Merge "Revert "Revert "Use interpret-only instead of verify-at-runtime when testing JIT"""
diff --git a/Android.mk b/Android.mk
index b2716cd..cf3a9e7 100644
--- a/Android.mk
+++ b/Android.mk
@@ -435,8 +435,9 @@
# Phony target for only building what go/lem requires on target.
.PHONY: build-art-target-golem
# Also include libartbenchmark, we always include it when running golem.
+# libstdc++ is needed when building for ART_TARGET_LINUX.
ART_TARGET_SHARED_LIBRARY_BENCHMARK := $(TARGET_OUT_SHARED_LIBRARIES)/libartbenchmark.so
-build-art-target-golem: dex2oat dalvikvm patchoat linker \
+build-art-target-golem: dex2oat dalvikvm patchoat linker libstdc++ \
$(TARGET_OUT)/etc/public.libraries.txt \
$(ART_TARGET_DEX_DEPENDENCIES) \
$(ART_TARGET_SHARED_LIBRARY_DEPENDENCIES) \
diff --git a/build/Android.gtest.mk b/build/Android.gtest.mk
index 4fce235..bd7f900 100644
--- a/build/Android.gtest.mk
+++ b/build/Android.gtest.mk
@@ -26,6 +26,8 @@
AbstractMethod \
AllFields \
DexToDexDecompiler \
+ ErroneousA \
+ ErroneousB \
ExceptionHandle \
GetMethodSignature \
ImageLayoutA \
@@ -84,7 +86,9 @@
# Dex file dependencies for each gtest.
ART_GTEST_dex2oat_environment_tests_DEX_DEPS := Main MainStripped MultiDex MultiDexModifiedSecondary Nested
-ART_GTEST_class_linker_test_DEX_DEPS := Interfaces MethodTypes MultiDex MyClass Nested Statics StaticsFromCode
+ART_GTEST_atomic_method_ref_map_test_DEX_DEPS := Interfaces
+ART_GTEST_class_linker_test_DEX_DEPS := ErroneousA ErroneousB Interfaces MethodTypes MultiDex MyClass Nested Statics StaticsFromCode
+ART_GTEST_class_table_test_DEX_DEPS := XandY
ART_GTEST_compiler_driver_test_DEX_DEPS := AbstractMethod StaticLeafMethods ProfileTestMultiDex
ART_GTEST_dex_cache_test_DEX_DEPS := Main Packages MethodTypes
ART_GTEST_dex_file_test_DEX_DEPS := GetMethodSignature Main Nested
@@ -116,10 +120,14 @@
ART_GTEST_dex2oat_environment_tests_HOST_DEPS := \
$(HOST_CORE_IMAGE_optimizing_pic_64) \
$(HOST_CORE_IMAGE_optimizing_pic_32) \
+ $(HOST_CORE_IMAGE_optimizing_no-pic_64) \
+ $(HOST_CORE_IMAGE_optimizing_no-pic_32) \
$(HOST_OUT_EXECUTABLES)/patchoatd
ART_GTEST_dex2oat_environment_tests_TARGET_DEPS := \
$(TARGET_CORE_IMAGE_optimizing_pic_64) \
$(TARGET_CORE_IMAGE_optimizing_pic_32) \
+ $(TARGET_CORE_IMAGE_optimizing_no-pic_64) \
+ $(TARGET_CORE_IMAGE_optimizing_no-pic_32) \
$(TARGET_OUT_EXECUTABLES)/patchoatd
ART_GTEST_oat_file_assistant_test_HOST_DEPS := \
@@ -593,6 +601,7 @@
ART_TEST_TARGET_VALGRIND_GTEST_RULES :=
ART_GTEST_TARGET_ANDROID_ROOT :=
ART_GTEST_class_linker_test_DEX_DEPS :=
+ART_GTEST_class_table_test_DEX_DEPS :=
ART_GTEST_compiler_driver_test_DEX_DEPS :=
ART_GTEST_dex_file_test_DEX_DEPS :=
ART_GTEST_exception_test_DEX_DEPS :=
diff --git a/build/Android.oat.mk b/build/Android.oat.mk
index 3b273a2..e297b4f 100644
--- a/build/Android.oat.mk
+++ b/build/Android.oat.mk
@@ -215,24 +215,9 @@
$(4)TARGET_CORE_IMAGE_$(1)_$(2)_64 := $$(core_image_name)
else
$(4)TARGET_CORE_IMAGE_$(1)_$(2)_32 := $$(core_image_name)
- ifdef ART_USE_VIXL_ARM_BACKEND
- ifeq ($(1),optimizing)
- # TODO(VIXL): The ARM VIXL backend is still work in progress. Therefore for now we do not
- # compile the core image with the Optimizing backend when ART_USE_VIXL_ARM_BACKEND is
- # defined.
- core_compile_options += --compiler-filter=interpret-only
- endif
- endif
endif
else
$(4)TARGET_CORE_IMAGE_$(1)_$(2)_32 := $$(core_image_name)
- ifdef ART_USE_VIXL_ARM_BACKEND
- ifeq ($(1),optimizing)
- # TODO(VIXL): The ARM VIXL backend is still work in progress. Therefore for now we do not
- # compile the core image with the Optimizing backend when ART_USE_VIXL_ARM_BACKEND is defined.
- core_compile_options += --compiler-filter=interpret-only
- endif
- endif
endif
$(4)TARGET_CORE_IMG_OUTS += $$(core_image_name)
$(4)TARGET_CORE_OAT_OUTS += $$(core_oat_name)
diff --git a/build/art.go b/build/art.go
index ccaa11d..0af1767 100644
--- a/build/art.go
+++ b/build/art.go
@@ -259,7 +259,7 @@
}
func artLibrary() (blueprint.Module, []interface{}) {
- library, _ := cc.NewLibrary(android.HostAndDeviceSupported, true, true)
+ library, _ := cc.NewLibrary(android.HostAndDeviceSupported)
module, props := library.Init()
props = installCodegenCustomizer(module, props, true)
diff --git a/cmdline/cmdline.h b/cmdline/cmdline.h
index 6e042c3..f4540ff 100644
--- a/cmdline/cmdline.h
+++ b/cmdline/cmdline.h
@@ -24,10 +24,12 @@
#include <iostream>
#include <string>
-#include "runtime.h"
+#include "android-base/stringprintf.h"
+
+#include "base/logging.h"
#include "base/stringpiece.h"
#include "noop_compiler_callbacks.h"
-#include "base/logging.h"
+#include "runtime.h"
#if !defined(NDEBUG)
#define DBG_LOG LOG(INFO)
@@ -197,7 +199,7 @@
" Example: --boot-image=/system/framework/boot.art\n"
" (specifies /system/framework/<arch>/boot.art as the image file)\n"
"\n";
- usage += StringPrintf( // Optional.
+ usage += android::base::StringPrintf( // Optional.
" --instruction-set=(arm|arm64|mips|mips64|x86|x86_64): for locating the image\n"
" file based on the image location set.\n"
" Example: --instruction-set=x86\n"
@@ -264,8 +266,8 @@
// Check that the boot image location points to a valid file name.
std::string file_name;
if (!LocationToFilename(boot_image_location, instruction_set_, &file_name)) {
- *error_msg = StringPrintf("No corresponding file for location '%s' exists",
- file_name.c_str());
+ *error_msg = android::base::StringPrintf("No corresponding file for location '%s' exists",
+ file_name.c_str());
return false;
}
diff --git a/cmdline/cmdline_types.h b/cmdline/cmdline_types.h
index 156ca9e..e41d9bd 100644
--- a/cmdline/cmdline_types.h
+++ b/cmdline/cmdline_types.h
@@ -22,6 +22,8 @@
#include "detail/cmdline_debug_detail.h"
#include "cmdline_type_parser.h"
+#include "android-base/strings.h"
+
// Includes for the types that are being specialized
#include <string>
#include "base/logging.h"
@@ -447,7 +449,7 @@
}
std::string Join() const {
- return art::Join(list_, Separator);
+ return android::base::Join(list_, Separator);
}
static ParseStringList<Separator> Split(const std::string& str) {
@@ -709,43 +711,43 @@
// The rest of these options are always the wildcard from '-Xps-*'
std::string suffix = RemovePrefix(option);
- if (StartsWith(option, "min-save-period-ms:")) {
+ if (android::base::StartsWith(option, "min-save-period-ms:")) {
CmdlineType<unsigned int> type_parser;
return ParseInto(existing,
&ProfileSaverOptions::min_save_period_ms_,
type_parser.Parse(suffix));
}
- if (StartsWith(option, "save-resolved-classes-delay-ms:")) {
+ if (android::base::StartsWith(option, "save-resolved-classes-delay-ms:")) {
CmdlineType<unsigned int> type_parser;
return ParseInto(existing,
&ProfileSaverOptions::save_resolved_classes_delay_ms_,
type_parser.Parse(suffix));
}
- if (StartsWith(option, "startup-method-samples:")) {
+ if (android::base::StartsWith(option, "startup-method-samples:")) {
CmdlineType<unsigned int> type_parser;
return ParseInto(existing,
&ProfileSaverOptions::startup_method_samples_,
type_parser.Parse(suffix));
}
- if (StartsWith(option, "min-methods-to-save:")) {
+ if (android::base::StartsWith(option, "min-methods-to-save:")) {
CmdlineType<unsigned int> type_parser;
return ParseInto(existing,
&ProfileSaverOptions::min_methods_to_save_,
type_parser.Parse(suffix));
}
- if (StartsWith(option, "min-classes-to-save:")) {
+ if (android::base::StartsWith(option, "min-classes-to-save:")) {
CmdlineType<unsigned int> type_parser;
return ParseInto(existing,
&ProfileSaverOptions::min_classes_to_save_,
type_parser.Parse(suffix));
}
- if (StartsWith(option, "min-notification-before-wake:")) {
+ if (android::base::StartsWith(option, "min-notification-before-wake:")) {
CmdlineType<unsigned int> type_parser;
return ParseInto(existing,
&ProfileSaverOptions::min_notification_before_wake_,
type_parser.Parse(suffix));
}
- if (StartsWith(option, "max-notification-before-wake:")) {
+ if (android::base::StartsWith(option, "max-notification-before-wake:")) {
CmdlineType<unsigned int> type_parser;
return ParseInto(existing,
&ProfileSaverOptions::max_notification_before_wake_,
diff --git a/cmdline/detail/cmdline_parse_argument_detail.h b/cmdline/detail/cmdline_parse_argument_detail.h
index 14eac30..da03c21 100644
--- a/cmdline/detail/cmdline_parse_argument_detail.h
+++ b/cmdline/detail/cmdline_parse_argument_detail.h
@@ -25,6 +25,8 @@
#include <numeric>
#include <memory>
+#include "android-base/strings.h"
+
#include "cmdline_parse_result.h"
#include "cmdline_types.h"
#include "token_range.h"
@@ -399,7 +401,7 @@
allowed_values.push_back(name);
}
- std::string allowed_values_flat = Join(allowed_values, ',');
+ std::string allowed_values_flat = android::base::Join(allowed_values, ',');
return CmdlineResult(CmdlineResult::kFailure,
"Argument value '" + argument + "' does not match any of known valid"
"values: {" + allowed_values_flat + "}");
@@ -426,7 +428,7 @@
allowed_values.push_back(arg_name);
}
- std::string allowed_values_flat = Join(allowed_values, ',');
+ std::string allowed_values_flat = android::base::Join(allowed_values, ',');
return CmdlineResult(CmdlineResult::kFailure,
"Argument value '" + argument + "' does not match any of known valid"
"values: {" + allowed_values_flat + "}");
diff --git a/cmdline/token_range.h b/cmdline/token_range.h
index 3358067..c22d6c8 100644
--- a/cmdline/token_range.h
+++ b/cmdline/token_range.h
@@ -23,6 +23,8 @@
#include <algorithm>
#include <memory>
+#include "android-base/strings.h"
+
namespace art {
// A range of tokens to make token matching algorithms easier.
//
@@ -374,7 +376,7 @@
// e.g. ["hello", "world"].join('$') == "hello$world"
std::string Join(char separator) const {
TokenList tmp(begin(), end());
- return art::Join(tmp, separator);
+ return android::base::Join(tmp, separator);
// TODO: Join should probably take an offset or iterators
}
diff --git a/compiler/Android.bp b/compiler/Android.bp
index e2a450d..2eb6fba 100644
--- a/compiler/Android.bp
+++ b/compiler/Android.bp
@@ -53,6 +53,7 @@
"optimizing/code_generator_utils.cc",
"optimizing/constant_folding.cc",
"optimizing/dead_code_elimination.cc",
+ "optimizing/escape.cc",
"optimizing/graph_checker.cc",
"optimizing/graph_visualizer.cc",
"optimizing/gvn.cc",
@@ -144,6 +145,7 @@
mips64: {
srcs: [
"jni/quick/mips64/calling_convention_mips64.cc",
+ "linker/mips64/relative_patcher_mips64.cc",
"optimizing/code_generator_mips64.cc",
"optimizing/intrinsics_mips64.cc",
"utils/mips64/assembler_mips64.cc",
@@ -254,7 +256,10 @@
},
},
},
- shared_libs: ["libart"],
+ shared_libs: [
+ "libart",
+ "libart-dexlayout",
+ ],
}
art_cc_library {
@@ -291,7 +296,10 @@
},
},
},
- shared_libs: ["libartd"],
+ shared_libs: [
+ "libartd",
+ "libartd-dexlayout"
+ ],
}
art_cc_library {
@@ -342,6 +350,7 @@
"optimizing/ssa_test.cc",
"optimizing/stack_map_test.cc",
"optimizing/suspend_check_test.cc",
+ "utils/atomic_method_ref_map_test.cc",
"utils/dedupe_set_test.cc",
"utils/intrusive_forward_list_test.cc",
"utils/string_reference_test.cc",
@@ -373,6 +382,11 @@
"linker/mips/relative_patcher_mips32r6_test.cc",
],
},
+ mips64: {
+ srcs: [
+ "linker/mips64/relative_patcher_mips64_test.cc",
+ ],
+ },
x86: {
srcs: [
"linker/x86/relative_patcher_x86_test.cc",
diff --git a/compiler/compiled_class.h b/compiler/compiled_class.h
index b88d613..06ce946 100644
--- a/compiler/compiled_class.h
+++ b/compiler/compiled_class.h
@@ -28,8 +28,11 @@
mirror::Class::Status GetStatus() const {
return status_;
}
+ void SetStatus(mirror::Class::Status status) {
+ status_ = status;
+ }
private:
- const mirror::Class::Status status_;
+ mirror::Class::Status status_;
};
} // namespace art
diff --git a/compiler/compiled_method.h b/compiler/compiled_method.h
index 99b0ac1..bbf9eee 100644
--- a/compiler/compiled_method.h
+++ b/compiler/compiled_method.h
@@ -26,6 +26,7 @@
#include "base/array_ref.h"
#include "base/bit_utils.h"
#include "base/length_prefixed_array.h"
+#include "dex_file_types.h"
#include "method_reference.h"
namespace art {
@@ -302,9 +303,9 @@
return target_dex_file_;
}
- uint32_t TargetTypeIndex() const {
+ dex::TypeIndex TargetTypeIndex() const {
DCHECK(patch_type_ == Type::kType || patch_type_ == Type::kTypeRelative);
- return type_idx_;
+ return dex::TypeIndex(type_idx_);
}
const DexFile* TargetStringDexFile() const {
@@ -314,11 +315,11 @@
return target_dex_file_;
}
- uint32_t TargetStringIndex() const {
+ dex::StringIndex TargetStringIndex() const {
DCHECK(patch_type_ == Type::kString ||
patch_type_ == Type::kStringRelative ||
patch_type_ == Type::kStringBssEntry);
- return string_idx_;
+ return dex::StringIndex(string_idx_);
}
const DexFile* TargetDexCacheDexFile() const {
diff --git a/compiler/debug/elf_debug_info_writer.h b/compiler/debug/elf_debug_info_writer.h
index 0a4f094..30d4b47 100644
--- a/compiler/debug/elf_debug_info_writer.h
+++ b/compiler/debug/elf_debug_info_writer.h
@@ -53,7 +53,7 @@
uint32_t parameters_size = DecodeUnsignedLeb128(&stream);
for (uint32_t i = 0; i < parameters_size; ++i) {
uint32_t id = DecodeUnsignedLeb128P1(&stream);
- names.push_back(mi->dex_file->StringDataByIdx(id));
+ names.push_back(mi->dex_file->StringDataByIdx(dex::StringIndex(id)));
}
}
}
diff --git a/compiler/dex/dex_to_dex_compiler.cc b/compiler/dex/dex_to_dex_compiler.cc
index cf69f46..d4f6545 100644
--- a/compiler/dex/dex_to_dex_compiler.cc
+++ b/compiler/dex/dex_to_dex_compiler.cc
@@ -16,6 +16,8 @@
#include "dex_to_dex_compiler.h"
+#include "android-base/stringprintf.h"
+
#include "art_field-inl.h"
#include "art_method-inl.h"
#include "base/logging.h"
@@ -32,6 +34,8 @@
namespace art {
namespace optimizer {
+using android::base::StringPrintf;
+
// Controls quickening activation.
const bool kEnableQuickening = true;
// Control check-cast elision.
diff --git a/compiler/dex/dex_to_dex_decompiler.cc b/compiler/dex/dex_to_dex_decompiler.cc
index 051125e..bfd485d 100644
--- a/compiler/dex/dex_to_dex_decompiler.cc
+++ b/compiler/dex/dex_to_dex_decompiler.cc
@@ -27,10 +27,13 @@
class DexDecompiler {
public:
- DexDecompiler(const DexFile::CodeItem& code_item, const ArrayRef<const uint8_t>& quickened_info)
+ DexDecompiler(const DexFile::CodeItem& code_item,
+ const ArrayRef<const uint8_t>& quickened_info,
+ bool decompile_return_instruction)
: code_item_(code_item),
quickened_info_ptr_(quickened_info.data()),
- quickened_info_end_(quickened_info.data() + quickened_info.size()) {}
+ quickened_info_end_(quickened_info.data() + quickened_info.size()),
+ decompile_return_instruction_(decompile_return_instruction) {}
bool Decompile();
@@ -87,6 +90,7 @@
const DexFile::CodeItem& code_item_;
const uint8_t* quickened_info_ptr_;
const uint8_t* const quickened_info_end_;
+ const bool decompile_return_instruction_;
DISALLOW_COPY_AND_ASSIGN(DexDecompiler);
};
@@ -102,7 +106,9 @@
switch (inst->Opcode()) {
case Instruction::RETURN_VOID_NO_BARRIER:
- inst->SetOpcode(Instruction::RETURN_VOID);
+ if (decompile_return_instruction_) {
+ inst->SetOpcode(Instruction::RETURN_VOID);
+ }
break;
case Instruction::NOP:
@@ -189,8 +195,12 @@
}
bool ArtDecompileDEX(const DexFile::CodeItem& code_item,
- const ArrayRef<const uint8_t>& quickened_info) {
- DexDecompiler decompiler(code_item, quickened_info);
+ const ArrayRef<const uint8_t>& quickened_info,
+ bool decompile_return_instruction) {
+ if (quickened_info.size() == 0 && !decompile_return_instruction) {
+ return true;
+ }
+ DexDecompiler decompiler(code_item, quickened_info, decompile_return_instruction);
return decompiler.Decompile();
}
diff --git a/compiler/dex/dex_to_dex_decompiler.h b/compiler/dex/dex_to_dex_decompiler.h
index 5502ca2..b5d5b91 100644
--- a/compiler/dex/dex_to_dex_decompiler.h
+++ b/compiler/dex/dex_to_dex_decompiler.h
@@ -30,7 +30,8 @@
// consistent with DexToDexCompiler, but we should really change it to
// DexFile::CodeItem*.
bool ArtDecompileDEX(const DexFile::CodeItem& code_item,
- const ArrayRef<const uint8_t>& quickened_data);
+ const ArrayRef<const uint8_t>& quickened_data,
+ bool decompile_return_instruction);
} // namespace optimizer
} // namespace art
diff --git a/compiler/dex/dex_to_dex_decompiler_test.cc b/compiler/dex/dex_to_dex_decompiler_test.cc
index ea6c7a2..9a8d27c 100644
--- a/compiler/dex/dex_to_dex_decompiler_test.cc
+++ b/compiler/dex/dex_to_dex_decompiler_test.cc
@@ -102,7 +102,8 @@
if (compiled_method != nullptr) {
table = compiled_method->GetVmapTable();
}
- optimizer::ArtDecompileDEX(*it.GetMethodCodeItem(), table);
+ optimizer::ArtDecompileDEX(
+ *it.GetMethodCodeItem(), table, /* decompile_return_instruction */ true);
it.Next();
}
while (it.HasNextVirtualMethod()) {
@@ -113,7 +114,8 @@
if (compiled_method != nullptr) {
table = compiled_method->GetVmapTable();
}
- optimizer::ArtDecompileDEX(*it.GetMethodCodeItem(), table);
+ optimizer::ArtDecompileDEX(
+ *it.GetMethodCodeItem(), table, /* decompile_return_instruction */ true);
it.Next();
}
DCHECK(!it.HasNext());
diff --git a/compiler/dex/verification_results.cc b/compiler/dex/verification_results.cc
index 511a787..9d39bf2 100644
--- a/compiler/dex/verification_results.cc
+++ b/compiler/dex/verification_results.cc
@@ -23,6 +23,7 @@
#include "driver/compiler_options.h"
#include "thread.h"
#include "thread-inl.h"
+#include "utils/atomic_method_ref_map-inl.h"
#include "verified_method.h"
#include "verifier/method_verifier-inl.h"
@@ -31,54 +32,88 @@
VerificationResults::VerificationResults(const CompilerOptions* compiler_options)
: compiler_options_(compiler_options),
verified_methods_lock_("compiler verified methods lock"),
- verified_methods_(),
- rejected_classes_lock_("compiler rejected classes lock"),
- rejected_classes_() {
-}
+ rejected_classes_lock_("compiler rejected classes lock") {}
VerificationResults::~VerificationResults() {
- Thread* self = Thread::Current();
- {
- WriterMutexLock mu(self, verified_methods_lock_);
- STLDeleteValues(&verified_methods_);
- }
+ WriterMutexLock mu(Thread::Current(), verified_methods_lock_);
+ STLDeleteValues(&verified_methods_);
+ atomic_verified_methods_.Visit([](const MethodReference& ref ATTRIBUTE_UNUSED,
+ const VerifiedMethod* method) {
+ delete method;
+ });
}
void VerificationResults::ProcessVerifiedMethod(verifier::MethodVerifier* method_verifier) {
DCHECK(method_verifier != nullptr);
MethodReference ref = method_verifier->GetMethodReference();
bool compile = IsCandidateForCompilation(ref, method_verifier->GetAccessFlags());
- const VerifiedMethod* verified_method = VerifiedMethod::Create(method_verifier, compile);
+ std::unique_ptr<const VerifiedMethod> verified_method(
+ VerifiedMethod::Create(method_verifier, compile));
if (verified_method == nullptr) {
// We'll punt this later.
return;
}
-
- WriterMutexLock mu(Thread::Current(), verified_methods_lock_);
- auto it = verified_methods_.find(ref);
- if (it != verified_methods_.end()) {
+ AtomicMap::InsertResult result = atomic_verified_methods_.Insert(ref,
+ /*expected*/ nullptr,
+ verified_method.get());
+ const VerifiedMethod* existing = nullptr;
+ bool inserted;
+ if (result != AtomicMap::kInsertResultInvalidDexFile) {
+ inserted = (result == AtomicMap::kInsertResultSuccess);
+ if (!inserted) {
+ // Rare case.
+ CHECK(atomic_verified_methods_.Get(ref, &existing));
+ CHECK_NE(verified_method.get(), existing);
+ }
+ } else {
+ WriterMutexLock mu(Thread::Current(), verified_methods_lock_);
+ auto it = verified_methods_.find(ref);
+ inserted = it == verified_methods_.end();
+ if (inserted) {
+ verified_methods_.Put(ref, verified_method.get());
+ DCHECK(verified_methods_.find(ref) != verified_methods_.end());
+ } else {
+ existing = it->second;
+ }
+ }
+ if (inserted) {
+ // Successfully added, release the unique_ptr since we no longer have ownership.
+ DCHECK_EQ(GetVerifiedMethod(ref), verified_method.get());
+ verified_method.release();
+ } else {
// TODO: Investigate why are we doing the work again for this method and try to avoid it.
LOG(WARNING) << "Method processed more than once: " << ref.PrettyMethod();
if (!Runtime::Current()->UseJitCompilation()) {
- DCHECK_EQ(it->second->GetDevirtMap().size(), verified_method->GetDevirtMap().size());
- DCHECK_EQ(it->second->GetSafeCastSet().size(), verified_method->GetSafeCastSet().size());
+ DCHECK_EQ(existing->GetDevirtMap().size(), verified_method->GetDevirtMap().size());
+ DCHECK_EQ(existing->GetSafeCastSet().size(), verified_method->GetSafeCastSet().size());
}
- // Delete the new verified method since there was already an existing one registered. It
- // is unsafe to replace the existing one since the JIT may be using it to generate a
- // native GC map.
- delete verified_method;
- return;
+ // Let the unique_ptr delete the new verified method since there was already an existing one
+ // registered. It is unsafe to replace the existing one since the JIT may be using it to
+ // generate a native GC map.
}
- verified_methods_.Put(ref, verified_method);
- DCHECK(verified_methods_.find(ref) != verified_methods_.end());
}
const VerifiedMethod* VerificationResults::GetVerifiedMethod(MethodReference ref) {
+ const VerifiedMethod* ret = nullptr;
+ if (atomic_verified_methods_.Get(ref, &ret)) {
+ return ret;
+ }
ReaderMutexLock mu(Thread::Current(), verified_methods_lock_);
auto it = verified_methods_.find(ref);
return (it != verified_methods_.end()) ? it->second : nullptr;
}
+void VerificationResults::CreateVerifiedMethodFor(MethodReference ref) {
+ // This method should only be called for classes verified at compile time,
+ // which have no verifier error, nor has methods that we know will throw
+ // at runtime.
+ AtomicMap::InsertResult result = atomic_verified_methods_.Insert(
+ ref,
+ /*expected*/ nullptr,
+ new VerifiedMethod(/* encountered_error_types */ 0, /* has_runtime_throw */ false));
+ DCHECK_EQ(result, AtomicMap::kInsertResultSuccess);
+}
+
void VerificationResults::AddRejectedClass(ClassReference ref) {
{
WriterMutexLock mu(Thread::Current(), rejected_classes_lock_);
@@ -105,4 +140,22 @@
return true;
}
+void VerificationResults::AddDexFile(const DexFile* dex_file) {
+ atomic_verified_methods_.AddDexFile(dex_file);
+ WriterMutexLock mu(Thread::Current(), verified_methods_lock_);
+ // There can be some verified methods that are already registered for the dex_file since we set
+ // up well known classes earlier. Remove these and put them in the array so that we don't
+ // accidentally miss seeing them.
+ for (auto it = verified_methods_.begin(); it != verified_methods_.end(); ) {
+ MethodReference ref = it->first;
+ if (ref.dex_file == dex_file) {
+ CHECK(atomic_verified_methods_.Insert(ref, nullptr, it->second) ==
+ AtomicMap::kInsertResultSuccess);
+ it = verified_methods_.erase(it);
+ } else {
+ ++it;
+ }
+ }
+}
+
} // namespace art
diff --git a/compiler/dex/verification_results.h b/compiler/dex/verification_results.h
index 6afd1ab..22749fa 100644
--- a/compiler/dex/verification_results.h
+++ b/compiler/dex/verification_results.h
@@ -19,18 +19,20 @@
#include <stdint.h>
#include <set>
-#include <vector>
+#include "base/dchecked_vector.h"
#include "base/macros.h"
#include "base/mutex.h"
#include "class_reference.h"
#include "method_reference.h"
#include "safe_map.h"
+#include "utils/atomic_method_ref_map.h"
namespace art {
namespace verifier {
class MethodVerifier;
+class VerifierDepsTest;
} // namespace verifier
class CompilerOptions;
@@ -38,35 +40,49 @@
// Used by CompilerCallbacks to track verification information from the Runtime.
class VerificationResults {
- public:
- explicit VerificationResults(const CompilerOptions* compiler_options);
- ~VerificationResults();
+ public:
+ explicit VerificationResults(const CompilerOptions* compiler_options);
+ ~VerificationResults();
- void ProcessVerifiedMethod(verifier::MethodVerifier* method_verifier)
- REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!verified_methods_lock_);
+ void ProcessVerifiedMethod(verifier::MethodVerifier* method_verifier)
+ REQUIRES_SHARED(Locks::mutator_lock_)
+ REQUIRES(!verified_methods_lock_);
- const VerifiedMethod* GetVerifiedMethod(MethodReference ref)
- REQUIRES(!verified_methods_lock_);
+ void CreateVerifiedMethodFor(MethodReference ref)
+ REQUIRES(!verified_methods_lock_);
- void AddRejectedClass(ClassReference ref) REQUIRES(!rejected_classes_lock_);
- bool IsClassRejected(ClassReference ref) REQUIRES(!rejected_classes_lock_);
+ const VerifiedMethod* GetVerifiedMethod(MethodReference ref)
+ REQUIRES(!verified_methods_lock_);
- bool IsCandidateForCompilation(MethodReference& method_ref,
- const uint32_t access_flags);
+ void AddRejectedClass(ClassReference ref) REQUIRES(!rejected_classes_lock_);
+ bool IsClassRejected(ClassReference ref) REQUIRES(!rejected_classes_lock_);
- private:
- const CompilerOptions* const compiler_options_;
+ bool IsCandidateForCompilation(MethodReference& method_ref, const uint32_t access_flags);
- // Verified methods.
- typedef SafeMap<MethodReference, const VerifiedMethod*,
- MethodReferenceComparator> VerifiedMethodMap;
- ReaderWriterMutex verified_methods_lock_ DEFAULT_MUTEX_ACQUIRED_AFTER;
- VerifiedMethodMap verified_methods_ GUARDED_BY(verified_methods_lock_);
+ // Add a dex file to enable using the atomic map.
+ void AddDexFile(const DexFile* dex_file) REQUIRES(!verified_methods_lock_);
- // Rejected classes.
- ReaderWriterMutex rejected_classes_lock_ DEFAULT_MUTEX_ACQUIRED_AFTER;
- std::set<ClassReference> rejected_classes_ GUARDED_BY(rejected_classes_lock_);
+ private:
+ // Verified methods. The method array is fixed to avoid needing a lock to extend it.
+ using AtomicMap = AtomicMethodRefMap<const VerifiedMethod*>;
+ using VerifiedMethodMap = SafeMap<MethodReference,
+ const VerifiedMethod*,
+ MethodReferenceComparator>;
+
+ VerifiedMethodMap verified_methods_ GUARDED_BY(verified_methods_lock_);
+ const CompilerOptions* const compiler_options_;
+
+ // Dex2oat can add dex files to atomic_verified_methods_ to avoid locking when calling
+ // GetVerifiedMethod.
+ AtomicMap atomic_verified_methods_;
+
+ ReaderWriterMutex verified_methods_lock_ DEFAULT_MUTEX_ACQUIRED_AFTER;
+
+ // Rejected classes.
+ ReaderWriterMutex rejected_classes_lock_ DEFAULT_MUTEX_ACQUIRED_AFTER;
+ std::set<ClassReference> rejected_classes_ GUARDED_BY(rejected_classes_lock_);
+
+ friend class verifier::VerifierDepsTest;
};
} // namespace art
diff --git a/compiler/dex/verified_method.cc b/compiler/dex/verified_method.cc
index e19fb7b..a5979cc 100644
--- a/compiler/dex/verified_method.cc
+++ b/compiler/dex/verified_method.cc
@@ -218,35 +218,18 @@
for (; inst < end; inst = inst->Next()) {
Instruction::Code code = inst->Opcode();
- if ((code == Instruction::CHECK_CAST) || (code == Instruction::APUT_OBJECT)) {
+ if (code == Instruction::CHECK_CAST) {
uint32_t dex_pc = inst->GetDexPc(code_item->insns_);
if (!method_verifier->GetInstructionFlags(dex_pc).IsVisited()) {
// Do not attempt to quicken this instruction, it's unreachable anyway.
continue;
}
const verifier::RegisterLine* line = method_verifier->GetRegLine(dex_pc);
- bool is_safe_cast = false;
- if (code == Instruction::CHECK_CAST) {
- const verifier::RegType& reg_type(line->GetRegisterType(method_verifier,
- inst->VRegA_21c()));
- const verifier::RegType& cast_type =
- method_verifier->ResolveCheckedClass(inst->VRegB_21c());
- is_safe_cast = cast_type.IsStrictlyAssignableFrom(reg_type, method_verifier);
- } else {
- const verifier::RegType& array_type(line->GetRegisterType(method_verifier,
- inst->VRegB_23x()));
- // We only know its safe to assign to an array if the array type is precise. For example,
- // an Object[] can have any type of object stored in it, but it may also be assigned a
- // String[] in which case the stores need to be of Strings.
- if (array_type.IsPreciseReference()) {
- const verifier::RegType& value_type(line->GetRegisterType(method_verifier,
- inst->VRegA_23x()));
- const verifier::RegType& component_type = method_verifier->GetRegTypeCache()
- ->GetComponentType(array_type, method_verifier->GetClassLoader());
- is_safe_cast = component_type.IsStrictlyAssignableFrom(value_type, method_verifier);
- }
- }
- if (is_safe_cast) {
+ const verifier::RegType& reg_type(line->GetRegisterType(method_verifier,
+ inst->VRegA_21c()));
+ const verifier::RegType& cast_type =
+ method_verifier->ResolveCheckedClass(dex::TypeIndex(inst->VRegB_21c()));
+ if (cast_type.IsStrictlyAssignableFrom(reg_type, method_verifier)) {
// Verify ordering for push_back() to the sorted vector.
DCHECK(safe_cast_set_.empty() || safe_cast_set_.back() < dex_pc);
safe_cast_set_.push_back(dex_pc);
diff --git a/compiler/dex/verified_method.h b/compiler/dex/verified_method.h
index 04331e5..ce53417 100644
--- a/compiler/dex/verified_method.h
+++ b/compiler/dex/verified_method.h
@@ -32,6 +32,8 @@
class VerifiedMethod {
public:
+ VerifiedMethod(uint32_t encountered_error_types, bool has_runtime_throw);
+
// Cast elision set type.
// Since we're adding the dex PCs to the set in increasing order, a sorted vector
// is better for performance (not just memory usage), especially for large sets.
@@ -80,8 +82,6 @@
}
private:
- VerifiedMethod(uint32_t encountered_error_types, bool has_runtime_throw);
-
/*
* Generate the GC map for a method that has just been verified (i.e. we're doing this as part of
* verification). For type-precise determination we have all the data we need, so we just need to
diff --git a/compiler/driver/compiler_driver-inl.h b/compiler/driver/compiler_driver-inl.h
index 9711516..f056dd3 100644
--- a/compiler/driver/compiler_driver-inl.h
+++ b/compiler/driver/compiler_driver-inl.h
@@ -38,7 +38,7 @@
inline mirror::Class* CompilerDriver::ResolveClass(
const ScopedObjectAccess& soa, Handle<mirror::DexCache> dex_cache,
- Handle<mirror::ClassLoader> class_loader, uint16_t cls_index,
+ Handle<mirror::ClassLoader> class_loader, dex::TypeIndex cls_index,
const DexCompilationUnit* mUnit) {
DCHECK_EQ(dex_cache->GetDexFile(), mUnit->GetDexFile());
DCHECK_EQ(class_loader.Get(), GetClassLoader(soa, mUnit));
@@ -141,7 +141,7 @@
mirror::Class* referrer_class,
ArtMember* resolved_member,
uint16_t member_idx,
- uint32_t* storage_index) {
+ dex::TypeIndex* storage_index) {
DCHECK(resolved_member->IsStatic());
if (LIKELY(referrer_class != nullptr)) {
ObjPtr<mirror::Class> members_class = resolved_member->GetDeclaringClass();
@@ -156,7 +156,7 @@
// TODO: for images we can elide the static storage base null check
// if we know there's a non-null entry in the image
const DexFile* dex_file = dex_cache->GetDexFile();
- uint32_t storage_idx = DexFile::kDexNoIndex;
+ dex::TypeIndex storage_idx(DexFile::kDexNoIndex16);
if (LIKELY(members_class->GetDexCache() == dex_cache)) {
// common case where the dex cache of both the referrer and the member are the same,
// no need to search the dex file
@@ -166,27 +166,27 @@
// of the class mentioned in the dex file and there is no dex cache entry.
storage_idx = resolved_member->GetDeclaringClass()->FindTypeIndexInOtherDexFile(*dex_file);
}
- if (storage_idx != DexFile::kDexNoIndex) {
+ if (storage_idx.IsValid()) {
*storage_index = storage_idx;
return std::make_pair(true, !resolved_member->IsFinal());
}
}
}
// Conservative defaults.
- *storage_index = DexFile::kDexNoIndex;
+ *storage_index = dex::TypeIndex(DexFile::kDexNoIndex16);
return std::make_pair(false, false);
}
inline std::pair<bool, bool> CompilerDriver::IsFastStaticField(
mirror::DexCache* dex_cache, mirror::Class* referrer_class,
- ArtField* resolved_field, uint16_t field_idx, uint32_t* storage_index) {
+ ArtField* resolved_field, uint16_t field_idx, dex::TypeIndex* storage_index) {
return IsClassOfStaticMemberAvailableToReferrer(
dex_cache, referrer_class, resolved_field, field_idx, storage_index);
}
inline bool CompilerDriver::IsClassOfStaticMethodAvailableToReferrer(
mirror::DexCache* dex_cache, mirror::Class* referrer_class,
- ArtMethod* resolved_method, uint16_t method_idx, uint32_t* storage_index) {
+ ArtMethod* resolved_method, uint16_t method_idx, dex::TypeIndex* storage_index) {
std::pair<bool, bool> result = IsClassOfStaticMemberAvailableToReferrer(
dex_cache, referrer_class, resolved_method, method_idx, storage_index);
// Only the first member of `result` is meaningful, as there is no
diff --git a/compiler/driver/compiler_driver.cc b/compiler/driver/compiler_driver.cc
index aa0d10b..ec1642e 100644
--- a/compiler/driver/compiler_driver.cc
+++ b/compiler/driver/compiler_driver.cc
@@ -45,6 +45,7 @@
#include "dex_file-inl.h"
#include "dex_instruction-inl.h"
#include "dex/dex_to_dex_compiler.h"
+#include "dex/dex_to_dex_decompiler.h"
#include "dex/verification_results.h"
#include "dex/verified_method.h"
#include "driver/compiler_options.h"
@@ -70,8 +71,10 @@
#include "thread_pool.h"
#include "trampolines/trampoline_compiler.h"
#include "transaction.h"
+#include "utils/atomic_method_ref_map-inl.h"
#include "utils/dex_cache_arrays_layout-inl.h"
#include "utils/swap_space.h"
+#include "vdex_file.h"
#include "verifier/method_verifier.h"
#include "verifier/method_verifier-inl.h"
#include "verifier/verifier_log_mode.h"
@@ -285,8 +288,6 @@
instruction_set_features_(instruction_set_features),
requires_constructor_barrier_lock_("constructor barrier lock"),
compiled_classes_lock_("compiled classes lock"),
- compiled_methods_lock_("compiled method lock"),
- compiled_methods_(MethodTable::key_compare()),
non_relative_linker_patch_count_(0u),
image_classes_(image_classes),
classes_to_compile_(compiled_classes),
@@ -298,7 +299,7 @@
dump_passes_(dump_passes),
timings_logger_(timer),
compiler_context_(nullptr),
- support_boot_image_fixup_(instruction_set != kMips64),
+ support_boot_image_fixup_(true),
dex_files_for_oat_file_(nullptr),
compiled_method_storage_(swap_fd),
profile_compilation_info_(profile_compilation_info),
@@ -324,12 +325,12 @@
MutexLock mu(self, compiled_classes_lock_);
STLDeleteValues(&compiled_classes_);
}
- {
- MutexLock mu(self, compiled_methods_lock_);
- for (auto& pair : compiled_methods_) {
- CompiledMethod::ReleaseSwapAllocatedCompiledMethod(this, pair.second);
+ compiled_methods_.Visit([this](const MethodReference& ref ATTRIBUTE_UNUSED,
+ CompiledMethod* method) {
+ if (method != nullptr) {
+ CompiledMethod::ReleaseSwapAllocatedCompiledMethod(this, method);
}
- }
+ });
compiler_->UnInit();
}
@@ -394,7 +395,6 @@
void CompilerDriver::CompileAll(jobject class_loader,
const std::vector<const DexFile*>& dex_files,
- verifier::VerifierDeps* verifier_deps,
TimingLogger* timings) {
DCHECK(!Runtime::Current()->IsStarted());
@@ -406,7 +406,7 @@
// 2) Resolve all classes
// 3) Attempt to verify all classes
// 4) Attempt to initialize image classes, and trivially initialized classes
- PreCompile(class_loader, dex_files, verifier_deps, timings);
+ PreCompile(class_loader, dex_files, timings);
if (GetCompilerOptions().IsBootImage()) {
// We don't need to setup the intrinsics for non boot image compilation, as
// those compilations will pick up a boot image that have the ArtMethod already
@@ -423,7 +423,7 @@
// Compile:
// 1) Compile all classes and methods enabled for compilation. May fall back to dex-to-dex
// compilation.
- if (!GetCompilerOptions().VerifyAtRuntime()) {
+ if (!GetCompilerOptions().VerifyAtRuntime() && !GetCompilerOptions().VerifyOnlyProfile()) {
Compile(class_loader, dex_files, timings);
}
if (dump_stats_) {
@@ -433,6 +433,78 @@
FreeThreadPools();
}
+// In-place unquicken the given `dex_files` based on `quickening_info`.
+static void Unquicken(const std::vector<const DexFile*>& dex_files,
+ const ArrayRef<const uint8_t>& quickening_info,
+ bool decompile_return_instruction) {
+ const uint8_t* quickening_info_ptr = quickening_info.data();
+ const uint8_t* const quickening_info_end = quickening_info.data() + quickening_info.size();
+ for (const DexFile* dex_file : dex_files) {
+ for (uint32_t i = 0; i < dex_file->NumClassDefs(); ++i) {
+ const DexFile::ClassDef& class_def = dex_file->GetClassDef(i);
+ const uint8_t* class_data = dex_file->GetClassData(class_def);
+ if (class_data == nullptr) {
+ continue;
+ }
+ ClassDataItemIterator it(*dex_file, class_data);
+ // Skip fields
+ while (it.HasNextStaticField()) {
+ it.Next();
+ }
+ while (it.HasNextInstanceField()) {
+ it.Next();
+ }
+
+ while (it.HasNextDirectMethod()) {
+ const DexFile::CodeItem* code_item = it.GetMethodCodeItem();
+ if (code_item != nullptr) {
+ uint32_t quickening_size = *reinterpret_cast<const uint32_t*>(quickening_info_ptr);
+ quickening_info_ptr += sizeof(uint32_t);
+ optimizer::ArtDecompileDEX(*code_item,
+ ArrayRef<const uint8_t>(quickening_info_ptr, quickening_size),
+ decompile_return_instruction);
+ quickening_info_ptr += quickening_size;
+ }
+ it.Next();
+ }
+
+ while (it.HasNextVirtualMethod()) {
+ const DexFile::CodeItem* code_item = it.GetMethodCodeItem();
+ if (code_item != nullptr) {
+ uint32_t quickening_size = *reinterpret_cast<const uint32_t*>(quickening_info_ptr);
+ quickening_info_ptr += sizeof(uint32_t);
+ optimizer::ArtDecompileDEX(*code_item,
+ ArrayRef<const uint8_t>(quickening_info_ptr, quickening_size),
+ decompile_return_instruction);
+ quickening_info_ptr += quickening_size;
+ }
+ it.Next();
+ }
+ DCHECK(!it.HasNext());
+ }
+ }
+ DCHECK_EQ(quickening_info_ptr, quickening_info_end) << "Failed to use all quickening info";
+}
+
+void CompilerDriver::CompileAll(jobject class_loader,
+ const std::vector<const DexFile*>& dex_files,
+ VdexFile* vdex_file,
+ TimingLogger* timings) {
+ if (vdex_file != nullptr) {
+ // TODO: we unquicken unconditionnally, as we don't know
+ // if the boot image has changed. How exactly we'll know is under
+ // experimentation.
+ TimingLogger::ScopedTiming t("Unquicken", timings);
+ // We do not decompile a RETURN_VOID_NO_BARRIER into a RETURN_VOID, as the quickening
+ // optimization does not depend on the boot image (the optimization relies on not
+ // having final fields in a class, which does not change for an app).
+ Unquicken(dex_files, vdex_file->GetQuickeningInfo(), /* decompile_return_instruction */ false);
+ Runtime::Current()->GetCompilerCallbacks()->SetVerifierDeps(
+ new verifier::VerifierDeps(dex_files, vdex_file->GetVerifierDepsData()));
+ }
+ CompileAll(class_loader, dex_files, timings);
+}
+
static optimizer::DexToDexCompilationLevel GetDexToDexCompilationLevel(
Thread* self, const CompilerDriver& driver, Handle<mirror::ClassLoader> class_loader,
const DexFile& dex_file, const DexFile::ClassDef& class_def)
@@ -508,8 +580,7 @@
const DexFile& dex_file,
optimizer::DexToDexCompilationLevel dex_to_dex_compilation_level,
bool compilation_enabled,
- Handle<mirror::DexCache> dex_cache)
- REQUIRES(!driver->compiled_methods_lock_) {
+ Handle<mirror::DexCache> dex_cache) {
DCHECK(driver != nullptr);
CompiledMethod* compiled_method = nullptr;
uint64_t start_ns = kTimeCompileMethod ? NanoTime() : 0;
@@ -673,7 +744,7 @@
InitializeThreadPools();
- PreCompile(jclass_loader, dex_files, /* verifier_deps */ nullptr, timings);
+ PreCompile(jclass_loader, dex_files, timings);
// Can we run DEX-to-DEX compiler on this class ?
optimizer::DexToDexCompilationLevel dex_to_dex_compilation_level =
@@ -775,9 +846,9 @@
switch (inst->Opcode()) {
case Instruction::CONST_STRING:
case Instruction::CONST_STRING_JUMBO: {
- uint32_t string_index = (inst->Opcode() == Instruction::CONST_STRING)
+ dex::StringIndex string_index((inst->Opcode() == Instruction::CONST_STRING)
? inst->VRegB_21c()
- : inst->VRegB_31c();
+ : inst->VRegB_31c());
mirror::String* string = class_linker->ResolveString(dex_file, string_index, dex_cache);
CHECK(string != nullptr) << "Could not allocate a string when forcing determinism";
break;
@@ -870,10 +941,16 @@
void CompilerDriver::PreCompile(jobject class_loader,
const std::vector<const DexFile*>& dex_files,
- verifier::VerifierDeps* verifier_deps,
TimingLogger* timings) {
CheckThreadPools();
+ for (const DexFile* dex_file : dex_files) {
+ // Can be already inserted if the caller is CompileOne. This happens for gtests.
+ if (!compiled_methods_.HaveDexFile(dex_file)) {
+ compiled_methods_.AddDexFile(dex_file);
+ }
+ }
+
LoadImageClasses(timings);
VLOG(compiler) << "LoadImageClasses: " << GetMemoryUsageString(false);
@@ -904,7 +981,7 @@
VLOG(compiler) << "Resolve const-strings: " << GetMemoryUsageString(false);
}
- Verify(class_loader, dex_files, verifier_deps, timings);
+ Verify(class_loader, dex_files, timings);
VLOG(compiler) << "Verify: " << GetMemoryUsageString(false);
if (had_hard_verifier_failure_ && GetCompilerOptions().AbortOnHardVerifierFailure()) {
@@ -912,8 +989,10 @@
<< "situations. Please check the log.";
}
- InitializeClasses(class_loader, dex_files, timings);
- VLOG(compiler) << "InitializeClasses: " << GetMemoryUsageString(false);
+ if (!verify_only_profile) {
+ InitializeClasses(class_loader, dex_files, timings);
+ VLOG(compiler) << "InitializeClasses: " << GetMemoryUsageString(false);
+ }
UpdateImageClasses(timings);
VLOG(compiler) << "UpdateImageClasses: " << GetMemoryUsageString(false);
@@ -969,7 +1048,7 @@
}
DCHECK(profile_compilation_info_ != nullptr);
const DexFile::ClassDef& class_def = dex_file.GetClassDef(class_idx);
- uint16_t type_idx = class_def.class_idx_;
+ dex::TypeIndex type_idx = class_def.class_idx_;
bool result = profile_compilation_info_->ContainsClass(dex_file, type_idx);
if (kDebugProfileGuidedCompilation) {
LOG(INFO) << "[ProfileGuidedCompilation] " << (result ? "Verified" : "Skipped") << " method:"
@@ -981,7 +1060,7 @@
class ResolveCatchBlockExceptionsClassVisitor : public ClassVisitor {
public:
explicit ResolveCatchBlockExceptionsClassVisitor(
- std::set<std::pair<uint16_t, const DexFile*>>& exceptions_to_resolve)
+ std::set<std::pair<dex::TypeIndex, const DexFile*>>& exceptions_to_resolve)
: exceptions_to_resolve_(exceptions_to_resolve) {}
virtual bool operator()(ObjPtr<mirror::Class> c) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
@@ -1012,8 +1091,8 @@
has_catch_all = true;
}
for (int32_t j = 0; j < encoded_catch_handler_size; j++) {
- uint16_t encoded_catch_handler_handlers_type_idx =
- DecodeUnsignedLeb128(&encoded_catch_handler_list);
+ dex::TypeIndex encoded_catch_handler_handlers_type_idx =
+ dex::TypeIndex(DecodeUnsignedLeb128(&encoded_catch_handler_list));
// Add to set of types to resolve if not already in the dex cache resolved types
if (!method_handle->IsResolvedTypeIdx(encoded_catch_handler_handlers_type_idx,
pointer_size)) {
@@ -1030,7 +1109,7 @@
}
}
- std::set<std::pair<uint16_t, const DexFile*>>& exceptions_to_resolve_;
+ std::set<std::pair<dex::TypeIndex, const DexFile*>>& exceptions_to_resolve_;
};
class RecordImageClassesVisitor : public ClassVisitor {
@@ -1078,7 +1157,7 @@
// Resolve exception classes referenced by the loaded classes. The catch logic assumes
// exceptions are resolved by the verifier when there is a catch block in an interested method.
// Do this here so that exception classes appear to have been specified image classes.
- std::set<std::pair<uint16_t, const DexFile*>> unresolved_exception_types;
+ std::set<std::pair<dex::TypeIndex, const DexFile*>> unresolved_exception_types;
StackHandleScope<1> hs(self);
Handle<mirror::Class> java_lang_Throwable(
hs.NewHandle(class_linker->FindSystemClass(self, "Ljava/lang/Throwable;")));
@@ -1086,8 +1165,8 @@
unresolved_exception_types.clear();
ResolveCatchBlockExceptionsClassVisitor visitor(unresolved_exception_types);
class_linker->VisitClasses(&visitor);
- for (const std::pair<uint16_t, const DexFile*>& exception_type : unresolved_exception_types) {
- uint16_t exception_type_idx = exception_type.first;
+ for (const auto& exception_type : unresolved_exception_types) {
+ dex::TypeIndex exception_type_idx = exception_type.first;
const DexFile* dex_file = exception_type.second;
StackHandleScope<2> hs2(self);
Handle<mirror::DexCache> dex_cache(hs2.NewHandle(class_linker->RegisterDexFile(*dex_file,
@@ -1117,13 +1196,12 @@
CHECK_NE(image_classes_->size(), 0U);
}
-static void MaybeAddToImageClasses(Handle<mirror::Class> c,
+static void MaybeAddToImageClasses(Thread* self,
+ ObjPtr<mirror::Class> klass,
std::unordered_set<std::string>* image_classes)
REQUIRES_SHARED(Locks::mutator_lock_) {
- Thread* self = Thread::Current();
+ DCHECK_EQ(self, Thread::Current());
StackHandleScope<1> hs(self);
- // Make a copy of the handle so that we don't clobber it doing Assign.
- MutableHandle<mirror::Class> klass(hs.NewHandle(c.Get()));
std::string temp;
const PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
while (!klass->IsObjectClass()) {
@@ -1134,19 +1212,16 @@
break;
}
VLOG(compiler) << "Adding " << descriptor << " to image classes";
- for (size_t i = 0; i < klass->NumDirectInterfaces(); ++i) {
- StackHandleScope<1> hs2(self);
- // May cause thread suspension.
