Revert "Revert "Implement RetransformClasses""

This reverts commit 52a2db50b76f2b981d21d5508c3d9e8ab4c5fe93.

Reason for revert: Issue with RedefineClasses was resolved.

Test: ART_TEST_JNI_FORCECOPY=true mma -j40 test-art-host

Change-Id: I06f198df4fb40c48647b358d241710329e0812e9
diff --git a/test/921-hello-failure/expected.txt b/test/921-hello-failure/expected.txt
index 1c1d4d9..9615e6b 100644
--- a/test/921-hello-failure/expected.txt
+++ b/test/921-hello-failure/expected.txt
@@ -21,3 +21,11 @@
 Transformation error : java.lang.Exception(Failed to redefine classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
 hello - MultiRedef
 hello2 - MultiRedef
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform2;, LTransform;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
diff --git a/test/921-hello-failure/src/Main.java b/test/921-hello-failure/src/Main.java
index 1fe2599..43d6e9e 100644
--- a/test/921-hello-failure/src/Main.java
+++ b/test/921-hello-failure/src/Main.java
@@ -25,6 +25,7 @@
     MissingInterface.doTest(new Transform2());
     ReorderInterface.doTest(new Transform2());
     MultiRedef.doTest(new Transform(), new Transform2());
+    MultiRetrans.doTest(new Transform(), new Transform2());
   }
 
   // Transforms the class. This throws an exception if something goes wrong.
@@ -47,7 +48,20 @@
                                    dex_files.toArray(new byte[0][]));
   }
 
