_test.h"
+#include "handle.h"
+#include "handle_scope-inl.h"
+#include "mem_map.h"
+#include "mirror/class-inl.h"
+#include "mirror/class_loader.h"
+#include "obj_ptr.h"
+#include "runtime.h"
+#include "scoped_thread_state_change-inl.h"
+#include "ScopedLocalRef.h"
+#include "thread-inl.h"
+#include "thread_list.h"
+#include "well_known_classes.h"
+
+namespace art {
+
+class RuntimeCallbacksTest : public CommonRuntimeTest {
+ protected:
+  void SetUp() OVERRIDE {
+    CommonRuntimeTest::SetUp();
+
+    Thread* self = Thread::Current();
+    ScopedObjectAccess soa(self);
+    ScopedThreadSuspension sts(self, kWaitingForDebuggerToAttach);
+    ScopedSuspendAll ssa("RuntimeCallbacksTest SetUp");
+    AddListener();
+  }
+
+  void TearDown() OVERRIDE {
+    {
+      Thread* self = Thread::Current();
+      ScopedObjectAccess soa(self);
+      ScopedThreadSuspension sts(self, kWaitingForDebuggerToAttach);
+      ScopedSuspendAll ssa("RuntimeCallbacksTest TearDown");
+      RemoveListener();
+    }
+
+    CommonRuntimeTest::TearDown();
+  }
+
+  virtual void AddListener() REQUIRES(Locks::mutator_lock_) = 0;
+  virtual void RemoveListener() REQUIRES(Locks::mutator_lock_) = 0;
+
+  void MakeExecutable(ObjPtr<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) {
+    CHECK(klass != nullptr);
+    PointerSize pointer_size = class_linker_->GetImagePointerSize();
+    for (auto& m : klass->GetMethods(pointer_size)) {
+      if (!m.IsAbstract()) {
+        class_linker_->SetEntryPointsToInterpreter(&m);
+      }
+    }
+  }
+};
+
+class ThreadLifecycleCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ public:
+  static void* PthreadsCallback(void* arg ATTRIBUTE_UNUSED) {
+    // Attach.
+    Runtime* runtime = Runtime::Current();
+    CHECK(runtime->AttachCurrentThread("ThreadLifecycle test thread", true, nullptr, false));
+
+    // Detach.
+    runtime->DetachCurrentThread();
+
+    // Die...
+    return nullptr;
+  }
+
+ protected:
+  void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->AddThreadLifecycleCallback(&cb_);
+  }
+  void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->RemoveThreadLifecycleCallback(&cb_);
+  }
+
+  enum CallbackState {
+    kBase,
+    kStarted,
+    kDied,
+    kWrongStart,
+    kWrongDeath,
+  };
+
+  struct Callback : public ThreadLifecycleCallback {
+    void ThreadStart(Thread* self) OVERRIDE {
+      if (state == CallbackState::kBase) {
+        state = CallbackState::kStarted;
+        stored_self = self;
+      } else {
+        state = CallbackState::kWrongStart;
+      }
+    }
+
+    void ThreadDeath(Thread* self) OVERRIDE {
+      if (state == CallbackState::kStarted && self == stored_self) {
+        state = CallbackState::kDied;
+      } else {
+        state = CallbackState::kWrongDeath;
+      }
+    }
+
+    Thread* stored_self;
+    CallbackState state = CallbackState::kBase;
+  };
+
+  Callback cb_;
+};
+
+TEST_F(ThreadLifecycleCallbackRuntimeCallbacksTest, ThreadLifecycleCallbackJava) {
+  Thread* self = Thread::Current();
+
+  self->TransitionFromSuspendedToRunnable();
+  bool started = runtime_->Start();
+  ASSERT_TRUE(started);
+
+  cb_.state = CallbackState::kBase;  // Ignore main thread attach.
+
+  {
+    ScopedObjectAccess soa(self);
+    MakeExecutable(soa.Decode<mirror::Class>(WellKnownClasses::java_lang_Thread));
+  }
+
+  JNIEnv* env = self->GetJniEnv();
+
+  ScopedLocalRef<jobject> thread_name(env,
+                                      env->NewStringUTF("ThreadLifecycleCallback test thread"));
+  ASSERT_TRUE(thread_name.get() != nullptr);
+
+  ScopedLocalRef<jobject> thread(env, env->AllocObject(WellKnownClasses::java_lang_Thread));
+  ASSERT_TRUE(thread.get() != nullptr);
+
+  env->CallNonvirtualVoidMethod(thread.get(),
+                                WellKnownClasses::java_lang_Thread,
+                                WellKnownClasses::java_lang_Thread_init,
+                                runtime_->GetMainThreadGroup(),
+                                thread_name.get(),
+                                kMinThreadPriority,
+                                JNI_FALSE);
+  ASSERT_FALSE(env->ExceptionCheck());
+
+  jmethodID start_id = env->GetMethodID(WellKnownClasses::java_lang_Thread, "start", "()V");
+  ASSERT_TRUE(start_id != nullptr);
+
+  env->CallVoidMethod(thread.get(), start_id);
+  ASSERT_FALSE(env->ExceptionCheck());
+
+  jmethodID join_id = env->GetMethodID(WellKnownClasses::java_lang_Thread, "join", "()V");
+  ASSERT_TRUE(join_id != nullptr);
+
+  env->CallVoidMethod(thread.get(), join_id);
+  ASSERT_FALSE(env->ExceptionCheck());
+
+  EXPECT_TRUE(cb_.state == CallbackState::kDied) << static_cast<int>(cb_.state);
+}
+
+TEST_F(ThreadLifecycleCallbackRuntimeCallbacksTest, ThreadLifecycleCallbackAttach) {
+  std::string error_msg;
+  std::unique_ptr<MemMap> stack(MemMap::MapAnonymous("ThreadLifecycleCallback Thread",
+                                                     nullptr,
+                                                     128 * kPageSize,  // Just some small stack.
+                                                     PROT_READ | PROT_WRITE,
+                                                     false,
+                                                     false,
+                                                     &error_msg));
+  ASSERT_FALSE(stack == nullptr) << error_msg;
+
+  const char* reason = "ThreadLifecycleCallback test thread";
+  pthread_attr_t attr;
+  CHECK_PTHREAD_CALL(pthread_attr_init, (&attr), reason);
+  CHECK_PTHREAD_CALL(pthread_attr_setstack, (&attr, stack->Begin(), stack->Size()), reason);
+  pthread_t pthread;
+  CHECK_PTHREAD_CALL(pthread_create,
+                     (&pthread,
+                         &attr,
+                         &ThreadLifecycleCallbackRuntimeCallbacksTest::PthreadsCallback,
+                         this),
+                         reason);
+  CHECK_PTHREAD_CALL(pthread_attr_destroy, (&attr), reason);
+
+  CHECK_PTHREAD_CALL(pthread_join, (pthread, nullptr), "ThreadLifecycleCallback test shutdown");
+
+  // Detach is not a ThreadDeath event, so we expect to be in state Started.
+  EXPECT_TRUE(cb_.state == CallbackState::kStarted) << static_cast<int>(cb_.state);
+}
+
+class ClassLoadCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ protected:
+  void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->AddClassLoadCallback(&cb_);
+  }
+  void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->RemoveClassLoadCallback(&cb_);
+  }
+
+  bool Expect(std::initializer_list<const char*> list) {
+    if (cb_.data.size() != list.size()) {
+      PrintError(list);
+      return false;
+    }
+
+    if (!std::equal(cb_.data.begin(), cb_.data.end(), list.begin())) {
+      PrintError(list);
+      return false;
+    }
+
+    return true;
+  }
+
+  void PrintError(std::initializer_list<const char*> list) {
+    LOG(ERROR) << "Expected:";
+    for (const char* expected : list) {
+      LOG(ERROR) << "  " << expected;
+    }
+    LOG(ERROR) << "Found:";
+    for (const auto& s : cb_.data) {
+      LOG(ERROR) << "  " << s;
+    }
+  }
+
+  struct Callback : public ClassLoadCallback {
+    void ClassLoad(Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+      std::string tmp;
+      std::string event = std::string("Load:") + klass->GetDescriptor(&tmp);
+      data.push_back(event);
+    }
+
+    void ClassPrepare(Handle<mirror::Class> temp_klass,
+                      Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+      std::string tmp, tmp2;
+      std::string event = std::string("Prepare:") + klass->GetDescriptor(&tmp)
+          + "[" + temp_klass->GetDescriptor(&tmp2) + "]";
+      data.push_back(event);
+    }
+
+    std::vector<std::string> data;
+  };
+
+  Callback cb_;
+};
+
+TEST_F(ClassLoadCallbackRuntimeCallbacksTest, ClassLoadCallback) {
+  ScopedObjectAccess soa(Thread::Current());
+  jobject jclass_loader = LoadDex("XandY");
+  VariableSizedHandleScope hs(soa.Self());
+  Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+      soa.Decode<mirror::ClassLoader>(jclass_loader)));
+
+  const char* descriptor_y = "LY;";
+  Handle<mirror::Class> h_Y(
+      hs.NewHandle(class_linker_->FindClass(soa.Self(), descriptor_y, class_loader)));
+  ASSERT_TRUE(h_Y.Get() != nullptr);
+
+  bool expect1 = Expect({ "Load:LX;", "Prepare:LX;[LX;]", "Load:LY;", "Prepare:LY;[LY;]" });
+  EXPECT_TRUE(expect1);
+
+  cb_.data.clear();
+
+  ASSERT_TRUE(class_linker_->EnsureInitialized(Thread::Current(), h_Y, true, true));
+
+  bool expect2 = Expect({ "Load:LY$Z;", "Prepare:LY$Z;[LY$Z;]" });
+  EXPECT_TRUE(expect2);
+}
+
+class RuntimeSigQuitCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ protected:
+  void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->AddRuntimeSigQuitCallback(&cb_);
+  }
+  void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->RemoveRuntimeSigQuitCallback(&cb_);
+  }
+
+  struct Callback : public RuntimeSigQuitCallback {
+    void SigQuit() OVERRIDE {
+      ++sigquit_count;
+    }
+
+    size_t sigquit_count = 0;
+  };
+
+  Callback cb_;
+};
+
+TEST_F(RuntimeSigQuitCallbackRuntimeCallbacksTest, SigQuit) {
+  // The runtime needs to be started for the signal handler.
+  Thread* self = Thread::Current();
+
+  self->TransitionFromSuspendedToRunnable();
+  bool started = runtime_->Start();
+  ASSERT_TRUE(started);
+
+  EXPECT_EQ(0u, cb_.sigquit_count);
+
+  kill(getpid(), SIGQUIT);
+
+  // Try a few times.
+  for (size_t i = 0; i != 30; ++i) {
+    if (cb_.sigquit_count == 0) {
+      sleep(1);
+    } else {
+      break;
+    }
+  }
+  EXPECT_EQ(1u, cb_.sigquit_count);
+}
+
+class RuntimePhaseCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ protected:
+  void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->AddRuntimePhaseCallback(&cb_);
+  }
+  void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->RemoveRuntimePhaseCallback(&cb_);
+  }
+
+  void TearDown() OVERRIDE {
+    // Bypass RuntimeCallbacksTest::TearDown, as the runtime is already gone.
+    CommonRuntimeTest::TearDown();
+  }
+
+  struct Callback : public RuntimePhaseCallback {
+    void NextRuntimePhase(RuntimePhaseCallback::RuntimePhase p) OVERRIDE {
+      if (p == RuntimePhaseCallback::RuntimePhase::kInitialAgents) {
+        if (start_seen > 0 || init_seen > 0 || death_seen > 0) {
+          LOG(FATAL) << "Unexpected order";
+        }
+        ++initial_agents_seen;
+      } else if (p == RuntimePhaseCallback::RuntimePhase::kStart) {
+        if (init_seen > 0 || death_seen > 0) {
+          LOG(FATAL) << "Init seen before start.";
+        }
+        ++start_seen;
+      } else if (p == RuntimePhaseCallback::RuntimePhase::kInit) {
+        ++init_seen;
+      } else if (p == RuntimePhaseCallback::RuntimePhase::kDeath) {
+        ++death_seen;
+      } else {
+        LOG(FATAL) << "Unknown phase " << static_cast<uint32_t>(p);
+      }
+    }
+
+    size_t initial_agents_seen = 0;
+    size_t start_seen = 0;
+    size_t init_seen = 0;
+    size_t death_seen = 0;
+  };
+
+  Callback cb_;
+};
+
+TEST_F(RuntimePhaseCallbackRuntimeCallbacksTest, Phases) {
+  ASSERT_EQ(0u, cb_.initial_agents_seen);
+  ASSERT_EQ(0u, cb_.start_seen);
+  ASSERT_EQ(0u, cb_.init_seen);
+  ASSERT_EQ(0u, cb_.death_seen);
+
+  // Start the runtime.
+  {
+    Thread* self = Thread::Current();
+    self->TransitionFromSuspendedToRunnable();
+    bool started = runtime_->Start();
+    ASSERT_TRUE(started);
+  }
+
+  ASSERT_EQ(0u, cb_.initial_agents_seen);
+  ASSERT_EQ(1u, cb_.start_seen);
+  ASSERT_EQ(1u, cb_.init_seen);
+  ASSERT_EQ(0u, cb_.death_seen);
+
+  // Delete the runtime.
+  runtime_.reset();
+
+  ASSERT_EQ(0u, cb_.initial_agents_seen);
+  ASSERT_EQ(1u, cb_.start_seen);
+  ASSERT_EQ(1u, cb_.init_seen);
+  ASSERT_EQ(1u, cb_.death_seen);
+}
+
+}  // namespace art
diff --git a/runtime/thread.cc b/runtime/thread.cc
index ebf14c1..d93eab1 100644
--- a/runtime/thread.cc
+++ b/runtime/thread.cc
@@ -67,6 +67,7 @@
 #include "quick/quick_method_frame_info.h"
 #include "reflection.h"
 #include "runtime.h"
+#include "runtime_callbacks.h"
 #include "scoped_thread_state_change-inl.h"
 #include "ScopedLocalRef.h"
 #include "ScopedUtfChars.h"
@@ -431,7 +432,8 @@
 