- MaybeAddToImageClasses(hs2.NewHandle(mirror::Class::GetDirectInterface(self, klass, i)),
- image_classes);
+ for (size_t i = 0, num_interfaces = klass->NumDirectInterfaces(); i != num_interfaces; ++i) {
+ ObjPtr<mirror::Class> interface = mirror::Class::GetDirectInterface(self, klass, i);
+ DCHECK(interface != nullptr);
+ MaybeAddToImageClasses(self, interface, image_classes);
}
- for (auto& m : c->GetVirtualMethods(pointer_size)) {
- StackHandleScope<1> hs2(self);
- MaybeAddToImageClasses(hs2.NewHandle(m.GetDeclaringClass()), image_classes);
+ for (auto& m : klass->GetVirtualMethods(pointer_size)) {
+ MaybeAddToImageClasses(self, m.GetDeclaringClass(), image_classes);
}
if (klass->IsArrayClass()) {
- StackHandleScope<1> hs2(self);
- MaybeAddToImageClasses(hs2.NewHandle(klass->GetComponentType()), image_classes);
+ MaybeAddToImageClasses(self, klass->GetComponentType(), image_classes);
}
klass.Assign(klass->GetSuperClass());
}
@@ -1197,8 +1272,10 @@
for (Handle<mirror::Class> klass_root : image_classes_) {
VisitClinitClassesObject(klass_root.Get());
}
+ Thread* self = Thread::Current();
+ ScopedAssertNoThreadSuspension ants(__FUNCTION__);
for (Handle<mirror::Class> h_klass : to_insert_) {
- MaybeAddToImageClasses(h_klass, image_class_descriptors_);
+ MaybeAddToImageClasses(self, h_klass.Get(), image_class_descriptors_);
}
}
@@ -1338,7 +1415,7 @@
bool CompilerDriver::CanAccessTypeWithoutChecks(uint32_t referrer_idx,
Handle<mirror::DexCache> dex_cache,
- uint32_t type_idx) {
+ dex::TypeIndex type_idx) {
// Get type from dex cache assuming it was populated by the verifier
mirror::Class* resolved_class = dex_cache->GetResolvedType(type_idx);
if (resolved_class == nullptr) {
@@ -1367,7 +1444,7 @@
bool CompilerDriver::CanAccessInstantiableTypeWithoutChecks(uint32_t referrer_idx,
Handle<mirror::DexCache> dex_cache,
- uint32_t type_idx,
+ dex::TypeIndex type_idx,
bool* finalizable) {
// Get type from dex cache assuming it was populated by the verifier.
mirror::Class* resolved_class = dex_cache->GetResolvedType(type_idx);
@@ -1861,7 +1938,7 @@
public:
explicit ResolveTypeVisitor(const ParallelCompilationManager* manager) : manager_(manager) {
}
- virtual void Visit(size_t type_idx) OVERRIDE REQUIRES(!Locks::mutator_lock_) {
+ void Visit(size_t type_idx) OVERRIDE REQUIRES(!Locks::mutator_lock_) {
// Class derived values are more complicated, they require the linker and loader.
ScopedObjectAccess soa(Thread::Current());
ClassLinker* class_linker = manager_->GetClassLinker();
@@ -1872,7 +1949,10 @@
Handle<mirror::DexCache> dex_cache(hs.NewHandle(class_linker->RegisterDexFile(
dex_file,
class_loader.Get())));
- mirror::Class* klass = class_linker->ResolveType(dex_file, type_idx, dex_cache, class_loader);
+ mirror::Class* klass = class_linker->ResolveType(dex_file,
+ dex::TypeIndex(type_idx),
+ dex_cache,
+ class_loader);
if (klass == nullptr) {
soa.Self()->AssertPendingException();
@@ -1931,10 +2011,41 @@
}
}
+static void PopulateVerifiedMethods(const DexFile& dex_file,
+ uint32_t class_def_index,
+ VerificationResults* verification_results) {
+ const DexFile::ClassDef& class_def = dex_file.GetClassDef(class_def_index);
+ const uint8_t* class_data = dex_file.GetClassData(class_def);
+ if (class_data == nullptr) {
+ return;
+ }
+ ClassDataItemIterator it(dex_file, class_data);
+ // Skip fields
+ while (it.HasNextStaticField()) {
+ it.Next();
+ }
+ while (it.HasNextInstanceField()) {
+ it.Next();
+ }
+
+ while (it.HasNextDirectMethod()) {
+ verification_results->CreateVerifiedMethodFor(MethodReference(&dex_file, it.GetMemberIndex()));
+ it.Next();
+ }
+
+ while (it.HasNextVirtualMethod()) {
+ verification_results->CreateVerifiedMethodFor(MethodReference(&dex_file, it.GetMemberIndex()));
+ it.Next();
+ }
+ DCHECK(!it.HasNext());
+}
+
void CompilerDriver::Verify(jobject jclass_loader,
const std::vector<const DexFile*>& dex_files,
- verifier::VerifierDeps* verifier_deps,
TimingLogger* timings) {
+ verifier::VerifierDeps* verifier_deps =
+ Runtime::Current()->GetCompilerCallbacks()->GetVerifierDeps();
+ // If there is an existing `VerifierDeps`, try to use it for fast verification.
if (verifier_deps != nullptr) {
TimingLogger::ScopedTiming t("Fast Verify", timings);
ScopedObjectAccess soa(Thread::Current());
@@ -1952,19 +2063,37 @@
for (const DexFile* dex_file : dex_files) {
// Fetch the list of unverified classes and turn it into a set for faster
// lookups.
- const std::vector<uint16_t>& unverified_classes =
+ const std::vector<dex::TypeIndex>& unverified_classes =
verifier_deps->GetUnverifiedClasses(*dex_file);
- std::set<uint16_t> set(unverified_classes.begin(), unverified_classes.end());
+ std::set<dex::TypeIndex> set(unverified_classes.begin(), unverified_classes.end());
for (uint32_t i = 0; i < dex_file->NumClassDefs(); ++i) {
const DexFile::ClassDef& class_def = dex_file->GetClassDef(i);
- const char* descriptor = dex_file->GetClassDescriptor(class_def);
- cls.Assign(class_linker->FindClass(soa.Self(), descriptor, class_loader));
- if (cls.Get() == nullptr) {
- CHECK(soa.Self()->IsExceptionPending());
- soa.Self()->ClearException();
- } else if (set.find(class_def.class_idx_) == set.end()) {
- ObjectLock<mirror::Class> lock(soa.Self(), cls);
- mirror::Class::SetStatus(cls, mirror::Class::kStatusVerified, soa.Self());
+ if (set.find(class_def.class_idx_) == set.end()) {
+ if (GetCompilerOptions().VerifyOnlyProfile()) {
+ // Just update the compiled_classes_ map. The compiler doesn't need to resolve
+ // the type.
+ compiled_classes_.Overwrite(
+ ClassReference(dex_file, i), new CompiledClass(mirror::Class::kStatusVerified));
+ } else {
+ // Resolve the type, so later compilation stages know they don't need to verify
+ // the class.
+ const char* descriptor = dex_file->GetClassDescriptor(class_def);
+ cls.Assign(class_linker->FindClass(soa.Self(), descriptor, class_loader));
+ if (cls.Get() != nullptr) {
+ ObjectLock<mirror::Class> lock(soa.Self(), cls);
+ mirror::Class::SetStatus(cls, mirror::Class::kStatusVerified, soa.Self());
+ } else {
+ DCHECK(soa.Self()->IsExceptionPending());
+ soa.Self()->ClearException();
+ }
+ // Create `VerifiedMethod`s for each methods, the compiler expects one for
+ // quickening or compiling.
+ // Note that this means:
+ // - We're only going to compile methods that did verify.
+ // - Quickening will not do checkcast ellision.
+ // TODO(ngeoffray): Reconsider this once we refactor compiler filters.
+ PopulateVerifiedMethods(*dex_file, i, verification_results_);
+ }
}
}
}
@@ -1972,13 +2101,20 @@
}
}
- // If there is no passed `verifier_deps` (because of non-existing vdex), or
- // the passed `verifier_deps` is not valid anymore, create a new one for
+ // If there is no existing `verifier_deps` (because of non-existing vdex), or
+ // the existing `verifier_deps` is not valid anymore, create a new one for
// non boot image compilation. The verifier will need it to record the new dependencies.
// Then dex2oat can update the vdex file with these new dependencies.
if (!GetCompilerOptions().IsBootImage()) {
- Runtime::Current()->GetCompilerCallbacks()->SetVerifierDeps(
- new verifier::VerifierDeps(dex_files));
+ // Create the main VerifierDeps, and set it to this thread.
+ verifier_deps = new verifier::VerifierDeps(dex_files);
+ Runtime::Current()->GetCompilerCallbacks()->SetVerifierDeps(verifier_deps);
+ Thread::Current()->SetVerifierDeps(verifier_deps);
+ // Create per-thread VerifierDeps to avoid contention on the main one.
+ // We will merge them after verification.
+ for (ThreadPoolWorker* worker : parallel_thread_pool_->GetWorkers()) {
+ worker->GetThread()->SetVerifierDeps(new verifier::VerifierDeps(dex_files));
+ }
}
// Note: verification should not be pulling in classes anymore when compiling the boot image,
// as all should have been resolved before. As such, doing this in parallel should still
@@ -1992,6 +2128,17 @@
parallel_thread_count_,
timings);
}
+
+ if (!GetCompilerOptions().IsBootImage()) {
+ // Merge all VerifierDeps into the main one.
+ for (ThreadPoolWorker* worker : parallel_thread_pool_->GetWorkers()) {
+ verifier::VerifierDeps* thread_deps = worker->GetThread()->GetVerifierDeps();
+ worker->GetThread()->SetVerifierDeps(nullptr);
+ verifier_deps->MergeWith(*thread_deps, dex_files);;
+ delete thread_deps;
+ }
+ Thread::Current()->SetVerifierDeps(nullptr);
+ }
}
class VerifyClassVisitor : public CompilationVisitor {
@@ -2527,30 +2674,15 @@
size_t non_relative_linker_patch_count) {
DCHECK(GetCompiledMethod(method_ref) == nullptr)
<< method_ref.dex_file->PrettyMethod(method_ref.dex_method_index);
- {
- MutexLock mu(Thread::Current(), compiled_methods_lock_);
- compiled_methods_.Put(method_ref, compiled_method);
- non_relative_linker_patch_count_ += non_relative_linker_patch_count;
- }
+ MethodTable::InsertResult result = compiled_methods_.Insert(method_ref,
+ /*expected*/ nullptr,
+ compiled_method);
+ CHECK(result == MethodTable::kInsertResultSuccess);
+ non_relative_linker_patch_count_.FetchAndAddRelaxed(non_relative_linker_patch_count);
DCHECK(GetCompiledMethod(method_ref) != nullptr)
<< method_ref.dex_file->PrettyMethod(method_ref.dex_method_index);
}
-void CompilerDriver::RemoveCompiledMethod(const MethodReference& method_ref) {
- CompiledMethod* compiled_method = nullptr;
- {
- MutexLock mu(Thread::Current(), compiled_methods_lock_);
- auto it = compiled_methods_.find(method_ref);
- if (it != compiled_methods_.end()) {
- compiled_method = it->second;
- compiled_methods_.erase(it);
- }
- }
- if (compiled_method != nullptr) {
- CompiledMethod::ReleaseSwapAllocatedCompiledMethod(this, compiled_method);
- }
-}
-
CompiledClass* CompilerDriver::GetCompiledClass(ClassReference ref) const {
MutexLock mu(Thread::Current(), compiled_classes_lock_);
ClassTable::const_iterator it = compiled_classes_.find(ref);
@@ -2562,40 +2694,36 @@
}
void CompilerDriver::RecordClassStatus(ClassReference ref, mirror::Class::Status status) {
+ switch (status) {
+ case mirror::Class::kStatusNotReady:
+ case mirror::Class::kStatusError:
+ case mirror::Class::kStatusRetryVerificationAtRuntime:
+ case mirror::Class::kStatusVerified:
+ case mirror::Class::kStatusInitialized:
+ case mirror::Class::kStatusResolved:
+ break; // Expected states.
+ default:
+ LOG(FATAL) << "Unexpected class status for class "
+ << PrettyDescriptor(ref.first->GetClassDescriptor(ref.first->GetClassDef(ref.second)))
+ << " of " << status;
+ }
+
MutexLock mu(Thread::Current(), compiled_classes_lock_);
auto it = compiled_classes_.find(ref);
- if (it == compiled_classes_.end() || it->second->GetStatus() != status) {
- // An entry doesn't exist or the status is lower than the new status.
- if (it != compiled_classes_.end()) {
- CHECK_GT(status, it->second->GetStatus());
- delete it->second;
- }
- switch (status) {
- case mirror::Class::kStatusNotReady:
- case mirror::Class::kStatusError:
- case mirror::Class::kStatusRetryVerificationAtRuntime:
- case mirror::Class::kStatusVerified:
- case mirror::Class::kStatusInitialized:
- case mirror::Class::kStatusResolved:
- break; // Expected states.
- default:
- LOG(FATAL) << "Unexpected class status for class "
- << PrettyDescriptor(ref.first->GetClassDescriptor(ref.first->GetClassDef(ref.second)))
- << " of " << status;
- }
+ if (it == compiled_classes_.end()) {
CompiledClass* compiled_class = new CompiledClass(status);
compiled_classes_.Overwrite(ref, compiled_class);
+ } else if (status > it->second->GetStatus()) {
+ // Update the status if we now have a greater one. This happens with vdex,
+ // which records a class is verified, but does not resolve it.
+ it->second->SetStatus(status);
}
}
CompiledMethod* CompilerDriver::GetCompiledMethod(MethodReference ref) const {
- MutexLock mu(Thread::Current(), compiled_methods_lock_);
- MethodTable::const_iterator it = compiled_methods_.find(ref);
- if (it == compiled_methods_.end()) {
- return nullptr;
- }
- CHECK(it->second != nullptr);
- return it->second;
+ CompiledMethod* compiled_method = nullptr;
+ compiled_methods_.Get(ref, &compiled_method);
+ return compiled_method;
}
bool CompilerDriver::IsMethodVerifiedWithoutFailures(uint32_t method_idx,
@@ -2624,8 +2752,7 @@
}
size_t CompilerDriver::GetNonRelativeLinkerPatchCount() const {
- MutexLock mu(Thread::Current(), compiled_methods_lock_);
- return non_relative_linker_patch_count_;
+ return non_relative_linker_patch_count_.LoadRelaxed();
}
void CompilerDriver::SetRequiresConstructorBarrier(Thread* self,
diff --git a/compiler/driver/compiler_driver.h b/compiler/driver/compiler_driver.h
index 1bd3546..eb69931 100644
--- a/compiler/driver/compiler_driver.h
+++ b/compiler/driver/compiler_driver.h
@@ -31,6 +31,7 @@
#include "class_reference.h"
#include "compiler.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "driver/compiled_method_storage.h"
#include "jit/offline_profiling_info.h"
#include "invoke_type.h"
@@ -40,6 +41,7 @@
#include "runtime.h"
#include "safe_map.h"
#include "thread_pool.h"
+#include "utils/atomic_method_ref_map.h"
#include "utils/dex_cache_arrays_layout.h"
namespace art {
@@ -50,7 +52,6 @@
namespace verifier {
class MethodVerifier;
-class VerifierDeps;
class VerifierDepsTest;
} // namespace verifier
@@ -68,6 +69,7 @@
using SwapSrcMap = SrcMap<SwapAllocator<SrcMapElem>>;
template<class T> class Handle;
class TimingLogger;
+class VdexFile;
class VerificationResults;
class VerifiedMethod;
@@ -118,14 +120,19 @@
void CompileAll(jobject class_loader,
const std::vector<const DexFile*>& dex_files,
- verifier::VerifierDeps* verifier_deps,
+ TimingLogger* timings)
+ REQUIRES(!Locks::mutator_lock_, !compiled_classes_lock_, !dex_to_dex_references_lock_);
+
+ void CompileAll(jobject class_loader,
+ const std::vector<const DexFile*>& dex_files,
+ VdexFile* vdex_file,
TimingLogger* timings)
REQUIRES(!Locks::mutator_lock_, !compiled_classes_lock_, !dex_to_dex_references_lock_);
// Compile a single Method.
void CompileOne(Thread* self, ArtMethod* method, TimingLogger* timings)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!compiled_methods_lock_, !compiled_classes_lock_, !dex_to_dex_references_lock_);
+ REQUIRES(!compiled_classes_lock_, !dex_to_dex_references_lock_);
VerificationResults* GetVerificationResults() const {
DCHECK(Runtime::Current()->IsAotCompiler());
@@ -162,18 +169,12 @@
CompiledClass* GetCompiledClass(ClassReference ref) const
REQUIRES(!compiled_classes_lock_);
- CompiledMethod* GetCompiledMethod(MethodReference ref) const
- REQUIRES(!compiled_methods_lock_);
- size_t GetNonRelativeLinkerPatchCount() const
- REQUIRES(!compiled_methods_lock_);
-
+ CompiledMethod* GetCompiledMethod(MethodReference ref) const;
+ size_t GetNonRelativeLinkerPatchCount() const;
// Add a compiled method.
void AddCompiledMethod(const MethodReference& method_ref,
CompiledMethod* const compiled_method,
- size_t non_relative_linker_patch_count)
- REQUIRES(!compiled_methods_lock_);
- // Remove and delete a compiled method.
- void RemoveCompiledMethod(const MethodReference& method_ref) REQUIRES(!compiled_methods_lock_);
+ size_t non_relative_linker_patch_count);
void SetRequiresConstructorBarrier(Thread* self,
const DexFile* dex_file,
@@ -188,14 +189,14 @@
// Are runtime access checks necessary in the compiled code?
bool CanAccessTypeWithoutChecks(uint32_t referrer_idx,
Handle<mirror::DexCache> dex_cache,
- uint32_t type_idx)
+ dex::TypeIndex type_idx)
REQUIRES_SHARED(Locks::mutator_lock_);
// Are runtime access and instantiable checks necessary in the code?
// out_is_finalizable is set to whether the type is finalizable.
bool CanAccessInstantiableTypeWithoutChecks(uint32_t referrer_idx,
Handle<mirror::DexCache> dex_cache,
- uint32_t type_idx,
+ dex::TypeIndex type_idx,
bool* out_is_finalizable)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -207,7 +208,7 @@
mirror::Class* ResolveClass(
const ScopedObjectAccess& soa, Handle<mirror::DexCache> dex_cache,
- Handle<mirror::ClassLoader> class_loader, uint16_t type_index,
+ Handle<mirror::ClassLoader> class_loader, dex::TypeIndex type_index,
const DexCompilationUnit* mUnit)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -234,9 +235,11 @@
// Can we fast-path an SGET/SPUT access to a static field? If yes, compute the type index
// of the declaring class in the referrer's dex file.
- std::pair<bool, bool> IsFastStaticField(
- mirror::DexCache* dex_cache, mirror::Class* referrer_class,
- ArtField* resolved_field, uint16_t field_idx, uint32_t* storage_index)
+ std::pair<bool, bool> IsFastStaticField(mirror::DexCache* dex_cache,
+ mirror::Class* referrer_class,
+ ArtField* resolved_field,
+ uint16_t field_idx,
+ dex::TypeIndex* storage_index)
REQUIRES_SHARED(Locks::mutator_lock_);
// Return whether the declaring class of `resolved_method` is
@@ -248,7 +251,7 @@
mirror::Class* referrer_class,
ArtMethod* resolved_method,
uint16_t method_idx,
- uint32_t* storage_index)
+ dex::TypeIndex* storage_index)
REQUIRES_SHARED(Locks::mutator_lock_);
// Resolve a method. Returns null on failure, including incompatible class change.
@@ -395,7 +398,7 @@
mirror::Class* referrer_class,
ArtMember* resolved_member,
uint16_t member_idx,
- uint32_t* storage_index)
+ dex::TypeIndex* storage_index)
REQUIRES_SHARED(Locks::mutator_lock_);
// Can `referrer_class` access the resolved `member`?
@@ -417,7 +420,6 @@
private:
void PreCompile(jobject class_loader,
const std::vector<const DexFile*>& dex_files,
- verifier::VerifierDeps* verifier_deps,
TimingLogger* timings)
REQUIRES(!Locks::mutator_lock_, !compiled_classes_lock_);
@@ -438,10 +440,12 @@
TimingLogger* timings)
REQUIRES(!Locks::mutator_lock_);
+ // NO_THREAD_SAFETY_ANALYSIS as the method accesses a guarded value in a
+ // single-threaded way.
void Verify(jobject class_loader,
const std::vector<const DexFile*>& dex_files,
- verifier::VerifierDeps* verifier_deps,
- TimingLogger* timings);
+ TimingLogger* timings)
+ NO_THREAD_SAFETY_ANALYSIS;
void VerifyDexFile(jobject class_loader,
const DexFile& dex_file,
@@ -513,18 +517,15 @@
mutable Mutex compiled_classes_lock_ DEFAULT_MUTEX_ACQUIRED_AFTER;
ClassTable compiled_classes_ GUARDED_BY(compiled_classes_lock_);
- typedef SafeMap<const MethodReference, CompiledMethod*, MethodReferenceComparator> MethodTable;
-
- public:
- // Lock is public so that non-members can have lock annotations.
- mutable Mutex compiled_methods_lock_ DEFAULT_MUTEX_ACQUIRED_AFTER;
+ typedef AtomicMethodRefMap<CompiledMethod*> MethodTable;
private:
// All method references that this compiler has compiled.
- MethodTable compiled_methods_ GUARDED_BY(compiled_methods_lock_);
+ MethodTable compiled_methods_;
+
// Number of non-relative patches in all compiled methods. These patches need space
// in the .oat_patches ELF section if requested in the compiler options.
- size_t non_relative_linker_patch_count_ GUARDED_BY(compiled_methods_lock_);
+ Atomic<size_t> non_relative_linker_patch_count_;
// If image_ is true, specifies the classes that will be included in the image.
// Note if image_classes_ is null, all classes are included in the image.
diff --git a/compiler/driver/compiler_driver_test.cc b/compiler/driver/compiler_driver_test.cc
index 9679a79..12684c0 100644
--- a/compiler/driver/compiler_driver_test.cc
+++ b/compiler/driver/compiler_driver_test.cc
@@ -24,6 +24,7 @@
#include "class_linker-inl.h"
#include "common_compiler_test.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "gc/heap.h"
#include "mirror/class-inl.h"
#include "mirror/class_loader.h"
@@ -110,14 +111,14 @@
ObjPtr<mirror::DexCache> dex_cache = class_linker_->FindDexCache(soa.Self(), dex);
EXPECT_EQ(dex.NumStringIds(), dex_cache->NumStrings());
for (size_t i = 0; i < dex_cache->NumStrings(); i++) {
- const mirror::String* string = dex_cache->GetResolvedString(i);
+ const mirror::String* string = dex_cache->GetResolvedString(dex::StringIndex(i));
EXPECT_TRUE(string != nullptr) << "string_idx=" << i;
}
EXPECT_EQ(dex.NumTypeIds(), dex_cache->NumResolvedTypes());
for (size_t i = 0; i < dex_cache->NumResolvedTypes(); i++) {
- mirror::Class* type = dex_cache->GetResolvedType(i);
+ mirror::Class* type = dex_cache->GetResolvedType(dex::TypeIndex(i));
EXPECT_TRUE(type != nullptr) << "type_idx=" << i
- << " " << dex.GetTypeDescriptor(dex.GetTypeId(i));
+ << " " << dex.GetTypeDescriptor(dex.GetTypeId(dex::TypeIndex(i)));
}
EXPECT_EQ(dex.NumMethodIds(), dex_cache->NumResolvedMethods());
auto* cl = Runtime::Current()->GetClassLinker();
diff --git a/compiler/driver/dex_compilation_unit.cc b/compiler/driver/dex_compilation_unit.cc
index 64fd9e7..47b1929 100644
--- a/compiler/driver/dex_compilation_unit.cc
+++ b/compiler/driver/dex_compilation_unit.cc
@@ -16,7 +16,6 @@
#include "dex_compilation_unit.h"
-#include "base/stringprintf.h"
#include "mirror/dex_cache.h"
#include "utils.h"
diff --git a/compiler/elf_writer_test.cc b/compiler/elf_writer_test.cc
index 6f48779..9669c4a 100644
--- a/compiler/elf_writer_test.cc
+++ b/compiler/elf_writer_test.cc
@@ -16,7 +16,6 @@
#include "elf_file.h"
-#include "base/stringprintf.h"
#include "base/unix_file/fd_file.h"
#include "common_compiler_test.h"
#include "elf_file.h"
diff --git a/compiler/image_test.cc b/compiler/image_test.cc
index fcb8979..1290379 100644
--- a/compiler/image_test.cc
+++ b/compiler/image_test.cc
@@ -20,6 +20,8 @@
#include <string>
#include <vector>
+#include "android-base/stringprintf.h"
+
#include "base/unix_file/fd_file.h"
#include "class_linker-inl.h"
#include "common_compiler_test.h"
@@ -29,6 +31,8 @@
#include "elf_writer_quick.h"
#include "gc/space/image_space.h"
#include "image_writer.h"
+#include "linker/buffered_output_stream.h"
+#include "linker/file_output_stream.h"
#include "linker/multi_oat_relative_patcher.h"
#include "lock_word.h"
#include "mirror/object-inl.h"
@@ -132,7 +136,8 @@
// Create a generic tmp file, to be the base of the .art and .oat temporary files.
ScratchFile location;
for (int i = 0; i < static_cast<int>(class_path.size()); ++i) {
- std::string cur_location(StringPrintf("%s-%d.art", location.GetFilename().c_str(), i));
+ std::string cur_location =
+ android::base::StringPrintf("%s-%d.art", location.GetFilename().c_str(), i);
image_locations.push_back(ScratchFile(cur_location));
}
}
@@ -211,7 +216,9 @@
&driver->GetCompilerOptions(),
oat_file.GetFile()));
elf_writers.back()->Start();
- oat_writers.emplace_back(new OatWriter(/*compiling_boot_image*/true, &timings));
+ oat_writers.emplace_back(new OatWriter(/*compiling_boot_image*/true,
+ &timings,
+ /*profile_compilation_info*/nullptr));
}
std::vector<OutputStream*> rodata;
@@ -254,6 +261,16 @@
bool image_space_ok = writer->PrepareImageAddressSpace();
ASSERT_TRUE(image_space_ok);
+ if (kIsVdexEnabled) {
+ for (size_t i = 0, size = vdex_files.size(); i != size; ++i) {
+ std::unique_ptr<BufferedOutputStream> vdex_out(
+ MakeUnique<BufferedOutputStream>(
+ MakeUnique<FileOutputStream>(vdex_files[i].GetFile())));
+ oat_writers[i]->WriteVerifierDeps(vdex_out.get(), nullptr);
+ oat_writers[i]->WriteChecksumsAndVdexHeader(vdex_out.get());
+ }
+ }
+
for (size_t i = 0, size = oat_files.size(); i != size; ++i) {
linker::MultiOatRelativePatcher patcher(driver->GetInstructionSet(),
driver->GetInstructionSetFeatures());
diff --git a/compiler/image_writer.cc b/compiler/image_writer.cc
index d7b7403..9c38445 100644
--- a/compiler/image_writer.cc
+++ b/compiler/image_writer.cc
@@ -32,6 +32,7 @@
#include "class_linker-inl.h"
#include "compiled_method.h"
#include "dex_file-inl.h"
+#include "dex_file_types.h"
#include "driver/compiler_driver.h"
#include "elf_file.h"
#include "elf_utils.h"
@@ -432,7 +433,7 @@
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
Thread* const self = Thread::Current();
- ReaderMutexLock mu(self, *class_linker->DexLock());
+ ReaderMutexLock mu(self, *Locks::dex_lock_);
for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) {
ObjPtr<mirror::DexCache> dex_cache =
ObjPtr<mirror::DexCache>::DownCast(self->DecodeJObject(data.weak_root));
@@ -802,6 +803,13 @@
result = result || PruneAppImageClassInternal(klass->GetSuperClass(),
&my_early_exit,
visited);
+ // Remove the class if the dex file is not in the set of dex files. This happens for classes that
+ // are from uses library if there is no profile. b/30688277
+ mirror::DexCache* dex_cache = klass->GetDexCache();
+ if (dex_cache != nullptr) {
+ result = result ||
+ dex_file_oat_index_map_.find(dex_cache->GetDexFile()) == dex_file_oat_index_map_.end();
+ }
// Erase the element we stored earlier since we are exiting the function.
auto it = visited->find(klass);
DCHECK(it != visited->end());
@@ -837,21 +845,73 @@
return true;
}
-class ImageWriter::NonImageClassesVisitor : public ClassVisitor {
+class ImageWriter::PruneClassesVisitor : public ClassVisitor {
public:
- explicit NonImageClassesVisitor(ImageWriter* image_writer) : image_writer_(image_writer) {}
+ PruneClassesVisitor(ImageWriter* image_writer, ObjPtr<mirror::ClassLoader> class_loader)
+ : image_writer_(image_writer),
+ class_loader_(class_loader),
+ classes_to_prune_(),
+ defined_class_count_(0u) { }
- bool operator()(ObjPtr<Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+ bool operator()(ObjPtr<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
if (!image_writer_->KeepClass(klass.Ptr())) {
classes_to_prune_.insert(klass.Ptr());
+ if (klass->GetClassLoader() == class_loader_) {
+ ++defined_class_count_;
+ }
}
return true;
}
- std::unordered_set<mirror::Class*> classes_to_prune_;
+ size_t Prune() REQUIRES_SHARED(Locks::mutator_lock_) {
+ ClassTable* class_table =
+ Runtime::Current()->GetClassLinker()->ClassTableForClassLoader(class_loader_);
+ for (mirror::Class* klass : classes_to_prune_) {
+ std::string storage;
+ const char* descriptor = klass->GetDescriptor(&storage);
+ bool result = class_table->Remove(descriptor);
+ DCHECK(result);
+ DCHECK(!class_table->Remove(descriptor)) << descriptor;
+ }
+ return defined_class_count_;
+ }
+
+ private:
ImageWriter* const image_writer_;
+ const ObjPtr<mirror::ClassLoader> class_loader_;
+ std::unordered_set<mirror::Class*> classes_to_prune_;
+ size_t defined_class_count_;
};
+class ImageWriter::PruneClassLoaderClassesVisitor : public ClassLoaderVisitor {
+ public:
+ explicit PruneClassLoaderClassesVisitor(ImageWriter* image_writer)
+ : image_writer_(image_writer), removed_class_count_(0) {}
+
+ virtual void Visit(ObjPtr<mirror::ClassLoader> class_loader) OVERRIDE
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ PruneClassesVisitor classes_visitor(image_writer_, class_loader);
+ ClassTable* class_table =
+ Runtime::Current()->GetClassLinker()->ClassTableForClassLoader(class_loader);
+ class_table->Visit(classes_visitor);
+ removed_class_count_ += classes_visitor.Prune();
+ }
+
+ size_t GetRemovedClassCount() const {
+ return removed_class_count_;
+ }
+
+ private:
+ ImageWriter* const image_writer_;
+ size_t removed_class_count_;
+};
+
+void ImageWriter::VisitClassLoaders(ClassLoaderVisitor* visitor) {
+ WriterMutexLock mu(Thread::Current(), *Locks::classlinker_classes_lock_);
+ visitor->Visit(nullptr); // Visit boot class loader.
+ Runtime::Current()->GetClassLinker()->VisitClassLoaders(visitor);
+}
+
void ImageWriter::PruneNonImageClasses() {
Runtime* runtime = Runtime::Current();
ClassLinker* class_linker = runtime->GetClassLinker();
@@ -861,21 +921,11 @@
// path dex caches.
class_linker->ClearClassTableStrongRoots();
- // Make a list of classes we would like to prune.
- NonImageClassesVisitor visitor(this);
- class_linker->VisitClasses(&visitor);
-
// Remove the undesired classes from the class roots.
- VLOG(compiler) << "Pruning " << visitor.classes_to_prune_.size() << " classes";
- for (mirror::Class* klass : visitor.classes_to_prune_) {
- std::string temp;
- const char* name = klass->GetDescriptor(&temp);
- VLOG(compiler) << "Pruning class " << name;
- if (!compile_app_image_) {
- DCHECK(IsBootClassLoaderClass(klass));
- }
- bool result = class_linker->RemoveClass(name, klass->GetClassLoader());
- DCHECK(result);
+ {
+ PruneClassLoaderClassesVisitor class_loader_visitor(this);
+ VisitClassLoaders(&class_loader_visitor);
+ VLOG(compiler) << "Pruned " << class_loader_visitor.GetRemovedClassCount() << " classes";
}
// Clear references to removed classes from the DexCaches.
@@ -883,16 +933,16 @@
ScopedAssertNoThreadSuspension sa(__FUNCTION__);
ReaderMutexLock mu(self, *Locks::classlinker_classes_lock_); // For ClassInClassTable
- ReaderMutexLock mu2(self, *class_linker->DexLock());
+ ReaderMutexLock mu2(self, *Locks::dex_lock_);
for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) {
if (self->IsJWeakCleared(data.weak_root)) {
continue;
}
ObjPtr<mirror::DexCache> dex_cache = self->DecodeJObject(data.weak_root)->AsDexCache();
for (size_t i = 0; i < dex_cache->NumResolvedTypes(); i++) {
- Class* klass = dex_cache->GetResolvedType(i);
+ Class* klass = dex_cache->GetResolvedType(dex::TypeIndex(i));
if (klass != nullptr && !KeepClass(klass)) {
- dex_cache->SetResolvedType(i, nullptr);
+ dex_cache->SetResolvedType(dex::TypeIndex(i), nullptr);
}
}
ArtMethod** resolved_methods = dex_cache->GetResolvedMethods();
@@ -1012,7 +1062,7 @@
// caches. We check that the number of dex caches does not change.
size_t dex_cache_count = 0;
{
- ReaderMutexLock mu(self, *class_linker->DexLock());
+ ReaderMutexLock mu(self, *Locks::dex_lock_);
// Count number of dex caches not in the boot image.
for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) {
ObjPtr<mirror::DexCache> dex_cache =
@@ -1030,7 +1080,7 @@
hs.NewHandle(ObjectArray<Object>::Alloc(self, object_array_class.Get(), dex_cache_count)));
CHECK(dex_caches.Get() != nullptr) << "Failed to allocate a dex cache array.";
{
- ReaderMutexLock mu(self, *class_linker->DexLock());
+ ReaderMutexLock mu(self, *Locks::dex_lock_);
size_t non_image_dex_caches = 0;
// Re-count number of non image dex caches.
for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) {
@@ -1063,11 +1113,15 @@
}
// build an Object[] of the roots needed to restore the runtime
+ int32_t image_roots_size = ImageHeader::NumberOfImageRoots(compile_app_image_);
auto image_roots(hs.NewHandle(
- ObjectArray<Object>::Alloc(self, object_array_class.Get(), ImageHeader::kImageRootsMax)));
+ ObjectArray<Object>::Alloc(self, object_array_class.Get(), image_roots_size)));
image_roots->Set<false>(ImageHeader::kDexCaches, dex_caches.Get());
image_roots->Set<false>(ImageHeader::kClassRoots, class_linker->GetClassRoots());
- for (int i = 0; i < ImageHeader::kImageRootsMax; i++) {
+ // image_roots[ImageHeader::kClassLoader] will be set later for app image.
+ static_assert(ImageHeader::kClassLoader + 1u == ImageHeader::kImageRootsMax,
+ "Class loader should be the last image root.");
+ for (int32_t i = 0; i < ImageHeader::kImageRootsMax - 1; ++i) {
CHECK(image_roots->Get(i) != nullptr);
}
return image_roots.Get();
@@ -1450,7 +1504,8 @@
InternTable* const intern_table = runtime->GetInternTable();
for (size_t i = 0, count = dex_file->NumStringIds(); i < count; ++i) {
uint32_t utf16_length;
- const char* utf8_data = dex_file->StringDataAndUtf16LengthByIdx(i, &utf16_length);
+ const char* utf8_data = dex_file->StringDataAndUtf16LengthByIdx(dex::StringIndex(i),
+ &utf16_length);
mirror::String* string = intern_table->LookupStrong(self, utf16_length, utf8_data).Ptr();
TryAssignBinSlot(work_stack, string, oat_index);
}
@@ -1488,6 +1543,12 @@
}
// Process the work stack in case anything was added by TryAssignBinSlot.
ProcessWorkStack(&work_stack);
+
+ // Store the class loader in the class roots.
+ CHECK_EQ(class_loaders_.size(), 1u);
+ CHECK_EQ(image_roots.size(), 1u);
+ CHECK(*class_loaders_.begin() != nullptr);
+ image_roots[0]->Set<false>(ImageHeader::kClassLoader, *class_loaders_.begin());
}
// Verify that all objects have assigned image bin slots.
@@ -1506,8 +1567,10 @@
}
// Calculate the size of the class table.
ReaderMutexLock mu(self, *Locks::classlinker_classes_lock_);
- DCHECK_EQ(image_info.class_table_->NumZygoteClasses(), 0u);
- if (image_info.class_table_->NumNonZygoteClasses() != 0u) {
+ CHECK_EQ(class_loaders_.size(), compile_app_image_ ? 1u : 0u);
+ mirror::ClassLoader* class_loader = compile_app_image_ ? *class_loaders_.begin() : nullptr;
+ DCHECK_EQ(image_info.class_table_->NumZygoteClasses(class_loader), 0u);
+ if (image_info.class_table_->NumNonZygoteClasses(class_loader) != 0u) {
image_info.class_table_bytes_ += image_info.class_table_->WriteToMemory(nullptr);
}
}
@@ -1852,11 +1915,12 @@
// above comment for intern tables.
ClassTable temp_class_table;
temp_class_table.ReadFromMemory(class_table_memory_ptr);
- CHECK_EQ(temp_class_table.NumZygoteClasses(), table->NumNonZygoteClasses() +
- table->NumZygoteClasses());
- BufferedRootVisitor<kDefaultBufferedRootCount> buffered_visitor(&root_visitor,
- RootInfo(kRootUnknown));
- temp_class_table.VisitRoots(buffered_visitor);
+ CHECK_EQ(class_loaders_.size(), compile_app_image_ ? 1u : 0u);
+ mirror::ClassLoader* class_loader = compile_app_image_ ? *class_loaders_.begin() : nullptr;
+ CHECK_EQ(temp_class_table.NumZygoteClasses(class_loader),
+ table->NumNonZygoteClasses(class_loader) + table->NumZygoteClasses(class_loader));
+ UnbufferedRootVisitor visitor(&root_visitor, RootInfo(kRootUnknown));
+ temp_class_table.VisitRoots(visitor);
}
}
diff --git a/compiler/image_writer.h b/compiler/image_writer.h
index 24fad46..c537483 100644
--- a/compiler/image_writer.h
+++ b/compiler/image_writer.h
@@ -50,6 +50,7 @@
} // namespace space
} // namespace gc
+class ClassLoaderVisitor;
class ClassTable;
static constexpr int kInvalidFd = -1;
@@ -373,6 +374,9 @@
void ComputeLazyFieldsForImageClasses()
REQUIRES_SHARED(Locks::mutator_lock_);
+ // Visit all class loaders.
+ void VisitClassLoaders(ClassLoaderVisitor* visitor) REQUIRES_SHARED(Locks::mutator_lock_);
+
// Remove unwanted classes from various roots.
void PruneNonImageClasses() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -588,7 +592,8 @@
class FixupVisitor;
class GetRootsVisitor;
class NativeLocationVisitor;
- class NonImageClassesVisitor;
+ class PruneClassesVisitor;
+ class PruneClassLoaderClassesVisitor;
class VisitReferencesVisitor;
DISALLOW_COPY_AND_ASSIGN(ImageWriter);
diff --git a/compiler/intrinsics_list.h b/compiler/intrinsics_list.h
index 555baf6..9bd25d8 100644
--- a/compiler/intrinsics_list.h
+++ b/compiler/intrinsics_list.h
@@ -117,6 +117,12 @@
V(StringNewStringFromBytes, kStatic, kNeedsEnvironmentOrCache, kAllSideEffects, kCanThrow, "Ljava/lang/StringFactory;", "newStringFromBytes", "([BIII)Ljava/lang/String;") \
V(StringNewStringFromChars, kStatic, kNeedsEnvironmentOrCache, kAllSideEffects, kCanThrow, "Ljava/lang/StringFactory;", "newStringFromChars", "(II[C)Ljava/lang/String;") \
V(StringNewStringFromString, kStatic, kNeedsEnvironmentOrCache, kAllSideEffects, kCanThrow, "Ljava/lang/StringFactory;", "newStringFromString", "(Ljava/lang/String;)Ljava/lang/String;") \
+ V(StringBufferAppend, kVirtual, kNeedsEnvironmentOrCache, kAllSideEffects, kCanThrow, "Ljava/lang/StringBuffer;", "append", "(Ljava/lang/String;)Ljava/lang/StringBuffer;") \
+ V(StringBufferLength, kVirtual, kNeedsEnvironmentOrCache, kAllSideEffects, kNoThrow, "Ljava/lang/StringBuffer;", "length", "()I") \
+ V(StringBufferToString, kVirtual, kNeedsEnvironmentOrCache, kAllSideEffects, kCanThrow, "Ljava/lang/StringBuffer;", "toString", "()Ljava/lang/String;") \
+ V(StringBuilderAppend, kVirtual, kNeedsEnvironmentOrCache, kAllSideEffects, kCanThrow, "Ljava/lang/StringBuilder;", "append", "(Ljava/lang/String;)Ljava/lang/StringBuilder;") \
+ V(StringBuilderLength, kVirtual, kNeedsEnvironmentOrCache, kReadSideEffects, kNoThrow, "Ljava/lang/StringBuilder;", "length", "()I") \
+ V(StringBuilderToString, kVirtual, kNeedsEnvironmentOrCache, kAllSideEffects, kCanThrow, "Ljava/lang/StringBuilder;", "toString", "()Ljava/lang/String;") \
V(UnsafeCASInt, kVirtual, kNeedsEnvironmentOrCache, kAllSideEffects, kCanThrow, "Lsun/misc/Unsafe;", "compareAndSwapInt", "(Ljava/lang/Object;JII)Z") \
V(UnsafeCASLong, kVirtual, kNeedsEnvironmentOrCache, kAllSideEffects, kCanThrow, "Lsun/misc/Unsafe;", "compareAndSwapLong", "(Ljava/lang/Object;JJJ)Z") \
V(UnsafeCASObject, kVirtual, kNeedsEnvironmentOrCache, kAllSideEffects, kCanThrow, "Lsun/misc/Unsafe;", "compareAndSwapObject", "(Ljava/lang/Object;JLjava/lang/Object;Ljava/lang/Object;)Z") \
diff --git a/compiler/jit/jit_compiler.cc b/compiler/jit/jit_compiler.cc
index 9dfb434..148ce4f 100644
--- a/compiler/jit/jit_compiler.cc
+++ b/compiler/jit/jit_compiler.cc
@@ -16,6 +16,8 @@
#include "jit_compiler.h"
+#include "android-base/stringprintf.h"
+
#include "arch/instruction_set.h"
#include "arch/instruction_set_features.h"
#include "art_method-inl.h"
@@ -81,7 +83,7 @@
va_list ap;
va_start(ap, fmt);
std::string error;
- StringAppendV(&error, fmt, ap);
+ android::base::StringAppendV(&error, fmt, ap);
LOG(FATAL) << error;
va_end(ap);
exit(EXIT_FAILURE);
diff --git a/compiler/jni/jni_cfi_test_expected.inc b/compiler/jni/jni_cfi_test_expected.inc
index a205800..2710ae9 100644
--- a/compiler/jni/jni_cfi_test_expected.inc
+++ b/compiler/jni/jni_cfi_test_expected.inc
@@ -327,7 +327,7 @@
0xC0, 0xFF, 0xBD, 0x27, 0x3C, 0x00, 0xBF, 0xAF, 0x38, 0x00, 0xBE, 0xAF,
0x34, 0x00, 0xB7, 0xAF, 0x30, 0x00, 0xB6, 0xAF, 0x2C, 0x00, 0xB5, 0xAF,
0x28, 0x00, 0xB4, 0xAF, 0x24, 0x00, 0xB3, 0xAF, 0x20, 0x00, 0xB2, 0xAF,
- 0x00, 0x00, 0xA4, 0xAF, 0x44, 0x00, 0xA5, 0xAF, 0x48, 0x00, 0xAC, 0xE7,
+ 0x00, 0x00, 0xA4, 0xAF, 0x44, 0x00, 0xA5, 0xAF, 0x48, 0x00, 0xA8, 0xE7,
0x4C, 0x00, 0xA6, 0xAF, 0x50, 0x00, 0xA7, 0xAF, 0xE0, 0xFF, 0xBD, 0x27,
0x20, 0x00, 0xBD, 0x27, 0x20, 0x00, 0xB2, 0x8F, 0x24, 0x00, 0xB3, 0x8F,
0x28, 0x00, 0xB4, 0x8F, 0x2C, 0x00, 0xB5, 0x8F, 0x30, 0x00, 0xB6, 0x8F,
@@ -361,7 +361,7 @@
// 0x00000024: .cfi_offset: r18 at cfa-32
// 0x00000024: sw r4, +0(r29)
// 0x00000028: sw r5, +68(r29)
-// 0x0000002c: swc1 f12, +72(r29)
+// 0x0000002c: swc1 f8, +72(r29)
// 0x00000030: sw r6, +76(r29)
// 0x00000034: sw r7, +80(r29)
// 0x00000038: addiu r29, r29, -32
diff --git a/compiler/jni/quick/mips/calling_convention_mips.cc b/compiler/jni/quick/mips/calling_convention_mips.cc
index e6948ec..0e0716e 100644
--- a/compiler/jni/quick/mips/calling_convention_mips.cc
+++ b/compiler/jni/quick/mips/calling_convention_mips.cc
@@ -23,6 +23,10 @@
namespace art {
namespace mips {
+//
+// JNI calling convention constants.
+//
+
// Up to how many float-like (float, double) args can be enregistered in floating-point registers.
// The rest of the args must go in integer registers or on the stack.
constexpr size_t kMaxFloatOrDoubleRegisterArguments = 2u;
@@ -30,9 +34,17 @@
// enregistered. The rest of the args must go on the stack.
constexpr size_t kMaxIntLikeRegisterArguments = 4u;
-static const Register kCoreArgumentRegisters[] = { A0, A1, A2, A3 };
-static const FRegister kFArgumentRegisters[] = { F12, F14 };
-static const DRegister kDArgumentRegisters[] = { D6, D7 };
+static const Register kJniCoreArgumentRegisters[] = { A0, A1, A2, A3 };
+static const FRegister kJniFArgumentRegisters[] = { F12, F14 };
+static const DRegister kJniDArgumentRegisters[] = { D6, D7 };
+
+//
+// Managed calling convention constants.
+//
+
+static const Register kManagedCoreArgumentRegisters[] = { A0, A1, A2, A3, T0, T1 };
+static const FRegister kManagedFArgumentRegisters[] = { F8, F10, F12, F14, F16, F18 };
+static const DRegister kManagedDArgumentRegisters[] = { D4, D5, D6, D7, D8, D9 };
static constexpr ManagedRegister kCalleeSaveRegisters[] = {
// Core registers.
@@ -133,30 +145,30 @@
for (ResetIterator(FrameOffset(0)); HasNext(); Next()) {
if (IsCurrentParamAFloatOrDouble()) {
if (IsCurrentParamADouble()) {
- if (fpr_index < arraysize(kDArgumentRegisters)) {
+ if (fpr_index < arraysize(kManagedDArgumentRegisters)) {
entry_spills_.push_back(
- MipsManagedRegister::FromDRegister(kDArgumentRegisters[fpr_index++]));
+ MipsManagedRegister::FromDRegister(kManagedDArgumentRegisters[fpr_index++]));
} else {
entry_spills_.push_back(ManagedRegister::NoRegister(), 8);
}
} else {
- if (fpr_index < arraysize(kFArgumentRegisters)) {
+ if (fpr_index < arraysize(kManagedFArgumentRegisters)) {
entry_spills_.push_back(
- MipsManagedRegister::FromFRegister(kFArgumentRegisters[fpr_index++]));
+ MipsManagedRegister::FromFRegister(kManagedFArgumentRegisters[fpr_index++]));
} else {
entry_spills_.push_back(ManagedRegister::NoRegister(), 4);
}
}
} else {
if (IsCurrentParamALong() && !IsCurrentParamAReference()) {
- if (gpr_index == 1) {
- // Don't use a1-a2 as a register pair, move to a2-a3 instead.
+ if (gpr_index == 1 || gpr_index == 3) {
+ // Don't use A1-A2(A3-T0) as a register pair, move to A2-A3(T0-T1) instead.
gpr_index++;
}
- if (gpr_index < arraysize(kCoreArgumentRegisters) - 1) {
+ if (gpr_index < arraysize(kManagedCoreArgumentRegisters) - 1) {
entry_spills_.push_back(
- MipsManagedRegister::FromCoreRegister(kCoreArgumentRegisters[gpr_index++]));
- } else if (gpr_index == arraysize(kCoreArgumentRegisters) - 1) {
+ MipsManagedRegister::FromCoreRegister(kManagedCoreArgumentRegisters[gpr_index++]));
+ } else if (gpr_index == arraysize(kManagedCoreArgumentRegisters) - 1) {
gpr_index++;
entry_spills_.push_back(ManagedRegister::NoRegister(), 4);
} else {
@@ -164,9 +176,9 @@
}
}
- if (gpr_index < arraysize(kCoreArgumentRegisters)) {
+ if (gpr_index < arraysize(kManagedCoreArgumentRegisters)) {
entry_spills_.push_back(
- MipsManagedRegister::FromCoreRegister(kCoreArgumentRegisters[gpr_index++]));
+ MipsManagedRegister::FromCoreRegister(kManagedCoreArgumentRegisters[gpr_index++]));
} else {
entry_spills_.push_back(ManagedRegister::NoRegister(), 4);
}
@@ -175,6 +187,7 @@
}
return entry_spills_;
}
+
// JNI calling convention
MipsJniCallingConvention::MipsJniCallingConvention(bool is_static,
@@ -285,7 +298,7 @@
// | FLOAT | INT | DOUBLE |
// | F12 | A1 | A2 | A3 |
// (c) first two arguments are floating-point (float, double)
- // | FLAOT | (PAD) | DOUBLE | INT |
+ // | FLOAT | (PAD) | DOUBLE | INT |
// | F12 | | F14 | SP+16 |
// (d) first two arguments are floating-point (double, float)
// | DOUBLE | FLOAT | INT |
@@ -404,9 +417,9 @@
if (use_fp_arg_registers_ && (itr_args_ < kMaxFloatOrDoubleRegisterArguments)) {
if (IsCurrentParamAFloatOrDouble()) {
if (IsCurrentParamADouble()) {
- return MipsManagedRegister::FromDRegister(kDArgumentRegisters[itr_args_]);
+ return MipsManagedRegister::FromDRegister(kJniDArgumentRegisters[itr_args_]);
} else {
- return MipsManagedRegister::FromFRegister(kFArgumentRegisters[itr_args_]);
+ return MipsManagedRegister::FromFRegister(kJniFArgumentRegisters[itr_args_]);
}
}
}
@@ -420,7 +433,7 @@
return MipsManagedRegister::FromRegisterPair(A2_A3);
}
} else {
- return MipsManagedRegister::FromCoreRegister(kCoreArgumentRegisters[itr_slots_]);
+ return MipsManagedRegister::FromCoreRegister(kJniCoreArgumentRegisters[itr_slots_]);
}
}
diff --git a/compiler/linker/mips/relative_patcher_mips32r6_test.cc b/compiler/linker/mips/relative_patcher_mips32r6_test.cc
index a16aaca..4f9a3a0 100644
--- a/compiler/linker/mips/relative_patcher_mips32r6_test.cc
+++ b/compiler/linker/mips/relative_patcher_mips32r6_test.cc
@@ -29,10 +29,10 @@
Mips32r6RelativePatcherTest() : RelativePatcherTest(kMips, "mips32r6") {}
protected:
- static const uint8_t UnpatchedPcRelativeRawCode[];
- static const uint32_t LiteralOffset;
- static const uint32_t AnchorOffset;
- static const ArrayRef<const uint8_t> UnpatchedPcRelativeCode;
+ static const uint8_t kUnpatchedPcRelativeRawCode[];
+ static const uint32_t kLiteralOffset;
+ static const uint32_t kAnchorOffset;
+ static const ArrayRef<const uint8_t> kUnpatchedPcRelativeCode;
uint32_t GetMethodOffset(uint32_t method_idx) {
auto result = method_offset_map_.FindMethodOffset(MethodRef(method_idx));
@@ -45,24 +45,25 @@
void TestStringReference(uint32_t string_offset);
};
-const uint8_t Mips32r6RelativePatcherTest::UnpatchedPcRelativeRawCode[] = {
+const uint8_t Mips32r6RelativePatcherTest::kUnpatchedPcRelativeRawCode[] = {
0x34, 0x12, 0x5E, 0xEE, // auipc s2, high(diff); placeholder = 0x1234
0x78, 0x56, 0x52, 0x26, // addiu s2, s2, low(diff); placeholder = 0x5678
};
-const uint32_t Mips32r6RelativePatcherTest::LiteralOffset = 0; // At auipc (where patching starts).