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) throws Exception {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
   public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
                                                            byte[][] classfiles,
                                                            byte[][] dexfiles) throws Exception;
+  public static native void doCommonClassRetransformation(Class<?>... target) throws Exception;
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
 }
diff --git a/test/921-hello-failure/src/MultiRetrans.java b/test/921-hello-failure/src/MultiRetrans.java
new file mode 100644
index 0000000..95aaf07
--- /dev/null
+++ b/test/921-hello-failure/src/MultiRetrans.java
@@ -0,0 +1,108 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+class MultiRetrans {
+
+  // class NotTransform {
+  //   public void sayHi(String name) {
+  //     throw new Error("Should not be called!");
+  //   }
+  // }
+  private static CommonClassDefinition INVALID_DEFINITION_T1 = new CommonClassDefinition(
+      Transform.class,
+      Base64.getDecoder().decode(
+          "yv66vgAAADQAFQoABgAPBwAQCAARCgACABIHABMHABQBAAY8aW5pdD4BAAMoKVYBAARDb2RlAQAP" +
+          "TGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApTb3VyY2VG" +
+          "aWxlAQARTm90VHJhbnNmb3JtLmphdmEMAAcACAEAD2phdmEvbGFuZy9FcnJvcgEAFVNob3VsZCBu" +
+          "b3QgYmUgY2FsbGVkIQwABwAMAQAMTm90VHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAAgAAUA" +
+          "BgAAAAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAAAEAAQALAAwA" +
+          "AQAJAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEACgAAAAYAAQAAAAMAAQANAAAAAgAO"),
+      Base64.getDecoder().decode(
+          "ZGV4CjAzNQDLV95i5xnv6iUi6uIeDoY5jP5Xe9NP1AiYAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAL" +
+          "AAAAcAAAAAUAAACcAAAAAgAAALAAAAAAAAAAAAAAAAQAAADIAAAAAQAAAOgAAACQAQAACAEAAEoB" +
+          "AABSAQAAYgEAAHUBAACJAQAAnQEAALABAADHAQAAygEAAM4BAADiAQAAAQAAAAIAAAADAAAABAAA" +
+          "AAcAAAAHAAAABAAAAAAAAAAIAAAABAAAAEQBAAAAAAAAAAAAAAAAAQAKAAAAAQABAAAAAAACAAAA" +
+          "AAAAAAAAAAAAAAAAAgAAAAAAAAAFAAAAAAAAAPQBAAAAAAAAAQABAAEAAADpAQAABAAAAHAQAwAA" +
+          "AA4ABAACAAIAAADuAQAACQAAACIAAQAbAQYAAABwIAIAEAAnAAAAAQAAAAMABjxpbml0PgAOTE5v" +
+          "dFRyYW5zZm9ybTsAEUxqYXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZh" +
+          "L2xhbmcvU3RyaW5nOwARTm90VHJhbnNmb3JtLmphdmEAFVNob3VsZCBub3QgYmUgY2FsbGVkIQAB" +
+          "VgACVkwAEmVtaXR0ZXI6IGphY2stNC4yMAAFc2F5SGkAAQAHDgADAQAHDgAAAAEBAICABIgCAQGg" +
+          "AgAADAAAAAAAAAABAAAAAAAAAAEAAAALAAAAcAAAAAIAAAAFAAAAnAAAAAMAAAACAAAAsAAAAAUA" +
+          "AAAEAAAAyAAAAAYAAAABAAAA6AAAAAEgAAACAAAACAEAAAEQAAABAAAARAEAAAIgAAALAAAASgEA" +
+          "AAMgAAACAAAA6QEAAAAgAAABAAAA9AEAAAAQAAABAAAABAIAAA=="));
+
+  // Valid redefinition of Transform2
+  // class Transform2 implements Iface1, Iface2 {
+  //   public void sayHi(String name) {
+  //     throw new Error("Should not be called!");
+  //   }
+  // }
+  private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
+      Transform2.class,
+      Base64.getDecoder().decode(
+          "yv66vgAAADQAGQoABgARBwASCAATCgACABQHABUHABYHABcHABgBAAY8aW5pdD4BAAMoKVYBAARD" +
+          "b2RlAQAPTGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApT" +
+          "b3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoBAA9qYXZhL2xhbmcvRXJyb3IBABVTaG91" +
+          "bGQgbm90IGJlIGNhbGxlZCEMAAkADgEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAG" +
+          "SWZhY2UxAQAGSWZhY2UyACAABQAGAAIABwAIAAAAAgAAAAkACgABAAsAAAAdAAEAAQAAAAUqtwAB" +
+          "sQAAAAEADAAAAAYAAQAAAAEAAQANAA4AAQALAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEADAAA" +
+          "AAYAAQAAAAMAAQAPAAAAAgAQ"),
+      Base64.getDecoder().decode(
+          "ZGV4CjAzNQDSWls05CPkX+gbTGMVRvx9dc9vozzVbu7AAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAN" +
+          "AAAAcAAAAAcAAACkAAAAAgAAAMAAAAAAAAAAAAAAAAQAAADYAAAAAQAAAPgAAACoAQAAGAEAAGIB" +
+          "AABqAQAAdAEAAH4BAACMAQAAnwEAALMBAADHAQAA3gEAAO8BAADyAQAA9gEAAAoCAAABAAAAAgAA" +
+          "AAMAAAAEAAAABQAAAAYAAAAJAAAACQAAAAYAAAAAAAAACgAAAAYAAABcAQAAAgAAAAAAAAACAAEA" +
+          "DAAAAAMAAQAAAAAABAAAAAAAAAACAAAAAAAAAAQAAABUAQAACAAAAAAAAAAcAgAAAAAAAAEAAQAB" +
+          "AAAAEQIAAAQAAABwEAMAAAAOAAQAAgACAAAAFgIAAAkAAAAiAAMAGwEHAAAAcCACABAAJwAAAAIA" +
+          "AAAAAAEAAQAAAAUABjxpbml0PgAITElmYWNlMTsACExJZmFjZTI7AAxMVHJhbnNmb3JtMjsAEUxq" +
+          "YXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAV" +
+          "U2hvdWxkIG5vdCBiZSBjYWxsZWQhAA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBq" +