     ArtField* priorityField = jni::DecodeArtField(WellKnownClasses::java_lang_Thread_priority);
     self->SetNativePriority(priorityField->GetInt(self->tlsPtr_.opeer));
-    Dbg::PostThreadStart(self);
+
+    runtime->GetRuntimeCallbacks()->ThreadStart(self);
 
     // Invoke the 'run' method of our java.lang.Thread.
     ObjPtr<mirror::Object> receiver = self->tlsPtr_.opeer;
@@ -723,8 +725,8 @@
   return true;
 }
 
-Thread* Thread::Attach(const char* thread_name, bool as_daemon, jobject thread_group,
-                       bool create_peer) {
+template <typename PeerAction>
+Thread* Thread::Attach(const char* thread_name, bool as_daemon, PeerAction peer_action) {
   Runtime* runtime = Runtime::Current();
   if (runtime == nullptr) {
     LOG(ERROR) << "Thread attaching to non-existent runtime: " << thread_name;
@@ -753,32 +755,11 @@
   CHECK_NE(self->GetState(), kRunnable);
   self->SetState(kNative);
 
-  // If we're the main thread, ClassLinker won't be created until after we're attached,
-  // so that thread needs a two-stage attach. Regular threads don't need this hack.
-  // In the compiler, all threads need this hack, because no-one's going to be getting
-  // a native peer!
-  if (create_peer) {
-    self->CreatePeer(thread_name, as_daemon, thread_group);
-    if (self->IsExceptionPending()) {
-      // We cannot keep the exception around, as we're deleting self. Try to be helpful and log it.
-      {
-        ScopedObjectAccess soa(self);
-        LOG(ERROR) << "Exception creating thread peer:";
-        LOG(ERROR) << self->GetException()->Dump();
-        self->ClearException();
-      }
-      runtime->GetThreadList()->Unregister(self);
-      // Unregister deletes self, no need to do this here.
-      return nullptr;
-    }
-  } else {
-    // These aren't necessary, but they improve diagnostics for unit tests & command-line tools.
-    if (thread_name != nullptr) {
-      self->tlsPtr_.name->assign(thread_name);
-      ::art::SetThreadName(thread_name);
-    } else if (self->GetJniEnv()->check_jni) {
-      LOG(WARNING) << *Thread::Current() << " attached without supplying a name";
-    }
+  // Run the action that is acting on the peer.
+  if (!peer_action(self)) {
+    runtime->GetThreadList()->Unregister(self);
+    // Unregister deletes self, no need to do this here.
+    return nullptr;
   }
 