-const uint32_t Mips32r6RelativePatcherTest::AnchorOffset = 0; // At auipc (where PC+0 points).
-const ArrayRef<const uint8_t> Mips32r6RelativePatcherTest::UnpatchedPcRelativeCode(
- UnpatchedPcRelativeRawCode);
+const uint32_t Mips32r6RelativePatcherTest::kLiteralOffset = 0; // At auipc (where
+ // patching starts).
+const uint32_t Mips32r6RelativePatcherTest::kAnchorOffset = 0; // At auipc (where PC+0 points).
+const ArrayRef<const uint8_t> Mips32r6RelativePatcherTest::kUnpatchedPcRelativeCode(
+ kUnpatchedPcRelativeRawCode);
void Mips32r6RelativePatcherTest::CheckPcRelativePatch(const ArrayRef<const LinkerPatch>& patches,
uint32_t target_offset) {
- AddCompiledMethod(MethodRef(1u), UnpatchedPcRelativeCode, ArrayRef<const LinkerPatch>(patches));
+ AddCompiledMethod(MethodRef(1u), kUnpatchedPcRelativeCode, ArrayRef<const LinkerPatch>(patches));
Link();
auto result = method_offset_map_.FindMethodOffset(MethodRef(1u));
ASSERT_TRUE(result.first);
- uint32_t diff = target_offset - (result.second + AnchorOffset);
+ uint32_t diff = target_offset - (result.second + kAnchorOffset);
if (patches[0].GetType() == LinkerPatch::Type::kDexCacheArray) {
diff += kDexCacheArrayLwOffset;
}
@@ -79,7 +80,7 @@
uint32_t element_offset) {
dex_cache_arrays_begin_ = dex_cache_arrays_begin;
LinkerPatch patches[] = {
- LinkerPatch::DexCacheArrayPatch(LiteralOffset, nullptr, AnchorOffset, element_offset)
+ LinkerPatch::DexCacheArrayPatch(kLiteralOffset, nullptr, kAnchorOffset, element_offset)
};
CheckPcRelativePatch(ArrayRef<const LinkerPatch>(patches),
dex_cache_arrays_begin_ + element_offset);
@@ -89,7 +90,7 @@
constexpr uint32_t kStringIndex = 1u;
string_index_to_offset_map_.Put(kStringIndex, string_offset);
LinkerPatch patches[] = {
- LinkerPatch::RelativeStringPatch(LiteralOffset, nullptr, AnchorOffset, kStringIndex)
+ LinkerPatch::RelativeStringPatch(kLiteralOffset, nullptr, kAnchorOffset, kStringIndex)
};
CheckPcRelativePatch(ArrayRef<const LinkerPatch>(patches), string_offset);
}
diff --git a/compiler/linker/mips/relative_patcher_mips_test.cc b/compiler/linker/mips/relative_patcher_mips_test.cc
index 335ce2e..faeb92a 100644
--- a/compiler/linker/mips/relative_patcher_mips_test.cc
+++ b/compiler/linker/mips/relative_patcher_mips_test.cc
@@ -29,10 +29,10 @@
MipsRelativePatcherTest() : RelativePatcherTest(kMips, "mips32r2") {}
protected:
- static const uint8_t UnpatchedPcRelativeRawCode[];
- static const uint32_t LiteralOffset;
- static const uint32_t AnchorOffset;
- static const ArrayRef<const uint8_t> UnpatchedPcRelativeCode;
+ static const uint8_t kUnpatchedPcRelativeRawCode[];
+ static const uint32_t kLiteralOffset;
+ static const uint32_t kAnchorOffset;
+ static const ArrayRef<const uint8_t> kUnpatchedPcRelativeCode;
uint32_t GetMethodOffset(uint32_t method_idx) {
auto result = method_offset_map_.FindMethodOffset(MethodRef(method_idx));
@@ -45,26 +45,26 @@
void TestStringReference(uint32_t string_offset);
};
-const uint8_t MipsRelativePatcherTest::UnpatchedPcRelativeRawCode[] = {
+const uint8_t MipsRelativePatcherTest::kUnpatchedPcRelativeRawCode[] = {
0x00, 0x00, 0x10, 0x04, // nal
0x34, 0x12, 0x12, 0x3C, // lui s2, high(diff); placeholder = 0x1234
0x78, 0x56, 0x52, 0x36, // ori s2, s2, low(diff); placeholder = 0x5678
0x21, 0x90, 0x5F, 0x02, // addu s2, s2, ra
};
-const uint32_t MipsRelativePatcherTest::LiteralOffset = 4; // At lui (where patching starts).
-const uint32_t MipsRelativePatcherTest::AnchorOffset = 8; // At ori (where PC+0 points).
-const ArrayRef<const uint8_t> MipsRelativePatcherTest::UnpatchedPcRelativeCode(
- UnpatchedPcRelativeRawCode);
+const uint32_t MipsRelativePatcherTest::kLiteralOffset = 4; // At lui (where patching starts).
+const uint32_t MipsRelativePatcherTest::kAnchorOffset = 8; // At ori (where PC+0 points).
+const ArrayRef<const uint8_t> MipsRelativePatcherTest::kUnpatchedPcRelativeCode(
+ kUnpatchedPcRelativeRawCode);
void MipsRelativePatcherTest::CheckPcRelativePatch(const ArrayRef<const LinkerPatch>& patches,
uint32_t target_offset) {
- AddCompiledMethod(MethodRef(1u), UnpatchedPcRelativeCode, ArrayRef<const LinkerPatch>(patches));
+ AddCompiledMethod(MethodRef(1u), kUnpatchedPcRelativeCode, ArrayRef<const LinkerPatch>(patches));
Link();
auto result = method_offset_map_.FindMethodOffset(MethodRef(1u));
ASSERT_TRUE(result.first);
- uint32_t diff = target_offset - (result.second + AnchorOffset);
+ uint32_t diff = target_offset - (result.second + kAnchorOffset);
if (patches[0].GetType() == LinkerPatch::Type::kDexCacheArray) {
diff += kDexCacheArrayLwOffset;
}
@@ -82,7 +82,7 @@
uint32_t element_offset) {
dex_cache_arrays_begin_ = dex_cache_arrays_begin;
LinkerPatch patches[] = {
- LinkerPatch::DexCacheArrayPatch(LiteralOffset, nullptr, AnchorOffset, element_offset)
+ LinkerPatch::DexCacheArrayPatch(kLiteralOffset, nullptr, kAnchorOffset, element_offset)
};
CheckPcRelativePatch(ArrayRef<const LinkerPatch>(patches),
dex_cache_arrays_begin_ + element_offset);
@@ -92,7 +92,7 @@
constexpr uint32_t kStringIndex = 1u;
string_index_to_offset_map_.Put(kStringIndex, string_offset);
LinkerPatch patches[] = {
- LinkerPatch::RelativeStringPatch(LiteralOffset, nullptr, AnchorOffset, kStringIndex)
+ LinkerPatch::RelativeStringPatch(kLiteralOffset, nullptr, kAnchorOffset, kStringIndex)
};
CheckPcRelativePatch(ArrayRef<const LinkerPatch>(patches), string_offset);
}
diff --git a/compiler/linker/mips64/relative_patcher_mips64.cc b/compiler/linker/mips64/relative_patcher_mips64.cc
new file mode 100644
index 0000000..c479716
--- /dev/null
+++ b/compiler/linker/mips64/relative_patcher_mips64.cc
@@ -0,0 +1,111 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "linker/mips64/relative_patcher_mips64.h"
+
+#include "compiled_method.h"
+
+namespace art {
+namespace linker {
+
+uint32_t Mips64RelativePatcher::ReserveSpace(
+ uint32_t offset,
+ const CompiledMethod* compiled_method ATTRIBUTE_UNUSED,
+ MethodReference method_ref ATTRIBUTE_UNUSED) {
+ return offset; // No space reserved; no limit on relative call distance.
+}
+
+uint32_t Mips64RelativePatcher::ReserveSpaceEnd(uint32_t offset) {
+ return offset; // No space reserved; no limit on relative call distance.
+}
+
+uint32_t Mips64RelativePatcher::WriteThunks(OutputStream* out ATTRIBUTE_UNUSED, uint32_t offset) {
+ return offset; // No thunks added; no limit on relative call distance.
+}
+
+void Mips64RelativePatcher::PatchCall(std::vector<uint8_t>* code,
+ uint32_t literal_offset,
+ uint32_t patch_offset,
+ uint32_t target_offset) {
+ // Basic sanity checks.
+ DCHECK_GE(code->size(), 8u);
+ DCHECK_LE(literal_offset, code->size() - 8u);
+ // auipc reg, offset_high
+ DCHECK_EQ((*code)[literal_offset + 0], 0x34);
+ DCHECK_EQ((*code)[literal_offset + 1], 0x12);
+ DCHECK_EQ(((*code)[literal_offset + 2] & 0x1F), 0x1E);
+ DCHECK_EQ(((*code)[literal_offset + 3] & 0xFC), 0xEC);
+ // jialc reg, offset_low
+ DCHECK_EQ((*code)[literal_offset + 4], 0x78);
+ DCHECK_EQ((*code)[literal_offset + 5], 0x56);
+ DCHECK_EQ(((*code)[literal_offset + 6] & 0xE0), 0x00);
+ DCHECK_EQ((*code)[literal_offset + 7], 0xF8);
+
+ // Apply patch.
+ uint32_t diff = target_offset - patch_offset;
+ // Note that a combination of auipc with an instruction that adds a sign-extended
+ // 16-bit immediate operand (e.g. jialc) provides a PC-relative range of
+ // PC-0x80000000 to PC+0x7FFF7FFF on MIPS64, that is, short of 2GB on one end
+ // by 32KB.
+ diff += (diff & 0x8000) << 1; // Account for sign extension in jialc.
+
+ // auipc reg, offset_high
+ (*code)[literal_offset + 0] = static_cast<uint8_t>(diff >> 16);
+ (*code)[literal_offset + 1] = static_cast<uint8_t>(diff >> 24);
+ // jialc reg, offset_low
+ (*code)[literal_offset + 4] = static_cast<uint8_t>(diff >> 0);
+ (*code)[literal_offset + 5] = static_cast<uint8_t>(diff >> 8);
+}
+
+void Mips64RelativePatcher::PatchPcRelativeReference(std::vector<uint8_t>* code,
+ const LinkerPatch& patch,
+ uint32_t patch_offset,
+ uint32_t target_offset) {
+ uint32_t anchor_literal_offset = patch.PcInsnOffset();
+ uint32_t literal_offset = patch.LiteralOffset();
+
+ // Basic sanity checks.
+ DCHECK_GE(code->size(), 8u);
+ DCHECK_LE(literal_offset, code->size() - 8u);
+ DCHECK_EQ(literal_offset, anchor_literal_offset);
+ // auipc reg, offset_high
+ DCHECK_EQ((*code)[literal_offset + 0], 0x34);
+ DCHECK_EQ((*code)[literal_offset + 1], 0x12);
+ DCHECK_EQ(((*code)[literal_offset + 2] & 0x1F), 0x1E);
+ DCHECK_EQ(((*code)[literal_offset + 3] & 0xFC), 0xEC);
+ // instr reg(s), offset_low
+ DCHECK_EQ((*code)[literal_offset + 4], 0x78);
+ DCHECK_EQ((*code)[literal_offset + 5], 0x56);
+
+ // Apply patch.
+ uint32_t anchor_offset = patch_offset - literal_offset + anchor_literal_offset;
+ uint32_t diff = target_offset - anchor_offset;
+ // Note that a combination of auipc with an instruction that adds a sign-extended
+ // 16-bit immediate operand (e.g. ld) provides a PC-relative range of
+ // PC-0x80000000 to PC+0x7FFF7FFF on MIPS64, that is, short of 2GB on one end
+ // by 32KB.
+ diff += (diff & 0x8000) << 1; // Account for sign extension in instruction following auipc.
+
+ // auipc reg, offset_high
+ (*code)[literal_offset + 0] = static_cast<uint8_t>(diff >> 16);
+ (*code)[literal_offset + 1] = static_cast<uint8_t>(diff >> 24);
+ // instr reg(s), offset_low
+ (*code)[literal_offset + 4] = static_cast<uint8_t>(diff >> 0);
+ (*code)[literal_offset + 5] = static_cast<uint8_t>(diff >> 8);
+}
+
+} // namespace linker
+} // namespace art
diff --git a/compiler/linker/mips64/relative_patcher_mips64.h b/compiler/linker/mips64/relative_patcher_mips64.h
new file mode 100644
index 0000000..8ef8ceb
--- /dev/null
+++ b/compiler/linker/mips64/relative_patcher_mips64.h
@@ -0,0 +1,50 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_COMPILER_LINKER_MIPS64_RELATIVE_PATCHER_MIPS64_H_
+#define ART_COMPILER_LINKER_MIPS64_RELATIVE_PATCHER_MIPS64_H_
+
+#include "linker/relative_patcher.h"
+
+namespace art {
+namespace linker {
+
+class Mips64RelativePatcher FINAL : public RelativePatcher {
+ public:
+ explicit Mips64RelativePatcher() {}
+
+ uint32_t ReserveSpace(uint32_t offset,
+ const CompiledMethod* compiled_method,
+ MethodReference method_ref) OVERRIDE;
+ uint32_t ReserveSpaceEnd(uint32_t offset) OVERRIDE;
+ uint32_t WriteThunks(OutputStream* out, uint32_t offset) OVERRIDE;
+ void PatchCall(std::vector<uint8_t>* code,
+ uint32_t literal_offset,
+ uint32_t patch_offset,
+ uint32_t target_offset) OVERRIDE;
+ void PatchPcRelativeReference(std::vector<uint8_t>* code,
+ const LinkerPatch& patch,
+ uint32_t patch_offset,
+ uint32_t target_offset) OVERRIDE;
+
+ private:
+ DISALLOW_COPY_AND_ASSIGN(Mips64RelativePatcher);
+};
+
+} // namespace linker
+} // namespace art
+
+#endif // ART_COMPILER_LINKER_MIPS64_RELATIVE_PATCHER_MIPS64_H_
diff --git a/compiler/linker/mips64/relative_patcher_mips64_test.cc b/compiler/linker/mips64/relative_patcher_mips64_test.cc
new file mode 100644
index 0000000..9e37f6b
--- /dev/null
+++ b/compiler/linker/mips64/relative_patcher_mips64_test.cc
@@ -0,0 +1,127 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "linker/relative_patcher_test.h"
+#include "linker/mips64/relative_patcher_mips64.h"
+
+namespace art {
+namespace linker {
+
+class Mips64RelativePatcherTest : public RelativePatcherTest {
+ public:
+ Mips64RelativePatcherTest() : RelativePatcherTest(kMips64, "default") {}
+
+ protected:
+ static const uint8_t kUnpatchedPcRelativeRawCode[];
+ static const uint8_t kUnpatchedPcRelativeCallRawCode[];
+ static const uint32_t kLiteralOffset;
+ static const uint32_t kAnchorOffset;
+ static const ArrayRef<const uint8_t> kUnpatchedPcRelativeCode;
+ static const ArrayRef<const uint8_t> kUnpatchedPcRelativeCallCode;
+
+ uint32_t GetMethodOffset(uint32_t method_idx) {
+ auto result = method_offset_map_.FindMethodOffset(MethodRef(method_idx));
+ CHECK(result.first);
+ return result.second;
+ }
+
+ void CheckPcRelativePatch(const ArrayRef<const LinkerPatch>& patches, uint32_t target_offset);
+ void TestDexCacheReference(uint32_t dex_cache_arrays_begin, uint32_t element_offset);
+ void TestStringReference(uint32_t string_offset);
+};
+
+const uint8_t Mips64RelativePatcherTest::kUnpatchedPcRelativeRawCode[] = {
+ 0x34, 0x12, 0x5E, 0xEE, // auipc s2, high(diff); placeholder = 0x1234
+ 0x78, 0x56, 0x52, 0x26, // addiu s2, s2, low(diff); placeholder = 0x5678
+};
+const uint8_t Mips64RelativePatcherTest::kUnpatchedPcRelativeCallRawCode[] = {
+ 0x34, 0x12, 0x3E, 0xEC, // auipc at, high(diff); placeholder = 0x1234
+ 0x78, 0x56, 0x01, 0xF8, // jialc at, low(diff); placeholder = 0x5678
+};
+const uint32_t Mips64RelativePatcherTest::kLiteralOffset = 0; // At auipc (where patching starts).
+const uint32_t Mips64RelativePatcherTest::kAnchorOffset = 0; // At auipc (where PC+0 points).
+const ArrayRef<const uint8_t> Mips64RelativePatcherTest::kUnpatchedPcRelativeCode(
+ kUnpatchedPcRelativeRawCode);
+const ArrayRef<const uint8_t> Mips64RelativePatcherTest::kUnpatchedPcRelativeCallCode(
+ kUnpatchedPcRelativeCallRawCode);
+
+void Mips64RelativePatcherTest::CheckPcRelativePatch(const ArrayRef<const LinkerPatch>& patches,
+ uint32_t target_offset) {
+ AddCompiledMethod(MethodRef(1u), kUnpatchedPcRelativeCode, ArrayRef<const LinkerPatch>(patches));
+ Link();
+
+ auto result = method_offset_map_.FindMethodOffset(MethodRef(1u));
+ ASSERT_TRUE(result.first);
+
+ uint32_t diff = target_offset - (result.second + kAnchorOffset);
+ diff += (diff & 0x8000) << 1; // Account for sign extension in instruction following auipc.
+
+ const uint8_t expected_code[] = {
+ static_cast<uint8_t>(diff >> 16), static_cast<uint8_t>(diff >> 24), 0x5E, 0xEE,
+ static_cast<uint8_t>(diff), static_cast<uint8_t>(diff >> 8), 0x52, 0x26,
+ };
+ EXPECT_TRUE(CheckLinkedMethod(MethodRef(1u), ArrayRef<const uint8_t>(expected_code)));
+}
+
+void Mips64RelativePatcherTest::TestDexCacheReference(uint32_t dex_cache_arrays_begin,
+ uint32_t element_offset) {
+ dex_cache_arrays_begin_ = dex_cache_arrays_begin;
+ LinkerPatch patches[] = {
+ LinkerPatch::DexCacheArrayPatch(kLiteralOffset, nullptr, kAnchorOffset, element_offset)
+ };
+ CheckPcRelativePatch(ArrayRef<const LinkerPatch>(patches),
+ dex_cache_arrays_begin_ + element_offset);
+}
+
+TEST_F(Mips64RelativePatcherTest, DexCacheReference) {
+ TestDexCacheReference(/* dex_cache_arrays_begin */ 0x12345678, /* element_offset */ 0x1234);
+}
+
+TEST_F(Mips64RelativePatcherTest, CallOther) {
+ LinkerPatch method1_patches[] = {
+ LinkerPatch::RelativeCodePatch(kLiteralOffset, nullptr, 2u),
+ };
+ AddCompiledMethod(MethodRef(1u),
+ kUnpatchedPcRelativeCallCode,
+ ArrayRef<const LinkerPatch>(method1_patches));
+ LinkerPatch method2_patches[] = {
+ LinkerPatch::RelativeCodePatch(kLiteralOffset, nullptr, 1u),
+ };
+ AddCompiledMethod(MethodRef(2u),
+ kUnpatchedPcRelativeCallCode,
+ ArrayRef<const LinkerPatch>(method2_patches));
+ Link();
+
+ uint32_t method1_offset = GetMethodOffset(1u);
+ uint32_t method2_offset = GetMethodOffset(2u);
+ uint32_t diff_after = method2_offset - (method1_offset + kAnchorOffset /* PC adjustment */);
+ diff_after += (diff_after & 0x8000) << 1; // Account for sign extension in jialc.
+ static const uint8_t method1_expected_code[] = {
+ static_cast<uint8_t>(diff_after >> 16), static_cast<uint8_t>(diff_after >> 24), 0x3E, 0xEC,
+ static_cast<uint8_t>(diff_after), static_cast<uint8_t>(diff_after >> 8), 0x01, 0xF8,
+ };
+ EXPECT_TRUE(CheckLinkedMethod(MethodRef(1u), ArrayRef<const uint8_t>(method1_expected_code)));
+ uint32_t diff_before = method1_offset - (method2_offset + kAnchorOffset /* PC adjustment */);
+ diff_before += (diff_before & 0x8000) << 1; // Account for sign extension in jialc.
+ static const uint8_t method2_expected_code[] = {
+ static_cast<uint8_t>(diff_before >> 16), static_cast<uint8_t>(diff_before >> 24), 0x3E, 0xEC,
+ static_cast<uint8_t>(diff_before), static_cast<uint8_t>(diff_before >> 8), 0x01, 0xF8,
+ };
+ EXPECT_TRUE(CheckLinkedMethod(MethodRef(2u), ArrayRef<const uint8_t>(method2_expected_code)));
+}
+
+} // namespace linker
+} // namespace art
diff --git a/compiler/linker/relative_patcher.cc b/compiler/linker/relative_patcher.cc
index 7765594..f1538b1 100644
--- a/compiler/linker/relative_patcher.cc
+++ b/compiler/linker/relative_patcher.cc
@@ -25,6 +25,9 @@
#ifdef ART_ENABLE_CODEGEN_mips
#include "linker/mips/relative_patcher_mips.h"
#endif
+#ifdef ART_ENABLE_CODEGEN_mips64
+#include "linker/mips64/relative_patcher_mips64.h"
+#endif
#ifdef ART_ENABLE_CODEGEN_x86
#include "linker/x86/relative_patcher_x86.h"
#endif
@@ -103,6 +106,10 @@
return std::unique_ptr<RelativePatcher>(
new MipsRelativePatcher(features->AsMipsInstructionSetFeatures()));
#endif
+#ifdef ART_ENABLE_CODEGEN_mips64
+ case kMips64:
+ return std::unique_ptr<RelativePatcher>(new Mips64RelativePatcher());
+#endif
default:
return std::unique_ptr<RelativePatcher>(new RelativePatcherNone);
}
diff --git a/compiler/linker/relative_patcher_test.h b/compiler/linker/relative_patcher_test.h
index 0151789..233daf4 100644
--- a/compiler/linker/relative_patcher_test.h
+++ b/compiler/linker/relative_patcher_test.h
@@ -163,7 +163,8 @@
offset + patch.LiteralOffset(),
target_offset);
} else if (patch.GetType() == LinkerPatch::Type::kStringRelative) {
- uint32_t target_offset = string_index_to_offset_map_.Get(patch.TargetStringIndex());
+ uint32_t target_offset =
+ string_index_to_offset_map_.Get(patch.TargetStringIndex().index_);
patcher_->PatchPcRelativeReference(&patched_code_,
patch,
offset + patch.LiteralOffset(),
diff --git a/compiler/oat_test.cc b/compiler/oat_test.cc
index 102637f..edc93ab 100644
--- a/compiler/oat_test.cc
+++ b/compiler/oat_test.cc
@@ -14,6 +14,8 @@
* limitations under the License.
*/
+#include "android-base/stringprintf.h"
+
#include "arch/instruction_set_features.h"
#include "art_method-inl.h"
#include "base/enums.h"
@@ -30,6 +32,8 @@
#include "elf_writer.h"
#include "elf_writer_quick.h"
#include "entrypoints/quick/quick_entrypoints.h"
+#include "linker/buffered_output_stream.h"
+#include "linker/file_output_stream.h"
#include "linker/multi_oat_relative_patcher.h"
#include "linker/vector_output_stream.h"
#include "mirror/class-inl.h"
@@ -46,7 +50,7 @@
va_list ap;
va_start(ap, fmt);
std::string error;
- StringAppendV(&error, fmt, ap);
+ android::base::StringAppendV(&error, fmt, ap);
LOG(FATAL) << error;
va_end(ap);
UNREACHABLE();
@@ -125,7 +129,9 @@
SafeMap<std::string, std::string>& key_value_store,
bool verify) {
TimingLogger timings("WriteElf", false, false);
- OatWriter oat_writer(/*compiling_boot_image*/false, &timings);
+ OatWriter oat_writer(/*compiling_boot_image*/false,
+ &timings,
+ /*profile_compilation_info*/nullptr);
for (const DexFile* dex_file : dex_files) {
ArrayRef<const uint8_t> raw_dex_file(
reinterpret_cast<const uint8_t*>(&dex_file->GetHeader()),
@@ -145,7 +151,9 @@
SafeMap<std::string, std::string>& key_value_store,
bool verify) {
TimingLogger timings("WriteElf", false, false);
- OatWriter oat_writer(/*compiling_boot_image*/false, &timings);
+ OatWriter oat_writer(/*compiling_boot_image*/false,
+ &timings,
+ /*profile_compilation_info*/nullptr);
for (const char* dex_filename : dex_filenames) {
if (!oat_writer.AddDexFileSource(dex_filename, dex_filename)) {
return false;
@@ -161,7 +169,9 @@
SafeMap<std::string, std::string>& key_value_store,
bool verify) {
TimingLogger timings("WriteElf", false, false);
- OatWriter oat_writer(/*compiling_boot_image*/false, &timings);
+ OatWriter oat_writer(/*compiling_boot_image*/false,
+ &timings,
+ /*profile_compilation_info*/nullptr);
if (!oat_writer.AddZippedDexFilesSource(std::move(zip_fd), location)) {
return false;
}
@@ -212,6 +222,17 @@
oat_writer.GetBssSize(),
oat_writer.GetBssRootsOffset());
+ if (kIsVdexEnabled) {
+ std::unique_ptr<BufferedOutputStream> vdex_out(
+ MakeUnique<BufferedOutputStream>(MakeUnique<FileOutputStream>(vdex_file)));
+ if (!oat_writer.WriteVerifierDeps(vdex_out.get(), nullptr)) {
+ return false;
+ }
+ if (!oat_writer.WriteChecksumsAndVdexHeader(vdex_out.get())) {
+ return false;
+ }
+ }
+
if (!oat_writer.WriteRodata(oat_rodata)) {
return false;
}
diff --git a/compiler/oat_writer.cc b/compiler/oat_writer.cc
index f9173f5..bebd5f5 100644
--- a/compiler/oat_writer.cc
+++ b/compiler/oat_writer.cc
@@ -33,6 +33,7 @@
#include "debug/method_debug_info.h"
#include "dex/verification_results.h"
#include "dex_file-inl.h"
+#include "dexlayout.h"
#include "driver/compiler_driver.h"
#include "driver/compiler_options.h"
#include "gc/space/image_space.h"
@@ -260,16 +261,7 @@
// Data to write to a separate section.
dchecked_vector<uint32_t> class_offsets_;
- void InitTypeLookupTable(const DexFile& dex_file, uint8_t* storage) const {
- lookup_table_.reset(TypeLookupTable::Create(dex_file, storage));
- }
-
- TypeLookupTable* GetTypeLookupTable() const {
- return lookup_table_.get();
- }
-
private:
- mutable std::unique_ptr<TypeLookupTable> lookup_table_;
size_t GetClassOffsetsRawSize() const {
return class_offsets_.size() * sizeof(class_offsets_[0]);
}
@@ -285,7 +277,7 @@
DCHECK_EQ(static_cast<off_t>(file_offset + offset_), out->Seek(0, kSeekCurrent)) \
<< "file_offset=" << file_offset << " offset_=" << offset_
-OatWriter::OatWriter(bool compiling_boot_image, TimingLogger* timings)
+OatWriter::OatWriter(bool compiling_boot_image, TimingLogger* timings, ProfileCompilationInfo* info)
: write_state_(WriteState::kAddingDexFileSources),
timings_(timings),
raw_dex_files_(),
@@ -308,6 +300,7 @@
oat_data_offset_(0u),
oat_header_(nullptr),
size_vdex_header_(0),
+ size_vdex_checksums_(0),
size_dex_file_alignment_(0),
size_executable_offset_alignment_(0),
size_oat_header_(0),
@@ -346,7 +339,8 @@
size_oat_class_method_bitmaps_(0),
size_oat_class_method_offsets_(0),
relative_patcher_(nullptr),
- absolute_patch_locations_() {
+ absolute_patch_locations_(),
+ profile_compilation_info_(info) {
}
bool OatWriter::AddDexFileSource(const char* filename,
@@ -410,6 +404,43 @@
return true;
}
+// Add dex file source(s) from a vdex file specified by a file handle.
+bool OatWriter::AddVdexDexFilesSource(const VdexFile& vdex_file,
+ const char* location,
+ CreateTypeLookupTable create_type_lookup_table) {
+ DCHECK(write_state_ == WriteState::kAddingDexFileSources);
+ const uint8_t* current_dex_data = nullptr;
+ for (size_t i = 0; i < vdex_file.GetHeader().GetNumberOfDexFiles(); ++i) {
+ current_dex_data = vdex_file.GetNextDexFileData(current_dex_data);
+ if (current_dex_data == nullptr) {
+ LOG(ERROR) << "Unexpected number of dex files in vdex " << location;
+ return false;
+ }
+ if (!DexFile::IsMagicValid(current_dex_data)) {
+ LOG(ERROR) << "Invalid magic in vdex file created from " << location;
+ return false;
+ }
+ // We used `zipped_dex_file_locations_` to keep the strings in memory.
+ zipped_dex_file_locations_.push_back(DexFile::GetMultiDexLocation(i, location));
+ const char* full_location = zipped_dex_file_locations_.back().c_str();
+ oat_dex_files_.emplace_back(full_location,
+ DexFileSource(current_dex_data),
+ create_type_lookup_table);
+ oat_dex_files_.back().dex_file_location_checksum_ = vdex_file.GetLocationChecksum(i);
+ }
+
+ if (vdex_file.GetNextDexFileData(current_dex_data) != nullptr) {
+ LOG(ERROR) << "Unexpected number of dex files in vdex " << location;
+ return false;
+ }
+
+ if (oat_dex_files_.empty()) {
+ LOG(ERROR) << "No dex files in vdex file created from " << location;
+ return false;
+ }
+ return true;
+}
+
// Add dex file source from raw memory.
bool OatWriter::AddRawDexFileSource(const ArrayRef<const uint8_t>& data,
const char* location,
@@ -466,8 +497,8 @@
// Initialize VDEX and OAT headers.
if (kIsVdexEnabled) {
- size_vdex_header_ = sizeof(VdexFile::Header);
- vdex_size_ = size_vdex_header_;
+ // Reserve space for Vdex header and checksums.
+ vdex_size_ = sizeof(VdexFile::Header) + oat_dex_files_.size() * sizeof(VdexFile::VdexChecksum);
}
size_t oat_data_offset = InitOatHeader(instruction_set,
instruction_set_features,
@@ -771,7 +802,7 @@
// Update quick method header.
DCHECK_LT(method_offsets_index_, oat_class->method_headers_.size());
OatQuickMethodHeader* method_header = &oat_class->method_headers_[method_offsets_index_];
- uint32_t vmap_table_offset = method_header->vmap_table_offset_;
+ uint32_t vmap_table_offset = method_header->GetVmapTableOffset();
// The code offset was 0 when the mapping/vmap table offset was set, so it's set
// to 0-offset and we need to adjust it by code_offset.
uint32_t code_offset = quick_code_offset - thumb_offset;
@@ -913,7 +944,7 @@
// If vdex is enabled, we only emit the stack map of compiled code. The quickening info will
// be in the vdex file.
if (!compiled_method->GetQuickCode().empty() || !kIsVdexEnabled) {
- DCHECK_EQ(oat_class->method_headers_[method_offsets_index_].vmap_table_offset_, 0u);
+ DCHECK_EQ(oat_class->method_headers_[method_offsets_index_].GetVmapTableOffset(), 0u);
ArrayRef<const uint8_t> map = compiled_method->GetVmapTable();
uint32_t map_size = map.size() * sizeof(map[0]);
@@ -927,7 +958,7 @@
});
// Code offset is not initialized yet, so set the map offset to 0u-offset.
DCHECK_EQ(oat_class->method_offsets_[method_offsets_index_].code_offset_, 0u);
- oat_class->method_headers_[method_offsets_index_].vmap_table_offset_ = 0u - offset;
+ oat_class->method_headers_[method_offsets_index_].SetVmapTableOffset(0u - offset);
}
}
++method_offsets_index_;
@@ -1384,7 +1415,7 @@
size_t file_offset = file_offset_;
OutputStream* out = out_;
- uint32_t map_offset = oat_class->method_headers_[method_offsets_index_].vmap_table_offset_;
+ uint32_t map_offset = oat_class->method_headers_[method_offsets_index_].GetVmapTableOffset();
uint32_t code_offset = oat_class->method_offsets_[method_offsets_index_].code_offset_;
++method_offsets_index_;
@@ -1815,6 +1846,7 @@
size_total += (x);
DO_STAT(size_vdex_header_);
+ DO_STAT(size_vdex_checksums_);
DO_STAT(size_dex_file_alignment_);
DO_STAT(size_executable_offset_alignment_);
DO_STAT(size_oat_header_);
@@ -2090,7 +2122,11 @@
if (!SeekToDexFile(out, file, oat_dex_file)) {
return false;
}
- if (oat_dex_file->source_.IsZipEntry()) {
+ if (profile_compilation_info_ != nullptr) {
+ if (!LayoutAndWriteDexFile(out, oat_dex_file)) {
+ return false;
+ }
+ } else if (oat_dex_file->source_.IsZipEntry()) {
if (!WriteDexFile(out, file, oat_dex_file, oat_dex_file->source_.GetZipEntry())) {
return false;
}
@@ -2155,6 +2191,39 @@
return true;
}
+bool OatWriter::LayoutAndWriteDexFile(OutputStream* out, OatDexFile* oat_dex_file) {
+ TimingLogger::ScopedTiming split("Dex Layout", timings_);
+ std::string error_msg;
+ std::string location(oat_dex_file->GetLocation());
+ std::unique_ptr<const DexFile> dex_file;
+ if (oat_dex_file->source_.IsZipEntry()) {
+ ZipEntry* zip_entry = oat_dex_file->source_.GetZipEntry();
+ std::unique_ptr<MemMap> mem_map(
+ zip_entry->ExtractToMemMap(location.c_str(), "classes.dex", &error_msg));
+ dex_file = DexFile::Open(location,
+ zip_entry->GetCrc32(),
+ std::move(mem_map),
+ /* verify */ true,
+ /* verify_checksum */ true,
+ &error_msg);
+ } else {
+ DCHECK(oat_dex_file->source_.IsRawFile());
+ File* raw_file = oat_dex_file->source_.GetRawFile();
+ dex_file = DexFile::OpenDex(raw_file->Fd(), location, /* verify_checksum */ true, &error_msg);
+ }
+ Options options;
+ options.output_to_memmap_ = true;
+ DexLayout dex_layout(options, profile_compilation_info_, nullptr);
+ dex_layout.ProcessDexFile(location.c_str(), dex_file.get(), 0);
+ std::unique_ptr<MemMap> mem_map(dex_layout.GetAndReleaseMemMap());
+ if (!WriteDexFile(out, oat_dex_file, mem_map->Begin())) {
+ return false;
+ }
+ // Set the checksum of the new oat dex file to be the original file's checksum.
+ oat_dex_file->dex_file_location_checksum_ = dex_file->GetLocationChecksum();
+ return true;
+}
+
bool OatWriter::WriteDexFile(OutputStream* out,
File* file,
OatDexFile* oat_dex_file,
@@ -2324,6 +2393,7 @@
// Update dex file size and resize class offsets in the OatDexFile.
// Note: For raw data, the checksum is passed directly to AddRawDexFileSource().
+ // Note: For vdex, the checksum is copied from the existing vdex file.
oat_dex_file->dex_file_size_ = header->file_size_;
oat_dex_file->class_offsets_.resize(header->class_defs_size_);
return true;
@@ -2481,8 +2551,15 @@
// Create the lookup table. When `nullptr` is given as the storage buffer,
// TypeLookupTable allocates its own and OatDexFile takes ownership.
- oat_dex_file->InitTypeLookupTable(*opened_dex_files[i], /* storage */ nullptr);
- TypeLookupTable* table = oat_dex_file->GetTypeLookupTable();
+ const DexFile& dex_file = *opened_dex_files[i];
+ {
+ std::unique_ptr<TypeLookupTable> type_lookup_table =
+ TypeLookupTable::Create(dex_file, /* storage */ nullptr);
+ type_lookup_table_oat_dex_files_.push_back(
+ std::make_unique<art::OatDexFile>(std::move(type_lookup_table)));
+ dex_file.SetOatDexFile(type_lookup_table_oat_dex_files_.back().get());
+ }
+ TypeLookupTable* const table = type_lookup_table_oat_dex_files_.back()->GetTypeLookupTable();
// Type tables are required to be 4 byte aligned.
size_t initial_offset = oat_size_;
@@ -2526,11 +2603,31 @@
return true;
}
-bool OatWriter::WriteVdexHeader(OutputStream* vdex_out) {
+bool OatWriter::WriteChecksumsAndVdexHeader(OutputStream* vdex_out) {
if (!kIsVdexEnabled) {
return true;
}
- off_t actual_offset = vdex_out->Seek(0, kSeekSet);
+ // Write checksums
+ off_t actual_offset = vdex_out->Seek(sizeof(VdexFile::Header), kSeekSet);
+ if (actual_offset != sizeof(VdexFile::Header)) {
+ PLOG(ERROR) << "Failed to seek to the checksum location of vdex file. Actual: " << actual_offset
+ << " File: " << vdex_out->GetLocation();
+ return false;
+ }
+
+ for (size_t i = 0, size = oat_dex_files_.size(); i != size; ++i) {
+ OatDexFile* oat_dex_file = &oat_dex_files_[i];
+ if (!vdex_out->WriteFully(
+ &oat_dex_file->dex_file_location_checksum_, sizeof(VdexFile::VdexChecksum))) {
+ PLOG(ERROR) << "Failed to write dex file location checksum. File: "
+ << vdex_out->GetLocation();
+ return false;
+ }
+ size_vdex_checksums_ += sizeof(VdexFile::VdexChecksum);
+ }
+
+ // Write header.
+ actual_offset = vdex_out->Seek(0, kSeekSet);
if (actual_offset != 0) {
PLOG(ERROR) << "Failed to seek to the beginning of vdex file. Actual: " << actual_offset
<< " File: " << vdex_out->GetLocation();
@@ -2544,12 +2641,15 @@
size_t verifier_deps_section_size = vdex_quickening_info_offset_ - vdex_verifier_deps_offset_;
size_t quickening_info_section_size = vdex_size_ - vdex_quickening_info_offset_;
- VdexFile::Header vdex_header(
- dex_section_size, verifier_deps_section_size, quickening_info_section_size);
+ VdexFile::Header vdex_header(oat_dex_files_.size(),
+ dex_section_size,
+ verifier_deps_section_size,
+ quickening_info_section_size);
if (!vdex_out->WriteFully(&vdex_header, sizeof(VdexFile::Header))) {
PLOG(ERROR) << "Failed to write vdex header. File: " << vdex_out->GetLocation();
return false;
}
+ size_vdex_header_ = sizeof(VdexFile::Header);
if (!vdex_out->Flush()) {
PLOG(ERROR) << "Failed to flush stream after writing to vdex file."
diff --git a/compiler/oat_writer.h b/compiler/oat_writer.h
index 3d08ad3..da221d6 100644
--- a/compiler/oat_writer.h
+++ b/compiler/oat_writer.h
@@ -38,9 +38,11 @@
class CompiledMethod;
class CompilerDriver;
class ImageWriter;
+class ProfileCompilationInfo;
class OutputStream;
class TimingLogger;
class TypeLookupTable;
+class VdexFile;
class ZipEntry;
namespace debug {
@@ -110,18 +112,19 @@
kDefault = kCreate
};
- OatWriter(bool compiling_boot_image, TimingLogger* timings);
+ OatWriter(bool compiling_boot_image, TimingLogger* timings, ProfileCompilationInfo* info);
// To produce a valid oat file, the user must first add sources with any combination of
// - AddDexFileSource(),
// - AddZippedDexFilesSource(),
- // - AddRawDexFileSource().
+ // - AddRawDexFileSource(),
+ // - AddVdexDexFilesSource().
// Then the user must call in order
// - WriteAndOpenDexFiles()
// - Initialize()
// - WriteVerifierDeps()
// - WriteQuickeningInfo()
- // - WriteVdexHeader()
+ // - WriteChecksumsAndVdexHeader()
// - PrepareLayout(),
// - WriteRodata(),
// - WriteCode(),
@@ -144,6 +147,11 @@
const char* location,
uint32_t location_checksum,
CreateTypeLookupTable create_type_lookup_table = CreateTypeLookupTable::kDefault);
+ // Add dex file source(s) from a vdex file.
+ bool AddVdexDexFilesSource(
+ const VdexFile& vdex_file,
+ const char* location,
+ CreateTypeLookupTable create_type_lookup_table = CreateTypeLookupTable::kDefault);
dchecked_vector<const char*> GetSourceLocations() const;
// Write raw dex files to the vdex file, mmap the file and open the dex files from it.
@@ -160,7 +168,7 @@
/*out*/ std::vector<std::unique_ptr<const DexFile>>* opened_dex_files);
bool WriteQuickeningInfo(OutputStream* vdex_out);
bool WriteVerifierDeps(OutputStream* vdex_out, verifier::VerifierDeps* verifier_deps);
- bool WriteVdexHeader(OutputStream* vdex_out);
+ bool WriteChecksumsAndVdexHeader(OutputStream* vdex_out);
// Initialize the writer with the given parameters.
void Initialize(const CompilerDriver* compiler,
ImageWriter* image_writer,
@@ -258,6 +266,7 @@
bool WriteDexFiles(OutputStream* out, File* file);
bool WriteDexFile(OutputStream* out, File* file, OatDexFile* oat_dex_file);
bool SeekToDexFile(OutputStream* out, File* file, OatDexFile* oat_dex_file);
+ bool LayoutAndWriteDexFile(OutputStream* out, OatDexFile* oat_dex_file);
bool WriteDexFile(OutputStream* out,
File* file,
OatDexFile* oat_dex_file,
@@ -363,6 +372,9 @@
// Offset of the oat data from the start of the mmapped region of the elf file.
size_t oat_data_offset_;
+ // Fake OatDexFiles to hold type lookup tables for the compiler.
+ std::vector<std::unique_ptr<art::OatDexFile>> type_lookup_table_oat_dex_files_;
+
// data to write
std::unique_ptr<OatHeader> oat_header_;
dchecked_vector<OatDexFile> oat_dex_files_;
@@ -375,6 +387,7 @@
// output stats
uint32_t size_vdex_header_;
+ uint32_t size_vdex_checksums_;
uint32_t size_dex_file_alignment_;
uint32_t size_executable_offset_alignment_;
uint32_t size_oat_header_;
@@ -419,6 +432,9 @@
// The locations of absolute patches relative to the start of the executable section.
dchecked_vector<uintptr_t> absolute_patch_locations_;
+ // Profile info used to generate new layout of files.
+ ProfileCompilationInfo* profile_compilation_info_;
+
DISALLOW_COPY_AND_ASSIGN(OatWriter);
};
diff --git a/compiler/optimizing/bounds_check_elimination_test.cc b/compiler/optimizing/bounds_check_elimination_test.cc
index b7c24ff..dfa1504 100644
--- a/compiler/optimizing/bounds_check_elimination_test.cc
+++ b/compiler/optimizing/bounds_check_elimination_test.cc
@@ -70,9 +70,9 @@
graph_->AddBlock(entry);
graph_->SetEntryBlock(entry);
HInstruction* parameter1 = new (&allocator_)
- HParameterValue(graph_->GetDexFile(), 0, 0, Primitive::kPrimNot); // array
+ HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot); // array
HInstruction* parameter2 = new (&allocator_)
- HParameterValue(graph_->GetDexFile(), 0, 0, Primitive::kPrimInt); // i
+ HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt); // i
entry->AddInstruction(parameter1);
entry->AddInstruction(parameter2);
@@ -167,9 +167,9 @@
graph_->AddBlock(entry);
graph_->SetEntryBlock(entry);
HInstruction* parameter1 = new (&allocator_)
- HParameterValue(graph_->GetDexFile(), 0, 0, Primitive::kPrimNot); // array
+ HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot); // array
HInstruction* parameter2 = new (&allocator_)
- HParameterValue(graph_->GetDexFile(), 0, 0, Primitive::kPrimInt); // i
+ HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt); // i
entry->AddInstruction(parameter1);
entry->AddInstruction(parameter2);
@@ -231,9 +231,9 @@
graph_->AddBlock(entry);
graph_->SetEntryBlock(entry);
HInstruction* parameter1 = new (&allocator_)
- HParameterValue(graph_->GetDexFile(), 0, 0, Primitive::kPrimNot); // array
+ HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot); // array
HInstruction* parameter2 = new (&allocator_)
- HParameterValue(graph_->GetDexFile(), 0, 0, Primitive::kPrimInt); // i
+ HParameterValue(graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt); // i
entry->AddInstruction(parameter1);
entry->AddInstruction(parameter2);
@@ -295,7 +295,7 @@
graph_->AddBlock(entry);
graph_->SetEntryBlock(entry);
HInstruction* parameter = new (&allocator_) HParameterValue(
- graph_->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
entry->AddInstruction(parameter);
HInstruction* constant_5 = graph_->GetIntConstant(5);
@@ -364,7 +364,7 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter = new (allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
entry->AddInstruction(parameter);
HInstruction* constant_initial = graph->GetIntConstant(initial);
@@ -479,7 +479,7 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter = new (allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
entry->AddInstruction(parameter);
HInstruction* constant_initial = graph->GetIntConstant(initial);
@@ -600,7 +600,7 @@
constant_10,
graph->GetCurrentMethod(),
0,
- Primitive::kPrimInt,
+ dex::TypeIndex(static_cast<uint16_t>(Primitive::kPrimInt)),
graph->GetDexFile(),
kQuickAllocArray);
block->AddInstruction(new_array);
@@ -692,7 +692,7 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter = new (allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
entry->AddInstruction(parameter);
HInstruction* constant_initial = graph->GetIntConstant(initial);
@@ -795,7 +795,7 @@
graph_->AddBlock(entry);
graph_->SetEntryBlock(entry);
HInstruction* parameter = new (&allocator_) HParameterValue(
- graph_->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
entry->AddInstruction(parameter);
HInstruction* constant_0 = graph_->GetIntConstant(0);
diff --git a/compiler/optimizing/code_generator.cc b/compiler/optimizing/code_generator.cc
index 8b450e1..402eeee 100644
--- a/compiler/optimizing/code_generator.cc
+++ b/compiler/optimizing/code_generator.cc
@@ -304,6 +304,7 @@
SetFrameSize(RoundUp(
first_register_slot_in_slow_path_
+ maximum_safepoint_spill_size
+ + (GetGraph()->HasShouldDeoptimizeFlag() ? kShouldDeoptimizeFlagSize : 0)
+ FrameEntrySpillSize(),
kStackAlignment));
}
@@ -1375,4 +1376,41 @@
return klass->GetDisableIntrinsicFlagOffset().Uint32Value();
}
+void CodeGenerator::EmitJitRoots(uint8_t* code,
+ Handle<mirror::ObjectArray<mirror::Object>> roots,
+ const uint8_t* roots_data,
+ Handle<mirror::DexCache> outer_dex_cache) {
+ DCHECK_EQ(static_cast<size_t>(roots->GetLength()), GetNumberOfJitRoots());
+ StackHandleScope<1> hs(Thread::Current());
+ MutableHandle<mirror::DexCache> h_dex_cache(hs.NewHandle<mirror::DexCache>(nullptr));
+ ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+ size_t index = 0;
+ for (auto& entry : jit_string_roots_) {
+ const DexFile& entry_dex_file = *entry.first.dex_file;
+ // Avoid the expensive FindDexCache call by checking if the string is
+ // in the compiled method's dex file.
+ h_dex_cache.Assign(IsSameDexFile(*outer_dex_cache->GetDexFile(), entry_dex_file)
+ ? outer_dex_cache.Get()
+ : class_linker->FindDexCache(hs.Self(), entry_dex_file));
+ mirror::String* string = class_linker->LookupString(
+ entry_dex_file, entry.first.string_index, h_dex_cache);
+ DCHECK(string != nullptr) << "JIT roots require strings to have been loaded";
+ // Ensure the string is strongly interned. This is a requirement on how the JIT
+ // handles strings. b/32995596
+ class_linker->GetInternTable()->InternStrong(string);
+ roots->Set(index, string);
+ entry.second = index;
+ ++index;
+ }
+ for (auto& entry : jit_class_roots_) {
+ // Update the `roots` with the class, and replace the address temporarily
+ // stored to the index in the table.
+ uint64_t address = entry.second;
+ roots->Set(index, reinterpret_cast<StackReference<mirror::Class>*>(address)->AsMirrorPtr());
+ entry.second = index;
+ ++index;
+ }
+ EmitJitRootPatches(code, roots_data);
+}
+
} // namespace art
diff --git a/compiler/optimizing/code_generator.h b/compiler/optimizing/code_generator.h
index bf246ad..2e2c3c0 100644
--- a/compiler/optimizing/code_generator.h
+++ b/compiler/optimizing/code_generator.h
@@ -32,7 +32,9 @@
#include "optimizing_compiler_stats.h"
#include "read_barrier_option.h"
#include "stack_map_stream.h"
+#include "string_reference.h"
#include "utils/label.h"
+#include "utils/type_reference.h"
namespace art {
@@ -306,6 +308,12 @@
return POPCOUNT(GetSlowPathSpills(locations, core_registers));
}
+ size_t GetStackOffsetOfShouldDeoptimizeFlag() const {
+ DCHECK(GetGraph()->HasShouldDeoptimizeFlag());
+ DCHECK_GE(GetFrameSize(), FrameEntrySpillSize() + kShouldDeoptimizeFlagSize);
+ return GetFrameSize() - FrameEntrySpillSize() - kShouldDeoptimizeFlagSize;
+ }
+
// Record native to dex mapping for a suspend point. Required by runtime.
void RecordPcInfo(HInstruction* instruction, uint32_t dex_pc, SlowPathCode* slow_path = nullptr);
// Check whether we have already recorded mapping at this PC.
@@ -335,6 +343,17 @@
void BuildStackMaps(MemoryRegion region, const DexFile::CodeItem& code_item);
size_t ComputeStackMapsSize();
+ size_t GetNumberOfJitRoots() const {
+ return jit_string_roots_.size() + jit_class_roots_.size();
+ }
+
+ // Fills the `literals` array with literals collected during code generation.
+ // Also emits literal patches.
+ void EmitJitRoots(uint8_t* code,
+ Handle<mirror::ObjectArray<mirror::Object>> roots,
+ const uint8_t* roots_data,
+ Handle<mirror::DexCache> outer_dex_cache)
+ REQUIRES_SHARED(Locks::mutator_lock_);
bool IsLeafMethod() const {
return is_leaf_;
@@ -515,6 +534,26 @@
virtual HLoadClass::LoadKind GetSupportedLoadClassKind(
HLoadClass::LoadKind desired_class_load_kind) = 0;
+ static LocationSummary::CallKind GetLoadStringCallKind(HLoadString* load) {
+ switch (load->GetLoadKind()) {
+ case HLoadString::LoadKind::kBssEntry:
+ DCHECK(load->NeedsEnvironment());
+ return LocationSummary::kCallOnSlowPath;
+ case HLoadString::LoadKind::kDexCacheViaMethod:
+ DCHECK(load->NeedsEnvironment());
+ return LocationSummary::kCallOnMainOnly;
+ case HLoadString::LoadKind::kJitTableAddress:
+ DCHECK(!load->NeedsEnvironment());
+ return kEmitCompilerReadBarrier
+ ? LocationSummary::kCallOnSlowPath
+ : LocationSummary::kNoCall;
+ break;
+ default:
+ DCHECK(!load->NeedsEnvironment());
+ return LocationSummary::kNoCall;
+ }
+ }
+
// Check if the desired_dispatch_info is supported. If it is, return it,
// otherwise return a fall-back info that should be used instead.
virtual HInvokeStaticOrDirect::DispatchInfo GetSupportedInvokeStaticOrDirectDispatch(
@@ -571,6 +610,10 @@
fpu_callee_save_mask_(fpu_callee_save_mask),
stack_map_stream_(graph->GetArena()),
block_order_(nullptr),
+ jit_string_roots_(StringReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_class_roots_(TypeReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
disasm_info_(nullptr),
stats_(stats),
graph_(graph),
@@ -637,6 +680,13 @@
return current_slow_path_;
}
+ // Emit the patches assocatied with JIT roots. Only applies to JIT compiled code.