+          "YWNrLTQuMjAABXNheUhpAAEABw4AAwEABw4AAAABAQCAgASYAgEBsAIAAAwAAAAAAAAAAQAAAAAA" +
+          "AAABAAAADQAAAHAAAAACAAAABwAAAKQAAAADAAAAAgAAAMAAAAAFAAAABAAAANgAAAAGAAAAAQAA" +
+          "APgAAAABIAAAAgAAABgBAAABEAAAAgAAAFQBAAACIAAADQAAAGIBAAADIAAAAgAAABECAAAAIAAA" +
+          "AQAAABwCAAAAEAAAAQAAACwCAAA="));
+
+  public static void doTest(Transform t1, Transform2 t2) {
+    t1.sayHi("MultiRetrans");
+    t2.sayHi("MultiRetrans");
+    try {
+      Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+      Main.enableCommonRetransformation(true);
+      Main.doCommonClassRetransformation(Transform2.class, Transform.class);
+    } catch (Exception e) {
+      System.out.println(
+          "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+    } finally {
+      Main.enableCommonRetransformation(false);
+    }
+    t1.sayHi("MultiRetrans");
+    t2.sayHi("MultiRetrans");
+    try {
+      Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+      Main.enableCommonRetransformation(true);
+      Main.doCommonClassRetransformation(Transform.class, Transform2.class);
+    } catch (Exception e) {
+      System.out.println(
+          "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+    } finally {
+      Main.enableCommonRetransformation(false);
+    }
+    t1.sayHi("MultiRetrans");
+    t2.sayHi("MultiRetrans");
+  }
+}
diff --git a/test/930-hello-retransform/build b/test/930-hello-retransform/build
new file mode 100755
index 0000000..898e2e5
--- /dev/null
+++ b/test/930-hello-retransform/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#      http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/930-hello-retransform/expected.txt b/test/930-hello-retransform/expected.txt
new file mode 100644
index 0000000..4774b81
--- /dev/null
+++ b/test/930-hello-retransform/expected.txt
@@ -0,0 +1,2 @@
+hello
+Goodbye
diff --git a/test/930-hello-retransform/info.txt b/test/930-hello-retransform/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/930-hello-retransform/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/930-hello-retransform/run b/test/930-hello-retransform/run
new file mode 100755
index 0000000..4379349
--- /dev/null
+++ b/test/930-hello-retransform/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#      http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+                   --experimental runtime-plugins \
+                   --jvmti
diff --git a/test/930-hello-retransform/src/Main.java b/test/930-hello-retransform/src/Main.java
new file mode 100644
index 0000000..12194c3
--- /dev/null
+++ b/test/930-hello-retransform/src/Main.java
@@ -0,0 +1,70 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+
+  /**
+   * base64 encoded class/dex file for
+   * class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+    "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+  public static void main(String[] args) {
+    System.loadLibrary(args[1]);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi();
+    addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
+    enableCommonRetransformation(true);
+    doCommonClassRetransformation(Transform.class);
+    t.sayHi();
+  }
+
+  // Transforms the class
+  private static native void doCommonClassRetransformation(Class<?>... target);
+  private static native void enableCommonRetransformation(boolean enable);
+  private static native void addCommonTransformationResult(String target_name,
+                                                           byte[] class_bytes,
+                                                           byte[] dex_bytes);
+}
diff --git a/test/930-hello-retransform/src/Transform.java b/test/930-hello-retransform/src/Transform.java
new file mode 100644
index 0000000..8e8af35
--- /dev/null
+++ b/test/930-hello-retransform/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+  public void sayHi() {
+    // Use lower 'h' to make sure the string will have a different string id
+    // than the transformation (the transformation code is the same except
+    // the actual printed String, which was making the test inacurately passing
+    // in JIT mode when loading the string from the dex cache, as the string ids
+    // of the two different strings were the same).
+    // We know the string ids will be different because lexicographically:
+    // "Goodbye" < "LTransform;" < "hello".
+    System.out.println("hello");
+  }
+}
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index e604c93..38b88e4 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -309,6 +309,7 @@
   927-timers \
   928-jni-table \
   929-search \
+  930-hello-retransform \
 