   if (VLOG_IS_ON(threads)) {
@@ -793,12 +774,63 @@
 
   {
     ScopedObjectAccess soa(self);
-    Dbg::PostThreadStart(self);
+    runtime->GetRuntimeCallbacks()->ThreadStart(self);
   }
 
   return self;
 }
 
+Thread* Thread::Attach(const char* thread_name,
+                       bool as_daemon,
+                       jobject thread_group,
+                       bool create_peer) {
+  auto create_peer_action = [&](Thread* self) {
+    // If we're the main thread, ClassLinker won't be created until after we're attached,
+    // so that thread needs a two-stage attach. Regular threads don't need this hack.
+    // In the compiler, all threads need this hack, because no-one's going to be getting
+    // a native peer!
+    if (create_peer) {
+      self->CreatePeer(thread_name, as_daemon, thread_group);
+      if (self->IsExceptionPending()) {
+        // We cannot keep the exception around, as we're deleting self. Try to be helpful and log it.
+        {
+          ScopedObjectAccess soa(self);
+          LOG(ERROR) << "Exception creating thread peer:";
+          LOG(ERROR) << self->GetException()->Dump();
+          self->ClearException();
+        }
+        return false;
+      }
+    } else {
+      // These aren't necessary, but they improve diagnostics for unit tests & command-line tools.
+      if (thread_name != nullptr) {
+        self->tlsPtr_.name->assign(thread_name);
+        ::art::SetThreadName(thread_name);
+      } else if (self->GetJniEnv()->check_jni) {
+        LOG(WARNING) << *Thread::Current() << " attached without supplying a name";
+      }
+    }
+    return true;
+  };
+  return Attach(thread_name, as_daemon, create_peer_action);
+}
+
+Thread* Thread::Attach(const char* thread_name, bool as_daemon, jobject thread_peer) {
+  auto set_peer_action = [&](Thread* self) {
+    // Install the given peer.
+    {
+      DCHECK(self == Thread::Current());
+      ScopedObjectAccess soa(self);
+      self->tlsPtr_.opeer = soa.Decode<mirror::Object>(thread_peer).Ptr();
+    }
+    self->GetJniEnv()->SetLongField(thread_peer,
+                                    WellKnownClasses::java_lang_Thread_nativePeer,
+                                    reinterpret_cast<jlong>(self));
+    return true;
+  };
+  return Attach(thread_name, as_daemon, set_peer_action);
+}
+
 void Thread::CreatePeer(const char* name, bool as_daemon, jobject thread_group) {
   Runtime* runtime = Runtime::Current();
   CHECK(runtime->IsStarted());
@@ -1929,7 +1961,11 @@
       jni::DecodeArtField(WellKnownClasses::java_lang_Thread_nativePeer)
           ->SetLong<false>(tlsPtr_.opeer, 0);
     }
-    Dbg::PostThreadDeath(self);
+    Runtime* runtime = Runtime::Current();
+    if (runtime != nullptr) {
+      runtime->GetRuntimeCallbacks()->ThreadDeath(self);
+    }
+
 
     // Thread.join() is implemented as an Object.wait() on the Thread.lock object. Signal anyone
     // who is waiting.
diff --git a/runtime/thread.h b/runtime/thread.h
index 2b451bc..b609e72 100644
--- a/runtime/thread.h
+++ b/runtime/thread.h
@@ -158,6 +158,8 @@
   // Used to implement JNI AttachCurrentThread and AttachCurrentThreadAsDaemon calls.
   static Thread* Attach(const char* thread_name, bool as_daemon, jobject thread_group,
                         bool create_peer);
+  // Attaches the calling native thread to the runtime, returning the new native peer.
+  static Thread* Attach(const char* thread_name, bool as_daemon, jobject thread_peer);
 
   // Reset internal state of child thread after fork.
   void InitAfterFork();
@@ -1166,6 +1168,13 @@
   ~Thread() REQUIRES(!Locks::mutator_lock_, !Locks::thread_suspend_count_lock_);
   void Destroy();
 
+  // Attaches the calling native thread to the runtime, returning the new native peer.
+  // Used to implement JNI AttachCurrentThread and AttachCurrentThreadAsDaemon calls.
+  template <typename PeerAction>
+  static Thread* Attach(const char* thread_name,
+                        bool as_daemon,
+                        PeerAction p);
+
   void CreatePeer(const char* name, bool as_daemon, jobject thread_group);
 
   template<bool kTransactionActive>
@@ -1704,6 +1713,14 @@
   Thread* const self_;
 };
 
+class ThreadLifecycleCallback {
+ public:
+  virtual ~ThreadLifecycleCallback() {}
+
+  virtual void ThreadStart(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+  virtual void ThreadDeath(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
 std::ostream& operator<<(std::ostream& os, const Thread& thread);
 std::ostream& operator<<(std::ostream& os, const StackedShadowFrameType& thread);
 
diff --git a/runtime/verifier/verifier_deps.cc b/runtime/verifier/verifier_deps.cc
index 15cc566..1131607 100644
--- a/runtime/verifier/verifier_deps.cc
+++ b/runtime/verifier/verifier_deps.cc
@@ -963,20 +963,25 @@
   // Check recorded fields are resolved the same way, have the same recorded class,
   // and have the same recorded flags.
   ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
-  StackHandleScope<1> hs(self);
-  Handle<mirror::DexCache> dex_cache(
-      hs.NewHandle(class_linker->FindDexCache(self, dex_file, /* allow_failure */ false)));
   for (const auto& entry : fields) {
-    ArtField* field = class_linker->ResolveFieldJLS(
-        dex_file, entry.GetDexFieldIndex(), dex_cache, class_loader);
-
-    if (field == nullptr) {
-      DCHECK(self->IsExceptionPending());
-      self->ClearException();
+    const DexFile::FieldId& field_id = dex_file.GetFieldId(entry.GetDexFieldIndex());
+    StringPiece name(dex_file.StringDataByIdx(field_id.name_idx_));
+    StringPiece type(dex_file.StringDataByIdx(dex_file.GetTypeId(field_id.type_idx_).descriptor_idx_));
+    // Only use field_id.class_idx_ when the entry is unresolved, which is rare.
+    // Otherwise, we might end up resolving an application class, which is expensive.
+    std::string expected_decl_klass = entry.IsResolved()
+        ? GetStringFromId(dex_file, entry.GetDeclaringClassIndex())
+        : dex_file.StringByTypeIdx(field_id.class_idx_);
+    mirror::Class* cls = FindClassAndClearException(
+        class_linker, self, expected_decl_klass.c_str(), class_loader);
+    if (cls == nullptr) {
+      LOG(INFO) << "VerifierDeps: Could not resolve class " << expected_decl_klass;
+      return false;
     }
+    DCHECK(cls->IsResolved());
 
+    ArtField* field = mirror::Class::FindField(self, cls, name, type);
     if (entry.IsResolved()) {
-      std::string expected_decl_klass = GetStringFromId(dex_file, entry.GetDeclaringClassIndex());
       std::string temp;
       if (field == nullptr) {
         LOG(INFO) << "VerifierDeps: Could not resolve field "
@@ -1025,11 +1030,16 @@
 
     const char* name = dex_file.GetMethodName(method_id);
     const Signature signature = dex_file.GetMethodSignature(method_id);
-    const char* descriptor = dex_file.GetMethodDeclaringClassDescriptor(method_id);
+    // Only use method_id.class_idx_ when the entry is unresolved, which is rare.
+    // Otherwise, we might end up resolving an application class, which is expensive.
+    std::string expected_decl_klass = entry.IsResolved()
+        ? GetStringFromId(dex_file, entry.GetDeclaringClassIndex())
+        : dex_file.StringByTypeIdx(method_id.class_idx_);
 
-    mirror::Class* cls = FindClassAndClearException(class_linker, self, descriptor, class_loader);
+    mirror::Class* cls = FindClassAndClearException(
+        class_linker, self, expected_decl_klass.c_str(), class_loader);
     if (cls == nullptr) {
-      LOG(INFO) << "VerifierDeps: Could not resolve class " << descriptor;
+      LOG(INFO) << "VerifierDeps: Could not resolve class " << expected_decl_klass;
       return false;
     }
     DCHECK(cls->IsResolved());
@@ -1045,7 +1055,6 @@
 
     if (entry.IsResolved()) {
       std::string temp;
-      std::string expected_decl_klass = GetStringFromId(dex_file, entry.GetDeclaringClassIndex());
       if (method == nullptr) {
         LOG(INFO) << "VerifierDeps: Could not resolve "
                   << kind
diff --git a/test/595-profile-saving/profile-saving.cc b/test/595-profile-saving/profile-saving.cc
index bf3d812..0f8dd57 100644
--- a/test/595-profile-saving/profile-saving.cc
+++ b/test/595-profile-saving/profile-saving.cc
@@ -17,7 +17,7 @@
 #include "dex_file.h"
 