+ virtual void EmitJitRootPatches(uint8_t* code ATTRIBUTE_UNUSED,
+ const uint8_t* roots_data ATTRIBUTE_UNUSED) {
+ DCHECK_EQ(jit_string_roots_.size(), 0u);
+ DCHECK_EQ(jit_class_roots_.size(), 0u);
+ }
+
// Frame size required for this method.
uint32_t frame_size_;
uint32_t core_spill_mask_;
@@ -662,6 +712,16 @@
// The order to use for code generation.
const ArenaVector<HBasicBlock*>* block_order_;
+ // Maps a StringReference (dex_file, string_index) to the index in the literal table.
+ // Entries are intially added with a 0 index, and `EmitJitRoots` will compute all the
+ // indices.
+ ArenaSafeMap<StringReference, uint32_t, StringReferenceValueComparator> jit_string_roots_;
+
+ // Maps a ClassReference (dex_file, type_index) to the index in the literal table.
+ // Entries are intially added with a pointer in the handle zone, and `EmitJitRoots`
+ // will compute all the indices.
+ ArenaSafeMap<TypeReference, uint64_t, TypeReferenceValueComparator> jit_class_roots_;
+
DisassemblyInformation* disasm_info_;
private:
diff --git a/compiler/optimizing/code_generator_arm.cc b/compiler/optimizing/code_generator_arm.cc
index 7c3a2c6..8104613 100644
--- a/compiler/optimizing/code_generator_arm.cc
+++ b/compiler/optimizing/code_generator_arm.cc
@@ -383,7 +383,7 @@
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- __ LoadImmediate(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex());
+ __ LoadImmediate(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType;
arm_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
@@ -430,7 +430,7 @@
LocationSummary* locations = instruction_->GetLocations();
DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(locations->Out().reg()));
HLoadString* load = instruction_->AsLoadString();
- const uint32_t string_index = load->GetStringIndex();
+ const uint32_t string_index = load->GetStringIndex().index_;
Register out = locations->Out().AsRegister<Register>();
Register temp = locations->GetTemp(0).AsRegister<Register>();
constexpr bool call_saves_everything_except_r0 = (!kUseReadBarrier || kUseBakerReadBarrier);
@@ -1214,7 +1214,11 @@
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
boot_image_address_patches_(std::less<uint32_t>(),
- graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_string_patches_(StringReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_class_patches_(TypeReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
// Always save the LR register to mimic Quick.
AddAllocatedRegister(Location::RegisterLocation(LR));
}
@@ -1327,6 +1331,13 @@
__ cfi().AdjustCFAOffset(kArmWordSize * POPCOUNT(fpu_spill_mask_));
__ cfi().RelOffsetForMany(DWARFReg(S0), 0, fpu_spill_mask_, kArmWordSize);
}
+
+ if (GetGraph()->HasShouldDeoptimizeFlag()) {
+ // Initialize should_deoptimize flag to 0.
+ __ mov(IP, ShifterOperand(0));
+ __ StoreToOffset(kStoreWord, IP, SP, -kShouldDeoptimizeFlagSize);
+ }
+
int adjust = GetFrameSize() - FrameEntrySpillSize();
__ AddConstant(SP, -adjust);
__ cfi().AdjustCFAOffset(adjust);
@@ -1942,6 +1953,19 @@
/* false_target */ nullptr);
}
+void LocationsBuilderARM::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ LocationSummary* locations = new (GetGraph()->GetArena())
+ LocationSummary(flag, LocationSummary::kNoCall);
+ locations->SetOut(Location::RequiresRegister());
+}
+
+void InstructionCodeGeneratorARM::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ __ LoadFromOffset(kLoadWord,
+ flag->GetLocations()->Out().AsRegister<Register>(),
+ SP,
+ codegen_->GetStackOffsetOfShouldDeoptimizeFlag());
+}
+
void LocationsBuilderARM::VisitSelect(HSelect* select) {
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select);
if (Primitive::IsFloatingPointType(select->GetType())) {
@@ -3951,7 +3975,7 @@
void InstructionCodeGeneratorARM::VisitNewArray(HNewArray* instruction) {
InvokeRuntimeCallingConvention calling_convention;
- __ LoadImmediate(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex());
+ __ LoadImmediate(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex().index_);
// Note: if heap poisoning is enabled, the entry point takes cares
// of poisoning the reference.
codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
@@ -5690,8 +5714,7 @@
break;
case HLoadClass::LoadKind::kBootImageAddress:
break;
- case HLoadClass::LoadKind::kDexCacheAddress:
- DCHECK(Runtime::Current()->UseJitCompilation());
+ case HLoadClass::LoadKind::kJitTableAddress:
break;
case HLoadClass::LoadKind::kDexCachePcRelative:
DCHECK(!Runtime::Current()->UseJitCompilation());
@@ -5741,7 +5764,7 @@
void InstructionCodeGeneratorARM::VisitLoadClass(HLoadClass* cls) {
LocationSummary* locations = cls->GetLocations();
if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex());
+ codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
return;
@@ -5792,22 +5815,12 @@
__ LoadLiteral(out, codegen_->DeduplicateBootImageAddressLiteral(address));
break;
}
- case HLoadClass::LoadKind::kDexCacheAddress: {
- DCHECK_NE(cls->GetAddress(), 0u);
- uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
- // 16-bit LDR immediate has a 5-bit offset multiplied by the size and that gives
- // a 128B range. To try and reduce the number of literals if we load multiple types,
- // simply split the dex cache address to a 128B aligned base loaded from a literal
- // and the remaining offset embedded in the load.
- static_assert(sizeof(GcRoot<mirror::Class>) == 4u, "Expected GC root to be 4 bytes.");
- DCHECK_ALIGNED(cls->GetAddress(), 4u);
- constexpr size_t offset_bits = /* encoded bits */ 5 + /* scale */ 2;
- uint32_t base_address = address & ~MaxInt<uint32_t>(offset_bits);
- uint32_t offset = address & MaxInt<uint32_t>(offset_bits);
- __ LoadLiteral(out, codegen_->DeduplicateDexCacheAddressLiteral(base_address));
- // /* GcRoot<mirror::Class> */ out = *(base_address + offset)
- GenerateGcRootFieldLoad(cls, out_loc, out, offset, read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
+ case HLoadClass::LoadKind::kJitTableAddress: {
+ __ LoadLiteral(out, codegen_->DeduplicateJitClassLiteral(cls->GetDexFile(),
+ cls->GetTypeIndex(),
+ cls->GetAddress()));
+ // /* GcRoot<mirror::Class> */ out = *out
+ GenerateGcRootFieldLoad(cls, out_loc, out, /* offset */ 0, kCompilerReadBarrierOption);
break;
}
case HLoadClass::LoadKind::kDexCachePcRelative: {
@@ -5828,7 +5841,7 @@
current_method,
ArtMethod::DexCacheResolvedTypesOffset(kArmPointerSize).Int32Value());
// /* GcRoot<mirror::Class> */ out = out[type_index]
- size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex());
+ size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_);
GenerateGcRootFieldLoad(cls, out_loc, out, offset, read_barrier_option);
generate_null_check = !cls->IsInDexCache();
}
@@ -5893,6 +5906,9 @@
case HLoadString::LoadKind::kBssEntry:
DCHECK(!Runtime::Current()->UseJitCompilation());
break;
+ case HLoadString::LoadKind::kJitTableAddress:
+ DCHECK(Runtime::Current()->UseJitCompilation());
+ break;
case HLoadString::LoadKind::kDexCacheViaMethod:
break;
}
@@ -5900,13 +5916,8 @@
}
void LocationsBuilderARM::VisitLoadString(HLoadString* load) {
- LocationSummary::CallKind call_kind = load->NeedsEnvironment()
- ? ((load->GetLoadKind() == HLoadString::LoadKind::kDexCacheViaMethod)
- ? LocationSummary::kCallOnMainOnly
- : LocationSummary::kCallOnSlowPath)
- : LocationSummary::kNoCall;
+ LocationSummary::CallKind call_kind = CodeGenerator::GetLoadStringCallKind(load);
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(load, call_kind);
-
HLoadString::LoadKind load_kind = load->GetLoadKind();
if (load_kind == HLoadString::LoadKind::kDexCacheViaMethod) {
locations->SetOut(Location::RegisterLocation(R0));
@@ -5946,7 +5957,7 @@
case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
DCHECK(codegen_->GetCompilerOptions().IsBootImage());
CodeGeneratorARM::PcRelativePatchInfo* labels =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
__ BindTrackedLabel(&labels->movw_label);
__ movw(out, /* placeholder */ 0u);
__ BindTrackedLabel(&labels->movt_label);
@@ -5965,7 +5976,7 @@
DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
Register temp = locations->GetTemp(0).AsRegister<Register>();
CodeGeneratorARM::PcRelativePatchInfo* labels =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
__ BindTrackedLabel(&labels->movw_label);
__ movw(temp, /* placeholder */ 0u);
__ BindTrackedLabel(&labels->movt_label);
@@ -5979,6 +5990,13 @@
__ Bind(slow_path->GetExitLabel());
return;
}
+ case HLoadString::LoadKind::kJitTableAddress: {
+ __ LoadLiteral(out, codegen_->DeduplicateJitStringLiteral(load->GetDexFile(),
+ load->GetStringIndex()));
+ // /* GcRoot<mirror::String> */ out = *out
+ GenerateGcRootFieldLoad(load, out_loc, out, /* offset */ 0, kCompilerReadBarrierOption);
+ return;
+ }
default:
break;
}
@@ -5987,7 +6005,7 @@
DCHECK(load_kind == HLoadString::LoadKind::kDexCacheViaMethod);
InvokeRuntimeCallingConvention calling_convention;
DCHECK_EQ(calling_convention.GetRegisterAt(0), out);
- __ LoadImmediate(calling_convention.GetRegisterAt(0), load->GetStringIndex());
+ __ LoadImmediate(calling_convention.GetRegisterAt(0), load->GetStringIndex().index_);
codegen_->InvokeRuntime(kQuickResolveString, load, load->GetDexPc());
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
}
@@ -7317,8 +7335,8 @@
}
CodeGeneratorARM::PcRelativePatchInfo* CodeGeneratorARM::NewPcRelativeTypePatch(
- const DexFile& dex_file, uint32_t type_index) {
- return NewPcRelativePatch(dex_file, type_index, &pc_relative_type_patches_);
+ const DexFile& dex_file, dex::TypeIndex type_index) {
+ return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_);
}
CodeGeneratorARM::PcRelativePatchInfo* CodeGeneratorARM::NewPcRelativeDexCacheArrayPatch(
@@ -7333,14 +7351,14 @@
}
Literal* CodeGeneratorARM::DeduplicateBootImageStringLiteral(const DexFile& dex_file,
- uint32_t string_index) {
+ dex::StringIndex string_index) {
return boot_image_string_patches_.GetOrCreate(
StringReference(&dex_file, string_index),
[this]() { return __ NewLiteral<uint32_t>(/* placeholder */ 0u); });
}
Literal* CodeGeneratorARM::DeduplicateBootImageTypeLiteral(const DexFile& dex_file,
- uint32_t type_index) {
+ dex::TypeIndex type_index) {
return boot_image_type_patches_.GetOrCreate(
TypeReference(&dex_file, type_index),
[this]() { return __ NewLiteral<uint32_t>(/* placeholder */ 0u); });
@@ -7352,8 +7370,21 @@
return DeduplicateUint32Literal(dchecked_integral_cast<uint32_t>(address), map);
}
-Literal* CodeGeneratorARM::DeduplicateDexCacheAddressLiteral(uint32_t address) {
- return DeduplicateUint32Literal(address, &uint32_literals_);
+Literal* CodeGeneratorARM::DeduplicateJitStringLiteral(const DexFile& dex_file,
+ dex::StringIndex string_index) {
+ jit_string_roots_.Overwrite(StringReference(&dex_file, string_index), /* placeholder */ 0u);
+ return jit_string_patches_.GetOrCreate(
+ StringReference(&dex_file, string_index),
+ [this]() { return __ NewLiteral<uint32_t>(/* placeholder */ 0u); });
+}
+
+Literal* CodeGeneratorARM::DeduplicateJitClassLiteral(const DexFile& dex_file,
+ dex::TypeIndex type_index,
+ uint64_t address) {
+ jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index), address);
+ return jit_class_patches_.GetOrCreate(
+ TypeReference(&dex_file, type_index),
+ [this]() { return __ NewLiteral<uint32_t>(/* placeholder */ 0u); });
}
template <LinkerPatch (*Factory)(size_t, const DexFile*, uint32_t, uint32_t)>
@@ -7421,7 +7452,7 @@
uint32_t literal_offset = literal->GetLabel()->Position();
linker_patches->push_back(LinkerPatch::StringPatch(literal_offset,
target_string.dex_file,
- target_string.string_index));
+ target_string.string_index.index_));
}
if (!GetCompilerOptions().IsBootImage()) {
EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
@@ -7437,7 +7468,7 @@
uint32_t literal_offset = literal->GetLabel()->Position();
linker_patches->push_back(LinkerPatch::TypePatch(literal_offset,
target_type.dex_file,
- target_type.type_index));
+ target_type.type_index.index_));
}
EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
linker_patches);
@@ -7672,6 +7703,31 @@
}
}
+static void PatchJitRootUse(uint8_t* code,
+ const uint8_t* roots_data,
+ Literal* literal,
+ uint64_t index_in_table) {
+ DCHECK(literal->GetLabel()->IsBound());
+ uint32_t literal_offset = literal->GetLabel()->Position();
+ uintptr_t address =
+ reinterpret_cast<uintptr_t>(roots_data) + index_in_table * sizeof(GcRoot<mirror::Object>);
+ uint8_t* data = code + literal_offset;
+ reinterpret_cast<uint32_t*>(data)[0] = dchecked_integral_cast<uint32_t>(address);
+}
+
+void CodeGeneratorARM::EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) {
+ for (const auto& entry : jit_string_patches_) {
+ const auto& it = jit_string_roots_.find(entry.first);
+ DCHECK(it != jit_string_roots_.end());
+ PatchJitRootUse(code, roots_data, entry.second, it->second);
+ }
+ for (const auto& entry : jit_class_patches_) {
+ const auto& it = jit_class_roots_.find(entry.first);
+ DCHECK(it != jit_class_roots_.end());
+ PatchJitRootUse(code, roots_data, entry.second, it->second);
+ }
+}
+
#undef __
#undef QUICK_ENTRY_POINT
diff --git a/compiler/optimizing/code_generator_arm.h b/compiler/optimizing/code_generator_arm.h
index f95dd57..605169d 100644
--- a/compiler/optimizing/code_generator_arm.h
+++ b/compiler/optimizing/code_generator_arm.h
@@ -19,6 +19,7 @@
#include "base/enums.h"
#include "code_generator.h"
+#include "dex_file_types.h"
#include "driver/compiler_options.h"
#include "nodes.h"
#include "string_reference.h"
@@ -481,16 +482,22 @@
};
PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index);
- PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, uint32_t type_index);
+ PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index);
PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
uint32_t element_offset);
- Literal* DeduplicateBootImageStringLiteral(const DexFile& dex_file, uint32_t string_index);
- Literal* DeduplicateBootImageTypeLiteral(const DexFile& dex_file, uint32_t type_index);
+ Literal* DeduplicateBootImageStringLiteral(const DexFile& dex_file,
+ dex::StringIndex string_index);
+ Literal* DeduplicateBootImageTypeLiteral(const DexFile& dex_file, dex::TypeIndex type_index);
Literal* DeduplicateBootImageAddressLiteral(uint32_t address);
- Literal* DeduplicateDexCacheAddressLiteral(uint32_t address);
+ Literal* DeduplicateJitStringLiteral(const DexFile& dex_file, dex::StringIndex string_index);
+ Literal* DeduplicateJitClassLiteral(const DexFile& dex_file,
+ dex::TypeIndex type_index,
+ uint64_t address);
void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
+ void EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) OVERRIDE;
+
// Fast path implementation of ReadBarrier::Barrier for a heap
// reference field load when Baker's read barriers are used.
void GenerateFieldLoadWithBakerReadBarrier(HInstruction* instruction,
@@ -591,12 +598,12 @@
using Uint32ToLiteralMap = ArenaSafeMap<uint32_t, Literal*>;
using MethodToLiteralMap = ArenaSafeMap<MethodReference, Literal*, MethodReferenceComparator>;
- using BootStringToLiteralMap = ArenaSafeMap<StringReference,
- Literal*,
- StringReferenceValueComparator>;
- using BootTypeToLiteralMap = ArenaSafeMap<TypeReference,
- Literal*,
- TypeReferenceValueComparator>;
+ using StringToLiteralMap = ArenaSafeMap<StringReference,
+ Literal*,
+ StringReferenceValueComparator>;
+ using TypeToLiteralMap = ArenaSafeMap<TypeReference,
+ Literal*,
+ TypeReferenceValueComparator>;
Literal* DeduplicateUint32Literal(uint32_t value, Uint32ToLiteralMap* map);
Literal* DeduplicateMethodLiteral(MethodReference target_method, MethodToLiteralMap* map);
@@ -605,7 +612,6 @@
PcRelativePatchInfo* NewPcRelativePatch(const DexFile& dex_file,
uint32_t offset_or_index,
ArenaDeque<PcRelativePatchInfo>* patches);
-
template <LinkerPatch (*Factory)(size_t, const DexFile*, uint32_t, uint32_t)>
static void EmitPcRelativeLinkerPatches(const ArenaDeque<PcRelativePatchInfo>& infos,
ArenaVector<LinkerPatch>* linker_patches);
@@ -630,16 +636,21 @@
// PC-relative patch info for each HArmDexCacheArraysBase.
ArenaDeque<PcRelativePatchInfo> pc_relative_dex_cache_patches_;
// Deduplication map for boot string literals for kBootImageLinkTimeAddress.
- BootStringToLiteralMap boot_image_string_patches_;
+ StringToLiteralMap boot_image_string_patches_;
// PC-relative String patch info; type depends on configuration (app .bss or boot image PIC).
ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
// Deduplication map for boot type literals for kBootImageLinkTimeAddress.
- BootTypeToLiteralMap boot_image_type_patches_;
+ TypeToLiteralMap boot_image_type_patches_;
// PC-relative type patch info.
ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
// Deduplication map for patchable boot image addresses.
Uint32ToLiteralMap boot_image_address_patches_;
+ // Patches for string literals in JIT compiled code.
+ StringToLiteralMap jit_string_patches_;
+ // Patches for class literals in JIT compiled code.
+ TypeToLiteralMap jit_class_patches_;
+
DISALLOW_COPY_AND_ASSIGN(CodeGeneratorARM);
};
diff --git a/compiler/optimizing/code_generator_arm64.cc b/compiler/optimizing/code_generator_arm64.cc
index 6ec9c91..5cff303 100644
--- a/compiler/optimizing/code_generator_arm64.cc
+++ b/compiler/optimizing/code_generator_arm64.cc
@@ -288,7 +288,7 @@
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- __ Mov(calling_convention.GetRegisterAt(0).W(), cls_->GetTypeIndex());
+ __ Mov(calling_convention.GetRegisterAt(0).W(), cls_->GetTypeIndex().index_);
QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType;
arm64_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
@@ -349,7 +349,7 @@
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex();
+ const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
__ Mov(calling_convention.GetRegisterAt(0).W(), string_index);
arm64_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
@@ -572,8 +572,10 @@
// We are about to use the assembler to place literals directly. Make sure we have enough
// underlying code buffer and we have generated the jump table with right size.
- CodeBufferCheckScope scope(codegen->GetVIXLAssembler(), num_entries * sizeof(int32_t),
- CodeBufferCheckScope::kCheck, CodeBufferCheckScope::kExactSize);
+ vixl::CodeBufferCheckScope scope(codegen->GetVIXLAssembler(),
+ num_entries * sizeof(int32_t),
+ vixl::CodeBufferCheckScope::kReserveBufferSpace,
+ vixl::CodeBufferCheckScope::kExactSize);
__ Bind(&table_start_);
const ArenaVector<HBasicBlock*>& successors = switch_instr_->GetBlock()->GetSuccessors();
@@ -1158,7 +1160,11 @@
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
boot_image_address_patches_(std::less<uint32_t>(),
- graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_string_patches_(StringReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_class_patches_(TypeReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
// Save the link register (containing the return address) to mimic Quick.
AddAllocatedRegister(LocationFrom(lr));
}
@@ -1269,6 +1275,12 @@
frame_size - GetCoreSpillSize());
GetAssembler()->SpillRegisters(GetFramePreservedFPRegisters(),
frame_size - FrameEntrySpillSize());
+
+ if (GetGraph()->HasShouldDeoptimizeFlag()) {
+ // Initialize should_deoptimize flag to 0.
+ Register wzr = Register(VIXLRegCodeFromART(WZR), kWRegSize);
+ __ Str(wzr, MemOperand(sp, GetStackOffsetOfShouldDeoptimizeFlag()));
+ }
}
}
@@ -2258,10 +2270,10 @@
masm->GetCursorAddress<vixl::aarch64::Instruction*>() - kInstructionSize;
if (prev->IsLoadOrStore()) {
// Make sure we emit only exactly one nop.
- vixl::aarch64::CodeBufferCheckScope scope(masm,
- kInstructionSize,
- vixl::aarch64::CodeBufferCheckScope::kCheck,
- vixl::aarch64::CodeBufferCheckScope::kExactSize);
+ vixl::CodeBufferCheckScope scope(masm,
+ kInstructionSize,
+ vixl::CodeBufferCheckScope::kReserveBufferSpace,
+ vixl::CodeBufferCheckScope::kExactSize);
__ nop();
}
}
@@ -3231,6 +3243,17 @@
/* false_target */ nullptr);
}
+void LocationsBuilderARM64::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ LocationSummary* locations = new (GetGraph()->GetArena())
+ LocationSummary(flag, LocationSummary::kNoCall);
+ locations->SetOut(Location::RequiresRegister());
+}
+
+void InstructionCodeGeneratorARM64::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ __ Ldr(OutputRegister(flag),
+ MemOperand(sp, codegen_->GetStackOffsetOfShouldDeoptimizeFlag()));
+}
+
static inline bool IsConditionOnFloatingPointValues(HInstruction* condition) {
return condition->IsCondition() &&
Primitive::IsFloatingPointType(condition->InputAt(0)->GetType());
@@ -4034,7 +4057,8 @@
vixl::aarch64::Label* label = &relative_call_patches_.back().label;
SingleEmissionCheckScope guard(GetVIXLAssembler());
__ Bind(label);
- __ bl(0); // Branch and link to itself. This will be overriden at link time.
+ // Branch and link to itself. This will be overriden at link time.
+ __ bl(static_cast<int64_t>(0));
break;
}
case HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup:
@@ -4100,9 +4124,9 @@
vixl::aarch64::Label* CodeGeneratorARM64::NewPcRelativeTypePatch(
const DexFile& dex_file,
- uint32_t type_index,
+ dex::TypeIndex type_index,
vixl::aarch64::Label* adrp_label) {
- return NewPcRelativePatch(dex_file, type_index, adrp_label, &pc_relative_type_patches_);
+ return NewPcRelativePatch(dex_file, type_index.index_, adrp_label, &pc_relative_type_patches_);
}
vixl::aarch64::Label* CodeGeneratorARM64::NewPcRelativeDexCacheArrayPatch(
@@ -4127,14 +4151,14 @@
}
vixl::aarch64::Literal<uint32_t>* CodeGeneratorARM64::DeduplicateBootImageStringLiteral(
- const DexFile& dex_file, uint32_t string_index) {
+ const DexFile& dex_file, dex::StringIndex string_index) {
return boot_image_string_patches_.GetOrCreate(
StringReference(&dex_file, string_index),
[this]() { return __ CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ 0u); });
}
vixl::aarch64::Literal<uint32_t>* CodeGeneratorARM64::DeduplicateBootImageTypeLiteral(
- const DexFile& dex_file, uint32_t type_index) {
+ const DexFile& dex_file, dex::TypeIndex type_index) {
return boot_image_type_patches_.GetOrCreate(
TypeReference(&dex_file, type_index),
[this]() { return __ CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ 0u); });
@@ -4147,9 +4171,20 @@
return DeduplicateUint32Literal(dchecked_integral_cast<uint32_t>(address), map);
}
-vixl::aarch64::Literal<uint64_t>* CodeGeneratorARM64::DeduplicateDexCacheAddressLiteral(
- uint64_t address) {
- return DeduplicateUint64Literal(address);
+vixl::aarch64::Literal<uint32_t>* CodeGeneratorARM64::DeduplicateJitStringLiteral(
+ const DexFile& dex_file, dex::StringIndex string_index) {
+ jit_string_roots_.Overwrite(StringReference(&dex_file, string_index), /* placeholder */ 0u);
+ return jit_string_patches_.GetOrCreate(
+ StringReference(&dex_file, string_index),
+ [this]() { return __ CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ 0u); });
+}
+
+vixl::aarch64::Literal<uint32_t>* CodeGeneratorARM64::DeduplicateJitClassLiteral(
+ const DexFile& dex_file, dex::TypeIndex type_index, uint64_t address) {
+ jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index), address);
+ return jit_class_patches_.GetOrCreate(
+ TypeReference(&dex_file, type_index),
+ [this]() { return __ CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ 0u); });
}
void CodeGeneratorARM64::EmitAdrpPlaceholder(vixl::aarch64::Label* fixup_label,
@@ -4157,7 +4192,7 @@
DCHECK(reg.IsX());
SingleEmissionCheckScope guard(GetVIXLAssembler());
__ Bind(fixup_label);
- __ adrp(reg, /* offset placeholder */ 0);
+ __ adrp(reg, /* offset placeholder */ static_cast<int64_t>(0));
}
void CodeGeneratorARM64::EmitAddPlaceholder(vixl::aarch64::Label* fixup_label,
@@ -4233,7 +4268,7 @@
vixl::aarch64::Literal<uint32_t>* literal = entry.second;
linker_patches->push_back(LinkerPatch::StringPatch(literal->GetOffset(),
target_string.dex_file,
- target_string.string_index));
+ target_string.string_index.index_));
}
if (!GetCompilerOptions().IsBootImage()) {
EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
@@ -4247,7 +4282,7 @@
vixl::aarch64::Literal<uint32_t>* literal = entry.second;
linker_patches->push_back(LinkerPatch::TypePatch(literal->GetOffset(),
target_type.dex_file,
- target_type.type_index));
+ target_type.type_index.index_));
}
EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
linker_patches);
@@ -4329,7 +4364,7 @@
break;
case HLoadClass::LoadKind::kBootImageAddress:
break;
- case HLoadClass::LoadKind::kDexCacheAddress:
+ case HLoadClass::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
break;
case HLoadClass::LoadKind::kDexCachePcRelative:
@@ -4371,7 +4406,7 @@
void InstructionCodeGeneratorARM64::VisitLoadClass(HLoadClass* cls) {
if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(cls->GetLocations()->GetTemp(0), cls->GetTypeIndex());
+ codegen_->MoveConstant(cls->GetLocations()->GetTemp(0), cls->GetTypeIndex().index_);
codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
return;
@@ -4407,7 +4442,7 @@
DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
// Add ADRP with its PC-relative type patch.
const DexFile& dex_file = cls->GetDexFile();
- uint32_t type_index = cls->GetTypeIndex();
+ dex::TypeIndex type_index = cls->GetTypeIndex();
vixl::aarch64::Label* adrp_label = codegen_->NewPcRelativeTypePatch(dex_file, type_index);
codegen_->EmitAdrpPlaceholder(adrp_label, out.X());
// Add ADD with its PC-relative type patch.
@@ -4422,26 +4457,16 @@
__ Ldr(out.W(), codegen_->DeduplicateBootImageAddressLiteral(cls->GetAddress()));
break;
}
- case HLoadClass::LoadKind::kDexCacheAddress: {
- DCHECK_NE(cls->GetAddress(), 0u);
- // LDR immediate has a 12-bit offset multiplied by the size and for 32-bit loads
- // that gives a 16KiB range. To try and reduce the number of literals if we load
- // multiple types, simply split the dex cache address to a 16KiB aligned base
- // loaded from a literal and the remaining offset embedded in the load.
- static_assert(sizeof(GcRoot<mirror::Class>) == 4u, "Expected GC root to be 4 bytes.");
- DCHECK_ALIGNED(cls->GetAddress(), 4u);
- constexpr size_t offset_bits = /* encoded bits */ 12 + /* scale */ 2;
- uint64_t base_address = cls->GetAddress() & ~MaxInt<uint64_t>(offset_bits);
- uint32_t offset = cls->GetAddress() & MaxInt<uint64_t>(offset_bits);
- __ Ldr(out.X(), codegen_->DeduplicateDexCacheAddressLiteral(base_address));
- // /* GcRoot<mirror::Class> */ out = *(base_address + offset)
+ case HLoadClass::LoadKind::kJitTableAddress: {
+ __ Ldr(out, codegen_->DeduplicateJitClassLiteral(cls->GetDexFile(),
+ cls->GetTypeIndex(),
+ cls->GetAddress()));
GenerateGcRootFieldLoad(cls,
out_loc,
out.X(),
- offset,
+ /* offset */ 0,
/* fixup_label */ nullptr,
- read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
+ kCompilerReadBarrierOption);
break;
}
case HLoadClass::LoadKind::kDexCachePcRelative: {
@@ -4475,7 +4500,7 @@
GenerateGcRootFieldLoad(cls,
out_loc,
out.X(),
- CodeGenerator::GetCacheOffset(cls->GetTypeIndex()),
+ CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_),
/* fixup_label */ nullptr,
read_barrier_option);
generate_null_check = !cls->IsInDexCache();
@@ -4537,16 +4562,15 @@
break;
case HLoadString::LoadKind::kDexCacheViaMethod:
break;
+ case HLoadString::LoadKind::kJitTableAddress:
+ DCHECK(Runtime::Current()->UseJitCompilation());
+ break;
}
return desired_string_load_kind;
}
void LocationsBuilderARM64::VisitLoadString(HLoadString* load) {
- LocationSummary::CallKind call_kind = load->NeedsEnvironment()
- ? ((load->GetLoadKind() == HLoadString::LoadKind::kDexCacheViaMethod)
- ? LocationSummary::kCallOnMainOnly
- : LocationSummary::kCallOnSlowPath)
- : LocationSummary::kNoCall;
+ LocationSummary::CallKind call_kind = CodeGenerator::GetLoadStringCallKind(load);
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(load, call_kind);
if (load->GetLoadKind() == HLoadString::LoadKind::kDexCacheViaMethod) {
InvokeRuntimeCallingConvention calling_convention;
@@ -4572,6 +4596,7 @@
void InstructionCodeGeneratorARM64::VisitLoadString(HLoadString* load) {
Register out = OutputRegister(load);
+ Location out_loc = load->GetLocations()->Out();
switch (load->GetLoadKind()) {
case HLoadString::LoadKind::kBootImageLinkTimeAddress:
@@ -4581,7 +4606,7 @@
case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
// Add ADRP with its PC-relative String patch.
const DexFile& dex_file = load->GetDexFile();
- uint32_t string_index = load->GetStringIndex();
+ uint32_t string_index = load->GetStringIndex().index_;
DCHECK(codegen_->GetCompilerOptions().IsBootImage());
vixl::aarch64::Label* adrp_label = codegen_->NewPcRelativeStringPatch(dex_file, string_index);
codegen_->EmitAdrpPlaceholder(adrp_label, out.X());
@@ -4599,7 +4624,7 @@
case HLoadString::LoadKind::kBssEntry: {
// Add ADRP with its PC-relative String .bss entry patch.
const DexFile& dex_file = load->GetDexFile();
- uint32_t string_index = load->GetStringIndex();
+ uint32_t string_index = load->GetStringIndex().index_;
DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
UseScratchRegisterScope temps(codegen_->GetVIXLAssembler());
Register temp = temps.AcquireX();
@@ -4608,9 +4633,9 @@
// Add LDR with its PC-relative String patch.
vixl::aarch64::Label* ldr_label =
codegen_->NewPcRelativeStringPatch(dex_file, string_index, adrp_label);
- // /* GcRoot<mirror::Class> */ out = *(base_address + offset) /* PC-relative */
+ // /* GcRoot<mirror::String> */ out = *(base_address + offset) /* PC-relative */
GenerateGcRootFieldLoad(load,
- load->GetLocations()->Out(),
+ out_loc,
temp,
/* offset placeholder */ 0u,
ldr_label,
@@ -4622,6 +4647,17 @@
__ Bind(slow_path->GetExitLabel());
return;
}
+ case HLoadString::LoadKind::kJitTableAddress: {
+ __ Ldr(out, codegen_->DeduplicateJitStringLiteral(load->GetDexFile(),
+ load->GetStringIndex()));
+ GenerateGcRootFieldLoad(load,
+ out_loc,
+ out.X(),
+ /* offset */ 0,
+ /* fixup_label */ nullptr,
+ kCompilerReadBarrierOption);
+ return;
+ }
default:
break;
}
@@ -4629,7 +4665,7 @@
// TODO: Re-add the compiler code to do string dex cache lookup again.
InvokeRuntimeCallingConvention calling_convention;
DCHECK_EQ(calling_convention.GetRegisterAt(0).GetCode(), out.GetCode());
- __ Mov(calling_convention.GetRegisterAt(0).W(), load->GetStringIndex());
+ __ Mov(calling_convention.GetRegisterAt(0).W(), load->GetStringIndex().index_);
codegen_->InvokeRuntime(kQuickResolveString, load, load->GetDexPc());
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
}
@@ -4754,7 +4790,7 @@
InvokeRuntimeCallingConvention calling_convention;
Register type_index = RegisterFrom(locations->GetTemp(0), Primitive::kPrimInt);
DCHECK(type_index.Is(w0));
- __ Mov(type_index, instruction->GetTypeIndex());
+ __ Mov(type_index, instruction->GetTypeIndex().index_);
// Note: if heap poisoning is enabled, the entry point takes cares
// of poisoning the reference.
codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
@@ -5741,7 +5777,29 @@
}
}
+static void PatchJitRootUse(uint8_t* code,
+ const uint8_t* roots_data,
+ vixl::aarch64::Literal<uint32_t>* literal,
+ uint64_t index_in_table) {
+ uint32_t literal_offset = literal->GetOffset();
+ uintptr_t address =
+ reinterpret_cast<uintptr_t>(roots_data) + index_in_table * sizeof(GcRoot<mirror::Object>);
+ uint8_t* data = code + literal_offset;
+ reinterpret_cast<uint32_t*>(data)[0] = dchecked_integral_cast<uint32_t>(address);
+}
+void CodeGeneratorARM64::EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) {
+ for (const auto& entry : jit_string_patches_) {
+ const auto& it = jit_string_roots_.find(entry.first);
+ DCHECK(it != jit_string_roots_.end());
+ PatchJitRootUse(code, roots_data, entry.second, it->second);
+ }
+ for (const auto& entry : jit_class_patches_) {
+ const auto& it = jit_class_roots_.find(entry.first);
+ DCHECK(it != jit_class_roots_.end());
+ PatchJitRootUse(code, roots_data, entry.second, it->second);
+ }
+}
#undef __
#undef QUICK_ENTRY_POINT
diff --git a/compiler/optimizing/code_generator_arm64.h b/compiler/optimizing/code_generator_arm64.h
index 0e8d4fd..85b6f9f 100644
--- a/compiler/optimizing/code_generator_arm64.h
+++ b/compiler/optimizing/code_generator_arm64.h
@@ -20,6 +20,7 @@
#include "arch/arm64/quick_method_frame_info_arm64.h"
#include "code_generator.h"
#include "common_arm64.h"
+#include "dex_file_types.h"
#include "driver/compiler_options.h"
#include "nodes.h"
#include "parallel_move_resolver.h"
@@ -547,7 +548,7 @@
// ADRP (pass `adrp_label = null`) or the ADD (pass `adrp_label` pointing
// to the associated ADRP patch label).
vixl::aarch64::Label* NewPcRelativeTypePatch(const DexFile& dex_file,
- uint32_t type_index,
+ dex::TypeIndex type_index,
vixl::aarch64::Label* adrp_label = nullptr);
// Add a new PC-relative dex cache array patch for an instruction and return
@@ -559,12 +560,17 @@
uint32_t element_offset,
vixl::aarch64::Label* adrp_label = nullptr);
- vixl::aarch64::Literal<uint32_t>* DeduplicateBootImageStringLiteral(const DexFile& dex_file,
- uint32_t string_index);
+ vixl::aarch64::Literal<uint32_t>* DeduplicateBootImageStringLiteral(
+ const DexFile& dex_file,
+ dex::StringIndex string_index);
vixl::aarch64::Literal<uint32_t>* DeduplicateBootImageTypeLiteral(const DexFile& dex_file,
- uint32_t type_index);
+ dex::TypeIndex type_index);
vixl::aarch64::Literal<uint32_t>* DeduplicateBootImageAddressLiteral(uint64_t address);
- vixl::aarch64::Literal<uint64_t>* DeduplicateDexCacheAddressLiteral(uint64_t address);
+ vixl::aarch64::Literal<uint32_t>* DeduplicateJitStringLiteral(const DexFile& dex_file,
+ dex::StringIndex string_index);
+ vixl::aarch64::Literal<uint32_t>* DeduplicateJitClassLiteral(const DexFile& dex_file,
+ dex::TypeIndex string_index,
+ uint64_t address);
void EmitAdrpPlaceholder(vixl::aarch64::Label* fixup_label, vixl::aarch64::Register reg);
void EmitAddPlaceholder(vixl::aarch64::Label* fixup_label,
@@ -576,6 +582,8 @@
void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
+ void EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) OVERRIDE;
+
// Fast path implementation of ReadBarrier::Barrier for a heap
// reference field load when Baker's read barriers are used.
void GenerateFieldLoadWithBakerReadBarrier(HInstruction* instruction,
@@ -673,12 +681,12 @@
using MethodToLiteralMap = ArenaSafeMap<MethodReference,
vixl::aarch64::Literal<uint64_t>*,
MethodReferenceComparator>;
- using BootStringToLiteralMap = ArenaSafeMap<StringReference,
- vixl::aarch64::Literal<uint32_t>*,
- StringReferenceValueComparator>;
- using BootTypeToLiteralMap = ArenaSafeMap<TypeReference,
- vixl::aarch64::Literal<uint32_t>*,
- TypeReferenceValueComparator>;
+ using StringToLiteralMap = ArenaSafeMap<StringReference,
+ vixl::aarch64::Literal<uint32_t>*,
+ StringReferenceValueComparator>;
+ using TypeToLiteralMap = ArenaSafeMap<TypeReference,
+ vixl::aarch64::Literal<uint32_t>*,
+ TypeReferenceValueComparator>;
vixl::aarch64::Literal<uint32_t>* DeduplicateUint32Literal(uint32_t value,
Uint32ToLiteralMap* map);
@@ -727,8 +735,7 @@
// Deduplication map for 32-bit literals, used for non-patchable boot image addresses.
Uint32ToLiteralMap uint32_literals_;
- // Deduplication map for 64-bit literals, used for non-patchable method address, method code
- // or string dex cache address.
+ // Deduplication map for 64-bit literals, used for non-patchable method address or method code.
Uint64ToLiteralMap uint64_literals_;
// Method patch info, map MethodReference to a literal for method address and method code.
MethodToLiteralMap method_patches_;
@@ -739,16 +746,21 @@
// PC-relative DexCache access info.
ArenaDeque<PcRelativePatchInfo> pc_relative_dex_cache_patches_;
// Deduplication map for boot string literals for kBootImageLinkTimeAddress.
- BootStringToLiteralMap boot_image_string_patches_;
+ StringToLiteralMap boot_image_string_patches_;
// PC-relative String patch info; type depends on configuration (app .bss or boot image PIC).
ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
// Deduplication map for boot type literals for kBootImageLinkTimeAddress.
- BootTypeToLiteralMap boot_image_type_patches_;
+ TypeToLiteralMap boot_image_type_patches_;
// PC-relative type patch info.
ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
// Deduplication map for patchable boot image addresses.
Uint32ToLiteralMap boot_image_address_patches_;
+ // Patches for string literals in JIT compiled code.
+ StringToLiteralMap jit_string_patches_;
+ // Patches for class literals in JIT compiled code.
+ TypeToLiteralMap jit_class_patches_;
+
DISALLOW_COPY_AND_ASSIGN(CodeGeneratorARM64);
};
diff --git a/compiler/optimizing/code_generator_arm_vixl.cc b/compiler/optimizing/code_generator_arm_vixl.cc
index 61e6b4b..1df00ff 100644
--- a/compiler/optimizing/code_generator_arm_vixl.cc
+++ b/compiler/optimizing/code_generator_arm_vixl.cc
@@ -46,7 +46,10 @@
using helpers::InputRegister;
using helpers::InputRegisterAt;
using helpers::InputSRegisterAt;
+using helpers::InputVRegister;
using helpers::InputVRegisterAt;
+using helpers::Int32ConstantFrom;
+using helpers::Int64ConstantFrom;
using helpers::LocationFrom;
using helpers::LowRegisterFrom;
using helpers::LowSRegisterFrom;
@@ -55,6 +58,10 @@
using helpers::OutputVRegister;
using helpers::RegisterFrom;
using helpers::SRegisterFrom;
+using helpers::Uint64ConstantFrom;
+
+using vixl::ExactAssemblyScope;
+using vixl::CodeBufferCheckScope;
using RegisterList = vixl32::RegisterList;
@@ -62,9 +69,10 @@
// We expected this for both core and fpu register pairs.
return ((location.low() & 1) == 0) && (location.low() + 1 == location.high());
}
-
+// Use a local definition to prevent copying mistakes.
+static constexpr size_t kArmWordSize = static_cast<size_t>(kArmPointerSize);
+static constexpr size_t kArmBitsPerWord = kArmWordSize * kBitsPerByte;
static constexpr int kCurrentMethodStackOffset = 0;
-static constexpr size_t kArmInstrMaxSizeInBytes = 4u;
static constexpr uint32_t kPackedSwitchCompareJumpThreshold = 7;
#ifdef __
@@ -132,7 +140,7 @@
vixl32::Register base = sp;
if (stack_offset != 0) {
base = temps.Acquire();
- __ Add(base, sp, stack_offset);
+ __ Add(base, sp, Operand::From(stack_offset));
}
__ Vstm(F64, base, NO_WRITE_BACK, DRegisterList(d_reg, number_of_d_regs));
}
@@ -180,7 +188,7 @@
vixl32::Register base = sp;
if (stack_offset != 0) {
base = temps.Acquire();
- __ Add(base, sp, stack_offset);
+ __ Add(base, sp, Operand::From(stack_offset));
}
__ Vldm(F64, base, NO_WRITE_BACK, DRegisterList(d_reg, number_of_d_regs));
}
@@ -398,7 +406,7 @@
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConventionARMVIXL calling_convention;
- __ Mov(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex());
+ __ Mov(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType;
arm_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
@@ -437,6 +445,62 @@
DISALLOW_COPY_AND_ASSIGN(LoadClassSlowPathARMVIXL);
};
+class LoadStringSlowPathARMVIXL : public SlowPathCodeARMVIXL {
+ public:
+ explicit LoadStringSlowPathARMVIXL(HLoadString* instruction)
+ : SlowPathCodeARMVIXL(instruction) {}
+
+ void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
+ LocationSummary* locations = instruction_->GetLocations();
+ DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(locations->Out().reg()));
+ HLoadString* load = instruction_->AsLoadString();
+ const uint32_t string_index = load->GetStringIndex().index_;
+ vixl32::Register out = OutputRegister(load);
+ vixl32::Register temp = RegisterFrom(locations->GetTemp(0));
+ constexpr bool call_saves_everything_except_r0 = (!kUseReadBarrier || kUseBakerReadBarrier);
+
+ CodeGeneratorARMVIXL* arm_codegen = down_cast<CodeGeneratorARMVIXL*>(codegen);
+ __ Bind(GetEntryLabel());
+ SaveLiveRegisters(codegen, locations);
+
+ InvokeRuntimeCallingConventionARMVIXL calling_convention;
+ // In the unlucky case that the `temp` is R0, we preserve the address in `out` across
+ // the kSaveEverything call (or use `out` for the address after non-kSaveEverything call).
+ bool temp_is_r0 = (temp.Is(calling_convention.GetRegisterAt(0)));
+ vixl32::Register entry_address = temp_is_r0 ? out : temp;
+ DCHECK(!entry_address.Is(calling_convention.GetRegisterAt(0)));
+ if (call_saves_everything_except_r0 && temp_is_r0) {
+ __ Mov(entry_address, temp);
+ }
+
+ __ Mov(calling_convention.GetRegisterAt(0), string_index);
+ arm_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
+ CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
+
+ // Store the resolved String to the .bss entry.
+ if (call_saves_everything_except_r0) {
+ // The string entry address was preserved in `entry_address` thanks to kSaveEverything.
+ __ Str(r0, MemOperand(entry_address));
+ } else {
+ // For non-Baker read barrier, we need to re-calculate the address of the string entry.
+ CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
+ arm_codegen->NewPcRelativeStringPatch(load->GetDexFile(), string_index);
+ arm_codegen->EmitMovwMovtPlaceholder(labels, out);
+ __ Str(r0, MemOperand(entry_address));
+ }
+
+ arm_codegen->Move32(locations->Out(), LocationFrom(r0));
+ RestoreLiveRegisters(codegen, locations);
+
+ __ B(GetExitLabel());
+ }
+
+ const char* GetDescription() const OVERRIDE { return "LoadStringSlowPathARMVIXL"; }
+
+ private:
+ DISALLOW_COPY_AND_ASSIGN(LoadStringSlowPathARMVIXL);
+};
+
class TypeCheckSlowPathARMVIXL : public SlowPathCodeARMVIXL {
public:
TypeCheckSlowPathARMVIXL(HInstruction* instruction, bool is_fatal)
@@ -555,6 +619,509 @@
DISALLOW_COPY_AND_ASSIGN(ArraySetSlowPathARMVIXL);
};
+// Slow path marking an object reference `ref` during a read
+// barrier. The field `obj.field` in the object `obj` holding this
+// reference does not get updated by this slow path after marking (see
+// ReadBarrierMarkAndUpdateFieldSlowPathARM below for that).
+//
+// This means that after the execution of this slow path, `ref` will
+// always be up-to-date, but `obj.field` may not; i.e., after the
+// flip, `ref` will be a to-space reference, but `obj.field` will
+// probably still be a from-space reference (unless it gets updated by
+// another thread, or if another thread installed another object
+// reference (different from `ref`) in `obj.field`).
+class ReadBarrierMarkSlowPathARMVIXL : public SlowPathCodeARMVIXL {
+ public:
+ ReadBarrierMarkSlowPathARMVIXL(HInstruction* instruction,
+ Location ref,
+ Location entrypoint = Location::NoLocation())
+ : SlowPathCodeARMVIXL(instruction), ref_(ref), entrypoint_(entrypoint) {
+ DCHECK(kEmitCompilerReadBarrier);
+ }
+
+ const char* GetDescription() const OVERRIDE { return "ReadBarrierMarkSlowPathARMVIXL"; }
+
+ void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
+ LocationSummary* locations = instruction_->GetLocations();
+ vixl32::Register ref_reg = RegisterFrom(ref_);
+ DCHECK(locations->CanCall());
+ DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(ref_reg.GetCode())) << ref_reg;
+ DCHECK(instruction_->IsInstanceFieldGet() ||
+ instruction_->IsStaticFieldGet() ||
+ instruction_->IsArrayGet() ||
+ instruction_->IsArraySet() ||
+ instruction_->IsLoadClass() ||
+ instruction_->IsLoadString() ||
+ instruction_->IsInstanceOf() ||
+ instruction_->IsCheckCast() ||
+ (instruction_->IsInvokeVirtual() && instruction_->GetLocations()->Intrinsified()) ||
+ (instruction_->IsInvokeStaticOrDirect() && instruction_->GetLocations()->Intrinsified()))
+ << "Unexpected instruction in read barrier marking slow path: "
+ << instruction_->DebugName();
+ // The read barrier instrumentation of object ArrayGet
+ // instructions does not support the HIntermediateAddress
+ // instruction.
+ DCHECK(!(instruction_->IsArrayGet() &&
+ instruction_->AsArrayGet()->GetArray()->IsIntermediateAddress()));
+
+ __ Bind(GetEntryLabel());
+ // No need to save live registers; it's taken care of by the
+ // entrypoint. Also, there is no need to update the stack mask,
+ // as this runtime call will not trigger a garbage collection.
+ CodeGeneratorARMVIXL* arm_codegen = down_cast<CodeGeneratorARMVIXL*>(codegen);
+ DCHECK(!ref_reg.Is(sp));
+ DCHECK(!ref_reg.Is(lr));
+ DCHECK(!ref_reg.Is(pc));
+ // IP is used internally by the ReadBarrierMarkRegX entry point
+ // as a temporary, it cannot be the entry point's input/output.
+ DCHECK(!ref_reg.Is(ip));
+ DCHECK(ref_reg.IsRegister()) << ref_reg;
+ // "Compact" slow path, saving two moves.
+ //
+ // Instead of using the standard runtime calling convention (input
+ // and output in R0):
+ //
+ // R0 <- ref
+ // R0 <- ReadBarrierMark(R0)
+ // ref <- R0
+ //
+ // we just use rX (the register containing `ref`) as input and output
+ // of a dedicated entrypoint:
+ //
+ // rX <- ReadBarrierMarkRegX(rX)
+ //
+ if (entrypoint_.IsValid()) {
+ arm_codegen->ValidateInvokeRuntimeWithoutRecordingPcInfo(instruction_, this);
+ __ Blx(RegisterFrom(entrypoint_));
+ } else {
+ int32_t entry_point_offset =
+ CodeGenerator::GetReadBarrierMarkEntryPointsOffset<kArmPointerSize>(ref_reg.GetCode());
+ // This runtime call does not require a stack map.
+ arm_codegen->InvokeRuntimeWithoutRecordingPcInfo(entry_point_offset, instruction_, this);
+ }
+ __ B(GetExitLabel());
+ }
+
+ private:
+ // The location (register) of the marked object reference.
+ const Location ref_;
+
+ // The location of the entrypoint if already loaded.
+ const Location entrypoint_;
+
+ DISALLOW_COPY_AND_ASSIGN(ReadBarrierMarkSlowPathARMVIXL);
+};
+
+// Slow path marking an object reference `ref` during a read barrier,
+// and if needed, atomically updating the field `obj.field` in the
+// object `obj` holding this reference after marking (contrary to
+// ReadBarrierMarkSlowPathARM above, which never tries to update
+// `obj.field`).
+//
+// This means that after the execution of this slow path, both `ref`
+// and `obj.field` will be up-to-date; i.e., after the flip, both will
+// hold the same to-space reference (unless another thread installed
+// another object reference (different from `ref`) in `obj.field`).
+class ReadBarrierMarkAndUpdateFieldSlowPathARMVIXL : public SlowPathCodeARMVIXL {
+ public:
+ ReadBarrierMarkAndUpdateFieldSlowPathARMVIXL(HInstruction* instruction,
+ Location ref,
+ vixl32::Register obj,
+ Location field_offset,
+ vixl32::Register temp1,
+ vixl32::Register temp2)
+ : SlowPathCodeARMVIXL(instruction),
+ ref_(ref),
+ obj_(obj),
+ field_offset_(field_offset),
+ temp1_(temp1),
+ temp2_(temp2) {
+ DCHECK(kEmitCompilerReadBarrier);
+ }
+
+ const char* GetDescription() const OVERRIDE {
+ return "ReadBarrierMarkAndUpdateFieldSlowPathARMVIXL";
+ }
+
+ void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
+ LocationSummary* locations = instruction_->GetLocations();
+ vixl32::Register ref_reg = RegisterFrom(ref_);
+ DCHECK(locations->CanCall());
+ DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(ref_reg.GetCode())) << ref_reg;
+ // This slow path is only used by the UnsafeCASObject intrinsic.
+ DCHECK((instruction_->IsInvokeVirtual() && instruction_->GetLocations()->Intrinsified()))
+ << "Unexpected instruction in read barrier marking and field updating slow path: "
+ << instruction_->DebugName();
+ DCHECK(instruction_->GetLocations()->Intrinsified());
+ DCHECK_EQ(instruction_->AsInvoke()->GetIntrinsic(), Intrinsics::kUnsafeCASObject);
+ DCHECK(field_offset_.IsRegisterPair()) << field_offset_;
+
+ __ Bind(GetEntryLabel());
+
+ // Save the old reference.
+ // Note that we cannot use IP to save the old reference, as IP is
+ // used internally by the ReadBarrierMarkRegX entry point, and we
+ // need the old reference after the call to that entry point.