 ifneq (,$(filter target,$(TARGET_TYPES)))
   ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index 2c6d3ed..8799c91 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -18,6 +18,7 @@
 
 #include <stdio.h>
 #include <sstream>
+#include <deque>
 
 #include "art_method.h"
 #include "jni.h"
@@ -60,17 +61,17 @@
   return true;
 }
 
-namespace common_redefine {
 
-static void throwRedefinitionError(jvmtiEnv* jvmti,
-                                   JNIEnv* env,
-                                   jint num_targets,
-                                   jclass* target,
-                                   jvmtiError res) {
+template <bool is_redefine>
+static void throwCommonRedefinitionError(jvmtiEnv* jvmti,
+                                         JNIEnv* env,
+                                         jint num_targets,
+                                         jclass* target,
+                                         jvmtiError res) {
   std::stringstream err;
   char* error = nullptr;
   jvmti->GetErrorName(res, &error);
-  err << "Failed to redefine class";
+  err << "Failed to " << (is_redefine ? "redefine" : "retransform") << " class";
   if (num_targets > 1) {
     err << "es";
   }
@@ -92,6 +93,16 @@
   env->ThrowNew(env->FindClass("java/lang/Exception"), message.c_str());
 }
 
+namespace common_redefine {
+
+static void throwRedefinitionError(jvmtiEnv* jvmti,
+                                   JNIEnv* env,
+                                   jint num_targets,
+                                   jclass* target,
+                                   jvmtiError res) {
+  return throwCommonRedefinitionError<true>(jvmti, env, num_targets, target, res);
+}
+
 static void DoMultiClassRedefine(jvmtiEnv* jvmti_env,
                                  JNIEnv* env,
                                  jint num_redefines,
@@ -161,7 +172,138 @@
                               dex_files.data());
 }
 
-// Don't do anything
+// Get all capabilities except those related to retransformation.
+jint OnLoad(JavaVM* vm,
+            char* options ATTRIBUTE_UNUSED,
+            void* reserved ATTRIBUTE_UNUSED) {
+  if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+    printf("Unable to get jvmti env!\n");
+    return 1;
+  }
+  jvmtiCapabilities caps;
+  jvmti_env->GetPotentialCapabilities(&caps);
+  caps.can_retransform_classes = 0;
+  caps.can_retransform_any_class = 0;
+  jvmti_env->AddCapabilities(&caps);
+  return 0;
+}
+
+}  // namespace common_redefine
+
+namespace common_retransform {
+
+struct CommonTransformationResult {
+  std::vector<unsigned char> class_bytes;
+  std::vector<unsigned char> dex_bytes;
+
+  CommonTransformationResult(size_t class_size, size_t dex_size)
+      : class_bytes(class_size), dex_bytes(dex_size) {}
+
+  CommonTransformationResult() = default;
+  CommonTransformationResult(CommonTransformationResult&&) = default;
+  CommonTransformationResult(CommonTransformationResult&) = default;
+};
+
+// Map from class name to transformation result.
+std::map<std::string, std::deque<CommonTransformationResult>> gTransformations;
+
+extern "C" JNIEXPORT void JNICALL Java_Main_addCommonTransformationResult(JNIEnv* env,
+                                                                          jclass,
+                                                                          jstring class_name,
+                                                                          jbyteArray class_array,
+                                                                          jbyteArray dex_array) {
+  const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
+  std::string name_str(name_chrs);
+  env->ReleaseStringUTFChars(class_name, name_chrs);
+  CommonTransformationResult trans(env->GetArrayLength(class_array),
+                                   env->GetArrayLength(dex_array));
+  if (env->ExceptionOccurred()) {
+    return;
+  }
+  env->GetByteArrayRegion(class_array,
+                          0,
+                          env->GetArrayLength(class_array),
+                          reinterpret_cast<jbyte*>(trans.class_bytes.data()));
+  if (env->ExceptionOccurred()) {
+    return;
+  }
+  env->GetByteArrayRegion(dex_array,
+                          0,
+                          env->GetArrayLength(dex_array),
+                          reinterpret_cast<jbyte*>(trans.dex_bytes.data()));
+  if (env->ExceptionOccurred()) {
+    return;
+  }
+  if (gTransformations.find(name_str) == gTransformations.end()) {
+    std::deque<CommonTransformationResult> list;
+    gTransformations[name_str] = std::move(list);
+  }
+  gTransformations[name_str].push_back(std::move(trans));
+}
+
+// The hook we are using.
+void JNICALL CommonClassFileLoadHookRetransformable(jvmtiEnv* jvmti_env,
+                                                    JNIEnv* jni_env ATTRIBUTE_UNUSED,
+                                                    jclass class_being_redefined ATTRIBUTE_UNUSED,
+                                                    jobject loader ATTRIBUTE_UNUSED,
+                                                    const char* name,
+                                                    jobject protection_domain ATTRIBUTE_UNUSED,
+                                                    jint class_data_len ATTRIBUTE_UNUSED,
+                                                    const unsigned char* class_dat ATTRIBUTE_UNUSED,
+                                                    jint* new_class_data_len,
+                                                    unsigned char** new_class_data) {
+  std::string name_str(name);
+  if (gTransformations.find(name_str) != gTransformations.end()) {
+    CommonTransformationResult& res = gTransformations[name_str][0];
+    const std::vector<unsigned char>& desired_array = IsJVM() ? res.class_bytes : res.dex_bytes;
+    unsigned char* new_data;
+    jvmti_env->Allocate(desired_array.size(), &new_data);
+    memcpy(new_data, desired_array.data(), desired_array.size());
+    *new_class_data = new_data;
+    *new_class_data_len = desired_array.size();
+    gTransformations[name_str].pop_front();
+  }
+}
+
+extern "C" JNIEXPORT void Java_Main_enableCommonRetransformation(JNIEnv* env,
+                                                                 jclass,
+                                                                 jboolean enable) {
+  jvmtiError res = jvmti_env->SetEventNotificationMode(enable ? JVMTI_ENABLE : JVMTI_DISABLE,
+                                                       JVMTI_EVENT_CLASS_FILE_LOAD_HOOK,
+                                                       nullptr);
+  if (res != JVMTI_ERROR_NONE) {
+    JvmtiErrorToException(env, res);
+  }
+}
+
+static void throwRetransformationError(jvmtiEnv* jvmti,
+                                       JNIEnv* env,
+                                       jint num_targets,
+                                       jclass* targets,
+                                       jvmtiError res) {
+  return throwCommonRedefinitionError<false>(jvmti, env, num_targets, targets, res);
+}
+
+static void DoClassRetransformation(jvmtiEnv* jvmti_env, JNIEnv* env, jobjectArray targets) {
+  std::vector<jclass> classes;
+  jint len = env->GetArrayLength(targets);
+  for (jint i = 0; i < len; i++) {
+    classes.push_back(static_cast<jclass>(env->GetObjectArrayElement(targets, i)));
+  }
+  jvmtiError res = jvmti_env->RetransformClasses(len, classes.data());
+  if (res != JVMTI_ERROR_NONE) {
+    throwRetransformationError(jvmti_env, env, len, classes.data(), res);
+  }
+}
+
+// TODO Write something useful.
+extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRetransformation(JNIEnv* env,
+                                                                          jclass,
+                                                                          jobjectArray targets) {
+  DoClassRetransformation(jvmti_env, env, targets);
+}
+
+// Get all capabilities except those related to retransformation.
 jint OnLoad(JavaVM* vm,
             char* options ATTRIBUTE_UNUSED,
             void* reserved ATTRIBUTE_UNUSED) {
@@ -170,9 +312,16 @@
     return 1;
   }
   SetAllCapabilities(jvmti_env);
+  jvmtiEventCallbacks cb;
+  memset(&cb, 0, sizeof(cb));
+  cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
+  if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
+    printf("Unable to set class file load hook cb!\n");
+    return 1;
+  }
   return 0;
 }
 