 #include "art_method-inl.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "jit/profile_saver.h"
 #include "jni.h"
 #include "method_reference.h"
diff --git a/test/901-hello-ti-agent/basics.cc b/test/901-hello-ti-agent/basics.cc
index 052fb9a..0b17656 100644
--- a/test/901-hello-ti-agent/basics.cc
+++ b/test/901-hello-ti-agent/basics.cc
@@ -28,6 +28,46 @@
 namespace art {
 namespace Test901HelloTi {
 
+static void EnableEvent(jvmtiEnv* env, jvmtiEvent evt) {
+  jvmtiError error = env->SetEventNotificationMode(JVMTI_ENABLE, evt, nullptr);
+  if (error != JVMTI_ERROR_NONE) {
+    printf("Failed to enable event");
+  }
+}
+
+static void JNICALL VMStartCallback(jvmtiEnv *jenv ATTRIBUTE_UNUSED,
+                                     JNIEnv* jni_env ATTRIBUTE_UNUSED) {
+  printf("VMStart\n");
+}
+
+static void JNICALL VMInitCallback(jvmtiEnv *jvmti_env ATTRIBUTE_UNUSED,
+                                   JNIEnv* jni_env ATTRIBUTE_UNUSED,
+                                   jthread thread ATTRIBUTE_UNUSED) {
+  printf("VMInit\n");
+}
+
+static void JNICALL VMDeatchCallback(jvmtiEnv *jenv ATTRIBUTE_UNUSED,
+                                     JNIEnv* jni_env ATTRIBUTE_UNUSED) {
+  printf("VMDeath\n");
+}
+
+
+static void InstallVMEvents(jvmtiEnv* env) {
+  jvmtiEventCallbacks callbacks;
+  memset(&callbacks, 0, sizeof(jvmtiEventCallbacks));
+  callbacks.VMStart = VMStartCallback;
+  callbacks.VMInit = VMInitCallback;
+  callbacks.VMDeath = VMDeatchCallback;
+  jvmtiError ret = env->SetEventCallbacks(&callbacks, sizeof(callbacks));
+  if (ret != JVMTI_ERROR_NONE) {
+    printf("Failed to install callbacks");
+  }
+
+  EnableEvent(env, JVMTI_EVENT_VM_START);
+  EnableEvent(env, JVMTI_EVENT_VM_INIT);
+  EnableEvent(env, JVMTI_EVENT_VM_DEATH);
+}
+
 jint OnLoad(JavaVM* vm,
             char* options ATTRIBUTE_UNUSED,
             void* reserved ATTRIBUTE_UNUSED) {
@@ -72,6 +112,10 @@
     printf("Unexpected version number!\n");
     return -1;
   }
+
+  InstallVMEvents(env);
+  InstallVMEvents(env2);
+
   CHECK_CALL_SUCCESS(env->DisposeEnvironment());
   CHECK_CALL_SUCCESS(env2->DisposeEnvironment());
 #undef CHECK_CALL_SUCCESS
@@ -82,6 +126,19 @@
   }
   SetAllCapabilities(jvmti_env);
 
+  jvmtiPhase current_phase;
+  jvmtiError phase_result = jvmti_env->GetPhase(&current_phase);
+  if (phase_result != JVMTI_ERROR_NONE) {
+    printf("Could not get phase");
+    return 1;
+  }
+  if (current_phase != JVMTI_PHASE_ONLOAD) {
+    printf("Wrong phase");
+    return 1;
+  }
+
+  InstallVMEvents(jvmti_env);
+
   return JNI_OK;
 }
 
@@ -92,5 +149,15 @@
   JvmtiErrorToException(env, result);
 }
 
+extern "C" JNIEXPORT jboolean JNICALL Java_Main_checkLivePhase(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+  jvmtiPhase current_phase;
+  jvmtiError phase_result = jvmti_env->GetPhase(&current_phase);
+  if (JvmtiErrorToException(env, phase_result)) {
+    return JNI_FALSE;
+  }
+  return (current_phase == JVMTI_PHASE_LIVE) ? JNI_TRUE : JNI_FALSE;
+}
+
 }  // namespace Test901HelloTi
 }  // namespace art
diff --git a/test/901-hello-ti-agent/expected.txt b/test/901-hello-ti-agent/expected.txt
index 2aee99b..c4b24cb 100644
--- a/test/901-hello-ti-agent/expected.txt
+++ b/test/901-hello-ti-agent/expected.txt
@@ -1,8 +1,12 @@
 Loaded Agent for test 901-hello-ti-agent
+VMStart
+VMInit
 Hello, world!
+Agent in live phase.
 0
 1
 2
 4
 8
 JVMTI_ERROR_ILLEGAL_ARGUMENT
+VMDeath
diff --git a/test/901-hello-ti-agent/src/Main.java b/test/901-hello-ti-agent/src/Main.java
index 775e5c2..faf2dc2 100644
--- a/test/901-hello-ti-agent/src/Main.java
+++ b/test/901-hello-ti-agent/src/Main.java
@@ -20,6 +20,10 @@
 
     System.out.println("Hello, world!");
 
+    if (checkLivePhase()) {
+      System.out.println("Agent in live phase.");
+    }
+
     set(0);  // OTHER
     set(1);  // GC
     set(2);  // CLASS
@@ -37,5 +41,6 @@
     }
   }
 
+  private static native boolean checkLivePhase();
   private static native void setVerboseFlag(int flag, boolean value);
 }
diff --git a/test/912-classes/classes.cc b/test/912-classes/classes.cc
index a22d1d7..29eeff6 100644
--- a/test/912-classes/classes.cc
+++ b/test/912-classes/classes.cc
@@ -241,5 +241,23 @@
   return ret;
 }
 
+extern "C" JNIEXPORT jintArray JNICALL Java_Main_getClassVersion(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jclass klass) {
+  jint major, minor;
+  jvmtiError result = jvmti_env->GetClassVersionNumbers(klass, &minor, &major);
+  if (JvmtiErrorToException(env, result)) {
+    return nullptr;
+  }
+
+  jintArray int_array = env->NewIntArray(2);
+  if (int_array == nullptr) {
+    return nullptr;
+  }
+  jint buf[2] = { major, minor };
+  env->SetIntArrayRegion(int_array, 0, 2, buf);
+
+  return int_array;
+}
+
 }  // namespace Test912Classes
 }  // namespace art
diff --git a/test/912-classes/expected.txt b/test/912-classes/expected.txt
index a95a465..f3cb261 100644
--- a/test/912-classes/expected.txt
+++ b/test/912-classes/expected.txt
@@ -59,3 +59,5 @@
 boot <- src+src-ex (A,B)
 912-classes.jar+ -> 
 [class A, class B, class java.lang.Object]
+
+[37, 0]
diff --git a/test/912-classes/src/Main.java b/test/912-classes/src/Main.java
index ea3c49c..cbf2392 100644
--- a/test/912-classes/src/Main.java
+++ b/test/912-classes/src/Main.java
@@ -80,6 +80,10 @@
     testClassLoader(getProxyClass());
 
     testClassLoaderClasses();
+
+    System.out.println();
+
+    testClassVersion();
   }
 
   private static Class<?> proxyClass = null;
@@ -202,6 +206,10 @@
     }
   }
 
+  private static void testClassVersion() {
+    System.out.println(Arrays.toString(getClassVersion(Main.class)));
+  }
+
   private static void printClassLoaderClasses(ClassLoader cl) {
     for (;;) {
       if (cl == null || !cl.getClass().getName().startsWith("dalvik.system")) {
@@ -262,6 +270,8 @@
 
   private static native Class<?>[] getClassLoaderClasses(ClassLoader cl);
 