+ DCHECK(!temp1_.Is(ip));
+ __ Mov(temp1_, ref_reg);
+
+ // No need to save live registers; it's taken care of by the
+ // entrypoint. Also, there is no need to update the stack mask,
+ // as this runtime call will not trigger a garbage collection.
+ CodeGeneratorARMVIXL* arm_codegen = down_cast<CodeGeneratorARMVIXL*>(codegen);
+ DCHECK(!ref_reg.Is(sp));
+ DCHECK(!ref_reg.Is(lr));
+ DCHECK(!ref_reg.Is(pc));
+ // IP is used internally by the ReadBarrierMarkRegX entry point
+ // as a temporary, it cannot be the entry point's input/output.
+ DCHECK(!ref_reg.Is(ip));
+ DCHECK(ref_reg.IsRegister()) << ref_reg;
+ // "Compact" slow path, saving two moves.
+ //
+ // Instead of using the standard runtime calling convention (input
+ // and output in R0):
+ //
+ // R0 <- ref
+ // R0 <- ReadBarrierMark(R0)
+ // ref <- R0
+ //
+ // we just use rX (the register containing `ref`) as input and output
+ // of a dedicated entrypoint:
+ //
+ // rX <- ReadBarrierMarkRegX(rX)
+ //
+ int32_t entry_point_offset =
+ CodeGenerator::GetReadBarrierMarkEntryPointsOffset<kArmPointerSize>(ref_reg.GetCode());
+ // This runtime call does not require a stack map.
+ arm_codegen->InvokeRuntimeWithoutRecordingPcInfo(entry_point_offset, instruction_, this);
+
+ // If the new reference is different from the old reference,
+ // update the field in the holder (`*(obj_ + field_offset_)`).
+ //
+ // Note that this field could also hold a different object, if
+ // another thread had concurrently changed it. In that case, the
+ // LDREX/SUBS/ITNE sequence of instructions in the compare-and-set
+ // (CAS) operation below would abort the CAS, leaving the field
+ // as-is.
+ vixl32::Label done;
+ __ Cmp(temp1_, ref_reg);
+ __ B(eq, &done);
+
+ // Update the the holder's field atomically. This may fail if
+ // mutator updates before us, but it's OK. This is achieved
+ // using a strong compare-and-set (CAS) operation with relaxed
+ // memory synchronization ordering, where the expected value is
+ // the old reference and the desired value is the new reference.
+
+ UseScratchRegisterScope temps(arm_codegen->GetVIXLAssembler());
+ // Convenience aliases.
+ vixl32::Register base = obj_;
+ // The UnsafeCASObject intrinsic uses a register pair as field
+ // offset ("long offset"), of which only the low part contains
+ // data.
+ vixl32::Register offset = LowRegisterFrom(field_offset_);
+ vixl32::Register expected = temp1_;
+ vixl32::Register value = ref_reg;
+ vixl32::Register tmp_ptr = temps.Acquire(); // Pointer to actual memory.
+ vixl32::Register tmp = temp2_; // Value in memory.
+
+ __ Add(tmp_ptr, base, offset);
+
+ if (kPoisonHeapReferences) {
+ arm_codegen->GetAssembler()->PoisonHeapReference(expected);
+ if (value.Is(expected)) {
+ // Do not poison `value`, as it is the same register as
+ // `expected`, which has just been poisoned.
+ } else {
+ arm_codegen->GetAssembler()->PoisonHeapReference(value);
+ }
+ }
+
+ // do {
+ // tmp = [r_ptr] - expected;
+ // } while (tmp == 0 && failure([r_ptr] <- r_new_value));
+
+ vixl32::Label loop_head, exit_loop;
+ __ Bind(&loop_head);
+
+ __ Ldrex(tmp, MemOperand(tmp_ptr));
+
+ __ Subs(tmp, tmp, expected);
+
+ {
+ ExactAssemblyScope aas(arm_codegen->GetVIXLAssembler(),
+ 2 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+
+ __ it(ne);
+ __ clrex(ne);
+ }
+
+ __ B(ne, &exit_loop);
+
+ __ Strex(tmp, value, MemOperand(tmp_ptr));
+ __ Cmp(tmp, 1);
+ __ B(eq, &loop_head);
+
+ __ Bind(&exit_loop);
+
+ if (kPoisonHeapReferences) {
+ arm_codegen->GetAssembler()->UnpoisonHeapReference(expected);
+ if (value.Is(expected)) {
+ // Do not unpoison `value`, as it is the same register as
+ // `expected`, which has just been unpoisoned.
+ } else {
+ arm_codegen->GetAssembler()->UnpoisonHeapReference(value);
+ }
+ }
+
+ __ Bind(&done);
+ __ B(GetExitLabel());
+ }
+
+ private:
+ // The location (register) of the marked object reference.
+ const Location ref_;
+ // The register containing the object holding the marked object reference field.
+ const vixl32::Register obj_;
+ // The location of the offset of the marked reference field within `obj_`.
+ Location field_offset_;
+
+ const vixl32::Register temp1_;
+ const vixl32::Register temp2_;
+
+ DISALLOW_COPY_AND_ASSIGN(ReadBarrierMarkAndUpdateFieldSlowPathARMVIXL);
+};
+
+// Slow path generating a read barrier for a heap reference.
+class ReadBarrierForHeapReferenceSlowPathARMVIXL : public SlowPathCodeARMVIXL {
+ public:
+ ReadBarrierForHeapReferenceSlowPathARMVIXL(HInstruction* instruction,
+ Location out,
+ Location ref,
+ Location obj,
+ uint32_t offset,
+ Location index)
+ : SlowPathCodeARMVIXL(instruction),
+ out_(out),
+ ref_(ref),
+ obj_(obj),
+ offset_(offset),
+ index_(index) {
+ DCHECK(kEmitCompilerReadBarrier);
+ // If `obj` is equal to `out` or `ref`, it means the initial object
+ // has been overwritten by (or after) the heap object reference load
+ // to be instrumented, e.g.:
+ //
+ // __ LoadFromOffset(kLoadWord, out, out, offset);
+ // codegen_->GenerateReadBarrierSlow(instruction, out_loc, out_loc, out_loc, offset);
+ //
+ // In that case, we have lost the information about the original
+ // object, and the emitted read barrier cannot work properly.
+ DCHECK(!obj.Equals(out)) << "obj=" << obj << " out=" << out;
+ DCHECK(!obj.Equals(ref)) << "obj=" << obj << " ref=" << ref;
+ }
+
+ void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
+ CodeGeneratorARMVIXL* arm_codegen = down_cast<CodeGeneratorARMVIXL*>(codegen);
+ LocationSummary* locations = instruction_->GetLocations();
+ vixl32::Register reg_out = RegisterFrom(out_);
+ DCHECK(locations->CanCall());
+ DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(reg_out.GetCode()));
+ DCHECK(instruction_->IsInstanceFieldGet() ||
+ instruction_->IsStaticFieldGet() ||
+ instruction_->IsArrayGet() ||
+ instruction_->IsInstanceOf() ||
+ instruction_->IsCheckCast() ||
+ (instruction_->IsInvokeVirtual()) && instruction_->GetLocations()->Intrinsified())
+ << "Unexpected instruction in read barrier for heap reference slow path: "
+ << instruction_->DebugName();
+ // The read barrier instrumentation of object ArrayGet
+ // instructions does not support the HIntermediateAddress
+ // instruction.
+ DCHECK(!(instruction_->IsArrayGet() &&
+ instruction_->AsArrayGet()->GetArray()->IsIntermediateAddress()));
+
+ __ Bind(GetEntryLabel());
+ SaveLiveRegisters(codegen, locations);
+
+ // We may have to change the index's value, but as `index_` is a
+ // constant member (like other "inputs" of this slow path),
+ // introduce a copy of it, `index`.
+ Location index = index_;
+ if (index_.IsValid()) {
+ // Handle `index_` for HArrayGet and UnsafeGetObject/UnsafeGetObjectVolatile intrinsics.
+ if (instruction_->IsArrayGet()) {
+ // Compute the actual memory offset and store it in `index`.
+ vixl32::Register index_reg = RegisterFrom(index_);
+ DCHECK(locations->GetLiveRegisters()->ContainsCoreRegister(index_reg.GetCode()));
+ if (codegen->IsCoreCalleeSaveRegister(index_reg.GetCode())) {
+ // We are about to change the value of `index_reg` (see the
+ // calls to art::arm::Thumb2Assembler::Lsl and
+ // art::arm::Thumb2Assembler::AddConstant below), but it has
+ // not been saved by the previous call to
+ // art::SlowPathCode::SaveLiveRegisters, as it is a
+ // callee-save register --
+ // art::SlowPathCode::SaveLiveRegisters does not consider
+ // callee-save registers, as it has been designed with the
+ // assumption that callee-save registers are supposed to be
+ // handled by the called function. So, as a callee-save
+ // register, `index_reg` _would_ eventually be saved onto
+ // the stack, but it would be too late: we would have
+ // changed its value earlier. Therefore, we manually save
+ // it here into another freely available register,
+ // `free_reg`, chosen of course among the caller-save
+ // registers (as a callee-save `free_reg` register would
+ // exhibit the same problem).
+ //
+ // Note we could have requested a temporary register from
+ // the register allocator instead; but we prefer not to, as
+ // this is a slow path, and we know we can find a
+ // caller-save register that is available.
+ vixl32::Register free_reg = FindAvailableCallerSaveRegister(codegen);
+ __ Mov(free_reg, index_reg);
+ index_reg = free_reg;
+ index = LocationFrom(index_reg);
+ } else {
+ // The initial register stored in `index_` has already been
+ // saved in the call to art::SlowPathCode::SaveLiveRegisters
+ // (as it is not a callee-save register), so we can freely
+ // use it.
+ }
+ // Shifting the index value contained in `index_reg` by the scale
+ // factor (2) cannot overflow in practice, as the runtime is
+ // unable to allocate object arrays with a size larger than
+ // 2^26 - 1 (that is, 2^28 - 4 bytes).
+ __ Lsl(index_reg, index_reg, TIMES_4);
+ static_assert(
+ sizeof(mirror::HeapReference<mirror::Object>) == sizeof(int32_t),
+ "art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
+ __ Add(index_reg, index_reg, offset_);
+ } else {
+ // In the case of the UnsafeGetObject/UnsafeGetObjectVolatile
+ // intrinsics, `index_` is not shifted by a scale factor of 2
+ // (as in the case of ArrayGet), as it is actually an offset
+ // to an object field within an object.
+ DCHECK(instruction_->IsInvoke()) << instruction_->DebugName();
+ DCHECK(instruction_->GetLocations()->Intrinsified());
+ DCHECK((instruction_->AsInvoke()->GetIntrinsic() == Intrinsics::kUnsafeGetObject) ||
+ (instruction_->AsInvoke()->GetIntrinsic() == Intrinsics::kUnsafeGetObjectVolatile))
+ << instruction_->AsInvoke()->GetIntrinsic();
+ DCHECK_EQ(offset_, 0U);
+ DCHECK(index_.IsRegisterPair());
+ // UnsafeGet's offset location is a register pair, the low
+ // part contains the correct offset.
+ index = index_.ToLow();
+ }
+ }
+
+ // We're moving two or three locations to locations that could
+ // overlap, so we need a parallel move resolver.
+ InvokeRuntimeCallingConventionARMVIXL calling_convention;
+ HParallelMove parallel_move(codegen->GetGraph()->GetArena());
+ parallel_move.AddMove(ref_,
+ LocationFrom(calling_convention.GetRegisterAt(0)),
+ Primitive::kPrimNot,
+ nullptr);
+ parallel_move.AddMove(obj_,
+ LocationFrom(calling_convention.GetRegisterAt(1)),
+ Primitive::kPrimNot,
+ nullptr);
+ if (index.IsValid()) {
+ parallel_move.AddMove(index,
+ LocationFrom(calling_convention.GetRegisterAt(2)),
+ Primitive::kPrimInt,
+ nullptr);
+ codegen->GetMoveResolver()->EmitNativeCode(¶llel_move);
+ } else {
+ codegen->GetMoveResolver()->EmitNativeCode(¶llel_move);
+ __ Mov(calling_convention.GetRegisterAt(2), offset_);
+ }
+ arm_codegen->InvokeRuntime(kQuickReadBarrierSlow, instruction_, instruction_->GetDexPc(), this);
+ CheckEntrypointTypes<
+ kQuickReadBarrierSlow, mirror::Object*, mirror::Object*, mirror::Object*, uint32_t>();
+ arm_codegen->Move32(out_, LocationFrom(r0));
+
+ RestoreLiveRegisters(codegen, locations);
+ __ B(GetExitLabel());
+ }
+
+ const char* GetDescription() const OVERRIDE {
+ return "ReadBarrierForHeapReferenceSlowPathARMVIXL";
+ }
+
+ private:
+ vixl32::Register FindAvailableCallerSaveRegister(CodeGenerator* codegen) {
+ uint32_t ref = RegisterFrom(ref_).GetCode();
+ uint32_t obj = RegisterFrom(obj_).GetCode();
+ for (uint32_t i = 0, e = codegen->GetNumberOfCoreRegisters(); i < e; ++i) {
+ if (i != ref && i != obj && !codegen->IsCoreCalleeSaveRegister(i)) {
+ return vixl32::Register(i);
+ }
+ }
+ // We shall never fail to find a free caller-save register, as
+ // there are more than two core caller-save registers on ARM
+ // (meaning it is possible to find one which is different from
+ // `ref` and `obj`).
+ DCHECK_GT(codegen->GetNumberOfCoreCallerSaveRegisters(), 2u);
+ LOG(FATAL) << "Could not find a free caller-save register";
+ UNREACHABLE();
+ }
+
+ const Location out_;
+ const Location ref_;
+ const Location obj_;
+ const uint32_t offset_;
+ // An additional location containing an index to an array.
+ // Only used for HArrayGet and the UnsafeGetObject &
+ // UnsafeGetObjectVolatile intrinsics.
+ const Location index_;
+
+ DISALLOW_COPY_AND_ASSIGN(ReadBarrierForHeapReferenceSlowPathARMVIXL);
+};
+
+// Slow path generating a read barrier for a GC root.
+class ReadBarrierForRootSlowPathARMVIXL : public SlowPathCodeARMVIXL {
+ public:
+ ReadBarrierForRootSlowPathARMVIXL(HInstruction* instruction, Location out, Location root)
+ : SlowPathCodeARMVIXL(instruction), out_(out), root_(root) {
+ DCHECK(kEmitCompilerReadBarrier);
+ }
+
+ void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
+ LocationSummary* locations = instruction_->GetLocations();
+ vixl32::Register reg_out = RegisterFrom(out_);
+ DCHECK(locations->CanCall());
+ DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(reg_out.GetCode()));
+ DCHECK(instruction_->IsLoadClass() || instruction_->IsLoadString())
+ << "Unexpected instruction in read barrier for GC root slow path: "
+ << instruction_->DebugName();
+
+ __ Bind(GetEntryLabel());
+ SaveLiveRegisters(codegen, locations);
+
+ InvokeRuntimeCallingConventionARMVIXL calling_convention;
+ CodeGeneratorARMVIXL* arm_codegen = down_cast<CodeGeneratorARMVIXL*>(codegen);
+ arm_codegen->Move32(LocationFrom(calling_convention.GetRegisterAt(0)), root_);
+ arm_codegen->InvokeRuntime(kQuickReadBarrierForRootSlow,
+ instruction_,
+ instruction_->GetDexPc(),
+ this);
+ CheckEntrypointTypes<kQuickReadBarrierForRootSlow, mirror::Object*, GcRoot<mirror::Object>*>();
+ arm_codegen->Move32(out_, LocationFrom(r0));
+
+ RestoreLiveRegisters(codegen, locations);
+ __ B(GetExitLabel());
+ }
+
+ const char* GetDescription() const OVERRIDE { return "ReadBarrierForRootSlowPathARMVIXL"; }
+
+ private:
+ const Location out_;
+ const Location root_;
+
+ DISALLOW_COPY_AND_ASSIGN(ReadBarrierForRootSlowPathARMVIXL);
+};
inline vixl32::Condition ARMCondition(IfCondition cond) {
switch (cond) {
@@ -629,9 +1196,30 @@
return mask;
}
-size_t CodeGeneratorARMVIXL::RestoreFloatingPointRegister(size_t stack_index, uint32_t reg_id) {
- GetAssembler()->LoadSFromOffset(vixl32::SRegister(reg_id), sp, stack_index);
- return kArmWordSize;
+// Saves the register in the stack. Returns the size taken on stack.
+size_t CodeGeneratorARMVIXL::SaveCoreRegister(size_t stack_index ATTRIBUTE_UNUSED,
+ uint32_t reg_id ATTRIBUTE_UNUSED) {
+ TODO_VIXL32(FATAL);
+ return 0;
+}
+
+// Restores the register from the stack. Returns the size taken on stack.
+size_t CodeGeneratorARMVIXL::RestoreCoreRegister(size_t stack_index ATTRIBUTE_UNUSED,
+ uint32_t reg_id ATTRIBUTE_UNUSED) {
+ TODO_VIXL32(FATAL);
+ return 0;
+}
+
+size_t CodeGeneratorARMVIXL::SaveFloatingPointRegister(size_t stack_index ATTRIBUTE_UNUSED,
+ uint32_t reg_id ATTRIBUTE_UNUSED) {
+ TODO_VIXL32(FATAL);
+ return 0;
+}
+
+size_t CodeGeneratorARMVIXL::RestoreFloatingPointRegister(size_t stack_index ATTRIBUTE_UNUSED,
+ uint32_t reg_id ATTRIBUTE_UNUSED) {
+ TODO_VIXL32(FATAL);
+ return 0;
}
#undef __
@@ -654,7 +1242,27 @@
instruction_visitor_(graph, this),
move_resolver_(graph->GetArena(), this),
assembler_(graph->GetArena()),
- isa_features_(isa_features) {
+ isa_features_(isa_features),
+ uint32_literals_(std::less<uint32_t>(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ method_patches_(MethodReferenceComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ call_patches_(MethodReferenceComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ relative_call_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ pc_relative_dex_cache_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ boot_image_string_patches_(StringReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ pc_relative_string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ boot_image_type_patches_(TypeReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ boot_image_address_patches_(std::less<uint32_t>(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_string_patches_(StringReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_class_patches_(TypeReferenceValueComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
// Always save the LR register to mimic Quick.
AddAllocatedRegister(Location::RegisterLocation(LR));
// Give d14 and d15 as scratch registers to VIXL.
@@ -673,11 +1281,11 @@
DCHECK_GE(num_entries, kPackedSwitchCompareJumpThreshold);
// We are about to use the assembler to place literals directly. Make sure we have enough
- // underlying code buffer and we have generated the jump table with right size.
- codegen->GetVIXLAssembler()->GetBuffer().Align();
- AssemblerAccurateScope aas(codegen->GetVIXLAssembler(),
- num_entries * sizeof(int32_t),
- CodeBufferCheckScope::kMaximumSize);
+ // underlying code buffer and we have generated a jump table of the right size, using
+ // codegen->GetVIXLAssembler()->GetBuffer().Align();
+ ExactAssemblyScope aas(codegen->GetVIXLAssembler(),
+ num_entries * sizeof(int32_t),
+ CodeBufferCheckScope::kMaximumSize);
// TODO(VIXL): Check that using lower case bind is fine here.
codegen->GetVIXLAssembler()->bind(&table_start_);
for (uint32_t i = 0; i < num_entries; i++) {
@@ -701,7 +1309,7 @@
DCHECK_GT(jump_offset, std::numeric_limits<int32_t>::min());
DCHECK_LE(jump_offset, std::numeric_limits<int32_t>::max());
- bb_addresses_[i].get()->UpdateValue(jump_offset, &codegen->GetVIXLAssembler()->GetBuffer());
+ bb_addresses_[i].get()->UpdateValue(jump_offset, codegen->GetVIXLAssembler()->GetBuffer());
}
}
@@ -789,11 +1397,11 @@
if (!skip_overflow_check) {
UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
- __ Sub(temp, sp, static_cast<int32_t>(GetStackOverflowReservedBytes(kArm)));
+ __ Sub(temp, sp, Operand::From(GetStackOverflowReservedBytes(kArm)));
// The load must immediately precede RecordPcInfo.
- AssemblerAccurateScope aas(GetVIXLAssembler(),
- kArmInstrMaxSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ ldr(temp, MemOperand(temp));
RecordPcInfo(nullptr, 0);
}
@@ -814,10 +1422,25 @@
GetAssembler()->cfi().AdjustCFAOffset(kArmWordSize * POPCOUNT(fpu_spill_mask_));
GetAssembler()->cfi().RelOffsetForMany(DWARFReg(s0), 0, fpu_spill_mask_, kArmWordSize);
}
+
+ if (GetGraph()->HasShouldDeoptimizeFlag()) {
+ UseScratchRegisterScope temps(GetVIXLAssembler());
+ vixl32::Register temp = temps.Acquire();
+ // Initialize should_deoptimize flag to 0.
+ __ Mov(temp, 0);
+ GetAssembler()->StoreToOffset(kStoreWord, temp, sp, -kShouldDeoptimizeFlagSize);
+ }
+
int adjust = GetFrameSize() - FrameEntrySpillSize();
__ Sub(sp, sp, adjust);
GetAssembler()->cfi().AdjustCFAOffset(adjust);
- GetAssembler()->StoreToOffset(kStoreWord, kMethodRegister, sp, 0);
+
+ // Save the current method if we need it. Note that we do not
+ // do this in HCurrentMethod, as the instruction might have been removed
+ // in the SSA graph.
+ if (RequiresCurrentMethod()) {
+ GetAssembler()->StoreToOffset(kStoreWord, kMethodRegister, sp, 0);
+ }
}
void CodeGeneratorARMVIXL::GenerateFrameExit() {
@@ -852,6 +1475,116 @@
__ Bind(GetLabelOf(block));
}
+Location InvokeDexCallingConventionVisitorARMVIXL::GetNextLocation(Primitive::Type type) {
+ switch (type) {
+ case Primitive::kPrimBoolean:
+ case Primitive::kPrimByte:
+ case Primitive::kPrimChar:
+ case Primitive::kPrimShort:
+ case Primitive::kPrimInt:
+ case Primitive::kPrimNot: {
+ uint32_t index = gp_index_++;
+ uint32_t stack_index = stack_index_++;
+ if (index < calling_convention.GetNumberOfRegisters()) {
+ return LocationFrom(calling_convention.GetRegisterAt(index));
+ } else {
+ return Location::StackSlot(calling_convention.GetStackOffsetOf(stack_index));
+ }
+ }
+
+ case Primitive::kPrimLong: {
+ uint32_t index = gp_index_;
+ uint32_t stack_index = stack_index_;
+ gp_index_ += 2;
+ stack_index_ += 2;
+ if (index + 1 < calling_convention.GetNumberOfRegisters()) {
+ if (calling_convention.GetRegisterAt(index).Is(r1)) {
+ // Skip R1, and use R2_R3 instead.
+ gp_index_++;
+ index++;
+ }
+ }
+ if (index + 1 < calling_convention.GetNumberOfRegisters()) {
+ DCHECK_EQ(calling_convention.GetRegisterAt(index).GetCode() + 1,
+ calling_convention.GetRegisterAt(index + 1).GetCode());
+
+ return LocationFrom(calling_convention.GetRegisterAt(index),
+ calling_convention.GetRegisterAt(index + 1));
+ } else {
+ return Location::DoubleStackSlot(calling_convention.GetStackOffsetOf(stack_index));
+ }
+ }
+
+ case Primitive::kPrimFloat: {
+ uint32_t stack_index = stack_index_++;
+ if (float_index_ % 2 == 0) {
+ float_index_ = std::max(double_index_, float_index_);
+ }
+ if (float_index_ < calling_convention.GetNumberOfFpuRegisters()) {
+ return LocationFrom(calling_convention.GetFpuRegisterAt(float_index_++));
+ } else {
+ return Location::StackSlot(calling_convention.GetStackOffsetOf(stack_index));
+ }
+ }
+
+ case Primitive::kPrimDouble: {
+ double_index_ = std::max(double_index_, RoundUp(float_index_, 2));
+ uint32_t stack_index = stack_index_;
+ stack_index_ += 2;
+ if (double_index_ + 1 < calling_convention.GetNumberOfFpuRegisters()) {
+ uint32_t index = double_index_;
+ double_index_ += 2;
+ Location result = LocationFrom(
+ calling_convention.GetFpuRegisterAt(index),
+ calling_convention.GetFpuRegisterAt(index + 1));
+ DCHECK(ExpectedPairLayout(result));
+ return result;
+ } else {
+ return Location::DoubleStackSlot(calling_convention.GetStackOffsetOf(stack_index));
+ }
+ }
+
+ case Primitive::kPrimVoid:
+ LOG(FATAL) << "Unexpected parameter type " << type;
+ break;
+ }
+ return Location::NoLocation();
+}
+
+Location InvokeDexCallingConventionVisitorARMVIXL::GetReturnLocation(Primitive::Type type) const {
+ switch (type) {
+ case Primitive::kPrimBoolean:
+ case Primitive::kPrimByte:
+ case Primitive::kPrimChar:
+ case Primitive::kPrimShort:
+ case Primitive::kPrimInt:
+ case Primitive::kPrimNot: {
+ return LocationFrom(r0);
+ }
+
+ case Primitive::kPrimFloat: {
+ return LocationFrom(s0);
+ }
+
+ case Primitive::kPrimLong: {
+ return LocationFrom(r0, r1);
+ }
+
+ case Primitive::kPrimDouble: {
+ return LocationFrom(s0, s1);
+ }
+
+ case Primitive::kPrimVoid:
+ return Location::NoLocation();
+ }
+
+ UNREACHABLE();
+}
+
+Location InvokeDexCallingConventionVisitorARMVIXL::GetMethodLocation() const {
+ return LocationFrom(kMethodRegister);
+}
+
void CodeGeneratorARMVIXL::Move32(Location destination, Location source) {
if (source.Equals(destination)) {
return;
@@ -923,10 +1656,14 @@
uint32_t dex_pc,
SlowPathCode* slow_path) {
ValidateInvokeRuntime(entrypoint, instruction, slow_path);
- GenerateInvokeRuntime(GetThreadOffset<kArmPointerSize>(entrypoint).Int32Value());
+ __ Ldr(lr, MemOperand(tr, GetThreadOffset<kArmPointerSize>(entrypoint).Int32Value()));
+ // Ensure the pc position is recorded immediately after the `blx` instruction.
+ // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used.
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::k16BitT32InstructionSizeInBytes,
+ CodeBufferCheckScope::kExactSize);
+ __ blx(lr);
if (EntrypointRequiresStackMap(entrypoint)) {
- // TODO(VIXL): If necessary, use a scope to ensure we record the pc info immediately after the
- // previous instruction.
RecordPcInfo(instruction, dex_pc, slow_path);
}
}
@@ -935,11 +1672,7 @@
HInstruction* instruction,
SlowPathCode* slow_path) {
ValidateInvokeRuntimeWithoutRecordingPcInfo(instruction, slow_path);
- GenerateInvokeRuntime(entry_point_offset);
-}
-
-void CodeGeneratorARMVIXL::GenerateInvokeRuntime(int32_t entry_point_offset) {
- GetAssembler()->LoadFromOffset(kLoadWord, lr, tr, entry_point_offset);
+ __ Ldr(lr, MemOperand(tr, entry_point_offset));
__ Blx(lr);
}
@@ -1081,7 +1814,7 @@
break;
}
if (right.IsConstant()) {
- int64_t value = right.GetConstant()->AsLongConstant()->GetValue();
+ int64_t value = Int64ConstantFrom(right);
int32_t val_low = Low32Bits(value);
int32_t val_high = High32Bits(value);
@@ -1152,7 +1885,8 @@
void InstructionCodeGeneratorARMVIXL::GenerateTestAndBranch(HInstruction* instruction,
size_t condition_input_index,
vixl32::Label* true_target,
- vixl32::Label* false_target) {
+ vixl32::Label* false_target,
+ bool far_target) {
HInstruction* cond = instruction->InputAt(condition_input_index);
if (true_target == nullptr && false_target == nullptr) {
@@ -1165,7 +1899,7 @@
__ B(true_target);
}
} else {
- DCHECK(cond->AsIntConstant()->IsFalse()) << cond->AsIntConstant()->GetValue();
+ DCHECK(cond->AsIntConstant()->IsFalse()) << Int32ConstantFrom(cond);
if (false_target != nullptr) {
__ B(false_target);
}
@@ -1188,9 +1922,13 @@
DCHECK(cond_val.IsRegister());
}
if (true_target == nullptr) {
- __ Cbz(InputRegisterAt(instruction, condition_input_index), false_target);
+ __ CompareAndBranchIfZero(InputRegisterAt(instruction, condition_input_index),
+ false_target,
+ far_target);
} else {
- __ Cbnz(InputRegisterAt(instruction, condition_input_index), true_target);
+ __ CompareAndBranchIfNonZero(InputRegisterAt(instruction, condition_input_index),
+ true_target,
+ far_target);
}
} else {
// Condition has not been materialized. Use its inputs as the comparison and
@@ -1264,6 +2002,19 @@
/* false_target */ nullptr);
}
+void LocationsBuilderARMVIXL::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ LocationSummary* locations = new (GetGraph()->GetArena())
+ LocationSummary(flag, LocationSummary::kNoCall);
+ locations->SetOut(Location::RequiresRegister());
+}
+
+void InstructionCodeGeneratorARMVIXL::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ GetAssembler()->LoadFromOffset(kLoadWord,
+ OutputRegister(flag),
+ sp,
+ codegen_->GetStackOffsetOfShouldDeoptimizeFlag());
+}
+
void LocationsBuilderARMVIXL::VisitSelect(HSelect* select) {
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select);
if (Primitive::IsFloatingPointType(select->GetType())) {
@@ -1285,7 +2036,8 @@
GenerateTestAndBranch(select,
/* condition_input_index */ 2,
/* true_target */ nullptr,
- &false_target);
+ &false_target,
+ /* far_target */ false);
codegen_->MoveLocation(locations->Out(), locations->InAt(1), select->GetType());
__ Bind(&false_target);
}
@@ -1315,11 +2067,10 @@
}
break;
- // TODO(VIXL): https://android-review.googlesource.com/#/c/252265/
case Primitive::kPrimFloat:
case Primitive::kPrimDouble:
locations->SetInAt(0, Location::RequiresFpuRegister());
- locations->SetInAt(1, Location::RequiresFpuRegister());
+ locations->SetInAt(1, ArithmeticZeroOrFpuRegister(cond->InputAt(1)));
if (!cond->IsEmittedAtUseSite()) {
locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
}
@@ -1339,16 +2090,23 @@
return;
}
+ Location right = cond->GetLocations()->InAt(1);
vixl32::Register out = OutputRegister(cond);
vixl32::Label true_label, false_label;
switch (cond->InputAt(0)->GetType()) {
default: {
// Integer case.
- __ Cmp(InputRegisterAt(cond, 0), InputOperandAt(cond, 1));
- AssemblerAccurateScope aas(GetVIXLAssembler(),
- kArmInstrMaxSizeInBytes * 3u,
- CodeBufferCheckScope::kMaximumSize);
+ if (right.IsRegister()) {
+ __ Cmp(InputRegisterAt(cond, 0), InputOperandAt(cond, 1));
+ } else {
+ DCHECK(right.IsConstant());
+ __ Cmp(InputRegisterAt(cond, 0),
+ CodeGenerator::GetInt32ValueOf(right.GetConstant()));
+ }
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ 3 * vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ ite(ARMCondition(cond->GetCondition()));
__ mov(ARMCondition(cond->GetCondition()), OutputRegister(cond), 1);
__ mov(ARMCondition(cond->GetOppositeCondition()), OutputRegister(cond), 0);
@@ -1562,7 +2320,10 @@
HandleInvoke(invoke);
- // TODO(VIXL): invoke->HasPcRelativeDexCache()
+ // For PC-relative dex cache the invoke has an extra input, the PC-relative address base.
+ if (invoke->HasPcRelativeDexCache()) {
+ invoke->GetLocations()->SetInAt(invoke->GetSpecialInputIndex(), Location::RequiresRegister());
+ }
}
static bool TryGenerateIntrinsicCode(HInvoke* invoke, CodeGeneratorARMVIXL* codegen) {
@@ -1584,15 +2345,13 @@
}
LocationSummary* locations = invoke->GetLocations();
- DCHECK(locations->HasTemps());
- codegen_->GenerateStaticOrDirectCall(invoke, locations->GetTemp(0));
- // TODO(VIXL): If necessary, use a scope to ensure we record the pc info immediately after the
- // previous instruction.
+ codegen_->GenerateStaticOrDirectCall(
+ invoke, locations->HasTemps() ? locations->GetTemp(0) : Location::NoLocation());
codegen_->RecordPcInfo(invoke, invoke->GetDexPc());
}
void LocationsBuilderARMVIXL::HandleInvoke(HInvoke* invoke) {
- InvokeDexCallingConventionVisitorARM calling_convention_visitor;
+ InvokeDexCallingConventionVisitorARMVIXL calling_convention_visitor;
CodeGenerator::CreateCommonInvokeLocationSummary(invoke, &calling_convention_visitor);
}
@@ -1611,10 +2370,8 @@
}
codegen_->GenerateVirtualCall(invoke, invoke->GetLocations()->GetTemp(0));
- DCHECK(!codegen_->IsLeafMethod());
- // TODO(VIXL): If necessary, use a scope to ensure we record the pc info immediately after the
- // previous instruction.
codegen_->RecordPcInfo(invoke, invoke->GetDexPc());
+ DCHECK(!codegen_->IsLeafMethod());
}
void LocationsBuilderARMVIXL::VisitInvokeInterface(HInvokeInterface* invoke) {
@@ -1633,10 +2390,15 @@
DCHECK(!receiver.IsStackSlot());
- // /* HeapReference<Class> */ temp = receiver->klass_
- GetAssembler()->LoadFromOffset(kLoadWord, temp, RegisterFrom(receiver), class_offset);
-
- codegen_->MaybeRecordImplicitNullCheck(invoke);
+ // Ensure the pc position is recorded immediately after the `ldr` instruction.
+ {
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ // /* HeapReference<Class> */ temp = receiver->klass_
+ __ ldr(temp, MemOperand(RegisterFrom(receiver), class_offset));
+ codegen_->MaybeRecordImplicitNullCheck(invoke);
+ }
// Instead of simply (possibly) unpoisoning `temp` here, we should
// emit a read barrier for the previous class reference load.
// However this is not required in practice, as this is an
@@ -1661,16 +2423,30 @@
// Set the hidden (in r12) argument. It is done here, right before a BLX to prevent other
// instruction from clobbering it as they might use r12 as a scratch register.
DCHECK(hidden_reg.Is(r12));
- __ Mov(hidden_reg, invoke->GetDexMethodIndex());
{
- AssemblerAccurateScope aas(GetVIXLAssembler(),
- kArmInstrMaxSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ // The VIXL macro assembler may clobber any of the scratch registers that are available to it,
+ // so it checks if the application is using them (by passing them to the macro assembler
+ // methods). The following application of UseScratchRegisterScope corrects VIXL's notion of
+ // what is available, and is the opposite of the standard usage: Instead of requesting a
+ // temporary location, it imposes an external constraint (i.e. a specific register is reserved
+ // for the hidden argument). Note that this works even if VIXL needs a scratch register itself
+ // (to materialize the constant), since the destination register becomes available for such use
+ // internally for the duration of the macro instruction.
+ UseScratchRegisterScope temps(GetVIXLAssembler());
+ temps.Exclude(hidden_reg);
+ __ Mov(hidden_reg, invoke->GetDexMethodIndex());
+ }
+ {
+ // Ensure the pc position is recorded immediately after the `blx` instruction.
+ // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used.
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::k16BitT32InstructionSizeInBytes,
+ CodeBufferCheckScope::kExactSize);
// LR();
__ blx(lr);
- DCHECK(!codegen_->IsLeafMethod());
codegen_->RecordPcInfo(invoke, invoke->GetDexPc());
+ DCHECK(!codegen_->IsLeafMethod());
}
}
@@ -1725,9 +2501,7 @@
case Primitive::kPrimFloat:
case Primitive::kPrimDouble:
- // TODO(VIXL): Consider introducing an InputVRegister()
- // helper function (equivalent to InputRegister()).
- __ Vneg(OutputVRegister(neg), InputVRegisterAt(neg, 0));
+ __ Vneg(OutputVRegister(neg), InputVRegister(neg));
break;
default:
@@ -2017,8 +2791,8 @@
} else {
DCHECK(in.IsConstant());
DCHECK(in.GetConstant()->IsLongConstant());
- int64_t value = in.GetConstant()->AsLongConstant()->GetValue();
- __ Mov(OutputRegister(conversion), static_cast<int32_t>(value));
+ int32_t value = Int32ConstantFrom(in);
+ __ Mov(OutputRegister(conversion), value);
}
break;
@@ -2195,10 +2969,9 @@
break;
}
- // TODO(VIXL): https://android-review.googlesource.com/#/c/254144/
case Primitive::kPrimLong: {
locations->SetInAt(0, Location::RequiresRegister());
- locations->SetInAt(1, Location::RequiresRegister());
+ locations->SetInAt(1, ArmEncodableConstantOrRegister(add->InputAt(1), ADD));
locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
break;
}
@@ -2228,11 +3001,15 @@
}
break;
- // TODO(VIXL): https://android-review.googlesource.com/#/c/254144/
case Primitive::kPrimLong: {
- DCHECK(second.IsRegisterPair());
- __ Adds(LowRegisterFrom(out), LowRegisterFrom(first), LowRegisterFrom(second));
- __ Adc(HighRegisterFrom(out), HighRegisterFrom(first), HighRegisterFrom(second));
+ if (second.IsConstant()) {
+ uint64_t value = static_cast<uint64_t>(Int64FromConstant(second.GetConstant()));
+ GenerateAddLongConst(out, first, value);
+ } else {
+ DCHECK(second.IsRegisterPair());
+ __ Adds(LowRegisterFrom(out), LowRegisterFrom(first), LowRegisterFrom(second));
+ __ Adc(HighRegisterFrom(out), HighRegisterFrom(first), HighRegisterFrom(second));
+ }
break;
}
@@ -2257,10 +3034,9 @@
break;
}
- // TODO(VIXL): https://android-review.googlesource.com/#/c/254144/
case Primitive::kPrimLong: {
locations->SetInAt(0, Location::RequiresRegister());
- locations->SetInAt(1, Location::RequiresRegister());
+ locations->SetInAt(1, ArmEncodableConstantOrRegister(sub->InputAt(1), SUB));
locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
break;
}
@@ -2287,11 +3063,15 @@
break;
}
- // TODO(VIXL): https://android-review.googlesource.com/#/c/254144/
case Primitive::kPrimLong: {
- DCHECK(second.IsRegisterPair());
- __ Subs(LowRegisterFrom(out), LowRegisterFrom(first), LowRegisterFrom(second));
- __ Sbc(HighRegisterFrom(out), HighRegisterFrom(first), HighRegisterFrom(second));
+ if (second.IsConstant()) {
+ uint64_t value = static_cast<uint64_t>(Int64FromConstant(second.GetConstant()));
+ GenerateAddLongConst(out, first, -value);
+ } else {
+ DCHECK(second.IsRegisterPair());
+ __ Subs(LowRegisterFrom(out), LowRegisterFrom(first), LowRegisterFrom(second));
+ __ Sbc(HighRegisterFrom(out), HighRegisterFrom(first), HighRegisterFrom(second));
+ }
break;
}
@@ -2351,8 +3131,8 @@
// Extra checks to protect caused by the existence of R1_R2.
// The algorithm is wrong if out.hi is either in1.lo or in2.lo:
// (e.g. in1=r0_r1, in2=r2_r3 and out=r1_r2);
- DCHECK_NE(out_hi.GetCode(), in1_lo.GetCode());
- DCHECK_NE(out_hi.GetCode(), in2_lo.GetCode());
+ DCHECK(!out_hi.Is(in1_lo));
+ DCHECK(!out_hi.Is(in2_lo));
// input: in1 - 64 bits, in2 - 64 bits
// output: out
@@ -2392,7 +3172,7 @@
vixl32::Register out = OutputRegister(instruction);
vixl32::Register dividend = InputRegisterAt(instruction, 0);
- int32_t imm = second.GetConstant()->AsIntConstant()->GetValue();
+ int32_t imm = Int32ConstantFrom(second);
DCHECK(imm == 1 || imm == -1);
if (instruction->IsRem()) {
@@ -2417,7 +3197,7 @@
vixl32::Register out = OutputRegister(instruction);
vixl32::Register dividend = InputRegisterAt(instruction, 0);
vixl32::Register temp = RegisterFrom(locations->GetTemp(0));
- int32_t imm = second.GetConstant()->AsIntConstant()->GetValue();
+ int32_t imm = Int32ConstantFrom(second);
uint32_t abs_imm = static_cast<uint32_t>(AbsOrMin(imm));
int ctz_imm = CTZ(abs_imm);
@@ -2452,13 +3232,14 @@
vixl32::Register dividend = InputRegisterAt(instruction, 0);
vixl32::Register temp1 = RegisterFrom(locations->GetTemp(0));
vixl32::Register temp2 = RegisterFrom(locations->GetTemp(1));
- int64_t imm = second.GetConstant()->AsIntConstant()->GetValue();
+ int32_t imm = Int32ConstantFrom(second);
int64_t magic;
int shift;
CalculateMagicAndShiftForDivRem(imm, false /* is_long */, &magic, &shift);
- __ Mov(temp1, magic);
+ // TODO(VIXL): Change the static cast to Operand::From() after VIXL is fixed.
+ __ Mov(temp1, static_cast<int32_t>(magic));
__ Smull(temp2, temp1, dividend, temp1);
if (imm > 0 && magic < 0) {
@@ -2489,7 +3270,7 @@
Location second = instruction->GetLocations()->InAt(1);
DCHECK(second.IsConstant());
- int32_t imm = second.GetConstant()->AsIntConstant()->GetValue();
+ int32_t imm = Int32ConstantFrom(second);
if (imm == 0) {
// Do not generate anything. DivZeroCheck would prevent any code to be executed.
} else if (imm == 1 || imm == -1) {
@@ -2523,7 +3304,7 @@
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::ConstantLocation(div->InputAt(1)->AsConstant()));
locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
- int32_t value = div->InputAt(1)->AsIntConstant()->GetValue();
+ int32_t value = Int32ConstantFrom(div->InputAt(1));
if (value == 1 || value == 0 || value == -1) {
// No temp register required.
} else {
@@ -2636,7 +3417,7 @@
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::ConstantLocation(rem->InputAt(1)->AsConstant()));
locations->SetOut(Location::RequiresRegister(), Location::kNoOutputOverlap);
- int32_t value = rem->InputAt(1)->AsIntConstant()->GetValue();
+ int32_t value = Int32ConstantFrom(rem->InputAt(1));
if (value == 1 || value == 0 || value == -1) {
// No temp register required.
} else {
@@ -2749,15 +3530,8 @@
void LocationsBuilderARMVIXL::VisitDivZeroCheck(HDivZeroCheck* instruction) {
- // TODO(VIXL): https://android-review.googlesource.com/#/c/275337/
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
locations->SetInAt(0, Location::RegisterOrConstant(instruction->InputAt(0)));
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void InstructionCodeGeneratorARMVIXL::VisitDivZeroCheck(HDivZeroCheck* instruction) {
@@ -2775,10 +3549,10 @@
case Primitive::kPrimShort:
case Primitive::kPrimInt: {
if (value.IsRegister()) {
- __ Cbz(InputRegisterAt(instruction, 0), slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(InputRegisterAt(instruction, 0), slow_path->GetEntryLabel());
} else {
DCHECK(value.IsConstant()) << value;
- if (value.GetConstant()->AsIntConstant()->GetValue() == 0) {
+ if (Int32ConstantFrom(value) == 0) {
__ B(slow_path->GetEntryLabel());
}
}
@@ -2792,7 +3566,7 @@
__ B(eq, slow_path->GetEntryLabel());
} else {
DCHECK(value.IsConstant()) << value;
- if (value.GetConstant()->AsLongConstant()->GetValue() == 0) {
+ if (Int64ConstantFrom(value) == 0) {
__ B(slow_path->GetEntryLabel());
}
}
@@ -2851,9 +3625,9 @@
}
// Rotate, or mov to out for zero or word size rotations.
if (rot != 0u) {
- __ Lsr(out_reg_hi, in_reg_hi, rot);
+ __ Lsr(out_reg_hi, in_reg_hi, Operand::From(rot));
__ Orr(out_reg_hi, out_reg_hi, Operand(in_reg_lo, ShiftType::LSL, kArmBitsPerWord - rot));
- __ Lsr(out_reg_lo, in_reg_lo, rot);
+ __ Lsr(out_reg_lo, in_reg_lo, Operand::From(rot));
__ Orr(out_reg_lo, out_reg_lo, Operand(in_reg_hi, ShiftType::LSL, kArmBitsPerWord - rot));
} else {
__ Mov(out_reg_lo, in_reg_lo);
@@ -2867,8 +3641,7 @@
__ And(shift_right, RegisterFrom(rhs), 0x1F);
__ Lsrs(shift_left, RegisterFrom(rhs), 6);
- // TODO(VIXL): Check that flags are kept after "vixl32::LeaveFlags" enabled.
- __ Rsb(shift_left, shift_right, kArmBitsPerWord);
+ __ Rsb(LeaveFlags, shift_left, shift_right, Operand::From(kArmBitsPerWord));
__ B(cc, &shift_by_32_plus_shift_right);
// out_reg_hi = (reg_hi << shift_left) | (reg_lo >> shift_right).
@@ -3003,7 +3776,7 @@
__ Lsr(out_reg, first_reg, out_reg);
}
} else {
- int32_t cst = second.GetConstant()->AsIntConstant()->GetValue();
+ int32_t cst = Int32ConstantFrom(second);
uint32_t shift_value = cst & kMaxIntShiftDistance;
if (shift_value == 0) { // ARM does not support shifting with 0 immediate.
__ Mov(out_reg, first_reg);
@@ -3034,15 +3807,15 @@
// Shift the high part
__ Lsl(o_h, high, o_l);
// Shift the low part and `or` what overflew on the high part
- __ Rsb(temp, o_l, kArmBitsPerWord);
+ __ Rsb(temp, o_l, Operand::From(kArmBitsPerWord));
__ Lsr(temp, low, temp);
__ Orr(o_h, o_h, temp);
// If the shift is > 32 bits, override the high part
- __ Subs(temp, o_l, kArmBitsPerWord);
+ __ Subs(temp, o_l, Operand::From(kArmBitsPerWord));
{
- AssemblerAccurateScope guard(GetVIXLAssembler(),
- 3 * kArmInstrMaxSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope guard(GetVIXLAssembler(),
+ 2 * vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ it(pl);
__ lsl(pl, o_h, low, temp);
}
@@ -3053,15 +3826,15 @@
// Shift the low part
__ Lsr(o_l, low, o_h);
// Shift the high part and `or` what underflew on the low part
- __ Rsb(temp, o_h, kArmBitsPerWord);
+ __ Rsb(temp, o_h, Operand::From(kArmBitsPerWord));
__ Lsl(temp, high, temp);
__ Orr(o_l, o_l, temp);
// If the shift is > 32 bits, override the low part
- __ Subs(temp, o_h, kArmBitsPerWord);
+ __ Subs(temp, o_h, Operand::From(kArmBitsPerWord));
{
- AssemblerAccurateScope guard(GetVIXLAssembler(),
- 3 * kArmInstrMaxSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope guard(GetVIXLAssembler(),
+ 2 * vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ it(pl);
__ asr(pl, o_l, high, temp);
}
@@ -3071,14 +3844,14 @@
__ And(o_h, second_reg, kMaxLongShiftDistance);
// same as Shr except we use `Lsr`s and not `Asr`s
__ Lsr(o_l, low, o_h);
- __ Rsb(temp, o_h, kArmBitsPerWord);
+ __ Rsb(temp, o_h, Operand::From(kArmBitsPerWord));
__ Lsl(temp, high, temp);
__ Orr(o_l, o_l, temp);
- __ Subs(temp, o_h, kArmBitsPerWord);
+ __ Subs(temp, o_h, Operand::From(kArmBitsPerWord));
{
- AssemblerAccurateScope guard(GetVIXLAssembler(),
- 3 * kArmInstrMaxSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope guard(GetVIXLAssembler(),
+ 2 * vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ it(pl);
__ lsr(pl, o_l, high, temp);
}
@@ -3088,7 +3861,7 @@
// Register allocator doesn't create partial overlap.
DCHECK(!o_l.Is(high));
DCHECK(!o_h.Is(low));
- int32_t cst = second.GetConstant()->AsIntConstant()->GetValue();
+ int32_t cst = Int32ConstantFrom(second);
uint32_t shift_value = cst & kMaxLongShiftDistance;
if (shift_value > 32) {
if (op->IsShl()) {
@@ -3194,9 +3967,10 @@
MemberOffset code_offset = ArtMethod::EntryPointFromQuickCompiledCodeOffset(kArmPointerSize);
GetAssembler()->LoadFromOffset(kLoadWord, temp, tr, QUICK_ENTRY_POINT(pNewEmptyString));
GetAssembler()->LoadFromOffset(kLoadWord, lr, temp, code_offset.Int32Value());
- AssemblerAccurateScope aas(GetVIXLAssembler(),
- kArmInstrMaxSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used.
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::k16BitT32InstructionSizeInBytes,
+ CodeBufferCheckScope::kExactSize);
__ blx(lr);
codegen_->RecordPcInfo(instruction, instruction->GetDexPc());
} else {
@@ -3217,7 +3991,7 @@
void InstructionCodeGeneratorARMVIXL::VisitNewArray(HNewArray* instruction) {
InvokeRuntimeCallingConventionARMVIXL calling_convention;
- __ Mov(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex());
+ __ Mov(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex().index_);
// Note: if heap poisoning is enabled, the entry point takes cares
// of poisoning the reference.
codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
@@ -3418,7 +4192,7 @@
__ Add(temp, addr, offset);
addr = temp;
}
- __ Ldrexd(out_lo, out_hi, addr);
+ __ Ldrexd(out_lo, out_hi, MemOperand(addr));
}
void InstructionCodeGeneratorARMVIXL::GenerateWideAtomicStore(vixl32::Register addr,
@@ -3436,12 +4210,18 @@
addr = temp;
}
__ Bind(&fail);
- // We need a load followed by store. (The address used in a STREX instruction must
- // be the same as the address in the most recently executed LDREX instruction.)
- __ Ldrexd(temp1, temp2, addr);
- codegen_->MaybeRecordImplicitNullCheck(instruction);
- __ Strexd(temp1, value_lo, value_hi, addr);
- __ Cbnz(temp1, &fail);
+ {
+ // Ensure the pc position is recorded immediately after the `ldrexd` instruction.
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ // We need a load followed by store. (The address used in a STREX instruction must
+ // be the same as the address in the most recently executed LDREX instruction.)
+ __ ldrexd(temp1, temp2, MemOperand(addr));
+ codegen_->MaybeRecordImplicitNullCheck(instruction);
+ }
+ __ Strexd(temp1, value_lo, value_hi, MemOperand(addr));
+ __ CompareAndBranchIfNonZero(temp1, &fail);
}
void LocationsBuilderARMVIXL::HandleFieldSet(
@@ -3588,6 +4368,11 @@
// Longs and doubles are handled in the switch.
if (field_type != Primitive::kPrimLong && field_type != Primitive::kPrimDouble) {
+ // TODO(VIXL): Here and for other calls to `MaybeRecordImplicitNullCheck` in this method, we
+ // should use a scope and the assembler to emit the store instruction to guarantee that we
+ // record the pc at the correct position. But the `Assembler` does not automatically handle
+ // unencodable offsets. Practically, everything is fine because the helper and VIXL, at the time
+ // of writing, do generate the store instruction last.
codegen_->MaybeRecordImplicitNullCheck(instruction);
}
@@ -3646,7 +4431,7 @@
locations->AddTemp(Location::RequiresRegister());
} else if (object_field_get_with_read_barrier && kUseBakerReadBarrier) {
// We need a temporary register for the read barrier marking slow
- // path in CodeGeneratorARM::GenerateFieldLoadWithBakerReadBarrier.
+ // path in CodeGeneratorARMVIXL::GenerateFieldLoadWithBakerReadBarrier.
locations->AddTemp(Location::RequiresRegister());
}
}
@@ -3759,10 +4544,16 @@
case Primitive::kPrimNot: {
// /* HeapReference<Object> */ out = *(base + offset)
if (kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
- TODO_VIXL32(FATAL);
+ Location temp_loc = locations->GetTemp(0);
+ // Note that a potential implicit null check is handled in this
+ // CodeGeneratorARMVIXL::GenerateFieldLoadWithBakerReadBarrier call.