-}  // namespace common_redefine
+}  // namespace common_retransform
 
 }  // namespace art
diff --git a/test/ti-agent/common_helper.h b/test/ti-agent/common_helper.h
index 642ca03..8599fc4 100644
--- a/test/ti-agent/common_helper.h
+++ b/test/ti-agent/common_helper.h
@@ -27,6 +27,10 @@
 jint OnLoad(JavaVM* vm, char* options, void* reserved);
 
 }  // namespace common_redefine
+namespace common_retransform {
+jint OnLoad(JavaVM* vm, char* options, void* reserved);
+}  // namespace common_retransform
+
 
 extern bool RuntimeIsJVM;
 
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 521e672..1b11442 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -64,8 +64,9 @@
   { "916-obsolete-jit", common_redefine::OnLoad, nullptr },
   { "917-fields-transformation", common_redefine::OnLoad, nullptr },
   { "919-obsolete-fields", common_redefine::OnLoad, nullptr },
-  { "921-hello-failure", common_redefine::OnLoad, nullptr },
+  { "921-hello-failure", common_retransform::OnLoad, nullptr },
   { "926-multi-obsolescence", common_redefine::OnLoad, nullptr },
+  { "930-hello-retransform", common_retransform::OnLoad, nullptr },
 };
 
 static AgentLib* FindAgent(char* name) {