+  private static native int[] getClassVersion(Class<?> c);
+
   private static class TestForNonInit {
     public static double dummy = Math.random();  // So it can't be compile-time initialized.
   }
diff --git a/test/921-hello-failure/expected.txt b/test/921-hello-failure/expected.txt
index 1c1d4d9..9615e6b 100644
--- a/test/921-hello-failure/expected.txt
+++ b/test/921-hello-failure/expected.txt
@@ -21,3 +21,11 @@
 Transformation error : java.lang.Exception(Failed to redefine classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
 hello - MultiRedef
 hello2 - MultiRedef
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform2;, LTransform;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
diff --git a/test/921-hello-failure/src/Main.java b/test/921-hello-failure/src/Main.java
index 1fe2599..43d6e9e 100644
--- a/test/921-hello-failure/src/Main.java
+++ b/test/921-hello-failure/src/Main.java
@@ -25,6 +25,7 @@
     MissingInterface.doTest(new Transform2());
     ReorderInterface.doTest(new Transform2());
     MultiRedef.doTest(new Transform(), new Transform2());
+    MultiRetrans.doTest(new Transform(), new Transform2());
   }
 
   // Transforms the class. This throws an exception if something goes wrong.
@@ -47,7 +48,20 @@
                                    dex_files.toArray(new byte[0][]));
   }
 
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) throws Exception {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
   public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
                                                            byte[][] classfiles,
                                                            byte[][] dexfiles) throws Exception;
+  public static native void doCommonClassRetransformation(Class<?>... target) throws Exception;
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
 }
diff --git a/test/921-hello-failure/src/MultiRetrans.java b/test/921-hello-failure/src/MultiRetrans.java
new file mode 100644
index 0000000..95aaf07
--- /dev/null
+++ b/test/921-hello-failure/src/MultiRetrans.java
@@ -0,0 +1,108 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+class MultiRetrans {
+
+  // class NotTransform {
+  //   public void sayHi(String name) {
+  //     throw new Error("Should not be called!");
+  //   }
+  // }
+  private static CommonClassDefinition INVALID_DEFINITION_T1 = new CommonClassDefinition(
+      Transform.class,
+      Base64.getDecoder().decode(
+          "yv66vgAAADQAFQoABgAPBwAQCAARCgACABIHABMHABQBAAY8aW5pdD4BAAMoKVYBAARDb2RlAQAP" +
+          "TGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApTb3VyY2VG" +
+          "aWxlAQARTm90VHJhbnNmb3JtLmphdmEMAAcACAEAD2phdmEvbGFuZy9FcnJvcgEAFVNob3VsZCBu" +
+          "b3QgYmUgY2FsbGVkIQwABwAMAQAMTm90VHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAAgAAUA" +
+          "BgAAAAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAAAEAAQALAAwA" +
+          "AQAJAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEACgAAAAYAAQAAAAMAAQANAAAAAgAO"),
+      Base64.getDecoder().decode(
+          "ZGV4CjAzNQDLV95i5xnv6iUi6uIeDoY5jP5Xe9NP1AiYAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAL" +
+          "AAAAcAAAAAUAAACcAAAAAgAAALAAAAAAAAAAAAAAAAQAAADIAAAAAQAAAOgAAACQAQAACAEAAEoB" +
+          "AABSAQAAYgEAAHUBAACJAQAAnQEAALABAADHAQAAygEAAM4BAADiAQAAAQAAAAIAAAADAAAABAAA" +
+          "AAcAAAAHAAAABAAAAAAAAAAIAAAABAAAAEQBAAAAAAAAAAAAAAAAAQAKAAAAAQABAAAAAAACAAAA" +
+          "AAAAAAAAAAAAAAAAAgAAAAAAAAAFAAAAAAAAAPQBAAAAAAAAAQABAAEAAADpAQAABAAAAHAQAwAA" +
+          "AA4ABAACAAIAAADuAQAACQAAACIAAQAbAQYAAABwIAIAEAAnAAAAAQAAAAMABjxpbml0PgAOTE5v" +
+          "dFRyYW5zZm9ybTsAEUxqYXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZh" +
+          "L2xhbmcvU3RyaW5nOwARTm90VHJhbnNmb3JtLmphdmEAFVNob3VsZCBub3QgYmUgY2FsbGVkIQAB" +
+          "VgACVkwAEmVtaXR0ZXI6IGphY2stNC4yMAAFc2F5SGkAAQAHDgADAQAHDgAAAAEBAICABIgCAQGg" +
+          "AgAADAAAAAAAAAABAAAAAAAAAAEAAAALAAAAcAAAAAIAAAAFAAAAnAAAAAMAAAACAAAAsAAAAAUA" +
+          "AAAEAAAAyAAAAAYAAAABAAAA6AAAAAEgAAACAAAACAEAAAEQAAABAAAARAEAAAIgAAALAAAASgEA" +
+          "AAMgAAACAAAA6QEAAAAgAAABAAAA9AEAAAAQAAABAAAABAIAAA=="));
+
+  // Valid redefinition of Transform2
+  // class Transform2 implements Iface1, Iface2 {
+  //   public void sayHi(String name) {
+  //     throw new Error("Should not be called!");
+  //   }
+  // }
+  private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
+      Transform2.class,
+      Base64.getDecoder().decode(
+          "yv66vgAAADQAGQoABgARBwASCAATCgACABQHABUHABYHABcHABgBAAY8aW5pdD4BAAMoKVYBAARD" +
+          "b2RlAQAPTGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApT" +
+          "b3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoBAA9qYXZhL2xhbmcvRXJyb3IBABVTaG91" +
+          "bGQgbm90IGJlIGNhbGxlZCEMAAkADgEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAG" +
+          "SWZhY2UxAQAGSWZhY2UyACAABQAGAAIABwAIAAAAAgAAAAkACgABAAsAAAAdAAEAAQAAAAUqtwAB" +
+          "sQAAAAEADAAAAAYAAQAAAAEAAQANAA4AAQALAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEADAAA" +
+          "AAYAAQAAAAMAAQAPAAAAAgAQ"),
+      Base64.getDecoder().decode(
+          "ZGV4CjAzNQDSWls05CPkX+gbTGMVRvx9dc9vozzVbu7AAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAN" +
+          "AAAAcAAAAAcAAACkAAAAAgAAAMAAAAAAAAAAAAAAAAQAAADYAAAAAQAAAPgAAACoAQAAGAEAAGIB" +
+          "AABqAQAAdAEAAH4BAACMAQAAnwEAALMBAADHAQAA3gEAAO8BAADyAQAA9gEAAAoCAAABAAAAAgAA" +
+          "AAMAAAAEAAAABQAAAAYAAAAJAAAACQAAAAYAAAAAAAAACgAAAAYAAABcAQAAAgAAAAAAAAACAAEA" +
+          "DAAAAAMAAQAAAAAABAAAAAAAAAACAAAAAAAAAAQAAABUAQAACAAAAAAAAAAcAgAAAAAAAAEAAQAB" +
+          "AAAAEQIAAAQAAABwEAMAAAAOAAQAAgACAAAAFgIAAAkAAAAiAAMAGwEHAAAAcCACABAAJwAAAAIA" +
+          "AAAAAAEAAQAAAAUABjxpbml0PgAITElmYWNlMTsACExJZmFjZTI7AAxMVHJhbnNmb3JtMjsAEUxq" +
+          "YXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAV" +
+          "U2hvdWxkIG5vdCBiZSBjYWxsZWQhAA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBq" +
+          "YWNrLTQuMjAABXNheUhpAAEABw4AAwEABw4AAAABAQCAgASYAgEBsAIAAAwAAAAAAAAAAQAAAAAA" +
+          "AAABAAAADQAAAHAAAAACAAAABwAAAKQAAAADAAAAAgAAAMAAAAAFAAAABAAAANgAAAAGAAAAAQAA" +
+          "APgAAAABIAAAAgAAABgBAAABEAAAAgAAAFQBAAACIAAADQAAAGIBAAADIAAAAgAAABECAAAAIAAA" +
+          "AQAAABwCAAAAEAAAAQAAACwCAAA="));
+
+  public static void doTest(Transform t1, Transform2 t2) {
+    t1.sayHi("MultiRetrans");
+    t2.sayHi("MultiRetrans");
+    try {
+      Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+      Main.enableCommonRetransformation(true);
+      Main.doCommonClassRetransformation(Transform2.class, Transform.class);
+    } catch (Exception e) {
+      System.out.println(
+          "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+    } finally {
+      Main.enableCommonRetransformation(false);
+    }
+    t1.sayHi("MultiRetrans");
+    t2.sayHi("MultiRetrans");
+    try {
+      Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+      Main.enableCommonRetransformation(true);
+      Main.doCommonClassRetransformation(Transform.class, Transform2.class);
+    } catch (Exception e) {
+      System.out.println(
+          "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+    } finally {
+      Main.enableCommonRetransformation(false);
+    }
+    t1.sayHi("MultiRetrans");
+    t2.sayHi("MultiRetrans");
+  }
+}
diff --git a/test/924-threads/expected.txt b/test/924-threads/expected.txt
index 32e3368..3b7fb24 100644
--- a/test/924-threads/expected.txt
+++ b/test/924-threads/expected.txt
@@ -29,3 +29,5 @@
 5 = ALIVE|RUNNABLE
 2 = TERMINATED
 [Thread[FinalizerDaemon,5,system], Thread[FinalizerWatchdogDaemon,5,system], Thread[HeapTaskDaemon,5,system], Thread[ReferenceQueueDaemon,5,system], Thread[Signal Catcher,5,system], Thread[main,5,main]]
+JVMTI_ERROR_THREAD_NOT_ALIVE
+JVMTI_ERROR_THREAD_NOT_ALIVE
diff --git a/test/924-threads/src/Main.java b/test/924-threads/src/Main.java
index 492a7ac..dec49a8 100644
--- a/test/924-threads/src/Main.java
+++ b/test/924-threads/src/Main.java
@@ -56,6 +56,8 @@
     doStateTests();
 