+ codegen_->GenerateFieldLoadWithBakerReadBarrier(
+ instruction, out, base, offset, temp_loc, /* needs_null_check */ true);
+ if (is_volatile) {
+ codegen_->GenerateMemoryBarrier(MemBarrierKind::kLoadAny);
+ }
} else {
GetAssembler()->LoadFromOffset(kLoadWord, RegisterFrom(out), base, offset);
- // TODO(VIXL): Scope to guarantee the position immediately after the load.
codegen_->MaybeRecordImplicitNullCheck(instruction);
if (is_volatile) {
codegen_->GenerateMemoryBarrier(MemBarrierKind::kLoadAny);
@@ -3799,7 +4590,6 @@
__ Vmov(out_dreg, lo, hi);
} else {
GetAssembler()->LoadDFromOffset(out_dreg, base, offset);
- // TODO(VIXL): Scope to guarantee the position immediately after the load.
codegen_->MaybeRecordImplicitNullCheck(instruction);
}
break;
@@ -3815,6 +4605,11 @@
// double fields, are handled in the previous switch statement.
} else {
// Address cases other than reference and double that may require an implicit null check.
+ // TODO(VIXL): Here and for other calls to `MaybeRecordImplicitNullCheck` in this method, we
+ // should use a scope and the assembler to emit the load instruction to guarantee that we
+ // record the pc at the correct position. But the `Assembler` does not automatically handle
+ // unencodable offsets. Practically, everything is fine because the helper and VIXL, at the time
+ // of writing, do generate the store instruction last.
codegen_->MaybeRecordImplicitNullCheck(instruction);
}
@@ -3929,15 +4724,8 @@
}
void LocationsBuilderARMVIXL::VisitNullCheck(HNullCheck* instruction) {
- // TODO(VIXL): https://android-review.googlesource.com/#/c/275337/
- LocationSummary::CallKind call_kind = instruction->CanThrowIntoCatchBlock()
- ? LocationSummary::kCallOnSlowPath
- : LocationSummary::kNoCall;
- LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
+ LocationSummary* locations = codegen_->CreateThrowingSlowPathLocations(instruction);
locations->SetInAt(0, Location::RequiresRegister());
- if (instruction->HasUses()) {
- locations->SetOut(Location::SameAsFirstInput());
- }
}
void CodeGeneratorARMVIXL::GenerateImplicitNullCheck(HNullCheck* instruction) {
@@ -3946,9 +4734,10 @@
}
UseScratchRegisterScope temps(GetVIXLAssembler());
- AssemblerAccurateScope aas(GetVIXLAssembler(),
- kArmInstrMaxSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ // Ensure the pc position is recorded immediately after the `ldr` instruction.
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ ldr(temps.Acquire(), MemOperand(InputRegisterAt(instruction, 0)));
RecordPcInfo(instruction, instruction->GetDexPc());
}
@@ -3957,7 +4746,7 @@
NullCheckSlowPathARMVIXL* slow_path =
new (GetGraph()->GetArena()) NullCheckSlowPathARMVIXL(instruction);
AddSlowPath(slow_path);
- __ Cbz(InputRegisterAt(instruction, 0), slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(InputRegisterAt(instruction, 0), slow_path->GetEntryLabel());
}
void InstructionCodeGeneratorARMVIXL::VisitNullCheck(HNullCheck* instruction) {
@@ -4089,7 +4878,7 @@
LocationSummary::kCallOnSlowPath :
LocationSummary::kNoCall);
if (object_array_get_with_read_barrier && kUseBakerReadBarrier) {
- TODO_VIXL32(FATAL);
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RegisterOrConstant(instruction->InputAt(1)));
@@ -4104,7 +4893,7 @@
object_array_get_with_read_barrier ? Location::kOutputOverlap : Location::kNoOutputOverlap);
}
// We need a temporary register for the read barrier marking slow
- // path in CodeGeneratorARM::GenerateArrayLoadWithBakerReadBarrier.
+ // path in CodeGeneratorARMVIXL::GenerateArrayLoadWithBakerReadBarrier.
// Also need for String compression feature.
if ((object_array_get_with_read_barrier && kUseBakerReadBarrier)
|| (mirror::kUseStringCompression && instruction->IsStringCharAt())) {
@@ -4113,7 +4902,6 @@
}
void InstructionCodeGeneratorARMVIXL::VisitArrayGet(HArrayGet* instruction) {
- UseScratchRegisterScope temps(GetAssembler()->GetVIXLAssembler());
LocationSummary* locations = instruction->GetLocations();
Location obj_loc = locations->InAt(0);
vixl32::Register obj = InputRegisterAt(instruction, 0);
@@ -4125,8 +4913,6 @@
instruction->IsStringCharAt();
HInstruction* array_instr = instruction->GetArray();
bool has_intermediate_address = array_instr->IsIntermediateAddress();
- // The read barrier instrumentation does not support the HIntermediateAddress instruction yet.
- DCHECK(!(has_intermediate_address && kEmitCompilerReadBarrier));
switch (type) {
case Primitive::kPrimBoolean:
@@ -4142,7 +4928,7 @@
codegen_->MaybeRecordImplicitNullCheck(instruction);
}
if (index.IsConstant()) {
- int32_t const_index = index.GetConstant()->AsIntConstant()->GetValue();
+ int32_t const_index = Int32ConstantFrom(index);
if (maybe_compressed_char_at) {
vixl32::Label uncompressed_load, done;
__ Lsrs(length, length, 1u); // LSRS has a 16-bit encoding, TST (immediate) does not.
@@ -4167,6 +4953,7 @@
GetAssembler()->LoadFromOffset(load_type, RegisterFrom(out_loc), obj, full_offset);
}
} else {
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
if (has_intermediate_address) {
@@ -4175,7 +4962,7 @@
// `TryExtractArrayAccessAddress()`.
if (kIsDebugBuild) {
HIntermediateAddress* tmp = array_instr->AsIntermediateAddress();
- DCHECK_EQ(tmp->GetOffset()->AsIntConstant()->GetValueAsUint64(), data_offset);
+ DCHECK_EQ(Uint64ConstantFrom(tmp->GetOffset()), data_offset);
}
temp = obj;
} else {
@@ -4200,25 +4987,40 @@
}
case Primitive::kPrimNot: {
+ // The read barrier instrumentation of object ArrayGet
+ // instructions does not support the HIntermediateAddress
+ // instruction.
+ DCHECK(!(has_intermediate_address && kEmitCompilerReadBarrier));
+
static_assert(
sizeof(mirror::HeapReference<mirror::Object>) == sizeof(int32_t),
"art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
// /* HeapReference<Object> */ out =
// *(obj + data_offset + index * sizeof(HeapReference<Object>))
if (kEmitCompilerReadBarrier && kUseBakerReadBarrier) {
- TODO_VIXL32(FATAL);
+ Location temp = locations->GetTemp(0);
+ // Note that a potential implicit null check is handled in this
+ // CodeGeneratorARMVIXL::GenerateArrayLoadWithBakerReadBarrier call.
+ codegen_->GenerateArrayLoadWithBakerReadBarrier(
+ instruction, out_loc, obj, data_offset, index, temp, /* needs_null_check */ true);
} else {
vixl32::Register out = OutputRegister(instruction);
if (index.IsConstant()) {
size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset;
+ (Int32ConstantFrom(index) << TIMES_4) + data_offset;
GetAssembler()->LoadFromOffset(kLoadWord, out, obj, offset);
+ // TODO(VIXL): Here and for other calls to `MaybeRecordImplicitNullCheck` in this method,
+ // we should use a scope and the assembler to emit the load instruction to guarantee that
+ // we record the pc at the correct position. But the `Assembler` does not automatically
+ // handle unencodable offsets. Practically, everything is fine because the helper and
+ // VIXL, at the time of writing, do generate the store instruction last.
codegen_->MaybeRecordImplicitNullCheck(instruction);
// If read barriers are enabled, emit read barriers other than
// Baker's using a slow path (and also unpoison the loaded
// reference, if heap poisoning is enabled).
codegen_->MaybeGenerateReadBarrierSlow(instruction, out_loc, out_loc, obj_loc, offset);
} else {
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
if (has_intermediate_address) {
@@ -4227,14 +5029,17 @@
// `TryExtractArrayAccessAddress()`.
if (kIsDebugBuild) {
HIntermediateAddress* tmp = array_instr->AsIntermediateAddress();
- DCHECK_EQ(tmp->GetOffset()->AsIntConstant()->GetValueAsUint64(), data_offset);
+ DCHECK_EQ(Uint64ConstantFrom(tmp->GetOffset()), data_offset);
}
temp = obj;
} else {
__ Add(temp, obj, data_offset);
}
codegen_->LoadFromShiftedRegOffset(type, out_loc, temp, RegisterFrom(index));
-
+ temps.Close();
+ // TODO(VIXL): Use a scope to ensure that we record the pc position immediately after the
+ // load instruction. Practically, everything is fine because the helper and VIXL, at the
+ // time of writing, do generate the store instruction last.
codegen_->MaybeRecordImplicitNullCheck(instruction);
// If read barriers are enabled, emit read barriers other than
// Baker's using a slow path (and also unpoison the loaded
@@ -4249,9 +5054,10 @@
case Primitive::kPrimLong: {
if (index.IsConstant()) {
size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + data_offset;
+ (Int32ConstantFrom(index) << TIMES_8) + data_offset;
GetAssembler()->LoadFromOffset(kLoadWordPair, LowRegisterFrom(out_loc), obj, offset);
} else {
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
__ Add(temp, obj, Operand(RegisterFrom(index), vixl32::LSL, TIMES_8));
GetAssembler()->LoadFromOffset(kLoadWordPair, LowRegisterFrom(out_loc), temp, data_offset);
@@ -4262,9 +5068,10 @@
case Primitive::kPrimFloat: {
vixl32::SRegister out = SRegisterFrom(out_loc);
if (index.IsConstant()) {
- size_t offset = (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset;
+ size_t offset = (Int32ConstantFrom(index) << TIMES_4) + data_offset;
GetAssembler()->LoadSFromOffset(out, obj, offset);
} else {
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
__ Add(temp, obj, Operand(RegisterFrom(index), vixl32::LSL, TIMES_4));
GetAssembler()->LoadSFromOffset(out, temp, data_offset);
@@ -4274,9 +5081,10 @@
case Primitive::kPrimDouble: {
if (index.IsConstant()) {
- size_t offset = (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + data_offset;
+ size_t offset = (Int32ConstantFrom(index) << TIMES_8) + data_offset;
GetAssembler()->LoadDFromOffset(DRegisterFrom(out_loc), obj, offset);
} else {
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
__ Add(temp, obj, Operand(RegisterFrom(index), vixl32::LSL, TIMES_8));
GetAssembler()->LoadDFromOffset(DRegisterFrom(out_loc), temp, data_offset);
@@ -4293,6 +5101,8 @@
// Potential implicit null checks, in the case of reference
// arrays, are handled in the previous switch statement.
} else if (!maybe_compressed_char_at) {
+ // TODO(VIXL): Use a scope to ensure we record the pc info immediately after
+ // the preceding load instruction.
codegen_->MaybeRecordImplicitNullCheck(instruction);
}
}
@@ -4325,7 +5135,6 @@
}
void InstructionCodeGeneratorARMVIXL::VisitArraySet(HArraySet* instruction) {
- UseScratchRegisterScope temps(GetAssembler()->GetVIXLAssembler());
LocationSummary* locations = instruction->GetLocations();
vixl32::Register array = InputRegisterAt(instruction, 0);
Location index = locations->InAt(1);
@@ -4338,8 +5147,6 @@
Location value_loc = locations->InAt(2);
HInstruction* array_instr = instruction->GetArray();
bool has_intermediate_address = array_instr->IsIntermediateAddress();
- // The read barrier instrumentation does not support the HIntermediateAddress instruction yet.
- DCHECK(!(has_intermediate_address && kEmitCompilerReadBarrier));
switch (value_type) {
case Primitive::kPrimBoolean:
@@ -4348,12 +5155,13 @@
case Primitive::kPrimChar:
case Primitive::kPrimInt: {
if (index.IsConstant()) {
- int32_t const_index = index.GetConstant()->AsIntConstant()->GetValue();
+ int32_t const_index = Int32ConstantFrom(index);
uint32_t full_offset =
data_offset + (const_index << Primitive::ComponentSizeShift(value_type));
StoreOperandType store_type = GetStoreOperandType(value_type);
GetAssembler()->StoreToOffset(store_type, RegisterFrom(value_loc), array, full_offset);
} else {
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
if (has_intermediate_address) {
@@ -4362,7 +5170,7 @@
// `TryExtractArrayAccessAddress()`.
if (kIsDebugBuild) {
HIntermediateAddress* tmp = array_instr->AsIntermediateAddress();
- DCHECK(tmp->GetOffset()->AsIntConstant()->GetValueAsUint64() == data_offset);
+ DCHECK_EQ(Uint64ConstantFrom(tmp->GetOffset()), data_offset);
}
temp = array;
} else {
@@ -4383,14 +5191,17 @@
// Just setting null.
if (index.IsConstant()) {
size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset;
+ (Int32ConstantFrom(index) << TIMES_4) + data_offset;
GetAssembler()->StoreToOffset(kStoreWord, value, array, offset);
} else {
DCHECK(index.IsRegister()) << index;
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
__ Add(temp, array, data_offset);
codegen_->StoreToShiftedRegOffset(value_type, value_loc, temp, RegisterFrom(index));
}
+ // TODO(VIXL): Use a scope to ensure we record the pc info immediately after the preceding
+ // store instruction.
codegen_->MaybeRecordImplicitNullCheck(instruction);
DCHECK(!needs_write_barrier);
DCHECK(!may_need_runtime_call_for_type_check);
@@ -4413,17 +5224,20 @@
codegen_->AddSlowPath(slow_path);
if (instruction->GetValueCanBeNull()) {
vixl32::Label non_zero;
- __ Cbnz(value, &non_zero);
+ __ CompareAndBranchIfNonZero(value, &non_zero);
if (index.IsConstant()) {
size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset;
+ (Int32ConstantFrom(index) << TIMES_4) + data_offset;
GetAssembler()->StoreToOffset(kStoreWord, value, array, offset);
} else {
DCHECK(index.IsRegister()) << index;
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
__ Add(temp, array, data_offset);
codegen_->StoreToShiftedRegOffset(value_type, value_loc, temp, RegisterFrom(index));
}
+ // TODO(VIXL): Use a scope to ensure we record the pc info immediately after the preceding
+ // store instruction.
codegen_->MaybeRecordImplicitNullCheck(instruction);
__ B(&done);
__ Bind(&non_zero);
@@ -4437,9 +5251,15 @@
// negative, in which case we would take the ArraySet slow
// path.
- // /* HeapReference<Class> */ temp1 = array->klass_
- GetAssembler()->LoadFromOffset(kLoadWord, temp1, array, class_offset);
- codegen_->MaybeRecordImplicitNullCheck(instruction);
+ {
+ // Ensure we record the pc position immediately after the `ldr` instruction.
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ // /* HeapReference<Class> */ temp1 = array->klass_
+ __ ldr(temp1, MemOperand(array, class_offset));
+ codegen_->MaybeRecordImplicitNullCheck(instruction);
+ }
GetAssembler()->MaybeUnpoisonHeapReference(temp1);
// /* HeapReference<Class> */ temp1 = temp1->component_type_
@@ -4461,7 +5281,7 @@
GetAssembler()->LoadFromOffset(kLoadWord, temp1, temp1, super_offset);
// If heap poisoning is enabled, no need to unpoison
// `temp1`, as we are comparing against null below.
- __ Cbnz(temp1, slow_path->GetEntryLabel());
+ __ CompareAndBranchIfNonZero(temp1, slow_path->GetEntryLabel());
__ Bind(&do_put);
} else {
__ B(ne, slow_path->GetEntryLabel());
@@ -4481,11 +5301,12 @@
if (index.IsConstant()) {
size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset;
+ (Int32ConstantFrom(index) << TIMES_4) + data_offset;
GetAssembler()->StoreToOffset(kStoreWord, source, array, offset);
} else {
DCHECK(index.IsRegister()) << index;
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
__ Add(temp, array, data_offset);
codegen_->StoreToShiftedRegOffset(value_type,
@@ -4495,6 +5316,8 @@
}
if (!may_need_runtime_call_for_type_check) {
+ // TODO(VIXL): Ensure we record the pc position immediately after the preceding store
+ // instruction.
codegen_->MaybeRecordImplicitNullCheck(instruction);
}
@@ -4515,9 +5338,10 @@
Location value = locations->InAt(2);
if (index.IsConstant()) {
size_t offset =
- (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + data_offset;
+ (Int32ConstantFrom(index) << TIMES_8) + data_offset;
GetAssembler()->StoreToOffset(kStoreWordPair, LowRegisterFrom(value), array, offset);
} else {
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
__ Add(temp, array, Operand(RegisterFrom(index), vixl32::LSL, TIMES_8));
GetAssembler()->StoreToOffset(kStoreWordPair, LowRegisterFrom(value), temp, data_offset);
@@ -4529,9 +5353,10 @@
Location value = locations->InAt(2);
DCHECK(value.IsFpuRegister());
if (index.IsConstant()) {
- size_t offset = (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_4) + data_offset;
+ size_t offset = (Int32ConstantFrom(index) << TIMES_4) + data_offset;
GetAssembler()->StoreSToOffset(SRegisterFrom(value), array, offset);
} else {
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
__ Add(temp, array, Operand(RegisterFrom(index), vixl32::LSL, TIMES_4));
GetAssembler()->StoreSToOffset(SRegisterFrom(value), temp, data_offset);
@@ -4543,9 +5368,10 @@
Location value = locations->InAt(2);
DCHECK(value.IsFpuRegisterPair());
if (index.IsConstant()) {
- size_t offset = (index.GetConstant()->AsIntConstant()->GetValue() << TIMES_8) + data_offset;
+ size_t offset = (Int32ConstantFrom(index) << TIMES_8) + data_offset;
GetAssembler()->StoreDToOffset(DRegisterFrom(value), array, offset);
} else {
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
__ Add(temp, array, Operand(RegisterFrom(index), vixl32::LSL, TIMES_8));
GetAssembler()->StoreDToOffset(DRegisterFrom(value), temp, data_offset);
@@ -4560,6 +5386,8 @@
// Objects are handled in the switch.
if (value_type != Primitive::kPrimNot) {
+ // TODO(VIXL): Ensure we record the pc position immediately after the preceding store
+ // instruction.
codegen_->MaybeRecordImplicitNullCheck(instruction);
}
}
@@ -4575,8 +5403,13 @@
uint32_t offset = CodeGenerator::GetArrayLengthOffset(instruction);
vixl32::Register obj = InputRegisterAt(instruction, 0);
vixl32::Register out = OutputRegister(instruction);
- GetAssembler()->LoadFromOffset(kLoadWord, out, obj, offset);
- codegen_->MaybeRecordImplicitNullCheck(instruction);
+ {
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ __ ldr(out, MemOperand(obj, offset));
+ codegen_->MaybeRecordImplicitNullCheck(instruction);
+ }
// Mask out compression flag from String's array length.
if (mirror::kUseStringCompression && instruction->IsStringLength()) {
__ Lsr(out, out, 1u);
@@ -4584,8 +5417,6 @@
}
void LocationsBuilderARMVIXL::VisitIntermediateAddress(HIntermediateAddress* instruction) {
- // The read barrier instrumentation does not support the HIntermediateAddress instruction yet.
- DCHECK(!kEmitCompilerReadBarrier);
LocationSummary* locations =
new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
@@ -4599,13 +5430,10 @@
vixl32::Register first = InputRegisterAt(instruction, 0);
Location second = instruction->GetLocations()->InAt(1);
- // The read barrier instrumentation does not support the HIntermediateAddress instruction yet.
- DCHECK(!kEmitCompilerReadBarrier);
-
if (second.IsRegister()) {
__ Add(out, first, RegisterFrom(second));
} else {
- __ Add(out, first, second.GetConstant()->AsIntConstant()->GetValue());
+ __ Add(out, first, Int32ConstantFrom(second));
}
}
@@ -4638,11 +5466,11 @@
bool can_be_null) {
vixl32::Label is_null;
if (can_be_null) {
- __ Cbz(value, &is_null);
+ __ CompareAndBranchIfZero(value, &is_null);
}
GetAssembler()->LoadFromOffset(
kLoadWord, card, tr, Thread::CardTableOffset<kArmPointerSize>().Int32Value());
- __ Lsr(temp, object, gc::accounting::CardTable::kCardShift);
+ __ Lsr(temp, object, Operand::From(gc::accounting::CardTable::kCardShift));
__ Strb(card, MemOperand(card, temp));
if (can_be_null) {
__ Bind(&is_null);
@@ -4658,8 +5486,9 @@
}
void LocationsBuilderARMVIXL::VisitSuspendCheck(HSuspendCheck* instruction) {
- new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnSlowPath);
- // TODO(VIXL): https://android-review.googlesource.com/#/c/275337/ and related.
+ LocationSummary* locations =
+ new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnSlowPath);
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
}
void InstructionCodeGeneratorARMVIXL::VisitSuspendCheck(HSuspendCheck* instruction) {
@@ -4692,15 +5521,15 @@
DCHECK_EQ(slow_path->GetSuccessor(), successor);
}
- UseScratchRegisterScope temps(GetAssembler()->GetVIXLAssembler());
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
GetAssembler()->LoadFromOffset(
kLoadUnsignedHalfword, temp, tr, Thread::ThreadFlagsOffset<kArmPointerSize>().Int32Value());
if (successor == nullptr) {
- __ Cbnz(temp, slow_path->GetEntryLabel());
+ __ CompareAndBranchIfNonZero(temp, slow_path->GetEntryLabel());
__ Bind(slow_path->GetReturnLabel());
} else {
- __ Cbz(temp, codegen_->GetLabelOf(successor));
+ __ CompareAndBranchIfZero(temp, codegen_->GetLabelOf(successor));
__ B(slow_path->GetEntryLabel());
}
}
@@ -4800,7 +5629,7 @@
GetAssembler()->StoreToOffset(kStoreWord, temp, sp, destination.GetStackIndex());
}
} else if (constant->IsLongConstant()) {
- int64_t value = constant->AsLongConstant()->GetValue();
+ int64_t value = Int64ConstantFrom(source);
if (destination.IsRegisterPair()) {
__ Mov(LowRegisterFrom(destination), Low32Bits(value));
__ Mov(HighRegisterFrom(destination), High32Bits(value));
@@ -4884,9 +5713,12 @@
} else if (source.IsStackSlot() && destination.IsRegister()) {
Exchange(RegisterFrom(destination), source.GetStackIndex());
} else if (source.IsStackSlot() && destination.IsStackSlot()) {
- TODO_VIXL32(FATAL);
+ Exchange(source.GetStackIndex(), destination.GetStackIndex());
} else if (source.IsFpuRegister() && destination.IsFpuRegister()) {
- TODO_VIXL32(FATAL);
+ vixl32::SRegister temp = temps.AcquireS();
+ __ Vmov(temp, SRegisterFrom(source));
+ __ Vmov(SRegisterFrom(source), SRegisterFrom(destination));
+ __ Vmov(SRegisterFrom(destination), temp);
} else if (source.IsRegisterPair() && destination.IsRegisterPair()) {
vixl32::DRegister temp = temps.AcquireD();
__ Vmov(temp, LowRegisterFrom(source), HighRegisterFrom(source));
@@ -4909,9 +5741,27 @@
__ Vmov(first, second);
__ Vmov(second, temp);
} else if (source.IsFpuRegisterPair() || destination.IsFpuRegisterPair()) {
- TODO_VIXL32(FATAL);
+ vixl32::DRegister reg = source.IsFpuRegisterPair()
+ ? DRegisterFrom(source)
+ : DRegisterFrom(destination);
+ int mem = source.IsFpuRegisterPair()
+ ? destination.GetStackIndex()
+ : source.GetStackIndex();
+ vixl32::DRegister temp = temps.AcquireD();
+ __ Vmov(temp, reg);
+ GetAssembler()->LoadDFromOffset(reg, sp, mem);
+ GetAssembler()->StoreDToOffset(temp, sp, mem);
} else if (source.IsFpuRegister() || destination.IsFpuRegister()) {
- TODO_VIXL32(FATAL);
+ vixl32::SRegister reg = source.IsFpuRegister()
+ ? SRegisterFrom(source)
+ : SRegisterFrom(destination);
+ int mem = source.IsFpuRegister()
+ ? destination.GetStackIndex()
+ : source.GetStackIndex();
+ vixl32::Register temp = temps.Acquire();
+ __ Vmov(temp, reg);
+ GetAssembler()->LoadSFromOffset(reg, sp, mem);
+ GetAssembler()->StoreToOffset(kStoreWord, temp, sp, mem);
} else if (source.IsDoubleStackSlot() && destination.IsDoubleStackSlot()) {
vixl32::DRegister temp1 = temps.AcquireD();
vixl32::DRegister temp2 = temps.AcquireD();
@@ -4932,12 +5782,35 @@
TODO_VIXL32(FATAL);
}
-// Check if the desired_class_load_kind is supported. If it is, return it,
-// otherwise return a fall-back kind that should be used instead.
HLoadClass::LoadKind CodeGeneratorARMVIXL::GetSupportedLoadClassKind(
- HLoadClass::LoadKind desired_class_load_kind ATTRIBUTE_UNUSED) {
- // TODO(VIXL): Implement optimized code paths.
- return HLoadClass::LoadKind::kDexCacheViaMethod;
+ HLoadClass::LoadKind desired_class_load_kind) {
+ switch (desired_class_load_kind) {
+ case HLoadClass::LoadKind::kReferrersClass:
+ break;
+ case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
+ DCHECK(!GetCompilerOptions().GetCompilePic());
+ break;
+ case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
+ DCHECK(GetCompilerOptions().GetCompilePic());
+ break;
+ case HLoadClass::LoadKind::kBootImageAddress:
+ break;
+ case HLoadClass::LoadKind::kJitTableAddress:
+ break;
+ case HLoadClass::LoadKind::kDexCachePcRelative:
+ DCHECK(!Runtime::Current()->UseJitCompilation());
+ // We disable pc-relative load when there is an irreducible loop, as the optimization
+ // is incompatible with it.
+ // TODO: Create as many ArmDexCacheArraysBase instructions as needed for methods
+ // with irreducible loops.
+ if (GetGraph()->HasIrreducibleLoops()) {
+ return HLoadClass::LoadKind::kDexCacheViaMethod;
+ }
+ break;
+ case HLoadClass::LoadKind::kDexCacheViaMethod:
+ break;
+ }
+ return desired_class_load_kind;
}
void LocationsBuilderARMVIXL::VisitLoadClass(HLoadClass* cls) {
@@ -4951,11 +5824,15 @@
return;
}
- // TODO(VIXL): read barrier code.
- LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || kEmitCompilerReadBarrier)
+ const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage();
+ LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier)
? LocationSummary::kCallOnSlowPath
: LocationSummary::kNoCall;
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(cls, call_kind);
+ if (kUseBakerReadBarrier && requires_read_barrier && !cls->NeedsEnvironment()) {
+ locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty()); // No caller-save registers.
+ }
+
HLoadClass::LoadKind load_kind = cls->GetLoadKind();
if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
load_kind == HLoadClass::LoadKind::kDexCacheViaMethod ||
@@ -4968,7 +5845,7 @@
void InstructionCodeGeneratorARMVIXL::VisitLoadClass(HLoadClass* cls) {
LocationSummary* locations = cls->GetLocations();
if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex());
+ codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
return;
@@ -4977,7 +5854,9 @@
Location out_loc = locations->Out();
vixl32::Register out = OutputRegister(cls);
- // TODO(VIXL): read barrier code.
+ const ReadBarrierOption read_barrier_option = cls->IsInBootImage()
+ ? kWithoutReadBarrier
+ : kCompilerReadBarrierOption;
bool generate_null_check = false;
switch (cls->GetLoadKind()) {
case HLoadClass::LoadKind::kReferrersClass: {
@@ -4989,7 +5868,44 @@
out_loc,
current_method,
ArtMethod::DeclaringClassOffset().Int32Value(),
- kEmitCompilerReadBarrier);
+ read_barrier_option);
+ break;
+ }
+ case HLoadClass::LoadKind::kBootImageLinkTimeAddress: {
+ DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
+ __ Ldr(out, codegen_->DeduplicateBootImageTypeLiteral(cls->GetDexFile(),
+ cls->GetTypeIndex()));
+ break;
+ }
+ case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: {
+ DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
+ CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
+ codegen_->NewPcRelativeTypePatch(cls->GetDexFile(), cls->GetTypeIndex());
+ codegen_->EmitMovwMovtPlaceholder(labels, out);
+ break;
+ }
+ case HLoadClass::LoadKind::kBootImageAddress: {
+ DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
+ DCHECK_NE(cls->GetAddress(), 0u);
+ uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+ __ Ldr(out, codegen_->DeduplicateBootImageAddressLiteral(address));
+ break;
+ }
+ case HLoadClass::LoadKind::kJitTableAddress: {
+ __ Ldr(out, codegen_->DeduplicateJitClassLiteral(cls->GetDexFile(),
+ cls->GetTypeIndex(),
+ cls->GetAddress()));
+ // /* GcRoot<mirror::Class> */ out = *out
+ GenerateGcRootFieldLoad(cls, out_loc, out, /* offset */ 0, kCompilerReadBarrierOption);
+ break;
+ }
+ case HLoadClass::LoadKind::kDexCachePcRelative: {
+ vixl32::Register base_reg = InputRegisterAt(cls, 0);
+ HArmDexCacheArraysBase* base = cls->InputAt(0)->AsArmDexCacheArraysBase();
+ int32_t offset = cls->GetDexCacheElementOffset() - base->GetElementOffset();
+ // /* GcRoot<mirror::Class> */ out = *(dex_cache_arrays_base + offset)
+ GenerateGcRootFieldLoad(cls, out_loc, base_reg, offset, read_barrier_option);
+ generate_null_check = !cls->IsInDexCache();
break;
}
case HLoadClass::LoadKind::kDexCacheViaMethod: {
@@ -5000,8 +5916,8 @@
ArtMethod::DexCacheResolvedTypesOffset(kArmPointerSize).Int32Value();
GetAssembler()->LoadFromOffset(kLoadWord, out, current_method, resolved_types_offset);
// /* GcRoot<mirror::Class> */ out = out[type_index]
- size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex());
- GenerateGcRootFieldLoad(cls, out_loc, out, offset, kEmitCompilerReadBarrier);
+ size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_);
+ GenerateGcRootFieldLoad(cls, out_loc, out, offset, read_barrier_option);
generate_null_check = !cls->IsInDexCache();
break;
}
@@ -5015,7 +5931,7 @@
cls, cls, cls->GetDexPc(), cls->MustGenerateClinitCheck());
codegen_->AddSlowPath(slow_path);
if (generate_null_check) {
- __ Cbz(out, slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(out, slow_path->GetEntryLabel());
}
if (cls->MustGenerateClinitCheck()) {
GenerateClassInitializationCheck(slow_path, out);
@@ -5061,42 +5977,110 @@
__ Bind(slow_path->GetExitLabel());
}
-// Check if the desired_string_load_kind is supported. If it is, return it,
-// otherwise return a fall-back kind that should be used instead.
HLoadString::LoadKind CodeGeneratorARMVIXL::GetSupportedLoadStringKind(
- HLoadString::LoadKind desired_string_load_kind ATTRIBUTE_UNUSED) {
- // TODO(VIXL): Implement optimized code paths. For now we always use the simpler fallback code.
- return HLoadString::LoadKind::kDexCacheViaMethod;
+ HLoadString::LoadKind desired_string_load_kind) {
+ switch (desired_string_load_kind) {
+ case HLoadString::LoadKind::kBootImageLinkTimeAddress:
+ DCHECK(!GetCompilerOptions().GetCompilePic());
+ break;
+ case HLoadString::LoadKind::kBootImageLinkTimePcRelative:
+ DCHECK(GetCompilerOptions().GetCompilePic());
+ break;
+ case HLoadString::LoadKind::kBootImageAddress:
+ break;
+ case HLoadString::LoadKind::kBssEntry:
+ DCHECK(!Runtime::Current()->UseJitCompilation());
+ break;
+ case HLoadString::LoadKind::kJitTableAddress:
+ DCHECK(Runtime::Current()->UseJitCompilation());
+ break;
+ case HLoadString::LoadKind::kDexCacheViaMethod:
+ break;
+ }
+ return desired_string_load_kind;
}
void LocationsBuilderARMVIXL::VisitLoadString(HLoadString* load) {
- LocationSummary::CallKind call_kind = load->NeedsEnvironment()
- ? LocationSummary::kCallOnMainOnly
- : LocationSummary::kNoCall;
+ LocationSummary::CallKind call_kind = CodeGenerator::GetLoadStringCallKind(load);
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(load, call_kind);
-
- // TODO(VIXL): Implement optimized code paths.
- // See InstructionCodeGeneratorARMVIXL::VisitLoadString.
HLoadString::LoadKind load_kind = load->GetLoadKind();
if (load_kind == HLoadString::LoadKind::kDexCacheViaMethod) {
- locations->SetInAt(0, Location::RequiresRegister());
- // TODO(VIXL): Use InvokeRuntimeCallingConventionARMVIXL instead.
locations->SetOut(LocationFrom(r0));
} else {
locations->SetOut(Location::RequiresRegister());
+ if (load_kind == HLoadString::LoadKind::kBssEntry) {
+ if (!kUseReadBarrier || kUseBakerReadBarrier) {
+ // Rely on the pResolveString and/or marking to save everything, including temps.
+ // Note that IP may theoretically be clobbered by saving/restoring the live register
+ // (only one thanks to the custom calling convention), so we request a different temp.
+ locations->AddTemp(Location::RequiresRegister());
+ RegisterSet caller_saves = RegisterSet::Empty();
+ InvokeRuntimeCallingConventionARMVIXL calling_convention;
+ caller_saves.Add(LocationFrom(calling_convention.GetRegisterAt(0)));
+ // TODO: Add GetReturnLocation() to the calling convention so that we can DCHECK()
+ // that the the kPrimNot result register is the same as the first argument register.
+ locations->SetCustomSlowPathCallerSaves(caller_saves);
+ } else {
+ // For non-Baker read barrier we have a temp-clobbering call.
+ }
+ }
}
}
void InstructionCodeGeneratorARMVIXL::VisitLoadString(HLoadString* load) {
- // TODO(VIXL): Implement optimized code paths.
- // We implemented the simplest solution to get first ART tests passing, we deferred the
- // optimized path until later, we should implement it using ARM64 implementation as a
- // reference. The same related to LocationsBuilderARMVIXL::VisitLoadString.
+ LocationSummary* locations = load->GetLocations();
+ Location out_loc = locations->Out();
+ vixl32::Register out = OutputRegister(load);
+ HLoadString::LoadKind load_kind = load->GetLoadKind();
+
+ switch (load_kind) {
+ case HLoadString::LoadKind::kBootImageLinkTimeAddress: {
+ __ Ldr(out, codegen_->DeduplicateBootImageStringLiteral(load->GetDexFile(),
+ load->GetStringIndex()));
+ return; // No dex cache slow path.
+ }
+ case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
+ DCHECK(codegen_->GetCompilerOptions().IsBootImage());
+ CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+ codegen_->EmitMovwMovtPlaceholder(labels, out);
+ return; // No dex cache slow path.
+ }
+ case HLoadString::LoadKind::kBootImageAddress: {
+ DCHECK_NE(load->GetAddress(), 0u);
+ uint32_t address = dchecked_integral_cast<uint32_t>(load->GetAddress());
+ __ Ldr(out, codegen_->DeduplicateBootImageAddressLiteral(address));
+ return; // No dex cache slow path.
+ }
+ case HLoadString::LoadKind::kBssEntry: {
+ DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
+ vixl32::Register temp = RegisterFrom(locations->GetTemp(0));
+ CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+ codegen_->EmitMovwMovtPlaceholder(labels, temp);
+ GenerateGcRootFieldLoad(load, out_loc, temp, /* offset */ 0, kCompilerReadBarrierOption);
+ LoadStringSlowPathARMVIXL* slow_path =
+ new (GetGraph()->GetArena()) LoadStringSlowPathARMVIXL(load);
+ codegen_->AddSlowPath(slow_path);
+ __ CompareAndBranchIfZero(out, slow_path->GetEntryLabel());
+ __ Bind(slow_path->GetExitLabel());
+ return;
+ }
+ case HLoadString::LoadKind::kJitTableAddress: {
+ __ Ldr(out, codegen_->DeduplicateJitStringLiteral(load->GetDexFile(),
+ load->GetStringIndex()));
+ // /* GcRoot<mirror::String> */ out = *out
+ GenerateGcRootFieldLoad(load, out_loc, out, /* offset */ 0, kCompilerReadBarrierOption);
+ return;
+ }
+ default:
+ break;
+ }
// TODO: Re-add the compiler code to do string dex cache lookup again.
DCHECK_EQ(load->GetLoadKind(), HLoadString::LoadKind::kDexCacheViaMethod);
InvokeRuntimeCallingConventionARMVIXL calling_convention;
- __ Mov(calling_convention.GetRegisterAt(0), load->GetStringIndex());
+ __ Mov(calling_convention.GetRegisterAt(0), load->GetStringIndex().index_);
codegen_->InvokeRuntime(kQuickResolveString, load, load->GetDexPc());
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
}
@@ -5140,14 +6124,27 @@
CheckEntrypointTypes<kQuickDeliverException, void, mirror::Object*>();
}
-static bool TypeCheckNeedsATemporary(TypeCheckKind type_check_kind) {
- return kEmitCompilerReadBarrier &&
- (kUseBakerReadBarrier ||
- type_check_kind == TypeCheckKind::kAbstractClassCheck ||
- type_check_kind == TypeCheckKind::kClassHierarchyCheck ||
- type_check_kind == TypeCheckKind::kArrayObjectCheck);
+// Temp is used for read barrier.
+static size_t NumberOfInstanceOfTemps(TypeCheckKind type_check_kind) {
+ if (kEmitCompilerReadBarrier &&
+ (kUseBakerReadBarrier ||
+ type_check_kind == TypeCheckKind::kAbstractClassCheck ||
+ type_check_kind == TypeCheckKind::kClassHierarchyCheck ||
+ type_check_kind == TypeCheckKind::kArrayObjectCheck)) {
+ return 1;
+ }
+ return 0;
}
+// Interface case has 3 temps, one for holding the number of interfaces, one for the current
+// interface pointer, one for loading the current interface.
+// The other checks have one temp for loading the object's class.
+static size_t NumberOfCheckCastTemps(TypeCheckKind type_check_kind) {
+ if (type_check_kind == TypeCheckKind::kInterfaceCheck) {
+ return 3;
+ }
+ return 1 + NumberOfInstanceOfTemps(type_check_kind);
+}
void LocationsBuilderARMVIXL::VisitInstanceOf(HInstanceOf* instruction) {
LocationSummary::CallKind call_kind = LocationSummary::kNoCall;
@@ -5178,11 +6175,7 @@
// The "out" register is used as a temporary, so it overlaps with the inputs.
// Note that TypeCheckSlowPathARM uses this register too.
locations->SetOut(Location::RequiresRegister(), Location::kOutputOverlap);
- // When read barriers are enabled, we need a temporary register for
- // some cases.
- if (TypeCheckNeedsATemporary(type_check_kind)) {
- locations->AddTemp(Location::RequiresRegister());
- }
+ locations->AddRegisterTemps(NumberOfInstanceOfTemps(type_check_kind));
}
void InstructionCodeGeneratorARMVIXL::VisitInstanceOf(HInstanceOf* instruction) {
@@ -5193,9 +6186,9 @@
vixl32::Register cls = InputRegisterAt(instruction, 1);
Location out_loc = locations->Out();
vixl32::Register out = OutputRegister(instruction);
- Location maybe_temp_loc = TypeCheckNeedsATemporary(type_check_kind) ?
- locations->GetTemp(0) :
- Location::NoLocation();
+ const size_t num_temps = NumberOfInstanceOfTemps(type_check_kind);
+ DCHECK_LE(num_temps, 1u);
+ Location maybe_temp_loc = (num_temps >= 1) ? locations->GetTemp(0) : Location::NoLocation();
uint32_t class_offset = mirror::Object::ClassOffset().Int32Value();
uint32_t super_offset = mirror::Class::SuperClassOffset().Int32Value();
uint32_t component_offset = mirror::Class::ComponentTypeOffset().Int32Value();
@@ -5206,7 +6199,7 @@
// Return 0 if `obj` is null.
// avoid null check if we know obj is not null.
if (instruction->MustDoNullCheck()) {
- __ Cbz(obj, &zero);
+ __ CompareAndBranchIfZero(obj, &zero, /* far_target */ false);
}
switch (type_check_kind) {
@@ -5216,7 +6209,8 @@
out_loc,
obj_loc,
class_offset,
- maybe_temp_loc);
+ maybe_temp_loc,
+ kCompilerReadBarrierOption);
__ Cmp(out, cls);
// Classes must be equal for the instanceof to succeed.
__ B(ne, &zero);
@@ -5231,15 +6225,20 @@
out_loc,
obj_loc,
class_offset,
- maybe_temp_loc);
+ maybe_temp_loc,
+ kCompilerReadBarrierOption);
// If the class is abstract, we eagerly fetch the super class of the
// object to avoid doing a comparison we know will fail.
vixl32::Label loop;
__ Bind(&loop);
// /* HeapReference<Class> */ out = out->super_class_
- GenerateReferenceLoadOneRegister(instruction, out_loc, super_offset, maybe_temp_loc);
+ GenerateReferenceLoadOneRegister(instruction,
+ out_loc,
+ super_offset,
+ maybe_temp_loc,
+ kCompilerReadBarrierOption);
// If `out` is null, we use it for the result, and jump to `done`.
- __ Cbz(out, &done);
+ __ CompareAndBranchIfZero(out, &done, /* far_target */ false);
__ Cmp(out, cls);
__ B(ne, &loop);
__ Mov(out, 1);
@@ -5255,15 +6254,20 @@
out_loc,
obj_loc,
class_offset,
- maybe_temp_loc);
+ maybe_temp_loc,
+ kCompilerReadBarrierOption);
// Walk over the class hierarchy to find a match.
vixl32::Label loop, success;
__ Bind(&loop);
__ Cmp(out, cls);
__ B(eq, &success);
// /* HeapReference<Class> */ out = out->super_class_
- GenerateReferenceLoadOneRegister(instruction, out_loc, super_offset, maybe_temp_loc);
- __ Cbnz(out, &loop);
+ GenerateReferenceLoadOneRegister(instruction,
+ out_loc,
+ super_offset,
+ maybe_temp_loc,
+ kCompilerReadBarrierOption);
+ __ CompareAndBranchIfNonZero(out, &loop);
// If `out` is null, we use it for the result, and jump to `done`.
__ B(&done);
__ Bind(&success);
@@ -5280,19 +6284,24 @@
out_loc,
obj_loc,
class_offset,
- maybe_temp_loc);
+ maybe_temp_loc,
+ kCompilerReadBarrierOption);
// Do an exact check.
vixl32::Label exact_check;
__ Cmp(out, cls);
__ B(eq, &exact_check);
// Otherwise, we need to check that the object's class is a non-primitive array.
// /* HeapReference<Class> */ out = out->component_type_
- GenerateReferenceLoadOneRegister(instruction, out_loc, component_offset, maybe_temp_loc);
+ GenerateReferenceLoadOneRegister(instruction,
+ out_loc,
+ component_offset,
+ maybe_temp_loc,
+ kCompilerReadBarrierOption);
// If `out` is null, we use it for the result, and jump to `done`.
- __ Cbz(out, &done);
+ __ CompareAndBranchIfZero(out, &done, /* far_target */ false);
GetAssembler()->LoadFromOffset(kLoadUnsignedHalfword, out, out, primitive_offset);
static_assert(Primitive::kPrimNot == 0, "Expected 0 for kPrimNot");
- __ Cbnz(out, &zero);
+ __ CompareAndBranchIfNonZero(out, &zero, /* far_target */ false);
__ Bind(&exact_check);
__ Mov(out, 1);
__ B(&done);
@@ -5300,12 +6309,14 @@
}
case TypeCheckKind::kArrayCheck: {
+ // No read barrier since the slow path will retry upon failure.
// /* HeapReference<Class> */ out = obj->klass_
GenerateReferenceLoadTwoRegisters(instruction,
out_loc,
obj_loc,
class_offset,
- maybe_temp_loc);
+ maybe_temp_loc,
+ kWithoutReadBarrier);
__ Cmp(out, cls);
DCHECK(locations->OnlyCallsOnSlowPath());
slow_path = new (GetGraph()->GetArena()) TypeCheckSlowPathARMVIXL(instruction,
@@ -5389,13 +6400,7 @@
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(instruction, call_kind);
locations->SetInAt(0, Location::RequiresRegister());
locations->SetInAt(1, Location::RequiresRegister());
- // Note that TypeCheckSlowPathARM uses this "temp" register too.
- locations->AddTemp(Location::RequiresRegister());
- // When read barriers are enabled, we need an additional temporary
- // register for some cases.
- if (TypeCheckNeedsATemporary(type_check_kind)) {
- locations->AddTemp(Location::RequiresRegister());
- }
+ locations->AddRegisterTemps(NumberOfCheckCastTemps(type_check_kind));
}
void InstructionCodeGeneratorARMVIXL::VisitCheckCast(HCheckCast* instruction) {
@@ -5406,20 +6411,31 @@
vixl32::Register cls = InputRegisterAt(instruction, 1);
Location temp_loc = locations->GetTemp(0);
vixl32::Register temp = RegisterFrom(temp_loc);
- Location maybe_temp2_loc = TypeCheckNeedsATemporary(type_check_kind) ?
- locations->GetTemp(1) :
- Location::NoLocation();
- uint32_t class_offset = mirror::Object::ClassOffset().Int32Value();
- uint32_t super_offset = mirror::Class::SuperClassOffset().Int32Value();
- uint32_t component_offset = mirror::Class::ComponentTypeOffset().Int32Value();
- uint32_t primitive_offset = mirror::Class::PrimitiveTypeOffset().Int32Value();
+ const size_t num_temps = NumberOfCheckCastTemps(type_check_kind);
+ DCHECK_LE(num_temps, 3u);
+ Location maybe_temp2_loc = (num_temps >= 2) ? locations->GetTemp(1) : Location::NoLocation();
+ Location maybe_temp3_loc = (num_temps >= 3) ? locations->GetTemp(2) : Location::NoLocation();
+ const uint32_t class_offset = mirror::Object::ClassOffset().Int32Value();
+ const uint32_t super_offset = mirror::Class::SuperClassOffset().Int32Value();
+ const uint32_t component_offset = mirror::Class::ComponentTypeOffset().Int32Value();
+ const uint32_t primitive_offset = mirror::Class::PrimitiveTypeOffset().Int32Value();
+ const uint32_t iftable_offset = mirror::Class::IfTableOffset().Uint32Value();
+ const uint32_t array_length_offset = mirror::Array::LengthOffset().Uint32Value();
+ const uint32_t object_array_data_offset =
+ mirror::Array::DataOffset(kHeapReferenceSize).Uint32Value();
- bool is_type_check_slow_path_fatal =
- (type_check_kind == TypeCheckKind::kExactCheck ||
- type_check_kind == TypeCheckKind::kAbstractClassCheck ||
- type_check_kind == TypeCheckKind::kClassHierarchyCheck ||
- type_check_kind == TypeCheckKind::kArrayObjectCheck) &&
- !instruction->CanThrowIntoCatchBlock();
+ // Always false for read barriers since we may need to go to the entrypoint for non-fatal cases
+ // from false negatives. The false negatives may come from avoiding read barriers below. Avoiding
+ // read barriers is done for performance and code size reasons.
+ bool is_type_check_slow_path_fatal = false;
+ if (!kEmitCompilerReadBarrier) {
+ is_type_check_slow_path_fatal =
+ (type_check_kind == TypeCheckKind::kExactCheck ||
+ type_check_kind == TypeCheckKind::kAbstractClassCheck ||
+ type_check_kind == TypeCheckKind::kClassHierarchyCheck ||
+ type_check_kind == TypeCheckKind::kArrayObjectCheck) &&
+ !instruction->CanThrowIntoCatchBlock();
+ }
SlowPathCodeARMVIXL* type_check_slow_path =
new (GetGraph()->GetArena()) TypeCheckSlowPathARMVIXL(instruction,
is_type_check_slow_path_fatal);
@@ -5428,15 +6444,20 @@
vixl32::Label done;
// Avoid null check if we know obj is not null.
if (instruction->MustDoNullCheck()) {
- __ Cbz(obj, &done);
+ __ CompareAndBranchIfZero(obj, &done, /* far_target */ false);
}
- // /* HeapReference<Class> */ temp = obj->klass_
- GenerateReferenceLoadTwoRegisters(instruction, temp_loc, obj_loc, class_offset, maybe_temp2_loc);
-
switch (type_check_kind) {
case TypeCheckKind::kExactCheck:
case TypeCheckKind::kArrayCheck: {
+ // /* HeapReference<Class> */ temp = obj->klass_
+ GenerateReferenceLoadTwoRegisters(instruction,
+ temp_loc,
+ obj_loc,
+ class_offset,
+ maybe_temp2_loc,
+ kWithoutReadBarrier);
+
__ Cmp(temp, cls);
// Jump to slow path for throwing the exception or doing a
// more involved array check.
@@ -5445,16 +6466,28 @@
}
case TypeCheckKind::kAbstractClassCheck: {
+ // /* HeapReference<Class> */ temp = obj->klass_
+ GenerateReferenceLoadTwoRegisters(instruction,
+ temp_loc,
+ obj_loc,
+ class_offset,
+ maybe_temp2_loc,
+ kWithoutReadBarrier);
+
// If the class is abstract, we eagerly fetch the super class of the
// object to avoid doing a comparison we know will fail.
vixl32::Label loop;
__ Bind(&loop);
// /* HeapReference<Class> */ temp = temp->super_class_
- GenerateReferenceLoadOneRegister(instruction, temp_loc, super_offset, maybe_temp2_loc);
+ GenerateReferenceLoadOneRegister(instruction,
+ temp_loc,
+ super_offset,
+ maybe_temp2_loc,
+ kWithoutReadBarrier);
// If the class reference currently in `temp` is null, jump to the slow path to throw the
// exception.
- __ Cbz(temp, type_check_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(temp, type_check_slow_path->GetEntryLabel());
// Otherwise, compare the classes.
__ Cmp(temp, cls);
@@ -5463,6 +6496,14 @@
}
case TypeCheckKind::kClassHierarchyCheck: {
+ // /* HeapReference<Class> */ temp = obj->klass_
+ GenerateReferenceLoadTwoRegisters(instruction,
+ temp_loc,
+ obj_loc,
+ class_offset,
+ maybe_temp2_loc,
+ kWithoutReadBarrier);
+
// Walk over the class hierarchy to find a match.
vixl32::Label loop;
__ Bind(&loop);
@@ -5470,39 +6511,52 @@
__ B(eq, &done);
// /* HeapReference<Class> */ temp = temp->super_class_
- GenerateReferenceLoadOneRegister(instruction, temp_loc, super_offset, maybe_temp2_loc);
+ GenerateReferenceLoadOneRegister(instruction,
+ temp_loc,
+ super_offset,
+ maybe_temp2_loc,
+ kWithoutReadBarrier);
// If the class reference currently in `temp` is null, jump to the slow path to throw the
// exception.
- __ Cbz(temp, type_check_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(temp, type_check_slow_path->GetEntryLabel());
// Otherwise, jump to the beginning of the loop.
__ B(&loop);
break;
}
case TypeCheckKind::kArrayObjectCheck: {
+ // /* HeapReference<Class> */ temp = obj->klass_
+ GenerateReferenceLoadTwoRegisters(instruction,
+ temp_loc,
+ obj_loc,
+ class_offset,
+ maybe_temp2_loc,
+ kWithoutReadBarrier);
+
// Do an exact check.
__ Cmp(temp, cls);
__ B(eq, &done);
// Otherwise, we need to check that the object's class is a non-primitive array.
// /* HeapReference<Class> */ temp = temp->component_type_
- GenerateReferenceLoadOneRegister(instruction, temp_loc, component_offset, maybe_temp2_loc);
+ GenerateReferenceLoadOneRegister(instruction,
+ temp_loc,
+ component_offset,
+ maybe_temp2_loc,
+ kWithoutReadBarrier);
// If the component type is null, jump to the slow path to throw the exception.