     doAllThreadsTests();
+
+    doTLSTests();
   }
 
   private static class Holder {
@@ -164,6 +166,68 @@
     System.out.println(Arrays.toString(threads));
   }
 
+  private static void doTLSTests() throws Exception {
+    doTLSNonLiveTests();
+    doTLSLiveTests();
+  }
+
+  private static void doTLSNonLiveTests() throws Exception {
+    Thread t = new Thread();
+    try {
+      setTLS(t, 1);
+      System.out.println("Expected failure setting TLS for non-live thread");
+    } catch (Exception e) {
+      System.out.println(e.getMessage());
+    }
+    t.start();
+    t.join();
+    try {
+      setTLS(t, 1);
+      System.out.println("Expected failure setting TLS for non-live thread");
+    } catch (Exception e) {
+      System.out.println(e.getMessage());
+    }
+  }
+
+  private static void doTLSLiveTests() throws Exception {
+    setTLS(Thread.currentThread(), 1);
+
+    long l = getTLS(Thread.currentThread());
+    if (l != 1) {
+      throw new RuntimeException("Unexpected TLS value: " + l);
+    };
+
+    final CountDownLatch cdl1 = new CountDownLatch(1);
+    final CountDownLatch cdl2 = new CountDownLatch(1);
+
+    Runnable r = new Runnable() {
+      @Override
+      public void run() {
+        try {
+          cdl1.countDown();
+          cdl2.await();
+          setTLS(Thread.currentThread(), 2);
+          if (getTLS(Thread.currentThread()) != 2) {
+            throw new RuntimeException("Different thread issue");
+          }
+        } catch (Exception e) {
+          throw new RuntimeException(e);
+        }
+      }
+    };
+
+    Thread t = new Thread(r);
+    t.start();
+    cdl1.await();
+    setTLS(Thread.currentThread(), 1);
+    cdl2.countDown();
+
+    t.join();
+    if (getTLS(Thread.currentThread()) != 1) {
+      throw new RuntimeException("Got clobbered");
+    }
+  }
+
   private final static Comparator<Thread> THREAD_COMP = new Comparator<Thread>() {
     public int compare(Thread o1, Thread o2) {
       return o1.getName().compareTo(o2.getName());
@@ -229,4 +293,6 @@
   private static native Object[] getThreadInfo(Thread t);
   private static native int getThreadState(Thread t);
   private static native Thread[] getAllThreads();
+  private static native void setTLS(Thread t, long l);
+  private static native long getTLS(Thread t);
 }
diff --git a/test/924-threads/threads.cc b/test/924-threads/threads.cc
index 1487b7c..d35eaa8 100644
--- a/test/924-threads/threads.cc
+++ b/test/924-threads/threads.cc
@@ -120,5 +120,22 @@
   return ret;
 }
 
+extern "C" JNIEXPORT jlong JNICALL Java_Main_getTLS(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jthread thread) {
+  void* tls;
+  jvmtiError result = jvmti_env->GetThreadLocalStorage(thread, &tls);
+  if (JvmtiErrorToException(env, result)) {
+    return 0;
+  }
+  return static_cast<jlong>(reinterpret_cast<uintptr_t>(tls));
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_setTLS(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jthread thread, jlong val) {
+  const void* tls = reinterpret_cast<void*>(static_cast<uintptr_t>(val));
+  jvmtiError result = jvmti_env->SetThreadLocalStorage(thread, tls);
+  JvmtiErrorToException(env, result);
+}
+
 }  // namespace Test924Threads
 }  // namespace art
diff --git a/test/930-hello-retransform/build b/test/930-hello-retransform/build
new file mode 100755
index 0000000..898e2e5
--- /dev/null
+++ b/test/930-hello-retransform/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#      http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/930-hello-retransform/expected.txt b/test/930-hello-retransform/expected.txt
new file mode 100644
index 0000000..4774b81
--- /dev/null
+++ b/test/930-hello-retransform/expected.txt
@@ -0,0 +1,2 @@
+hello
+Goodbye
diff --git a/test/930-hello-retransform/info.txt b/test/930-hello-retransform/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/930-hello-retransform/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/930-hello-retransform/run b/test/930-hello-retransform/run
new file mode 100755
index 0000000..4379349
--- /dev/null
+++ b/test/930-hello-retransform/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#      http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+                   --experimental runtime-plugins \
+                   --jvmti
diff --git a/test/930-hello-retransform/src/Main.java b/test/930-hello-retransform/src/Main.java
new file mode 100644
index 0000000..12194c3
--- /dev/null
+++ b/test/930-hello-retransform/src/Main.java
@@ -0,0 +1,70 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+
+  /**
+   * base64 encoded class/dex file for
+   * class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+    "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+  public static void main(String[] args) {
+    System.loadLibrary(args[1]);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi();
+    addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
+    enableCommonRetransformation(true);
+    doCommonClassRetransformation(Transform.class);
+    t.sayHi();
+  }
+
+  // Transforms the class
+  private static native void doCommonClassRetransformation(Class<?>... target);
+  private static native void enableCommonRetransformation(boolean enable);
+  private static native void addCommonTransformationResult(String target_name,
+                                                           byte[] class_bytes,
+                                                           byte[] dex_bytes);
+}
diff --git a/test/930-hello-retransform/src/Transform.java b/test/930-hello-retransform/src/Transform.java
new file mode 100644
index 0000000..8e8af35
--- /dev/null
+++ b/test/930-hello-retransform/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+  public void sayHi() {
+    // Use lower 'h' to make sure the string will have a different string id
+    // than the transformation (the transformation code is the same except
+    // the actual printed String, which was making the test inacurately passing
+    // in JIT mode when loading the string from the dex cache, as the string ids
+    // of the two different strings were the same).
+    // We know the string ids will be different because lexicographically:
+    // "Goodbye" < "LTransform;" < "hello".
+    System.out.println("hello");
+  }
+}
diff --git a/test/931-agent-thread/agent_thread.cc b/test/931-agent-thread/agent_thread.cc
new file mode 100644
index 0000000..6ace4ce
--- /dev/null
+++ b/test/931-agent-thread/agent_thread.cc
@@ -0,0 +1,132 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <inttypes.h>
+
+#include "barrier.h"
+#include "base/logging.h"
+#include "base/macros.h"
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+#include "runtime.h"
+#include "ScopedLocalRef.h"
+#include "thread-inl.h"
+#include "well_known_classes.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test930AgentThread {
+
+struct AgentData {
+  AgentData() : main_thread(nullptr),
+                jvmti_env(nullptr),
+                b(2) {
+  }
+
+  jthread main_thread;
+  jvmtiEnv* jvmti_env;
+  Barrier b;
+  jint priority;
+};
+
+static void AgentMain(jvmtiEnv* jenv, JNIEnv* env, void* arg) {
+  AgentData* data = reinterpret_cast<AgentData*>(arg);
+
+  // Check some basics.
+  // This thread is not the main thread.
+  jthread this_thread;
+  jvmtiError this_thread_result = jenv->GetCurrentThread(&this_thread);
+  CHECK(!JvmtiErrorToException(env, this_thread_result));
+  CHECK(!env->IsSameObject(this_thread, data->main_thread));
+
+  // The thread is a daemon.
+  jvmtiThreadInfo info;
+  jvmtiError info_result = jenv->GetThreadInfo(this_thread, &info);
+  CHECK(!JvmtiErrorToException(env, info_result));
+  CHECK(info.is_daemon);
+
+  // The thread has the requested priority.
+  // TODO: Our thread priorities do not work on the host.
+  // CHECK_EQ(info.priority, data->priority);
+
+  // Check further parts of the thread:
+  jint thread_count;
+  jthread* threads;
+  jvmtiError threads_result = jenv->GetAllThreads(&thread_count, &threads);
+  CHECK(!JvmtiErrorToException(env, threads_result));
+  bool found = false;
+  for (jint i = 0; i != thread_count; ++i) {
+    if (env->IsSameObject(threads[i], this_thread)) {
+      found = true;
+      break;
+    }
+  }
+  CHECK(found);
+
+  // Done, let the main thread progress.
+  data->b.Pass(Thread::Current());
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_testAgentThread(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+  // Create a Thread object.
+  ScopedLocalRef<jobject> thread_name(env,
+                                      env->NewStringUTF("Agent Thread"));
+  if (thread_name.get() == nullptr) {
+    return;
+  }
+
+  ScopedLocalRef<jobject> thread(env, env->AllocObject(WellKnownClasses::java_lang_Thread));
+  if (thread.get() == nullptr) {
+    return;
+  }
+
+  env->CallNonvirtualVoidMethod(thread.get(),
+                                WellKnownClasses::java_lang_Thread,
+                                WellKnownClasses::java_lang_Thread_init,
+                                Runtime::Current()->GetMainThreadGroup(),
+                                thread_name.get(),
+                                kMinThreadPriority,
+                                JNI_FALSE);
+  if (env->ExceptionCheck()) {
+    return;
+  }
+
+  jthread main_thread;
+  jvmtiError main_thread_result = jvmti_env->GetCurrentThread(&main_thread);
+  if (JvmtiErrorToException(env, main_thread_result)) {
+    return;
+  }
+
+  AgentData data;
+  data.main_thread = env->NewGlobalRef(main_thread);
+  data.jvmti_env = jvmti_env;
+  data.priority = JVMTI_THREAD_MIN_PRIORITY;
+
+  jvmtiError result = jvmti_env->RunAgentThread(thread.get(), AgentMain, &data, data.priority);
+  if (JvmtiErrorToException(env, result)) {
+    return;
+  }
+
+  data.b.Wait(Thread::Current());
+
+  env->DeleteGlobalRef(data.main_thread);
+}
+
+}  // namespace Test930AgentThread
+}  // namespace art
diff --git a/test/931-agent-thread/build b/test/931-agent-thread/build
new file mode 100755
index 0000000..898e2e5
--- /dev/null
+++ b/test/931-agent-thread/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#      http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/931-agent-thread/expected.txt b/test/931-agent-thread/expected.txt
new file mode 100644
index 0000000..a965a70
--- /dev/null
+++ b/test/931-agent-thread/expected.txt
@@ -0,0 +1 @@
+Done
diff --git a/test/931-agent-thread/info.txt b/test/931-agent-thread/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/931-agent-thread/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/931-agent-thread/run b/test/931-agent-thread/run
new file mode 100755
index 0000000..0a8d067
--- /dev/null
+++ b/test/931-agent-thread/run
@@ -0,0 +1,23 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#      http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# This test checks whether dex files can be injected into parent classloaders. App images preload
+# classes, which will make the injection moot. Turn off app images to avoid the issue.
+
+./default-run "$@" --experimental agents \
+                   --experimental runtime-plugins \
+                   --jvmti \
+                   --no-app-image
diff --git a/test/931-agent-thread/src/Main.java b/test/931-agent-thread/src/Main.java
new file mode 100644
index 0000000..6471bc8
--- /dev/null
+++ b/test/931-agent-thread/src/Main.java
@@ -0,0 +1,29 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+
+public class Main {
+  public static void main(String[] args) throws Exception {
+    System.loadLibrary(args[1]);
+
+    testAgentThread();
+
+    System.out.println("Done");
+  }
+
+  private static native void testAgentThread();
+}
diff --git a/test/Android.bp b/test/Android.bp
index 965d07a..be5bc59 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -269,6 +269,7 @@
         "927-timers/timers.cc",
         "928-jni-table/jni_table.cc",
         "929-search/search.cc",
+        "931-agent-thread/agent_thread.cc",
     ],
     shared_libs: [
         "libbase",
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index e604c93..c8e2185 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -309,6 +309,8 @@
   927-timers \
   928-jni-table \
   929-search \
+  930-hello-retransform \
+  931-agent-thread \
 
 ifneq (,$(filter target,$(TARGET_TYPES)))
   ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \
diff --git a/test/XandY/Y.java b/test/XandY/Y.java
index ecead6e..2a1f036 100644
--- a/test/XandY/Y.java
+++ b/test/XandY/Y.java
@@ -14,4 +14,8 @@
  * limitations under the License.
  */
 
-class Y extends X {}
+class Y extends X {
+  static Z z = new Z();
+  static class Z {
+  }
+}
diff --git a/test/etc/run-test-jar b/test/etc/run-test-jar
index 5f1071f..28fa130 100755
--- a/test/etc/run-test-jar
+++ b/test/etc/run-test-jar
@@ -44,7 +44,7 @@
 SECONDARY_DEX=""
 TIME_OUT="gdb"  # "n" (disabled), "timeout" (use timeout), "gdb" (use gdb)
 # Value in seconds
-if [ "$ART_USE_READ_BARRIER" = "true" ]; then
+if [ "$ART_USE_READ_BARRIER" != "false" ]; then
   TIME_OUT_VALUE=2400  # 40 minutes.
 else
   TIME_OUT_VALUE=1200  # 20 minutes.
diff --git a/test/run-test b/test/run-test
index a913e78..9b17802 100755
--- a/test/run-test
+++ b/test/run-test
@@ -722,7 +722,7 @@
     #
     # TODO: Enable Checker when read barrier support is added to more
     # architectures (b/12687968).
-    if [ "x$ART_USE_READ_BARRIER" = xtrue ]                    \
+    if [ "x$ART_USE_READ_BARRIER" != xfalse ]                  \
        && (([ "x$host_mode" = "xyes" ]                         \
             && ! arch_supports_read_barrier "$host_arch_name") \
            || ([ "x$target_mode" = "xyes" ]                    \
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index 2c6d3ed..8799c91 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -18,6 +18,7 @@
 
 #include <stdio.h>
 #include <sstream>
+#include <deque>
 
 #include "art_method.h"
 #include "jni.h"
@@ -60,17 +61,17 @@
   return true;
 }
 
-namespace common_redefine {
 
-static void throwRedefinitionError(jvmtiEnv* jvmti,
-                                   JNIEnv* env,
-                                   jint num_targets,
-                                   jclass* target,
-                                   jvmtiError res) {
+template <bool is_redefine>
+static void throwCommonRedefinitionError(jvmtiEnv* jvmti,
+                                         JNIEnv* env,
+                                         jint num_targets,
+                                         jclass* target,
+                                         jvmtiError res) {
   std::stringstream err;
   char* error = nullptr;
   jvmti->GetErrorName(res, &error);
-  err << "Failed to redefine class";
+  err << "Failed to " << (is_redefine ? "redefine" : "retransform") << " class";
   if (num_targets > 1) {
     err << "es";
   }
@@ -92,6 +93,16 @@
   env->ThrowNew(env->FindClass("java/lang/Exception"), message.c_str());
 }
 
+namespace common_redefine {
+
+static void throwRedefinitionError(jvmtiEnv* jvmti,
+                                   JNIEnv* env,
+                                   jint num_targets,
+                                   jclass* target,
+                                   jvmtiError res) {
+  return throwCommonRedefinitionError<true>(jvmti, env, num_targets, target, res);
+}
+
 static void DoMultiClassRedefine(jvmtiEnv* jvmti_env,
                                  JNIEnv* env,
                                  jint num_redefines,
@@ -161,7 +172,138 @@
                               dex_files.data());
 }
 