- __ Cbz(temp, type_check_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(temp, type_check_slow_path->GetEntryLabel());
// Otherwise,the object is indeed an array, jump to label `check_non_primitive_component_type`
// to further check that this component type is not a primitive type.
GetAssembler()->LoadFromOffset(kLoadUnsignedHalfword, temp, temp, primitive_offset);
static_assert(Primitive::kPrimNot == 0, "Expected 0 for art::Primitive::kPrimNot");
- __ Cbnz(temp, type_check_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfNonZero(temp, type_check_slow_path->GetEntryLabel());
break;
}
case TypeCheckKind::kUnresolvedCheck:
- case TypeCheckKind::kInterfaceCheck:
- // We always go into the type check slow path for the unresolved
- // and interface check cases.
- //
+ // We always go into the type check slow path for the unresolved check case.
// We cannot directly call the CheckCast runtime entry point
// without resorting to a type checking slow path here (i.e. by
// calling InvokeRuntime directly), as it would require to
@@ -5510,8 +6564,45 @@
// instruction (following the runtime calling convention), which
// might be cluttered by the potential first read barrier
// emission at the beginning of this method.
+
__ B(type_check_slow_path->GetEntryLabel());
break;
+
+ case TypeCheckKind::kInterfaceCheck: {
+ // Avoid read barriers to improve performance of the fast path. We can not get false
+ // positives by doing this.
+ // /* HeapReference<Class> */ temp = obj->klass_
+ GenerateReferenceLoadTwoRegisters(instruction,
+ temp_loc,
+ obj_loc,
+ class_offset,
+ maybe_temp2_loc,
+ kWithoutReadBarrier);
+
+ // /* HeapReference<Class> */ temp = temp->iftable_
+ GenerateReferenceLoadTwoRegisters(instruction,
+ temp_loc,
+ temp_loc,
+ iftable_offset,
+ maybe_temp2_loc,
+ kWithoutReadBarrier);
+ // Iftable is never null.
+ __ Ldr(RegisterFrom(maybe_temp2_loc), MemOperand(temp, array_length_offset));
+ // Loop through the iftable and check if any class matches.
+ vixl32::Label start_loop;
+ __ Bind(&start_loop);
+ __ CompareAndBranchIfZero(RegisterFrom(maybe_temp2_loc),
+ type_check_slow_path->GetEntryLabel());
+ __ Ldr(RegisterFrom(maybe_temp3_loc), MemOperand(temp, object_array_data_offset));
+ GetAssembler()->MaybeUnpoisonHeapReference(RegisterFrom(maybe_temp3_loc));
+ // Go to next interface.
+ __ Add(temp, temp, Operand::From(2 * kHeapReferenceSize));
+ __ Sub(RegisterFrom(maybe_temp2_loc), RegisterFrom(maybe_temp2_loc), 2);
+ // Compare the classes and continue the loop if they do not match.
+ __ Cmp(cls, RegisterFrom(maybe_temp3_loc));
+ __ B(ne, &start_loop);
+ break;
+ }
}
__ Bind(&done);
@@ -5695,6 +6786,33 @@
__ Eor(out, first, value);
}
+void InstructionCodeGeneratorARMVIXL::GenerateAddLongConst(Location out,
+ Location first,
+ uint64_t value) {
+ vixl32::Register out_low = LowRegisterFrom(out);
+ vixl32::Register out_high = HighRegisterFrom(out);
+ vixl32::Register first_low = LowRegisterFrom(first);
+ vixl32::Register first_high = HighRegisterFrom(first);
+ uint32_t value_low = Low32Bits(value);
+ uint32_t value_high = High32Bits(value);
+ if (value_low == 0u) {
+ if (!out_low.Is(first_low)) {
+ __ Mov(out_low, first_low);
+ }
+ __ Add(out_high, first_high, value_high);
+ return;
+ }
+ __ Adds(out_low, first_low, value_low);
+ if (GetAssembler()->ShifterOperandCanHold(ADC, value_high, kCcDontCare)) {
+ __ Adc(out_high, first_high, value_high);
+ } else if (GetAssembler()->ShifterOperandCanHold(SBC, ~value_high, kCcDontCare)) {
+ __ Sbc(out_high, first_high, ~value_high);
+ } else {
+ LOG(FATAL) << "Unexpected constant " << value_high;
+ UNREACHABLE();
+ }
+}
+
void InstructionCodeGeneratorARMVIXL::HandleBitwiseOperation(HBinaryOperation* instruction) {
LocationSummary* locations = instruction->GetLocations();
Location first = locations->InAt(0);
@@ -5772,13 +6890,30 @@
}
void InstructionCodeGeneratorARMVIXL::GenerateReferenceLoadOneRegister(
- HInstruction* instruction ATTRIBUTE_UNUSED,
+ HInstruction* instruction,
Location out,
uint32_t offset,
- Location maybe_temp ATTRIBUTE_UNUSED) {
+ Location maybe_temp,
+ ReadBarrierOption read_barrier_option) {
vixl32::Register out_reg = RegisterFrom(out);
- if (kEmitCompilerReadBarrier) {
- TODO_VIXL32(FATAL);
+ if (read_barrier_option == kWithReadBarrier) {
+ CHECK(kEmitCompilerReadBarrier);
+ DCHECK(maybe_temp.IsRegister()) << maybe_temp;
+ if (kUseBakerReadBarrier) {
+ // Load with fast path based Baker's read barrier.
+ // /* HeapReference<Object> */ out = *(out + offset)
+ codegen_->GenerateFieldLoadWithBakerReadBarrier(
+ instruction, out, out_reg, offset, maybe_temp, /* needs_null_check */ false);
+ } else {
+ // Load with slow path based read barrier.
+ // Save the value of `out` into `maybe_temp` before overwriting it
+ // in the following move operation, as we will need it for the
+ // read barrier below.
+ __ Mov(RegisterFrom(maybe_temp), out_reg);
+ // /* HeapReference<Object> */ out = *(out + offset)
+ GetAssembler()->LoadFromOffset(kLoadWord, out_reg, out_reg, offset);
+ codegen_->GenerateReadBarrierSlow(instruction, out, out, maybe_temp, offset);
+ }
} else {
// Plain load with no read barrier.
// /* HeapReference<Object> */ out = *(out + offset)
@@ -5788,15 +6923,28 @@
}
void InstructionCodeGeneratorARMVIXL::GenerateReferenceLoadTwoRegisters(
- HInstruction* instruction ATTRIBUTE_UNUSED,
+ HInstruction* instruction,
Location out,
Location obj,
uint32_t offset,
- Location maybe_temp ATTRIBUTE_UNUSED) {
+ Location maybe_temp,
+ ReadBarrierOption read_barrier_option) {
vixl32::Register out_reg = RegisterFrom(out);
vixl32::Register obj_reg = RegisterFrom(obj);
- if (kEmitCompilerReadBarrier) {
- TODO_VIXL32(FATAL);
+ if (read_barrier_option == kWithReadBarrier) {
+ CHECK(kEmitCompilerReadBarrier);
+ if (kUseBakerReadBarrier) {
+ DCHECK(maybe_temp.IsRegister()) << maybe_temp;
+ // Load with fast path based Baker's read barrier.
+ // /* HeapReference<Object> */ out = *(obj + offset)
+ codegen_->GenerateFieldLoadWithBakerReadBarrier(
+ instruction, out, obj_reg, offset, maybe_temp, /* needs_null_check */ false);
+ } else {
+ // Load with slow path based read barrier.
+ // /* HeapReference<Object> */ out = *(obj + offset)
+ GetAssembler()->LoadFromOffset(kLoadWord, out_reg, obj_reg, offset);
+ codegen_->GenerateReadBarrierSlow(instruction, out, out, obj, offset);
+ }
} else {
// Plain load with no read barrier.
// /* HeapReference<Object> */ out = *(obj + offset)
@@ -5806,14 +6954,61 @@
}
void InstructionCodeGeneratorARMVIXL::GenerateGcRootFieldLoad(
- HInstruction* instruction ATTRIBUTE_UNUSED,
+ HInstruction* instruction,
Location root,
vixl32::Register obj,
uint32_t offset,
- bool requires_read_barrier) {
+ ReadBarrierOption read_barrier_option) {
vixl32::Register root_reg = RegisterFrom(root);
- if (requires_read_barrier) {
- TODO_VIXL32(FATAL);
+ if (read_barrier_option == kWithReadBarrier) {
+ DCHECK(kEmitCompilerReadBarrier);
+ if (kUseBakerReadBarrier) {
+ // Fast path implementation of art::ReadBarrier::BarrierForRoot when
+ // Baker's read barrier are used:
+ //
+ // root = obj.field;
+ // temp = Thread::Current()->pReadBarrierMarkReg ## root.reg()
+ // if (temp != null) {
+ // root = temp(root)
+ // }
+
+ // /* GcRoot<mirror::Object> */ root = *(obj + offset)
+ GetAssembler()->LoadFromOffset(kLoadWord, root_reg, obj, offset);
+ static_assert(
+ sizeof(mirror::CompressedReference<mirror::Object>) == sizeof(GcRoot<mirror::Object>),
+ "art::mirror::CompressedReference<mirror::Object> and art::GcRoot<mirror::Object> "
+ "have different sizes.");
+ static_assert(sizeof(mirror::CompressedReference<mirror::Object>) == sizeof(int32_t),
+ "art::mirror::CompressedReference<mirror::Object> and int32_t "
+ "have different sizes.");
+
+ // Slow path marking the GC root `root`.
+ Location temp = LocationFrom(lr);
+ SlowPathCodeARMVIXL* slow_path =
+ new (GetGraph()->GetArena()) ReadBarrierMarkSlowPathARMVIXL(
+ instruction,
+ root,
+ /*entrypoint*/ temp);
+ codegen_->AddSlowPath(slow_path);
+
+ // temp = Thread::Current()->pReadBarrierMarkReg ## root.reg()
+ const int32_t entry_point_offset =
+ CodeGenerator::GetReadBarrierMarkEntryPointsOffset<kArmPointerSize>(root.reg());
+ // Loading the entrypoint does not require a load acquire since it is only changed when
+ // threads are suspended or running a checkpoint.
+ GetAssembler()->LoadFromOffset(kLoadWord, RegisterFrom(temp), tr, entry_point_offset);
+ // The entrypoint is null when the GC is not marking, this prevents one load compared to
+ // checking GetIsGcMarking.
+ __ CompareAndBranchIfNonZero(RegisterFrom(temp), slow_path->GetEntryLabel());
+ __ Bind(slow_path->GetExitLabel());
+ } else {
+ // GC root loaded through a slow path for read barriers other
+ // than Baker's.
+ // /* GcRoot<mirror::Object>* */ root = obj + offset
+ __ Add(root_reg, obj, offset);
+ // /* mirror::Object* */ root = root->Read()
+ codegen_->GenerateReadBarrierForRootSlow(instruction, root, root);
+ }
} else {
// Plain GC root load with no read barrier.
// /* GcRoot<mirror::Object> */ root = *(obj + offset)
@@ -5823,65 +7018,252 @@
}
}
-void CodeGeneratorARMVIXL::GenerateFieldLoadWithBakerReadBarrier(
- HInstruction* instruction ATTRIBUTE_UNUSED,
- Location ref ATTRIBUTE_UNUSED,
- vixl::aarch32::Register obj ATTRIBUTE_UNUSED,
- uint32_t offset ATTRIBUTE_UNUSED,
- Location temp ATTRIBUTE_UNUSED,
- bool needs_null_check ATTRIBUTE_UNUSED) {
- TODO_VIXL32(FATAL);
+void CodeGeneratorARMVIXL::GenerateFieldLoadWithBakerReadBarrier(HInstruction* instruction,
+ Location ref,
+ vixl32::Register obj,
+ uint32_t offset,
+ Location temp,
+ bool needs_null_check) {
+ DCHECK(kEmitCompilerReadBarrier);
+ DCHECK(kUseBakerReadBarrier);
+
+ // /* HeapReference<Object> */ ref = *(obj + offset)
+ Location no_index = Location::NoLocation();
+ ScaleFactor no_scale_factor = TIMES_1;
+ GenerateReferenceLoadWithBakerReadBarrier(
+ instruction, ref, obj, offset, no_index, no_scale_factor, temp, needs_null_check);
}
-void CodeGeneratorARMVIXL::GenerateReferenceLoadWithBakerReadBarrier(
- HInstruction* instruction ATTRIBUTE_UNUSED,
- Location ref ATTRIBUTE_UNUSED,
- vixl::aarch32::Register obj ATTRIBUTE_UNUSED,
- uint32_t offset ATTRIBUTE_UNUSED,
- Location index ATTRIBUTE_UNUSED,
- ScaleFactor scale_factor ATTRIBUTE_UNUSED,
- Location temp ATTRIBUTE_UNUSED,
- bool needs_null_check ATTRIBUTE_UNUSED,
- bool always_update_field ATTRIBUTE_UNUSED,
- vixl::aarch32::Register* temp2 ATTRIBUTE_UNUSED) {
- TODO_VIXL32(FATAL);
+void CodeGeneratorARMVIXL::GenerateArrayLoadWithBakerReadBarrier(HInstruction* instruction,
+ Location ref,
+ vixl32::Register obj,
+ uint32_t data_offset,
+ Location index,
+ Location temp,
+ bool needs_null_check) {
+ DCHECK(kEmitCompilerReadBarrier);
+ DCHECK(kUseBakerReadBarrier);
+
+ static_assert(
+ sizeof(mirror::HeapReference<mirror::Object>) == sizeof(int32_t),
+ "art::mirror::HeapReference<art::mirror::Object> and int32_t have different sizes.");
+ // /* HeapReference<Object> */ ref =
+ // *(obj + data_offset + index * sizeof(HeapReference<Object>))
+ ScaleFactor scale_factor = TIMES_4;
+ GenerateReferenceLoadWithBakerReadBarrier(
+ instruction, ref, obj, data_offset, index, scale_factor, temp, needs_null_check);
}
-void CodeGeneratorARMVIXL::GenerateReadBarrierSlow(HInstruction* instruction ATTRIBUTE_UNUSED,
- Location out ATTRIBUTE_UNUSED,
- Location ref ATTRIBUTE_UNUSED,
- Location obj ATTRIBUTE_UNUSED,
- uint32_t offset ATTRIBUTE_UNUSED,
- Location index ATTRIBUTE_UNUSED) {
- TODO_VIXL32(FATAL);
+void CodeGeneratorARMVIXL::GenerateReferenceLoadWithBakerReadBarrier(HInstruction* instruction,
+ Location ref,
+ vixl32::Register obj,
+ uint32_t offset,
+ Location index,
+ ScaleFactor scale_factor,
+ Location temp,
+ bool needs_null_check,
+ bool always_update_field,
+ vixl32::Register* temp2) {
+ DCHECK(kEmitCompilerReadBarrier);
+ DCHECK(kUseBakerReadBarrier);
+
+ // In slow path based read barriers, the read barrier call is
+ // inserted after the original load. However, in fast path based
+ // Baker's read barriers, we need to perform the load of
+ // mirror::Object::monitor_ *before* the original reference load.
+ // This load-load ordering is required by the read barrier.
+ // The fast path/slow path (for Baker's algorithm) should look like:
+ //
+ // uint32_t rb_state = Lockword(obj->monitor_).ReadBarrierState();
+ // lfence; // Load fence or artificial data dependency to prevent load-load reordering
+ // HeapReference<Object> ref = *src; // Original reference load.
+ // bool is_gray = (rb_state == ReadBarrier::GrayState());
+ // if (is_gray) {
+ // ref = ReadBarrier::Mark(ref); // Performed by runtime entrypoint slow path.
+ // }
+ //
+ // Note: the original implementation in ReadBarrier::Barrier is
+ // slightly more complex as it performs additional checks that we do
+ // not do here for performance reasons.
+
+ vixl32::Register ref_reg = RegisterFrom(ref);
+ vixl32::Register temp_reg = RegisterFrom(temp);
+ uint32_t monitor_offset = mirror::Object::MonitorOffset().Int32Value();
+
+ // /* int32_t */ monitor = obj->monitor_
+ GetAssembler()->LoadFromOffset(kLoadWord, temp_reg, obj, monitor_offset);
+ if (needs_null_check) {
+ MaybeRecordImplicitNullCheck(instruction);
+ }
+ // /* LockWord */ lock_word = LockWord(monitor)
+ static_assert(sizeof(LockWord) == sizeof(int32_t),
+ "art::LockWord and int32_t have different sizes.");
+
+ // Introduce a dependency on the lock_word including the rb_state,
+ // which shall prevent load-load reordering without using
+ // a memory barrier (which would be more expensive).
+ // `obj` is unchanged by this operation, but its value now depends
+ // on `temp_reg`.
+ __ Add(obj, obj, Operand(temp_reg, ShiftType::LSR, 32));
+
+ // The actual reference load.
+ if (index.IsValid()) {
+ // Load types involving an "index": ArrayGet,
+ // UnsafeGetObject/UnsafeGetObjectVolatile and UnsafeCASObject
+ // intrinsics.
+ // /* HeapReference<Object> */ ref = *(obj + offset + (index << scale_factor))
+ if (index.IsConstant()) {
+ size_t computed_offset =
+ (Int32ConstantFrom(index) << scale_factor) + offset;
+ GetAssembler()->LoadFromOffset(kLoadWord, ref_reg, obj, computed_offset);
+ } else {
+ // Handle the special case of the
+ // UnsafeGetObject/UnsafeGetObjectVolatile and UnsafeCASObject
+ // intrinsics, which use a register pair as index ("long
+ // offset"), of which only the low part contains data.
+ vixl32::Register index_reg = index.IsRegisterPair()
+ ? LowRegisterFrom(index)
+ : RegisterFrom(index);
+ UseScratchRegisterScope temps(GetVIXLAssembler());
+ const vixl32::Register temp3 = temps.Acquire();
+ __ Add(temp3, obj, Operand(index_reg, ShiftType::LSL, scale_factor));
+ GetAssembler()->LoadFromOffset(kLoadWord, ref_reg, temp3, offset);
+ }
+ } else {
+ // /* HeapReference<Object> */ ref = *(obj + offset)
+ GetAssembler()->LoadFromOffset(kLoadWord, ref_reg, obj, offset);
+ }
+
+ // Object* ref = ref_addr->AsMirrorPtr()
+ GetAssembler()->MaybeUnpoisonHeapReference(ref_reg);
+
+ // Slow path marking the object `ref` when it is gray.
+ SlowPathCodeARMVIXL* slow_path;
+ if (always_update_field) {
+ DCHECK(temp2 != nullptr);
+ // ReadBarrierMarkAndUpdateFieldSlowPathARMVIXL only supports address
+ // of the form `obj + field_offset`, where `obj` is a register and
+ // `field_offset` is a register pair (of which only the lower half
+ // is used). Thus `offset` and `scale_factor` above are expected
+ // to be null in this code path.
+ DCHECK_EQ(offset, 0u);
+ DCHECK_EQ(scale_factor, ScaleFactor::TIMES_1);
+ slow_path = new (GetGraph()->GetArena()) ReadBarrierMarkAndUpdateFieldSlowPathARMVIXL(
+ instruction, ref, obj, /* field_offset */ index, temp_reg, *temp2);
+ } else {
+ slow_path = new (GetGraph()->GetArena()) ReadBarrierMarkSlowPathARMVIXL(instruction, ref);
+ }
+ AddSlowPath(slow_path);
+
+ // if (rb_state == ReadBarrier::GrayState())
+ // ref = ReadBarrier::Mark(ref);
+ // Given the numeric representation, it's enough to check the low bit of the
+ // rb_state. We do that by shifting the bit out of the lock word with LSRS
+ // which can be a 16-bit instruction unlike the TST immediate.
+ static_assert(ReadBarrier::WhiteState() == 0, "Expecting white to have value 0");
+ static_assert(ReadBarrier::GrayState() == 1, "Expecting gray to have value 1");
+ __ Lsrs(temp_reg, temp_reg, LockWord::kReadBarrierStateShift + 1);
+ __ B(cs, slow_path->GetEntryLabel()); // Carry flag is the last bit shifted out by LSRS.
+ __ Bind(slow_path->GetExitLabel());
}
-void CodeGeneratorARMVIXL::MaybeGenerateReadBarrierSlow(HInstruction* instruction ATTRIBUTE_UNUSED,
+void CodeGeneratorARMVIXL::GenerateReadBarrierSlow(HInstruction* instruction,
+ Location out,
+ Location ref,
+ Location obj,
+ uint32_t offset,
+ Location index) {
+ DCHECK(kEmitCompilerReadBarrier);
+
+ // Insert a slow path based read barrier *after* the reference load.
+ //
+ // If heap poisoning is enabled, the unpoisoning of the loaded
+ // reference will be carried out by the runtime within the slow
+ // path.
+ //
+ // Note that `ref` currently does not get unpoisoned (when heap
+ // poisoning is enabled), which is alright as the `ref` argument is
+ // not used by the artReadBarrierSlow entry point.
+ //
+ // TODO: Unpoison `ref` when it is used by artReadBarrierSlow.
+ SlowPathCodeARMVIXL* slow_path = new (GetGraph()->GetArena())
+ ReadBarrierForHeapReferenceSlowPathARMVIXL(instruction, out, ref, obj, offset, index);
+ AddSlowPath(slow_path);
+
+ __ B(slow_path->GetEntryLabel());
+ __ Bind(slow_path->GetExitLabel());
+}
+
+void CodeGeneratorARMVIXL::MaybeGenerateReadBarrierSlow(HInstruction* instruction,
Location out,
- Location ref ATTRIBUTE_UNUSED,
- Location obj ATTRIBUTE_UNUSED,
- uint32_t offset ATTRIBUTE_UNUSED,
- Location index ATTRIBUTE_UNUSED) {
+ Location ref,
+ Location obj,
+ uint32_t offset,
+ Location index) {
if (kEmitCompilerReadBarrier) {
+ // Baker's read barriers shall be handled by the fast path
+ // (CodeGeneratorARM::GenerateReferenceLoadWithBakerReadBarrier).
DCHECK(!kUseBakerReadBarrier);
- TODO_VIXL32(FATAL);
+ // If heap poisoning is enabled, unpoisoning will be taken care of
+ // by the runtime within the slow path.
+ GenerateReadBarrierSlow(instruction, out, ref, obj, offset, index);
} else if (kPoisonHeapReferences) {
GetAssembler()->UnpoisonHeapReference(RegisterFrom(out));
}
}
+void CodeGeneratorARMVIXL::GenerateReadBarrierForRootSlow(HInstruction* instruction,
+ Location out,
+ Location root) {
+ DCHECK(kEmitCompilerReadBarrier);
+
+ // Insert a slow path based read barrier *after* the GC root load.
+ //
+ // Note that GC roots are not affected by heap poisoning, so we do
+ // not need to do anything special for this here.
+ SlowPathCodeARMVIXL* slow_path =
+ new (GetGraph()->GetArena()) ReadBarrierForRootSlowPathARMVIXL(instruction, out, root);
+ AddSlowPath(slow_path);
+
+ __ B(slow_path->GetEntryLabel());
+ __ Bind(slow_path->GetExitLabel());
+}
+
// Check if the desired_dispatch_info is supported. If it is, return it,
// otherwise return a fall-back info that should be used instead.
HInvokeStaticOrDirect::DispatchInfo CodeGeneratorARMVIXL::GetSupportedInvokeStaticOrDirectDispatch(
- const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info ATTRIBUTE_UNUSED,
- HInvokeStaticOrDirect* invoke ATTRIBUTE_UNUSED) {
- // TODO(VIXL): Implement optimized code paths.
- return {
- HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod,
- HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod,
- 0u,
- 0u
- };
+ const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info,
+ HInvokeStaticOrDirect* invoke) {
+ HInvokeStaticOrDirect::DispatchInfo dispatch_info = desired_dispatch_info;
+ // We disable pc-relative load when there is an irreducible loop, as the optimization
+ // is incompatible with it.
+ // TODO: Create as many ArmDexCacheArraysBase instructions as needed for methods
+ // with irreducible loops.
+ if (GetGraph()->HasIrreducibleLoops() &&
+ (dispatch_info.method_load_kind ==
+ HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative)) {
+ dispatch_info.method_load_kind = HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod;
+ }
+
+ if (dispatch_info.code_ptr_location == HInvokeStaticOrDirect::CodePtrLocation::kCallPCRelative) {
+ const DexFile& outer_dex_file = GetGraph()->GetDexFile();
+ if (&outer_dex_file != invoke->GetTargetMethod().dex_file) {
+ // Calls across dex files are more likely to exceed the available BL range,
+ // so use absolute patch with fixup if available and kCallArtMethod otherwise.
+ HInvokeStaticOrDirect::CodePtrLocation code_ptr_location =
+ (desired_dispatch_info.method_load_kind ==
+ HInvokeStaticOrDirect::MethodLoadKind::kDirectAddressWithFixup)
+ ? HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup
+ : HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod;
+ return HInvokeStaticOrDirect::DispatchInfo {
+ dispatch_info.method_load_kind,
+ code_ptr_location,
+ dispatch_info.method_load_data,
+ 0u
+ };
+ }
+ }
+ return dispatch_info;
}
vixl32::Register CodeGeneratorARMVIXL::GetInvokeStaticOrDirectExtraParameter(
@@ -5912,59 +7294,119 @@
void CodeGeneratorARMVIXL::GenerateStaticOrDirectCall(
HInvokeStaticOrDirect* invoke, Location temp) {
- Location callee_method = temp; // For all kinds except kRecursive, callee will be in temp.
- vixl32::Register temp_reg = RegisterFrom(temp);
+ // For better instruction scheduling we load the direct code pointer before the method pointer.
+ switch (invoke->GetCodePtrLocation()) {
+ case HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup:
+ // LR = code address from literal pool with link-time patch.
+ __ Ldr(lr, DeduplicateMethodCodeLiteral(invoke->GetTargetMethod()));
+ break;
+ case HInvokeStaticOrDirect::CodePtrLocation::kCallDirect:
+ // LR = invoke->GetDirectCodePtr();
+ __ Mov(lr, Operand::From(invoke->GetDirectCodePtr()));
+ break;
+ default:
+ break;
+ }
+ Location callee_method = temp; // For all kinds except kRecursive, callee will be in temp.
switch (invoke->GetMethodLoadKind()) {
case HInvokeStaticOrDirect::MethodLoadKind::kStringInit: {
uint32_t offset =
GetThreadOffset<kArmPointerSize>(invoke->GetStringInitEntryPoint()).Int32Value();
// temp = thread->string_init_entrypoint
- GetAssembler()->LoadFromOffset(kLoadWord, temp_reg, tr, offset);
+ GetAssembler()->LoadFromOffset(kLoadWord, RegisterFrom(temp), tr, offset);
+ break;
+ }
+ case HInvokeStaticOrDirect::MethodLoadKind::kRecursive:
+ callee_method = invoke->GetLocations()->InAt(invoke->GetSpecialInputIndex());
+ break;
+ case HInvokeStaticOrDirect::MethodLoadKind::kDirectAddress:
+ __ Mov(RegisterFrom(temp), Operand::From(invoke->GetMethodAddress()));
+ break;
+ case HInvokeStaticOrDirect::MethodLoadKind::kDirectAddressWithFixup:
+ __ Ldr(RegisterFrom(temp), DeduplicateMethodAddressLiteral(invoke->GetTargetMethod()));
+ break;
+ case HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative: {
+ HArmDexCacheArraysBase* base =
+ invoke->InputAt(invoke->GetSpecialInputIndex())->AsArmDexCacheArraysBase();
+ vixl32::Register base_reg = GetInvokeStaticOrDirectExtraParameter(invoke, RegisterFrom(temp));
+ int32_t offset = invoke->GetDexCacheArrayOffset() - base->GetElementOffset();
+ GetAssembler()->LoadFromOffset(kLoadWord, RegisterFrom(temp), base_reg, offset);
break;
}
case HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod: {
Location current_method = invoke->GetLocations()->InAt(invoke->GetSpecialInputIndex());
vixl32::Register method_reg;
+ vixl32::Register reg = RegisterFrom(temp);
if (current_method.IsRegister()) {
method_reg = RegisterFrom(current_method);
} else {
DCHECK(invoke->GetLocations()->Intrinsified());
DCHECK(!current_method.IsValid());
- method_reg = temp_reg;
- GetAssembler()->LoadFromOffset(kLoadWord, temp_reg, sp, kCurrentMethodStackOffset);
+ method_reg = reg;
+ GetAssembler()->LoadFromOffset(kLoadWord, reg, sp, kCurrentMethodStackOffset);
}
// /* ArtMethod*[] */ temp = temp.ptr_sized_fields_->dex_cache_resolved_methods_;
GetAssembler()->LoadFromOffset(
kLoadWord,
- temp_reg,
+ reg,
method_reg,
ArtMethod::DexCacheResolvedMethodsOffset(kArmPointerSize).Int32Value());
// temp = temp[index_in_cache];
// Note: Don't use invoke->GetTargetMethod() as it may point to a different dex file.
uint32_t index_in_cache = invoke->GetDexMethodIndex();
GetAssembler()->LoadFromOffset(
- kLoadWord, temp_reg, temp_reg, CodeGenerator::GetCachePointerOffset(index_in_cache));
+ kLoadWord, reg, reg, CodeGenerator::GetCachePointerOffset(index_in_cache));
break;
}
- default:
- TODO_VIXL32(FATAL);
}
- // TODO(VIXL): Support `CodePtrLocation` values other than `kCallArtMethod`.
- if (invoke->GetCodePtrLocation() != HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod) {
- TODO_VIXL32(FATAL);
+ switch (invoke->GetCodePtrLocation()) {
+ case HInvokeStaticOrDirect::CodePtrLocation::kCallSelf:
+ __ Bl(GetFrameEntryLabel());
+ break;
+ case HInvokeStaticOrDirect::CodePtrLocation::kCallPCRelative:
+ relative_call_patches_.emplace_back(*invoke->GetTargetMethod().dex_file,
+ invoke->GetTargetMethod().dex_method_index);
+ {
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ __ bind(&relative_call_patches_.back().label);
+ // Arbitrarily branch to the BL itself, override at link time.
+ __ bl(&relative_call_patches_.back().label);
+ }
+ break;
+ case HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup:
+ case HInvokeStaticOrDirect::CodePtrLocation::kCallDirect:
+ // LR prepared above for better instruction scheduling.
+ // LR()
+ {
+ // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used.
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::k16BitT32InstructionSizeInBytes,
+ CodeBufferCheckScope::kExactSize);
+ __ blx(lr);
+ }
+ break;
+ case HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod:
+ // LR = callee_method->entry_point_from_quick_compiled_code_
+ GetAssembler()->LoadFromOffset(
+ kLoadWord,
+ lr,
+ RegisterFrom(callee_method),
+ ArtMethod::EntryPointFromQuickCompiledCodeOffset(kArmPointerSize).Int32Value());
+ {
+ // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used.
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::k16BitT32InstructionSizeInBytes,
+ CodeBufferCheckScope::kExactSize);
+ // LR()
+ __ blx(lr);
+ }
+ break;
}
- // LR = callee_method->entry_point_from_quick_compiled_code_
- GetAssembler()->LoadFromOffset(
- kLoadWord,
- lr,
- RegisterFrom(callee_method),
- ArtMethod::EntryPointFromQuickCompiledCodeOffset(kArmPointerSize).Int32Value());
- // LR()
- __ Blx(lr);
-
DCHECK(!IsLeafMethod());
}
@@ -5980,9 +7422,15 @@
InvokeDexCallingConventionARMVIXL calling_convention;
vixl32::Register receiver = calling_convention.GetRegisterAt(0);
uint32_t class_offset = mirror::Object::ClassOffset().Int32Value();
- // /* HeapReference<Class> */ temp = receiver->klass_
- GetAssembler()->LoadFromOffset(kLoadWord, temp, receiver, class_offset);
- MaybeRecordImplicitNullCheck(invoke);
+ {
+ // Make sure the pc is recorded immediately after the `ldr` instruction.
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ // /* HeapReference<Class> */ temp = receiver->klass_
+ __ ldr(temp, MemOperand(receiver, class_offset));
+ MaybeRecordImplicitNullCheck(invoke);
+ }
// Instead of simply (possibly) unpoisoning `temp` here, we should
// emit a read barrier for the previous class reference load.
// However this is not required in practice, as this is an
@@ -5999,7 +7447,210 @@
// LR = temp->GetEntryPoint();
GetAssembler()->LoadFromOffset(kLoadWord, lr, temp, entry_point);
// LR();
- __ Blx(lr);
+ // This `blx` *must* be the *last* instruction generated by this stub, so that calls to
+ // `RecordPcInfo()` immediately following record the correct pc. Use a scope to help guarantee
+ // that.
+ // blx in T32 has only 16bit encoding that's why a stricter check for the scope is used.
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ vixl32::k16BitT32InstructionSizeInBytes,
+ CodeBufferCheckScope::kExactSize);
+ __ blx(lr);
+}
+
+CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeStringPatch(
+ const DexFile& dex_file, uint32_t string_index) {
+ return NewPcRelativePatch(dex_file, string_index, &pc_relative_string_patches_);
+}
+
+CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeTypePatch(
+ const DexFile& dex_file, dex::TypeIndex type_index) {
+ return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_);
+}
+
+CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeDexCacheArrayPatch(
+ const DexFile& dex_file, uint32_t element_offset) {
+ return NewPcRelativePatch(dex_file, element_offset, &pc_relative_dex_cache_patches_);
+}
+
+CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativePatch(
+ const DexFile& dex_file, uint32_t offset_or_index, ArenaDeque<PcRelativePatchInfo>* patches) {
+ patches->emplace_back(dex_file, offset_or_index);
+ return &patches->back();
+}
+
+VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateBootImageStringLiteral(
+ const DexFile& dex_file,
+ dex::StringIndex string_index) {
+ return boot_image_string_patches_.GetOrCreate(
+ StringReference(&dex_file, string_index),
+ [this]() {
+ return GetAssembler()->CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ 0u);
+ });
+}
+
+VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateBootImageTypeLiteral(
+ const DexFile& dex_file,
+ dex::TypeIndex type_index) {
+ return boot_image_type_patches_.GetOrCreate(
+ TypeReference(&dex_file, type_index),
+ [this]() {
+ return GetAssembler()->CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ 0u);
+ });
+}
+
+VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateBootImageAddressLiteral(uint32_t address) {
+ bool needs_patch = GetCompilerOptions().GetIncludePatchInformation();
+ Uint32ToLiteralMap* map = needs_patch ? &boot_image_address_patches_ : &uint32_literals_;
+ return DeduplicateUint32Literal(dchecked_integral_cast<uint32_t>(address), map);
+}
+
+VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateDexCacheAddressLiteral(uint32_t address) {
+ return DeduplicateUint32Literal(address, &uint32_literals_);
+}
+
+VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateJitStringLiteral(const DexFile& dex_file,
+ dex::StringIndex string_index) {
+ jit_string_roots_.Overwrite(StringReference(&dex_file, string_index), /* placeholder */ 0u);
+ return jit_string_patches_.GetOrCreate(
+ StringReference(&dex_file, string_index),
+ [this]() {
+ return GetAssembler()->CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ 0u);
+ });
+}
+
+VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateJitClassLiteral(const DexFile& dex_file,
+ dex::TypeIndex type_index,
+ uint64_t address) {
+ jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index), address);
+ return jit_class_patches_.GetOrCreate(
+ TypeReference(&dex_file, type_index),
+ [this]() {
+ return GetAssembler()->CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ 0u);
+ });
+}
+
+template <LinkerPatch (*Factory)(size_t, const DexFile*, uint32_t, uint32_t)>
+inline void CodeGeneratorARMVIXL::EmitPcRelativeLinkerPatches(
+ const ArenaDeque<PcRelativePatchInfo>& infos,
+ ArenaVector<LinkerPatch>* linker_patches) {
+ for (const PcRelativePatchInfo& info : infos) {
+ const DexFile& dex_file = info.target_dex_file;
+ size_t offset_or_index = info.offset_or_index;
+ DCHECK(info.add_pc_label.IsBound());
+ uint32_t add_pc_offset = dchecked_integral_cast<uint32_t>(info.add_pc_label.GetLocation());
+ // Add MOVW patch.
+ DCHECK(info.movw_label.IsBound());
+ uint32_t movw_offset = dchecked_integral_cast<uint32_t>(info.movw_label.GetLocation());
+ linker_patches->push_back(Factory(movw_offset, &dex_file, add_pc_offset, offset_or_index));
+ // Add MOVT patch.
+ DCHECK(info.movt_label.IsBound());
+ uint32_t movt_offset = dchecked_integral_cast<uint32_t>(info.movt_label.GetLocation());
+ linker_patches->push_back(Factory(movt_offset, &dex_file, add_pc_offset, offset_or_index));
+ }
+}
+
+void CodeGeneratorARMVIXL::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) {
+ DCHECK(linker_patches->empty());
+ size_t size =
+ method_patches_.size() +
+ call_patches_.size() +
+ relative_call_patches_.size() +
+ /* MOVW+MOVT for each entry */ 2u * pc_relative_dex_cache_patches_.size() +
+ boot_image_string_patches_.size() +
+ /* MOVW+MOVT for each entry */ 2u * pc_relative_string_patches_.size() +
+ boot_image_type_patches_.size() +
+ /* MOVW+MOVT for each entry */ 2u * pc_relative_type_patches_.size() +
+ boot_image_address_patches_.size();
+ linker_patches->reserve(size);
+ for (const auto& entry : method_patches_) {
+ const MethodReference& target_method = entry.first;
+ VIXLUInt32Literal* literal = entry.second;
+ DCHECK(literal->IsBound());
+ uint32_t literal_offset = literal->GetLocation();
+ linker_patches->push_back(LinkerPatch::MethodPatch(literal_offset,
+ target_method.dex_file,
+ target_method.dex_method_index));
+ }
+ for (const auto& entry : call_patches_) {
+ const MethodReference& target_method = entry.first;
+ VIXLUInt32Literal* literal = entry.second;
+ DCHECK(literal->IsBound());
+ uint32_t literal_offset = literal->GetLocation();
+ linker_patches->push_back(LinkerPatch::CodePatch(literal_offset,
+ target_method.dex_file,
+ target_method.dex_method_index));
+ }
+ for (const PatchInfo<vixl32::Label>& info : relative_call_patches_) {
+ uint32_t literal_offset = info.label.GetLocation();
+ linker_patches->push_back(
+ LinkerPatch::RelativeCodePatch(literal_offset, &info.dex_file, info.index));
+ }
+ EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
+ linker_patches);
+ for (const auto& entry : boot_image_string_patches_) {
+ const StringReference& target_string = entry.first;
+ VIXLUInt32Literal* literal = entry.second;
+ DCHECK(literal->IsBound());
+ uint32_t literal_offset = literal->GetLocation();
+ linker_patches->push_back(LinkerPatch::StringPatch(literal_offset,
+ target_string.dex_file,
+ target_string.string_index.index_));
+ }
+ if (!GetCompilerOptions().IsBootImage()) {
+ EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
+ linker_patches);
+ } else {
+ EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_,
+ linker_patches);
+ }
+ for (const auto& entry : boot_image_type_patches_) {
+ const TypeReference& target_type = entry.first;
+ VIXLUInt32Literal* literal = entry.second;
+ DCHECK(literal->IsBound());
+ uint32_t literal_offset = literal->GetLocation();
+ linker_patches->push_back(LinkerPatch::TypePatch(literal_offset,
+ target_type.dex_file,
+ target_type.type_index.index_));
+ }
+ EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+ linker_patches);
+ for (const auto& entry : boot_image_address_patches_) {
+ DCHECK(GetCompilerOptions().GetIncludePatchInformation());
+ VIXLUInt32Literal* literal = entry.second;
+ DCHECK(literal->IsBound());
+ uint32_t literal_offset = literal->GetLocation();
+ linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
+ }
+}
+
+VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateUint32Literal(
+ uint32_t value,
+ Uint32ToLiteralMap* map) {
+ return map->GetOrCreate(
+ value,
+ [this, value]() {
+ return GetAssembler()->CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ value);
+ });
+}
+
+VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateMethodLiteral(
+ MethodReference target_method,
+ MethodToLiteralMap* map) {
+ return map->GetOrCreate(
+ target_method,
+ [this]() {
+ return GetAssembler()->CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ 0u);
+ });
+}
+
+VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateMethodAddressLiteral(
+ MethodReference target_method) {
+ return DeduplicateMethodLiteral(target_method, &method_patches_);
+}
+
+VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateMethodCodeLiteral(
+ MethodReference target_method) {
+ return DeduplicateMethodLiteral(target_method, &call_patches_);
}
void LocationsBuilderARMVIXL::VisitMultiplyAccumulate(HMultiplyAccumulate* instr) {
@@ -6063,7 +7714,7 @@
if (num_entries <= kPackedSwitchCompareJumpThreshold ||
!codegen_->GetAssembler()->GetVIXLAssembler()->IsUsingT32()) {
// Create a series of compare/jumps.
- UseScratchRegisterScope temps(GetAssembler()->GetVIXLAssembler());
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register temp_reg = temps.Acquire();
// Note: It is fine for the below AddConstantSetFlags() using IP register to temporarily store
// the immediate, because IP is used as the destination register. For the other
@@ -6111,7 +7762,7 @@
__ Cmp(key_reg, num_entries - 1);
__ B(hi, codegen_->GetLabelOf(default_block));
- UseScratchRegisterScope temps(GetAssembler()->GetVIXLAssembler());
+ UseScratchRegisterScope temps(GetVIXLAssembler());
vixl32::Register jump_offset = temps.Acquire();
// Load jump offset from the table.
@@ -6126,6 +7777,17 @@
jump_table->EmitTable(codegen_);
}
}
+void LocationsBuilderARMVIXL::VisitArmDexCacheArraysBase(HArmDexCacheArraysBase* base) {
+ LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(base);
+ locations->SetOut(Location::RequiresRegister());
+}
+
+void InstructionCodeGeneratorARMVIXL::VisitArmDexCacheArraysBase(HArmDexCacheArraysBase* base) {
+ vixl32::Register base_reg = OutputRegister(base);
+ CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
+ codegen_->NewPcRelativeDexCacheArrayPatch(base->GetDexFile(), base->GetElementOffset());
+ codegen_->EmitMovwMovtPlaceholder(labels, base_reg);
+}
// Copy the result of a call into the given target.
void CodeGeneratorARMVIXL::MoveFromReturnRegister(Location trg, Primitive::Type type) {
@@ -6136,7 +7798,7 @@
DCHECK_NE(type, Primitive::kPrimVoid);
- Location return_loc = InvokeDexCallingConventionVisitorARM().GetReturnLocation(type);
+ Location return_loc = InvokeDexCallingConventionVisitorARMVIXL().GetReturnLocation(type);
if (return_loc.Equals(trg)) {
return;
}
@@ -6155,16 +7817,74 @@
}
}
-void LocationsBuilderARMVIXL::VisitClassTableGet(
- HClassTableGet* instruction ATTRIBUTE_UNUSED) {
- TODO_VIXL32(FATAL);
+void LocationsBuilderARMVIXL::VisitClassTableGet(HClassTableGet* instruction) {
+ LocationSummary* locations =
+ new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kNoCall);
+ locations->SetInAt(0, Location::RequiresRegister());
+ locations->SetOut(Location::RequiresRegister());
}
-void InstructionCodeGeneratorARMVIXL::VisitClassTableGet(
- HClassTableGet* instruction ATTRIBUTE_UNUSED) {
- TODO_VIXL32(FATAL);
+void InstructionCodeGeneratorARMVIXL::VisitClassTableGet(HClassTableGet* instruction) {
+ if (instruction->GetTableKind() == HClassTableGet::TableKind::kVTable) {
+ uint32_t method_offset = mirror::Class::EmbeddedVTableEntryOffset(
+ instruction->GetIndex(), kArmPointerSize).SizeValue();
+ GetAssembler()->LoadFromOffset(kLoadWord,
+ OutputRegister(instruction),
+ InputRegisterAt(instruction, 0),
+ method_offset);
+ } else {
+ uint32_t method_offset = static_cast<uint32_t>(ImTable::OffsetOfElement(
+ instruction->GetIndex(), kArmPointerSize));
+ GetAssembler()->LoadFromOffset(kLoadWord,
+ OutputRegister(instruction),
+ InputRegisterAt(instruction, 0),
+ mirror::Class::ImtPtrOffset(kArmPointerSize).Uint32Value());
+ GetAssembler()->LoadFromOffset(kLoadWord,
+ OutputRegister(instruction),
+ OutputRegister(instruction),
+ method_offset);
+ }
}
+static void PatchJitRootUse(uint8_t* code,
+ const uint8_t* roots_data,
+ VIXLUInt32Literal* literal,
+ uint64_t index_in_table) {
+ DCHECK(literal->IsBound());
+ uint32_t literal_offset = literal->GetLocation();
+ uintptr_t address =
+ reinterpret_cast<uintptr_t>(roots_data) + index_in_table * sizeof(GcRoot<mirror::Object>);
+ uint8_t* data = code + literal_offset;
+ reinterpret_cast<uint32_t*>(data)[0] = dchecked_integral_cast<uint32_t>(address);
+}
+
+void CodeGeneratorARMVIXL::EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) {
+ for (const auto& entry : jit_string_patches_) {
+ const auto& it = jit_string_roots_.find(entry.first);
+ DCHECK(it != jit_string_roots_.end());
+ PatchJitRootUse(code, roots_data, entry.second, it->second);
+ }
+ for (const auto& entry : jit_class_patches_) {
+ const auto& it = jit_class_roots_.find(entry.first);
+ DCHECK(it != jit_class_roots_.end());
+ PatchJitRootUse(code, roots_data, entry.second, it->second);
+ }
+}
+
+void CodeGeneratorARMVIXL::EmitMovwMovtPlaceholder(
+ CodeGeneratorARMVIXL::PcRelativePatchInfo* labels,
+ vixl32::Register out) {
+ ExactAssemblyScope aas(GetVIXLAssembler(),
+ 3 * vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ // TODO(VIXL): Think about using mov instead of movw.
+ __ bind(&labels->movw_label);
+ __ movw(out, /* placeholder */ 0u);
+ __ bind(&labels->movt_label);
+ __ movt(out, /* placeholder */ 0u);
+ __ bind(&labels->add_pc_label);
+ __ add(out, out, pc);
+}
#undef __
#undef QUICK_ENTRY_POINT
diff --git a/compiler/optimizing/code_generator_arm_vixl.h b/compiler/optimizing/code_generator_arm_vixl.h
index 302ee38..45bd164 100644
--- a/compiler/optimizing/code_generator_arm_vixl.h
+++ b/compiler/optimizing/code_generator_arm_vixl.h
@@ -17,9 +17,15 @@
#ifndef ART_COMPILER_OPTIMIZING_CODE_GENERATOR_ARM_VIXL_H_
#define ART_COMPILER_OPTIMIZING_CODE_GENERATOR_ARM_VIXL_H_
-#include "code_generator_arm.h"
+#include "base/enums.h"
+#include "code_generator.h"
#include "common_arm.h"
+#include "driver/compiler_options.h"
+#include "nodes.h"
+#include "string_reference.h"
+#include "parallel_move_resolver.h"
#include "utils/arm/assembler_arm_vixl.h"
+#include "utils/type_reference.h"
// TODO(VIXL): make vixl clean wrt -Wshadow.
#pragma GCC diagnostic push
@@ -44,7 +50,7 @@
vixl::aarch32::r2,
vixl::aarch32::r3
};
-static const size_t kParameterCoreRegistersLengthVIXL = arraysize(kParameterCoreRegisters);
+static const size_t kParameterCoreRegistersLengthVIXL = arraysize(kParameterCoreRegistersVIXL);
static const vixl::aarch32::SRegister kParameterFpuRegistersVIXL[] = {
vixl::aarch32::s0,
vixl::aarch32::s1,
@@ -63,7 +69,7 @@
vixl::aarch32::s14,
vixl::aarch32::s15
};
-static const size_t kParameterFpuRegistersLengthVIXL = arraysize(kParameterFpuRegisters);
+static const size_t kParameterFpuRegistersLengthVIXL = arraysize(kParameterFpuRegistersVIXL);
static const vixl::aarch32::Register kMethodRegister = vixl::aarch32::r0;
@@ -90,7 +96,7 @@
vixl::aarch32::r3
};
static const size_t kRuntimeParameterCoreRegistersLengthVIXL =
- arraysize(kRuntimeParameterCoreRegisters);
+ arraysize(kRuntimeParameterCoreRegistersVIXL);
static const vixl::aarch32::SRegister kRuntimeParameterFpuRegistersVIXL[] = {
vixl::aarch32::s0,
vixl::aarch32::s1,
@@ -98,111 +104,23 @@
vixl::aarch32::s3
};
static const size_t kRuntimeParameterFpuRegistersLengthVIXL =
- arraysize(kRuntimeParameterFpuRegisters);
+ arraysize(kRuntimeParameterFpuRegistersVIXL);
class LoadClassSlowPathARMVIXL;
-
-#define FOR_EACH_IMPLEMENTED_INSTRUCTION(M) \
- M(Above) \
- M(AboveOrEqual) \
- M(Add) \
- M(And) \
- M(ArrayGet) \
- M(ArrayLength) \
- M(ArraySet) \
- M(Below) \
- M(BelowOrEqual) \
- M(BitwiseNegatedRight) \
- M(BooleanNot) \
- M(BoundsCheck) \
- M(BoundType) \
- M(CheckCast) \
- M(ClassTableGet) \
- M(ClearException) \
- M(ClinitCheck) \
- M(Compare) \
- M(CurrentMethod) \
- M(Deoptimize) \
- M(Div) \
- M(DivZeroCheck) \
- M(DoubleConstant) \
- M(Equal) \
- M(Exit) \
- M(FloatConstant) \
- M(Goto) \
- M(GreaterThan) \
- M(GreaterThanOrEqual) \
- M(If) \
- M(InstanceFieldGet) \
- M(InstanceFieldSet) \
- M(InstanceOf) \
- M(IntConstant) \
- M(IntermediateAddress) \
- M(InvokeInterface) \
- M(InvokeStaticOrDirect) \
- M(InvokeUnresolved) \
- M(InvokeVirtual) \
- M(LessThan) \
- M(LessThanOrEqual) \
- M(LoadClass) \
- M(LoadException) \
- M(LoadString) \
- M(LongConstant) \
- M(MemoryBarrier) \
- M(MonitorOperation) \
- M(Mul) \
- M(MultiplyAccumulate) \
- M(NativeDebugInfo) \
- M(Neg) \
- M(NewArray) \
- M(NewInstance) \
- M(Not) \
- M(NotEqual) \
- M(NullCheck) \
- M(NullConstant) \
- M(Or) \
- M(PackedSwitch) \
- M(ParallelMove) \
- M(ParameterValue) \
- M(Phi) \
- M(Rem) \
- M(Return) \
- M(ReturnVoid) \
- M(Ror) \
- M(Select) \
- M(Shl) \
- M(Shr) \
- M(StaticFieldGet) \
- M(StaticFieldSet) \
- M(Sub) \
- M(SuspendCheck) \
- M(Throw) \
- M(TryBoundary) \
- M(TypeConversion) \
- M(UnresolvedInstanceFieldGet) \
- M(UnresolvedInstanceFieldSet) \
- M(UnresolvedStaticFieldGet) \
- M(UnresolvedStaticFieldSet) \
- M(UShr) \
- M(Xor) \
-
-// TODO: Remove once the VIXL32 backend is implemented completely.