-// Don't do anything
+// Get all capabilities except those related to retransformation.
+jint OnLoad(JavaVM* vm,
+            char* options ATTRIBUTE_UNUSED,
+            void* reserved ATTRIBUTE_UNUSED) {
+  if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+    printf("Unable to get jvmti env!\n");
+    return 1;
+  }
+  jvmtiCapabilities caps;
+  jvmti_env->GetPotentialCapabilities(&caps);
+  caps.can_retransform_classes = 0;
+  caps.can_retransform_any_class = 0;
+  jvmti_env->AddCapabilities(&caps);
+  return 0;
+}
+
+}  // namespace common_redefine
+
+namespace common_retransform {
+
+struct CommonTransformationResult {
+  std::vector<unsigned char> class_bytes;
+  std::vector<unsigned char> dex_bytes;
+
+  CommonTransformationResult(size_t class_size, size_t dex_size)
+      : class_bytes(class_size), dex_bytes(dex_size) {}
+
+  CommonTransformationResult() = default;
+  CommonTransformationResult(CommonTransformationResult&&) = default;
+  CommonTransformationResult(CommonTransformationResult&) = default;
+};
+
+// Map from class name to transformation result.
+std::map<std::string, std::deque<CommonTransformationResult>> gTransformations;
+
+extern "C" JNIEXPORT void JNICALL Java_Main_addCommonTransformationResult(JNIEnv* env,
+                                                                          jclass,
+                                                                          jstring class_name,
+                                                                          jbyteArray class_array,
+                                                                          jbyteArray dex_array) {
+  const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
+  std::string name_str(name_chrs);
+  env->ReleaseStringUTFChars(class_name, name_chrs);
+  CommonTransformationResult trans(env->GetArrayLength(class_array),
+                                   env->GetArrayLength(dex_array));
+  if (env->ExceptionOccurred()) {
+    return;
+  }
+  env->GetByteArrayRegion(class_array,
+                          0,
+                          env->GetArrayLength(class_array),
+                          reinterpret_cast<jbyte*>(trans.class_bytes.data()));
+  if (env->ExceptionOccurred()) {
+    return;
+  }
+  env->GetByteArrayRegion(dex_array,
+                          0,
+                          env->GetArrayLength(dex_array),
+                          reinterpret_cast<jbyte*>(trans.dex_bytes.data()));
+  if (env->ExceptionOccurred()) {
+    return;
+  }
+  if (gTransformations.find(name_str) == gTransformations.end()) {
+    std::deque<CommonTransformationResult> list;
+    gTransformations[name_str] = std::move(list);
+  }
+  gTransformations[name_str].push_back(std::move(trans));
+}
+
+// The hook we are using.
+void JNICALL CommonClassFileLoadHookRetransformable(jvmtiEnv* jvmti_env,
+                                                    JNIEnv* jni_env ATTRIBUTE_UNUSED,
+                                                    jclass class_being_redefined ATTRIBUTE_UNUSED,
+                                                    jobject loader ATTRIBUTE_UNUSED,
+                                                    const char* name,
+                                                    jobject protection_domain ATTRIBUTE_UNUSED,
+                                                    jint class_data_len ATTRIBUTE_UNUSED,
+                                                    const unsigned char* class_dat ATTRIBUTE_UNUSED,
+                                                    jint* new_class_data_len,
+                                                    unsigned char** new_class_data) {
+  std::string name_str(name);
+  if (gTransformations.find(name_str) != gTransformations.end()) {
+    CommonTransformationResult& res = gTransformations[name_str][0];
+    const std::vector<unsigned char>& desired_array = IsJVM() ? res.class_bytes : res.dex_bytes;
+    unsigned char* new_data;
+    jvmti_env->Allocate(desired_array.size(), &new_data);
+    memcpy(new_data, desired_array.data(), desired_array.size());
+    *new_class_data = new_data;
+    *new_class_data_len = desired_array.size();
+    gTransformations[name_str].pop_front();
+  }
+}
+
+extern "C" JNIEXPORT void Java_Main_enableCommonRetransformation(JNIEnv* env,
+                                                                 jclass,
+                                                                 jboolean enable) {
+  jvmtiError res = jvmti_env->SetEventNotificationMode(enable ? JVMTI_ENABLE : JVMTI_DISABLE,
+                                                       JVMTI_EVENT_CLASS_FILE_LOAD_HOOK,
+                                                       nullptr);
+  if (res != JVMTI_ERROR_NONE) {
+    JvmtiErrorToException(env, res);
+  }
+}
+
+static void throwRetransformationError(jvmtiEnv* jvmti,
+                                       JNIEnv* env,
+                                       jint num_targets,
+                                       jclass* targets,
+                                       jvmtiError res) {
+  return throwCommonRedefinitionError<false>(jvmti, env, num_targets, targets, res);
+}
+
+static void DoClassRetransformation(jvmtiEnv* jvmti_env, JNIEnv* env, jobjectArray targets) {
+  std::vector<jclass> classes;
+  jint len = env->GetArrayLength(targets);
+  for (jint i = 0; i < len; i++) {
+    classes.push_back(static_cast<jclass>(env->GetObjectArrayElement(targets, i)));
+  }
+  jvmtiError res = jvmti_env->RetransformClasses(len, classes.data());
+  if (res != JVMTI_ERROR_NONE) {
+    throwRetransformationError(jvmti_env, env, len, classes.data(), res);
+  }
+}
+
+// TODO Write something useful.
+extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRetransformation(JNIEnv* env,
+                                                                          jclass,
+                                                                          jobjectArray targets) {
+  DoClassRetransformation(jvmti_env, env, targets);
+}
+
+// Get all capabilities except those related to retransformation.
 jint OnLoad(JavaVM* vm,
             char* options ATTRIBUTE_UNUSED,
             void* reserved ATTRIBUTE_UNUSED) {
@@ -170,9 +312,16 @@
     return 1;
   }
   SetAllCapabilities(jvmti_env);
+  jvmtiEventCallbacks cb;
+  memset(&cb, 0, sizeof(cb));
+  cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
+  if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
+    printf("Unable to set class file load hook cb!\n");
+    return 1;
+  }
   return 0;
 }
 
-}  // namespace common_redefine
+}  // namespace common_retransform
 
 }  // namespace art
diff --git a/test/ti-agent/common_helper.h b/test/ti-agent/common_helper.h
index 642ca03..8599fc4 100644
--- a/test/ti-agent/common_helper.h
+++ b/test/ti-agent/common_helper.h
@@ -27,6 +27,10 @@
 jint OnLoad(JavaVM* vm, char* options, void* reserved);
 
 }  // namespace common_redefine
+namespace common_retransform {
+jint OnLoad(JavaVM* vm, char* options, void* reserved);
+}  // namespace common_retransform
+
 
 extern bool RuntimeIsJVM;
 
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 521e672..1b11442 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -64,8 +64,9 @@
   { "916-obsolete-jit", common_redefine::OnLoad, nullptr },
   { "917-fields-transformation", common_redefine::OnLoad, nullptr },
   { "919-obsolete-fields", common_redefine::OnLoad, nullptr },
-  { "921-hello-failure", common_redefine::OnLoad, nullptr },
+  { "921-hello-failure", common_retransform::OnLoad, nullptr },
   { "926-multi-obsolescence", common_redefine::OnLoad, nullptr },
+  { "930-hello-retransform", common_retransform::OnLoad, nullptr },
 };
 
 static AgentLib* FindAgent(char* name) {
diff --git a/test/valgrind-suppressions.txt b/test/valgrind-suppressions.txt
index fd3c331..c148ad0 100644
--- a/test/valgrind-suppressions.txt
+++ b/test/valgrind-suppressions.txt
@@ -22,3 +22,27 @@
    ...
    fun:_ZN3art7Runtime17InitNativeMethodsEv
 }
+
+# SigQuit runs libbacktrace
+{
+   BackTraceReading64
+   Memcheck:Addr8
+   fun:access_mem_unrestricted
+   fun:_Uelf64_memory_read
+   fun:_Uelf64_valid_object_memory
+   fun:map_create_list
+   fun:unw_map_local_create
+   fun:_ZN14UnwindMapLocal5BuildEv
+   fun:_ZN12BacktraceMap6CreateEib
+}
+{
+   BackTraceReading32
+   Memcheck:Addr4
+   fun:access_mem_unrestricted
+   fun:_Uelf32_memory_read
+   fun:_Uelf32_valid_object_memory
+   fun:map_create_list
+   fun:unw_map_local_create
+   fun:_ZN14UnwindMapLocal5BuildEv
+   fun:_ZN12BacktraceMap6CreateEib
+}