-#define FOR_EACH_UNIMPLEMENTED_INSTRUCTION(M) \
- M(ArmDexCacheArraysBase) \
-
class CodeGeneratorARMVIXL;
+using VIXLInt32Literal = vixl::aarch32::Literal<int32_t>;
+using VIXLUInt32Literal = vixl::aarch32::Literal<uint32_t>;
+
class JumpTableARMVIXL : public DeletableArenaObject<kArenaAllocSwitchTable> {
public:
- typedef vixl::aarch32::Literal<int32_t> IntLiteral;
-
explicit JumpTableARMVIXL(HPackedSwitch* switch_instr)
: switch_instr_(switch_instr),
table_start_(),
bb_addresses_(switch_instr->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
uint32_t num_entries = switch_instr_->GetNumEntries();
for (uint32_t i = 0; i < num_entries; i++) {
- IntLiteral *lit = new IntLiteral(0);
+ VIXLInt32Literal *lit = new VIXLInt32Literal(0, vixl32::RawLiteral::kManuallyPlaced);
bb_addresses_.emplace_back(lit);
}
}
@@ -215,7 +133,7 @@
private:
HPackedSwitch* const switch_instr_;
vixl::aarch32::Label table_start_;
- ArenaVector<std::unique_ptr<IntLiteral>> bb_addresses_;
+ ArenaVector<std::unique_ptr<VIXLInt32Literal>> bb_addresses_;
DISALLOW_COPY_AND_ASSIGN(JumpTableARMVIXL);
};
@@ -248,6 +166,22 @@
DISALLOW_COPY_AND_ASSIGN(InvokeDexCallingConventionARMVIXL);
};
+class InvokeDexCallingConventionVisitorARMVIXL : public InvokeDexCallingConventionVisitor {
+ public:
+ InvokeDexCallingConventionVisitorARMVIXL() {}
+ virtual ~InvokeDexCallingConventionVisitorARMVIXL() {}
+
+ Location GetNextLocation(Primitive::Type type) OVERRIDE;
+ Location GetReturnLocation(Primitive::Type type) const OVERRIDE;
+ Location GetMethodLocation() const OVERRIDE;
+
+ private:
+ InvokeDexCallingConventionARMVIXL calling_convention;
+ uint32_t double_index_ = 0;
+
+ DISALLOW_COPY_AND_ASSIGN(InvokeDexCallingConventionVisitorARMVIXL);
+};
+
class FieldAccessCallingConventionARMVIXL : public FieldAccessCallingConvention {
public:
FieldAccessCallingConventionARMVIXL() {}
@@ -319,27 +253,26 @@
DISALLOW_COPY_AND_ASSIGN(ParallelMoveResolverARMVIXL);
};
-#define DEFINE_IMPLEMENTED_INSTRUCTION_VISITOR(Name) \
- void Visit##Name(H##Name*) OVERRIDE;
-
-#define DEFINE_UNIMPLEMENTED_INSTRUCTION_VISITOR(Name) \
- void Visit##Name(H##Name* instr) OVERRIDE { \
- VisitUnimplemementedInstruction(instr); }
-
class LocationsBuilderARMVIXL : public HGraphVisitor {
public:
LocationsBuilderARMVIXL(HGraph* graph, CodeGeneratorARMVIXL* codegen)
: HGraphVisitor(graph), codegen_(codegen) {}
- FOR_EACH_IMPLEMENTED_INSTRUCTION(DEFINE_IMPLEMENTED_INSTRUCTION_VISITOR)
+#define DECLARE_VISIT_INSTRUCTION(name, super) \
+ void Visit##name(H##name* instr) OVERRIDE;
- FOR_EACH_UNIMPLEMENTED_INSTRUCTION(DEFINE_UNIMPLEMENTED_INSTRUCTION_VISITOR)
+ FOR_EACH_CONCRETE_INSTRUCTION_COMMON(DECLARE_VISIT_INSTRUCTION)
+ FOR_EACH_CONCRETE_INSTRUCTION_ARM(DECLARE_VISIT_INSTRUCTION)
+ FOR_EACH_CONCRETE_INSTRUCTION_SHARED(DECLARE_VISIT_INSTRUCTION)
- private:
- void VisitUnimplemementedInstruction(HInstruction* instruction) {
- LOG(FATAL) << "Unimplemented Instruction: " << instruction->DebugName();
+#undef DECLARE_VISIT_INSTRUCTION
+
+ void VisitInstruction(HInstruction* instruction) OVERRIDE {
+ LOG(FATAL) << "Unreachable instruction " << instruction->DebugName()
+ << " (id " << instruction->GetId() << ")";
}
+ private:
void HandleInvoke(HInvoke* invoke);
void HandleBitwiseOperation(HBinaryOperation* operation, Opcode opcode);
void HandleCondition(HCondition* condition);
@@ -355,7 +288,7 @@
bool CanEncodeConstantAsImmediate(uint32_t value, Opcode opcode, SetCc set_cc = kCcDontCare);
CodeGeneratorARMVIXL* const codegen_;
- InvokeDexCallingConventionVisitorARM parameter_visitor_;
+ InvokeDexCallingConventionVisitorARMVIXL parameter_visitor_;
DISALLOW_COPY_AND_ASSIGN(LocationsBuilderARMVIXL);
};
@@ -364,28 +297,34 @@
public:
InstructionCodeGeneratorARMVIXL(HGraph* graph, CodeGeneratorARMVIXL* codegen);
- FOR_EACH_IMPLEMENTED_INSTRUCTION(DEFINE_IMPLEMENTED_INSTRUCTION_VISITOR)
+#define DECLARE_VISIT_INSTRUCTION(name, super) \
+ void Visit##name(H##name* instr) OVERRIDE;
- FOR_EACH_UNIMPLEMENTED_INSTRUCTION(DEFINE_UNIMPLEMENTED_INSTRUCTION_VISITOR)
+ FOR_EACH_CONCRETE_INSTRUCTION_COMMON(DECLARE_VISIT_INSTRUCTION)
+ FOR_EACH_CONCRETE_INSTRUCTION_ARM(DECLARE_VISIT_INSTRUCTION)
+ FOR_EACH_CONCRETE_INSTRUCTION_SHARED(DECLARE_VISIT_INSTRUCTION)
- ArmVIXLAssembler* GetAssembler() const { return assembler_; }
- vixl::aarch32::MacroAssembler* GetVIXLAssembler() { return GetAssembler()->GetVIXLAssembler(); }
+#undef DECLARE_VISIT_INSTRUCTION
- private:
- void VisitUnimplemementedInstruction(HInstruction* instruction) {
- LOG(FATAL) << "Unimplemented Instruction: " << instruction->DebugName();
+ void VisitInstruction(HInstruction* instruction) OVERRIDE {
+ LOG(FATAL) << "Unreachable instruction " << instruction->DebugName()
+ << " (id " << instruction->GetId() << ")";
}
+ ArmVIXLAssembler* GetAssembler() const { return assembler_; }
+ ArmVIXLMacroAssembler* GetVIXLAssembler() { return GetAssembler()->GetVIXLAssembler(); }
+
+ private:
// Generate code for the given suspend check. If not null, `successor`
// is the block to branch to if the suspend check is not needed, and after
// the suspend call.
void GenerateSuspendCheck(HSuspendCheck* instruction, HBasicBlock* successor);
void GenerateClassInitializationCheck(LoadClassSlowPathARMVIXL* slow_path,
vixl32::Register class_reg);
- void HandleGoto(HInstruction* got, HBasicBlock* successor);
void GenerateAndConst(vixl::aarch32::Register out, vixl::aarch32::Register first, uint32_t value);
void GenerateOrrConst(vixl::aarch32::Register out, vixl::aarch32::Register first, uint32_t value);
void GenerateEorConst(vixl::aarch32::Register out, vixl::aarch32::Register first, uint32_t value);
+ void GenerateAddLongConst(Location out, Location first, uint64_t value);
void HandleBitwiseOperation(HBinaryOperation* operation);
void HandleCondition(HCondition* condition);
void HandleIntegerRotate(HRor* ror);
@@ -421,7 +360,8 @@
void GenerateReferenceLoadOneRegister(HInstruction* instruction,
Location out,
uint32_t offset,
- Location maybe_temp);
+ Location maybe_temp,
+ ReadBarrierOption read_barrier_option);
// Generate a heap reference load using two different registers
// `out` and `obj`:
//
@@ -436,22 +376,23 @@
Location out,
Location obj,
uint32_t offset,
- Location maybe_temp);
-
+ Location maybe_temp,
+ ReadBarrierOption read_barrier_option);
// Generate a GC root reference load:
//
// root <- *(obj + offset)
//
- // while honoring read barriers if `requires_read_barrier` is true.
+ // while honoring read barriers based on read_barrier_option.
void GenerateGcRootFieldLoad(HInstruction* instruction,
Location root,
vixl::aarch32::Register obj,
uint32_t offset,
- bool requires_read_barrier);
+ ReadBarrierOption read_barrier_option);
void GenerateTestAndBranch(HInstruction* instruction,
size_t condition_input_index,
vixl::aarch32::Label* true_target,
- vixl::aarch32::Label* false_target);
+ vixl::aarch32::Label* false_target,
+ bool far_target = true);
void GenerateCompareTestAndBranch(HCondition* condition,
vixl::aarch32::Label* true_target,
vixl::aarch32::Label* false_target);
@@ -466,6 +407,7 @@
void DivRemByPowerOfTwo(HBinaryOperation* instruction);
void GenerateDivRemWithAnyConstant(HBinaryOperation* instruction);
void GenerateDivRemConstantIntegral(HBinaryOperation* instruction);
+ void HandleGoto(HInstruction* got, HBasicBlock* successor);
ArmVIXLAssembler* const assembler_;
CodeGeneratorARMVIXL* const codegen_;
@@ -479,36 +421,35 @@
const ArmInstructionSetFeatures& isa_features,
const CompilerOptions& compiler_options,
OptimizingCompilerStats* stats = nullptr);
-
virtual ~CodeGeneratorARMVIXL() {}
- void Initialize() OVERRIDE {
- block_labels_.resize(GetGraph()->GetBlocks().size());
- }
-
void GenerateFrameEntry() OVERRIDE;
void GenerateFrameExit() OVERRIDE;
-
void Bind(HBasicBlock* block) OVERRIDE;
-
- vixl::aarch32::Label* GetLabelOf(HBasicBlock* block) {
- block = FirstNonEmptyBlock(block);
- return &(block_labels_[block->GetBlockId()]);
- }
-
void MoveConstant(Location destination, int32_t value) OVERRIDE;
void MoveLocation(Location dst, Location src, Primitive::Type dst_type) OVERRIDE;
void AddLocationAsTemp(Location location, LocationSummary* locations) OVERRIDE;
+ size_t SaveCoreRegister(size_t stack_index, uint32_t reg_id) OVERRIDE;
+ size_t RestoreCoreRegister(size_t stack_index, uint32_t reg_id) OVERRIDE;
+ size_t SaveFloatingPointRegister(size_t stack_index, uint32_t reg_id) OVERRIDE;
+ size_t RestoreFloatingPointRegister(size_t stack_index, uint32_t reg_id) OVERRIDE;
+
+ size_t GetWordSize() const OVERRIDE {
+ return static_cast<size_t>(kArmPointerSize);
+ }
+
+ size_t GetFloatingPointSpillSlotSize() const OVERRIDE { return vixl::aarch32::kRegSizeInBytes; }
+
+ HGraphVisitor* GetLocationBuilder() OVERRIDE { return &location_builder_; }
+
+ HGraphVisitor* GetInstructionVisitor() OVERRIDE { return &instruction_visitor_; }
+
ArmVIXLAssembler* GetAssembler() OVERRIDE { return &assembler_; }
const ArmVIXLAssembler& GetAssembler() const OVERRIDE { return assembler_; }
- vixl::aarch32::MacroAssembler* GetVIXLAssembler() { return GetAssembler()->GetVIXLAssembler(); }
-
- size_t GetWordSize() const OVERRIDE { return kArmWordSize; }
-
- size_t GetFloatingPointSpillSlotSize() const OVERRIDE { return vixl::aarch32::kRegSizeInBytes; }
+ ArmVIXLMacroAssembler* GetVIXLAssembler() { return GetAssembler()->GetVIXLAssembler(); }
uintptr_t GetAddressOf(HBasicBlock* block) OVERRIDE {
vixl::aarch32::Label* block_entry_label = GetLabelOf(block);
@@ -516,25 +457,14 @@
return block_entry_label->GetLocation();
}
- JumpTableARMVIXL* CreateJumpTable(HPackedSwitch* switch_instr) {
- jump_tables_.emplace_back(new (GetGraph()->GetArena()) JumpTableARMVIXL(switch_instr));
- return jump_tables_.back().get();
- }
-
- HGraphVisitor* GetLocationBuilder() OVERRIDE { return &location_builder_; }
-
- HGraphVisitor* GetInstructionVisitor() OVERRIDE { return &instruction_visitor_; }
-
void FixJumpTables();
- void GenerateMemoryBarrier(MemBarrierKind kind);
- void Finalize(CodeAllocator* allocator) OVERRIDE;
void SetupBlockedRegisters() const OVERRIDE;
void DumpCoreRegister(std::ostream& stream, int reg) const OVERRIDE;
void DumpFloatingPointRegister(std::ostream& stream, int reg) const OVERRIDE;
+ ParallelMoveResolver* GetMoveResolver() OVERRIDE { return &move_resolver_; }
InstructionSet GetInstructionSet() const OVERRIDE { return InstructionSet::kThumb2; }
-
// Helper method to move a 32-bit value between two locations.
void Move32(Location destination, Location source);
@@ -549,45 +479,6 @@
vixl::aarch32::Register reg_index,
vixl::aarch32::Condition cond = vixl::aarch32::al);
- const ArmInstructionSetFeatures& GetInstructionSetFeatures() const { return isa_features_; }
-
- vixl::aarch32::Label* GetFrameEntryLabel() { return &frame_entry_label_; }
-
- // Saves the register in the stack. Returns the size taken on stack.
- size_t SaveCoreRegister(size_t stack_index ATTRIBUTE_UNUSED,
- uint32_t reg_id ATTRIBUTE_UNUSED) OVERRIDE {
- UNIMPLEMENTED(INFO) << "TODO: SaveCoreRegister";
- return 0;
- }
-
- // Restores the register from the stack. Returns the size taken on stack.
- size_t RestoreCoreRegister(size_t stack_index ATTRIBUTE_UNUSED,
- uint32_t reg_id ATTRIBUTE_UNUSED) OVERRIDE {
- UNIMPLEMENTED(INFO) << "TODO: RestoreCoreRegister";
- return 0;
- }
-
- size_t SaveFloatingPointRegister(size_t stack_index ATTRIBUTE_UNUSED,
- uint32_t reg_id ATTRIBUTE_UNUSED) OVERRIDE {
- UNIMPLEMENTED(INFO) << "TODO: SaveFloatingPointRegister";
- return 0;
- }
-
- size_t RestoreFloatingPointRegister(size_t stack_index, uint32_t reg_id) OVERRIDE;
-
- bool NeedsTwoRegisters(Primitive::Type type) const OVERRIDE {
- return type == Primitive::kPrimDouble || type == Primitive::kPrimLong;
- }
-
- void ComputeSpillMask() OVERRIDE;
-
- void GenerateImplicitNullCheck(HNullCheck* null_check) OVERRIDE;
- void GenerateExplicitNullCheck(HNullCheck* null_check) OVERRIDE;
-
- ParallelMoveResolver* GetMoveResolver() OVERRIDE {
- return &move_resolver_;
- }
-
// Generate code to invoke a runtime entry point.
void InvokeRuntime(QuickEntrypointEnum entrypoint,
HInstruction* instruction,
@@ -600,8 +491,6 @@
HInstruction* instruction,
SlowPathCode* slow_path);
- void GenerateInvokeRuntime(int32_t entry_point_offset);
-
// Emit a write barrier.
void MarkGCCard(vixl::aarch32::Register temp,
vixl::aarch32::Register card,
@@ -609,6 +498,90 @@
vixl::aarch32::Register value,
bool can_be_null);
+ void GenerateMemoryBarrier(MemBarrierKind kind);
+
+ vixl::aarch32::Label* GetLabelOf(HBasicBlock* block) {
+ block = FirstNonEmptyBlock(block);
+ return &(block_labels_[block->GetBlockId()]);
+ }
+
+ void Initialize() OVERRIDE {
+ block_labels_.resize(GetGraph()->GetBlocks().size());
+ }
+
+ void Finalize(CodeAllocator* allocator) OVERRIDE;
+
+ const ArmInstructionSetFeatures& GetInstructionSetFeatures() const { return isa_features_; }
+
+ bool NeedsTwoRegisters(Primitive::Type type) const OVERRIDE {
+ return type == Primitive::kPrimDouble || type == Primitive::kPrimLong;
+ }
+
+ void ComputeSpillMask() OVERRIDE;
+
+ vixl::aarch32::Label* GetFrameEntryLabel() { return &frame_entry_label_; }
+
+ // Check if the desired_string_load_kind is supported. If it is, return it,
+ // otherwise return a fall-back kind that should be used instead.
+ HLoadString::LoadKind GetSupportedLoadStringKind(
+ HLoadString::LoadKind desired_string_load_kind) OVERRIDE;
+
+ // Check if the desired_class_load_kind is supported. If it is, return it,
+ // otherwise return a fall-back kind that should be used instead.
+ HLoadClass::LoadKind GetSupportedLoadClassKind(
+ HLoadClass::LoadKind desired_class_load_kind) OVERRIDE;
+
+ // Check if the desired_dispatch_info is supported. If it is, return it,
+ // otherwise return a fall-back info that should be used instead.
+ HInvokeStaticOrDirect::DispatchInfo GetSupportedInvokeStaticOrDirectDispatch(
+ const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info,
+ HInvokeStaticOrDirect* invoke) OVERRIDE;
+
+ void GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) OVERRIDE;
+ void GenerateVirtualCall(HInvokeVirtual* invoke, Location temp) OVERRIDE;
+
+ void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE;
+
+ // The PcRelativePatchInfo is used for PC-relative addressing of dex cache arrays
+ // and boot image strings/types. The only difference is the interpretation of the
+ // offset_or_index. The PC-relative address is loaded with three instructions,
+ // MOVW+MOVT to load the offset to base_reg and then ADD base_reg, PC. The offset
+ // is calculated from the ADD's effective PC, i.e. PC+4 on Thumb2. Though we
+ // currently emit these 3 instructions together, instruction scheduling could
+ // split this sequence apart, so we keep separate labels for each of them.
+ struct PcRelativePatchInfo {
+ PcRelativePatchInfo(const DexFile& dex_file, uint32_t off_or_idx)
+ : target_dex_file(dex_file), offset_or_index(off_or_idx) { }
+ PcRelativePatchInfo(PcRelativePatchInfo&& other) = default;
+
+ const DexFile& target_dex_file;
+ // Either the dex cache array element offset or the string/type index.
+ uint32_t offset_or_index;
+ vixl::aarch32::Label movw_label;
+ vixl::aarch32::Label movt_label;
+ vixl::aarch32::Label add_pc_label;
+ };
+
+ PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index);
+ PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index);
+ PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
+ uint32_t element_offset);
+ VIXLUInt32Literal* DeduplicateBootImageStringLiteral(const DexFile& dex_file,
+ dex::StringIndex string_index);
+ VIXLUInt32Literal* DeduplicateBootImageTypeLiteral(const DexFile& dex_file,
+ dex::TypeIndex type_index);
+ VIXLUInt32Literal* DeduplicateBootImageAddressLiteral(uint32_t address);
+ VIXLUInt32Literal* DeduplicateDexCacheAddressLiteral(uint32_t address);
+ VIXLUInt32Literal* DeduplicateJitStringLiteral(const DexFile& dex_file,
+ dex::StringIndex string_index);
+ VIXLUInt32Literal* DeduplicateJitClassLiteral(const DexFile& dex_file,
+ dex::TypeIndex type_index,
+ uint64_t address);
+
+ void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
+
+ void EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) OVERRIDE;
+
// Fast path implementation of ReadBarrier::Barrier for a heap
// reference field load when Baker's read barriers are used.
void GenerateFieldLoadWithBakerReadBarrier(HInstruction* instruction,
@@ -617,7 +590,15 @@
uint32_t offset,
Location temp,
bool needs_null_check);
-
+ // Fast path implementation of ReadBarrier::Barrier for a heap
+ // reference array load when Baker's read barriers are used.
+ void GenerateArrayLoadWithBakerReadBarrier(HInstruction* instruction,
+ Location ref,
+ vixl::aarch32::Register obj,
+ uint32_t data_offset,
+ Location index,
+ Location temp,
+ bool needs_null_check);
// Factored implementation, used by GenerateFieldLoadWithBakerReadBarrier,
// GenerateArrayLoadWithBakerReadBarrier and some intrinsics.
//
@@ -675,33 +656,59 @@
uint32_t offset,
Location index = Location::NoLocation());
- // Check if the desired_string_load_kind is supported. If it is, return it,
- // otherwise return a fall-back kind that should be used instead.
- HLoadString::LoadKind GetSupportedLoadStringKind(
- HLoadString::LoadKind desired_string_load_kind) OVERRIDE;
-
- // Check if the desired_class_load_kind is supported. If it is, return it,
- // otherwise return a fall-back kind that should be used instead.
- HLoadClass::LoadKind GetSupportedLoadClassKind(
- HLoadClass::LoadKind desired_class_load_kind) OVERRIDE;
-
- // Check if the desired_dispatch_info is supported. If it is, return it,
- // otherwise return a fall-back info that should be used instead.
- HInvokeStaticOrDirect::DispatchInfo GetSupportedInvokeStaticOrDirectDispatch(
- const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info,
- HInvokeStaticOrDirect* invoke) OVERRIDE;
-
- void GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) OVERRIDE;
- void GenerateVirtualCall(HInvokeVirtual* invoke, Location temp) OVERRIDE;
-
- void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE;
+ // Generate a read barrier for a GC root within `instruction` using
+ // a slow path.
+ //
+ // A read barrier for an object reference GC root is implemented as
+ // a call to the artReadBarrierForRootSlow runtime entry point,
+ // which is passed the value in location `root`:
+ //
+ // mirror::Object* artReadBarrierForRootSlow(GcRoot<mirror::Object>* root);
+ //
+ // The `out` location contains the value returned by
+ // artReadBarrierForRootSlow.
+ void GenerateReadBarrierForRootSlow(HInstruction* instruction, Location out, Location root);
void GenerateNop() OVERRIDE;
+ void GenerateImplicitNullCheck(HNullCheck* instruction) OVERRIDE;
+ void GenerateExplicitNullCheck(HNullCheck* instruction) OVERRIDE;
+
+ JumpTableARMVIXL* CreateJumpTable(HPackedSwitch* switch_instr) {
+ jump_tables_.emplace_back(new (GetGraph()->GetArena()) JumpTableARMVIXL(switch_instr));
+ return jump_tables_.back().get();
+ }
+ void EmitJumpTables();
+
+ void EmitMovwMovtPlaceholder(CodeGeneratorARMVIXL::PcRelativePatchInfo* labels,
+ vixl::aarch32::Register out);
+
private:
vixl::aarch32::Register GetInvokeStaticOrDirectExtraParameter(HInvokeStaticOrDirect* invoke,
vixl::aarch32::Register temp);
+ using Uint32ToLiteralMap = ArenaSafeMap<uint32_t, VIXLUInt32Literal*>;
+ using MethodToLiteralMap =
+ ArenaSafeMap<MethodReference, VIXLUInt32Literal*, MethodReferenceComparator>;
+ using StringToLiteralMap = ArenaSafeMap<StringReference,
+ VIXLUInt32Literal*,
+ StringReferenceValueComparator>;
+ using TypeToLiteralMap = ArenaSafeMap<TypeReference,
+ VIXLUInt32Literal*,
+ TypeReferenceValueComparator>;
+
+ VIXLUInt32Literal* DeduplicateUint32Literal(uint32_t value, Uint32ToLiteralMap* map);
+ VIXLUInt32Literal* DeduplicateMethodLiteral(MethodReference target_method,
+ MethodToLiteralMap* map);
+ VIXLUInt32Literal* DeduplicateMethodAddressLiteral(MethodReference target_method);
+ VIXLUInt32Literal* DeduplicateMethodCodeLiteral(MethodReference target_method);
+ PcRelativePatchInfo* NewPcRelativePatch(const DexFile& dex_file,
+ uint32_t offset_or_index,
+ ArenaDeque<PcRelativePatchInfo>* patches);
+ template <LinkerPatch (*Factory)(size_t, const DexFile*, uint32_t, uint32_t)>
+ static void EmitPcRelativeLinkerPatches(const ArenaDeque<PcRelativePatchInfo>& infos,
+ ArenaVector<LinkerPatch>* linker_patches);
+
// Labels for each block that will be compiled.
// We use a deque so that the `vixl::aarch32::Label` objects do not move in memory.
ArenaDeque<vixl::aarch32::Label> block_labels_; // Indexed by block id.
@@ -715,15 +722,35 @@
ArmVIXLAssembler assembler_;
const ArmInstructionSetFeatures& isa_features_;
+ // Deduplication map for 32-bit literals, used for non-patchable boot image addresses.
+ Uint32ToLiteralMap uint32_literals_;
+ // Method patch info, map MethodReference to a literal for method address and method code.
+ MethodToLiteralMap method_patches_;
+ MethodToLiteralMap call_patches_;
+ // Relative call patch info.
+ // Using ArenaDeque<> which retains element addresses on push/emplace_back().
+ ArenaDeque<PatchInfo<vixl::aarch32::Label>> relative_call_patches_;
+ // PC-relative patch info for each HArmDexCacheArraysBase.
+ ArenaDeque<PcRelativePatchInfo> pc_relative_dex_cache_patches_;
+ // Deduplication map for boot string literals for kBootImageLinkTimeAddress.
+ StringToLiteralMap boot_image_string_patches_;
+ // PC-relative String patch info; type depends on configuration (app .bss or boot image PIC).
+ ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
+ // Deduplication map for boot type literals for kBootImageLinkTimeAddress.
+ TypeToLiteralMap boot_image_type_patches_;
+ // PC-relative type patch info.
+ ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
+ // Deduplication map for patchable boot image addresses.
+ Uint32ToLiteralMap boot_image_address_patches_;
+
+ // Patches for string literals in JIT compiled code.
+ StringToLiteralMap jit_string_patches_;
+ // Patches for class literals in JIT compiled code.
+ TypeToLiteralMap jit_class_patches_;
+
DISALLOW_COPY_AND_ASSIGN(CodeGeneratorARMVIXL);
};
-#undef FOR_EACH_IMPLEMENTED_INSTRUCTION
-#undef FOR_EACH_UNIMPLEMENTED_INSTRUCTION
-#undef DEFINE_IMPLEMENTED_INSTRUCTION_VISITOR
-#undef DEFINE_UNIMPLEMENTED_INSTRUCTION_VISITOR
-
-
} // namespace arm
} // namespace art
diff --git a/compiler/optimizing/code_generator_mips.cc b/compiler/optimizing/code_generator_mips.cc
index 573bb50..456c5c6 100644
--- a/compiler/optimizing/code_generator_mips.cc
+++ b/compiler/optimizing/code_generator_mips.cc
@@ -99,8 +99,9 @@
uint32_t gp_index = gp_index_;
gp_index_ += 2;
if (gp_index + 1 < calling_convention.GetNumberOfRegisters()) {
- if (calling_convention.GetRegisterAt(gp_index) == A1) {
- gp_index_++; // Skip A1, and use A2_A3 instead.
+ Register reg = calling_convention.GetRegisterAt(gp_index);
+ if (reg == A1 || reg == A3) {
+ gp_index_++; // Skip A1(A3), and use A2_A3(T0_T1) instead.
gp_index++;
}
Register low_even = calling_convention.GetRegisterAt(gp_index);
@@ -224,7 +225,7 @@
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- __ LoadConst32(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex());
+ __ LoadConst32(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType;
@@ -280,7 +281,7 @@
InvokeRuntimeCallingConvention calling_convention;
HLoadString* load = instruction_->AsLoadString();
- const uint32_t string_index = load->GetStringIndex();
+ const uint32_t string_index = load->GetStringIndex().index_;
__ LoadConst32(calling_convention.GetRegisterAt(0), string_index);
mips_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
@@ -756,6 +757,11 @@
if (RequiresCurrentMethod()) {
__ StoreToOffset(kStoreWord, kMethodRegisterArgument, SP, kCurrentMethodStackOffset);
}
+
+ if (GetGraph()->HasShouldDeoptimizeFlag()) {
+ // Initialize should deoptimize flag to 0.
+ __ StoreToOffset(kStoreWord, ZERO, SP, GetStackOffsetOfShouldDeoptimizeFlag());
+ }
}
void CodeGeneratorMIPS::GenerateFrameExit() {
@@ -1047,7 +1053,7 @@
uint32_t literal_offset = __ GetLabelLocation(literal->GetLabel());
linker_patches->push_back(LinkerPatch::StringPatch(literal_offset,
target_string.dex_file,
- target_string.string_index));
+ target_string.string_index.index_));
}
for (const auto& entry : boot_image_type_patches_) {
const TypeReference& target_type = entry.first;
@@ -1056,7 +1062,7 @@
uint32_t literal_offset = __ GetLabelLocation(literal->GetLabel());
linker_patches->push_back(LinkerPatch::TypePatch(literal_offset,
target_type.dex_file,
- target_type.type_index));
+ target_type.type_index.index_));
}
for (const auto& entry : boot_image_address_patches_) {
DCHECK(GetCompilerOptions().GetIncludePatchInformation());
@@ -1073,8 +1079,8 @@
}
CodeGeneratorMIPS::PcRelativePatchInfo* CodeGeneratorMIPS::NewPcRelativeTypePatch(
- const DexFile& dex_file, uint32_t type_index) {
- return NewPcRelativePatch(dex_file, type_index, &pc_relative_type_patches_);
+ const DexFile& dex_file, dex::TypeIndex type_index) {
+ return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_);
}
CodeGeneratorMIPS::PcRelativePatchInfo* CodeGeneratorMIPS::NewPcRelativeDexCacheArrayPatch(
@@ -1110,14 +1116,14 @@
}
Literal* CodeGeneratorMIPS::DeduplicateBootImageStringLiteral(const DexFile& dex_file,
- uint32_t string_index) {
+ dex::StringIndex string_index) {
return boot_image_string_patches_.GetOrCreate(
StringReference(&dex_file, string_index),
[this]() { return __ NewLiteral<uint32_t>(/* placeholder */ 0u); });
}
Literal* CodeGeneratorMIPS::DeduplicateBootImageTypeLiteral(const DexFile& dex_file,
- uint32_t type_index) {
+ dex::TypeIndex type_index) {
return boot_image_type_patches_.GetOrCreate(
TypeReference(&dex_file, type_index),
[this]() { return __ NewLiteral<uint32_t>(/* placeholder */ 0u); });
@@ -4688,6 +4694,19 @@
}
}
+void LocationsBuilderMIPS::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ LocationSummary* locations = new (GetGraph()->GetArena())
+ LocationSummary(flag, LocationSummary::kNoCall);
+ locations->SetOut(Location::RequiresRegister());
+}
+
+void InstructionCodeGeneratorMIPS::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ __ LoadFromOffset(kLoadWord,
+ flag->GetLocations()->Out().AsRegister<Register>(),
+ SP,
+ codegen_->GetStackOffsetOfShouldDeoptimizeFlag());
+}
+
void LocationsBuilderMIPS::VisitSelect(HSelect* select) {
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select);
CanMoveConditionally(select, codegen_->GetInstructionSetFeatures().IsR6(), locations);
@@ -5085,9 +5104,9 @@
void LocationsBuilderMIPS::VisitInvokeInterface(HInvokeInterface* invoke) {
HandleInvoke(invoke);
- // The register T0 is required to be used for the hidden argument in
+ // The register T7 is required to be used for the hidden argument in
// art_quick_imt_conflict_trampoline, so add the hidden argument.
- invoke->GetLocations()->AddTemp(Location::RegisterLocation(T0));
+ invoke->GetLocations()->AddTemp(Location::RegisterLocation(T7));
}
void InstructionCodeGeneratorMIPS::VisitInvokeInterface(HInvokeInterface* invoke) {
@@ -5207,6 +5226,11 @@
case HLoadString::LoadKind::kDexCacheViaMethod:
fallback_load = false;
break;
+ case HLoadString::LoadKind::kJitTableAddress:
+ DCHECK(Runtime::Current()->UseJitCompilation());
+ // TODO: implement.
+ fallback_load = true;
+ break;
}
if (fallback_load) {
desired_string_load_kind = HLoadString::LoadKind::kDexCacheViaMethod;
@@ -5235,9 +5259,9 @@
break;
case HLoadClass::LoadKind::kBootImageAddress:
break;
- case HLoadClass::LoadKind::kDexCacheAddress:
+ case HLoadClass::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
- fallback_load = false;
+ fallback_load = true;
break;
case HLoadClass::LoadKind::kDexCachePcRelative:
DCHECK(!Runtime::Current()->UseJitCompilation());
@@ -5534,7 +5558,7 @@
void InstructionCodeGeneratorMIPS::VisitLoadClass(HLoadClass* cls) {
LocationSummary* locations = cls->GetLocations();
if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex());
+ codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
return;
@@ -5598,17 +5622,8 @@
codegen_->DeduplicateBootImageAddressLiteral(address));
break;
}
- case HLoadClass::LoadKind::kDexCacheAddress: {
- DCHECK_NE(cls->GetAddress(), 0u);
- uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
- static_assert(sizeof(GcRoot<mirror::Class>) == 4u, "Expected GC root to be 4 bytes.");
- DCHECK_ALIGNED(cls->GetAddress(), 4u);
- int16_t offset = Low16Bits(address);
- uint32_t base_address = address - offset; // This accounts for offset sign extension.
- __ Lui(out, High16Bits(base_address));
- // /* GcRoot<mirror::Class> */ out = *(base_address + offset)
- GenerateGcRootFieldLoad(cls, out_loc, out, offset);
- generate_null_check = !cls->IsInDexCache();
+ case HLoadClass::LoadKind::kJitTableAddress: {
+ LOG(FATAL) << "Unimplemented";
break;
}
case HLoadClass::LoadKind::kDexCachePcRelative: {
@@ -5628,7 +5643,7 @@
base_or_current_method_reg,
ArtMethod::DexCacheResolvedTypesOffset(kArmPointerSize).Int32Value());
// /* GcRoot<mirror::Class> */ out = out[type_index]
- size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex());
+ size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_);
GenerateGcRootFieldLoad(cls, out_loc, out, offset);
generate_null_check = !cls->IsInDexCache();
}
@@ -5738,7 +5753,7 @@
DCHECK(!kEmitCompilerReadBarrier);
DCHECK(codegen_->GetCompilerOptions().IsBootImage());
CodeGeneratorMIPS::PcRelativePatchInfo* info =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
codegen_->EmitPcRelativeAddressPlaceholder(info, out, base_or_current_method_reg);
return; // No dex cache slow path.
}
@@ -5754,7 +5769,7 @@
case HLoadString::LoadKind::kBssEntry: {
DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
CodeGeneratorMIPS::PcRelativePatchInfo* info =
- codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
+ codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
codegen_->EmitPcRelativeAddressPlaceholder(info, out, base_or_current_method_reg);
__ LoadFromOffset(kLoadWord, out, out, 0);
SlowPathCodeMIPS* slow_path = new (GetGraph()->GetArena()) LoadStringSlowPathMIPS(load);
@@ -5770,7 +5785,7 @@
// TODO: Re-add the compiler code to do string dex cache lookup again.
DCHECK(load_kind == HLoadString::LoadKind::kDexCacheViaMethod);
InvokeRuntimeCallingConvention calling_convention;
- __ LoadConst32(calling_convention.GetRegisterAt(0), load->GetStringIndex());
+ __ LoadConst32(calling_convention.GetRegisterAt(0), load->GetStringIndex().index_);
codegen_->InvokeRuntime(kQuickResolveString, load, load->GetDexPc());
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
}
@@ -5970,7 +5985,7 @@
Register current_method_register = calling_convention.GetRegisterAt(2);
__ Lw(current_method_register, SP, kCurrentMethodStackOffset);
// Move an uint16_t value to a register.
- __ LoadConst32(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex());
+ __ LoadConst32(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex().index_);
codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck,
void*, uint32_t, int32_t, ArtMethod*>();
diff --git a/compiler/optimizing/code_generator_mips.h b/compiler/optimizing/code_generator_mips.h
index e132819..f03f29c 100644
--- a/compiler/optimizing/code_generator_mips.h
+++ b/compiler/optimizing/code_generator_mips.h
@@ -18,6 +18,7 @@
#define ART_COMPILER_OPTIMIZING_CODE_GENERATOR_MIPS_H_
#include "code_generator.h"
+#include "dex_file_types.h"
#include "driver/compiler_options.h"
#include "nodes.h"
#include "parallel_move_resolver.h"
@@ -31,11 +32,11 @@
// InvokeDexCallingConvention registers
static constexpr Register kParameterCoreRegisters[] =
- { A1, A2, A3 };
+ { A1, A2, A3, T0, T1 };
static constexpr size_t kParameterCoreRegistersLength = arraysize(kParameterCoreRegisters);
static constexpr FRegister kParameterFpuRegisters[] =
- { F12, F14 };
+ { F8, F10, F12, F14, F16, F18 };
static constexpr size_t kParameterFpuRegistersLength = arraysize(kParameterFpuRegisters);
@@ -47,7 +48,7 @@
arraysize(kRuntimeParameterCoreRegisters);
static constexpr FRegister kRuntimeParameterFpuRegisters[] =
- { F12, F14};
+ { F12, F14 };
static constexpr size_t kRuntimeParameterFpuRegistersLength =
arraysize(kRuntimeParameterFpuRegisters);
@@ -449,11 +450,12 @@
};
PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index);
- PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, uint32_t type_index);
+ PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index);
PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
uint32_t element_offset);
- Literal* DeduplicateBootImageStringLiteral(const DexFile& dex_file, uint32_t string_index);
- Literal* DeduplicateBootImageTypeLiteral(const DexFile& dex_file, uint32_t type_index);
+ Literal* DeduplicateBootImageStringLiteral(const DexFile& dex_file,
+ dex::StringIndex string_index);
+ Literal* DeduplicateBootImageTypeLiteral(const DexFile& dex_file, dex::TypeIndex type_index);
Literal* DeduplicateBootImageAddressLiteral(uint32_t address);
void EmitPcRelativeAddressPlaceholder(PcRelativePatchInfo* info, Register out, Register base);
diff --git a/compiler/optimizing/code_generator_mips64.cc b/compiler/optimizing/code_generator_mips64.cc
index 1a54935..44d3759 100644
--- a/compiler/optimizing/code_generator_mips64.cc
+++ b/compiler/optimizing/code_generator_mips64.cc
@@ -18,6 +18,7 @@
#include "art_method.h"
#include "code_generator_utils.h"
+#include "compiled_method.h"
#include "entrypoints/quick/quick_entrypoints.h"
#include "entrypoints/quick/quick_entrypoints_enum.h"
#include "gc/accounting/card_table.h"
@@ -180,7 +181,7 @@
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- __ LoadConst32(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex());
+ __ LoadConst32(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType;
mips64_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
@@ -234,7 +235,7 @@
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex();
+ const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
__ LoadConst32(calling_convention.GetRegisterAt(0), string_index);
mips64_codegen->InvokeRuntime(kQuickResolveString,
instruction_,
@@ -399,7 +400,15 @@
instruction_visitor_(graph, this),
move_resolver_(graph->GetArena(), this),
assembler_(graph->GetArena()),
- isa_features_(isa_features) {
+ isa_features_(isa_features),
+ uint64_literals_(std::less<uint64_t>(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ method_patches_(MethodReferenceComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ call_patches_(MethodReferenceComparator(),
+ graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ pc_relative_dex_cache_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ relative_call_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
// Save RA (containing the return address) to mimic Quick.
AddAllocatedRegister(Location::RegisterLocation(RA));
}
@@ -510,8 +519,6 @@
RecordPcInfo(nullptr, 0);
}
- // TODO: anything related to T9/GP/GOT/PIC/.so's?
-
if (HasEmptyFrame()) {
return;
}
@@ -562,13 +569,16 @@
"kCurrentMethodStackOffset must fit into int16_t");
__ Sd(kMethodRegisterArgument, SP, kCurrentMethodStackOffset);
}
+
+ if (GetGraph()->HasShouldDeoptimizeFlag()) {
+ // Initialize should_deoptimize flag to 0.
+ __ StoreToOffset(kStoreWord, ZERO, SP, GetStackOffsetOfShouldDeoptimizeFlag());
+ }
}
void CodeGeneratorMIPS64::GenerateFrameExit() {
__ cfi().RememberState();
- // TODO: anything related to T9/GP/GOT/PIC/.so's?
-
if (!HasEmptyFrame()) {
// Deallocate the rest of the frame.
@@ -878,6 +888,103 @@
}
}
+template <LinkerPatch (*Factory)(size_t, const DexFile*, uint32_t, uint32_t)>
+inline void CodeGeneratorMIPS64::EmitPcRelativeLinkerPatches(
+ const ArenaDeque<PcRelativePatchInfo>& infos,
+ ArenaVector<LinkerPatch>* linker_patches) {
+ for (const PcRelativePatchInfo& info : infos) {
+ const DexFile& dex_file = info.target_dex_file;
+ size_t offset_or_index = info.offset_or_index;
+ DCHECK(info.pc_rel_label.IsBound());
+ uint32_t pc_rel_offset = __ GetLabelLocation(&info.pc_rel_label);
+ linker_patches->push_back(Factory(pc_rel_offset, &dex_file, pc_rel_offset, offset_or_index));
+ }
+}
+
+void CodeGeneratorMIPS64::EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) {
+ DCHECK(linker_patches->empty());
+ size_t size =
+ method_patches_.size() +
+ call_patches_.size() +
+ pc_relative_dex_cache_patches_.size() +
+ relative_call_patches_.size();
+ linker_patches->reserve(size);
+ for (const auto& entry : method_patches_) {
+ const MethodReference& target_method = entry.first;
+ Literal* literal = entry.second;
+ DCHECK(literal->GetLabel()->IsBound());
+ uint32_t literal_offset = __ GetLabelLocation(literal->GetLabel());
+ linker_patches->push_back(LinkerPatch::MethodPatch(literal_offset,
+ target_method.dex_file,
+ target_method.dex_method_index));
+ }
+ for (const auto& entry : call_patches_) {
+ const MethodReference& target_method = entry.first;
+ Literal* literal = entry.second;
+ DCHECK(literal->GetLabel()->IsBound());
+ uint32_t literal_offset = __ GetLabelLocation(literal->GetLabel());
+ linker_patches->push_back(LinkerPatch::CodePatch(literal_offset,
+ target_method.dex_file,
+ target_method.dex_method_index));
+ }
+ EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
+ linker_patches);
+ for (const PcRelativePatchInfo& info : relative_call_patches_) {
+ const DexFile& dex_file = info.target_dex_file;
+ uint32_t method_index = info.offset_or_index;
+ DCHECK(info.pc_rel_label.IsBound());
+ uint32_t pc_rel_offset = __ GetLabelLocation(&info.pc_rel_label);
+ linker_patches->push_back(
+ LinkerPatch::RelativeCodePatch(pc_rel_offset, &dex_file, method_index));
+ }
+}
+
+CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewPcRelativeDexCacheArrayPatch(
+ const DexFile& dex_file, uint32_t element_offset) {
+ return NewPcRelativePatch(dex_file, element_offset, &pc_relative_dex_cache_patches_);
+}
+
+CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewPcRelativeCallPatch(
+ const DexFile& dex_file, uint32_t method_index) {
+ return NewPcRelativePatch(dex_file, method_index, &relative_call_patches_);
+}
+
+CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewPcRelativePatch(
+ const DexFile& dex_file, uint32_t offset_or_index, ArenaDeque<PcRelativePatchInfo>* patches) {
+ patches->emplace_back(dex_file, offset_or_index);
+ return &patches->back();
+}
+
+Literal* CodeGeneratorMIPS64::DeduplicateUint64Literal(uint64_t value) {
+ return uint64_literals_.GetOrCreate(
+ value,
+ [this, value]() { return __ NewLiteral<uint64_t>(value); });
+}
+
+Literal* CodeGeneratorMIPS64::DeduplicateMethodLiteral(MethodReference target_method,
+ MethodToLiteralMap* map) {
+ return map->GetOrCreate(
+ target_method,
+ [this]() { return __ NewLiteral<uint32_t>(/* placeholder */ 0u); });
+}
+
+Literal* CodeGeneratorMIPS64::DeduplicateMethodAddressLiteral(MethodReference target_method) {
+ return DeduplicateMethodLiteral(target_method, &method_patches_);
+}
+
+Literal* CodeGeneratorMIPS64::DeduplicateMethodCodeLiteral(MethodReference target_method) {
+ return DeduplicateMethodLiteral(target_method, &call_patches_);
+}
+
+void CodeGeneratorMIPS64::EmitPcRelativeAddressPlaceholderHigh(PcRelativePatchInfo* info,
+ GpuRegister out) {
+ __ Bind(&info->pc_rel_label);
+ // Add the high half of a 32-bit offset to PC.
+ __ Auipc(out, /* placeholder */ 0x1234);
+ // The immediately following instruction will add the sign-extended low half of the 32-bit
+ // offset to `out` (e.g. ld, jialc, addiu).
+}
+
void CodeGeneratorMIPS64::SetupBlockedRegisters() const {
// ZERO, K0, K1, GP, SP, RA are always reserved and can't be allocated.
blocked_core_registers_[ZERO] = true;
@@ -946,7 +1053,6 @@
uint32_t dex_pc,
SlowPathCode* slow_path) {
ValidateInvokeRuntime(entrypoint, instruction, slow_path);
- // TODO: anything related to T9/GP/GOT/PIC/.so's?
__ LoadFromOffset(kLoadDoubleword,
T9,
TR,
@@ -2636,6 +2742,19 @@
/* false_target */ nullptr);
}
+void LocationsBuilderMIPS64::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ LocationSummary* locations = new (GetGraph()->GetArena())
+ LocationSummary(flag, LocationSummary::kNoCall);
+ locations->SetOut(Location::RequiresRegister());
+}
+
+void InstructionCodeGeneratorMIPS64::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ __ LoadFromOffset(kLoadWord,
+ flag->GetLocations()->Out().AsRegister<GpuRegister>(),
+ SP,
+ codegen_->GetStackOffsetOfShouldDeoptimizeFlag());
+}
+
void LocationsBuilderMIPS64::VisitSelect(HSelect* select) {
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(select);
if (Primitive::IsFloatingPointType(select->GetType())) {
@@ -2976,39 +3095,33 @@
HInvokeStaticOrDirect::DispatchInfo CodeGeneratorMIPS64::GetSupportedInvokeStaticOrDirectDispatch(
const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info,
HInvokeStaticOrDirect* invoke ATTRIBUTE_UNUSED) {
- switch (desired_dispatch_info.method_load_kind) {
- case HInvokeStaticOrDirect::MethodLoadKind::kDirectAddressWithFixup:
- case HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative:
- // TODO: Implement these types. For the moment, we fall back to kDexCacheViaMethod.
- return HInvokeStaticOrDirect::DispatchInfo {
- HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod,
- HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod,
- 0u,
- 0u
- };
- default:
- break;
- }
- switch (desired_dispatch_info.code_ptr_location) {
- case HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup:
- case HInvokeStaticOrDirect::CodePtrLocation::kCallPCRelative:
- // TODO: Implement these types. For the moment, we fall back to kCallArtMethod.
- return HInvokeStaticOrDirect::DispatchInfo {
- desired_dispatch_info.method_load_kind,
- HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod,
- desired_dispatch_info.method_load_data,
- 0u
- };
- default:
- return desired_dispatch_info;
- }
+ // On MIPS64 we support all dispatch types.
+ return desired_dispatch_info;
}
void CodeGeneratorMIPS64::GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) {
// All registers are assumed to be correctly set up per the calling convention.
-
Location callee_method = temp; // For all kinds except kRecursive, callee will be in temp.
- switch (invoke->GetMethodLoadKind()) {
+ HInvokeStaticOrDirect::MethodLoadKind method_load_kind = invoke->GetMethodLoadKind();
+ HInvokeStaticOrDirect::CodePtrLocation code_ptr_location = invoke->GetCodePtrLocation();
+
+ // For better instruction scheduling we load the direct code pointer before the method pointer.
+ switch (code_ptr_location) {
+ case HInvokeStaticOrDirect::CodePtrLocation::kCallDirect:
+ // T9 = invoke->GetDirectCodePtr();
+ __ LoadLiteral(T9, kLoadDoubleword, DeduplicateUint64Literal(invoke->GetDirectCodePtr()));
+ break;
+ case HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup:
+ // T9 = code address from literal pool with link-time patch.
+ __ LoadLiteral(T9,
+ kLoadUnsignedWord,
+ DeduplicateMethodCodeLiteral(invoke->GetTargetMethod()));
+ break;
+ default:
+ break;
+ }
+
+ switch (method_load_kind) {
case HInvokeStaticOrDirect::MethodLoadKind::kStringInit: {
// temp = thread->string_init_entrypoint
uint32_t offset =
@@ -3023,14 +3136,23 @@
callee_method = invoke->GetLocations()->InAt(invoke->GetSpecialInputIndex());
break;
case HInvokeStaticOrDirect::MethodLoadKind::kDirectAddress:
- __ LoadConst64(temp.AsRegister<GpuRegister>(), invoke->GetMethodAddress());
+ __ LoadLiteral(temp.AsRegister<GpuRegister>(),
+ kLoadDoubleword,
+ DeduplicateUint64Literal(invoke->GetMethodAddress()));
break;
case HInvokeStaticOrDirect::MethodLoadKind::kDirectAddressWithFixup:
- case HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative:
- // TODO: Implement these types.
- // Currently filtered out by GetSupportedInvokeStaticOrDirectDispatch().
- LOG(FATAL) << "Unsupported";
- UNREACHABLE();
+ __ LoadLiteral(temp.AsRegister<GpuRegister>(),
+ kLoadUnsignedWord,
+ DeduplicateMethodAddressLiteral(invoke->GetTargetMethod()));
+ break;
+ case HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative: {
+ uint32_t offset = invoke->GetDexCacheArrayOffset();
+ CodeGeneratorMIPS64::PcRelativePatchInfo* info =
+ NewPcRelativeDexCacheArrayPatch(invoke->GetDexFile(), offset);
+ EmitPcRelativeAddressPlaceholderHigh(info, AT);
+ __ Ld(temp.AsRegister<GpuRegister>(), AT, /* placeholder */ 0x5678);
+ break;
+ }
case HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod: {
Location current_method = invoke->GetLocations()->InAt(invoke->GetSpecialInputIndex());
GpuRegister reg = temp.AsRegister<GpuRegister>();
@@ -3061,23 +3183,25 @@
}
}
- switch (invoke->GetCodePtrLocation()) {
+ switch (code_ptr_location) {
case HInvokeStaticOrDirect::CodePtrLocation::kCallSelf:
- __ Jialc(&frame_entry_label_, T9);
+ __ Balc(&frame_entry_label_);
break;
case HInvokeStaticOrDirect::CodePtrLocation::kCallDirect:
- // LR = invoke->GetDirectCodePtr();
- __ LoadConst64(T9, invoke->GetDirectCodePtr());
- // LR()
+ case HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup:
+ // T9 prepared above for better instruction scheduling.
+ // T9()
__ Jalr(T9);
__ Nop();
break;
- case HInvokeStaticOrDirect::CodePtrLocation::kCallDirectWithFixup:
- case HInvokeStaticOrDirect::CodePtrLocation::kCallPCRelative:
- // TODO: Implement these types.
- // Currently filtered out by GetSupportedInvokeStaticOrDirectDispatch().
- LOG(FATAL) << "Unsupported";
- UNREACHABLE();
+ case HInvokeStaticOrDirect::CodePtrLocation::kCallPCRelative: {
+ CodeGeneratorMIPS64::PcRelativePatchInfo* info =
+ NewPcRelativeCallPatch(*invoke->GetTargetMethod().dex_file,
+ invoke->GetTargetMethod().dex_method_index);
+ EmitPcRelativeAddressPlaceholderHigh(info, AT);
+ __ Jialc(AT, /* placeholder */ 0x5678);
+ break;
+ }
case HInvokeStaticOrDirect::CodePtrLocation::kCallArtMethod:
// T9 = callee_method->entry_point_from_quick_compiled_code_;
__ LoadFromOffset(kLoadDoubleword,
@@ -3157,7 +3281,7 @@
void InstructionCodeGeneratorMIPS64::VisitLoadClass(HLoadClass* cls) {
LocationSummary* locations = cls->GetLocations();
if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex());
+ codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
return;
@@ -3174,7 +3298,7 @@
__ LoadFromOffset(kLoadDoubleword, out, current_method,
ArtMethod::DexCacheResolvedTypesOffset(kMips64PointerSize).Int32Value());
__ LoadFromOffset(
- kLoadUnsignedWord, out, out, CodeGenerator::GetCacheOffset(cls->GetTypeIndex()));
+ kLoadUnsignedWord, out, out, CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_));
// TODO: We will need a read barrier here.
if (!cls->IsInDexCache() || cls->MustGenerateClinitCheck()) {
DCHECK(cls->CanCallRuntime());
@@ -3382,7 +3506,8 @@
void InstructionCodeGeneratorMIPS64::VisitNewArray(HNewArray* instruction) {
LocationSummary* locations = instruction->GetLocations();
// Move an uint16_t value to a register.
- __ LoadConst32(locations->GetTemp(0).AsRegister<GpuRegister>(), instruction->GetTypeIndex());
+ __ LoadConst32(locations->GetTemp(0).AsRegister<GpuRegister>(),
+ instruction->GetTypeIndex().index_);
codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
}
diff --git a/compiler/optimizing/code_generator_mips64.h b/compiler/optimizing/code_generator_mips64.h
index 690eccb..067c1f9 100644
--- a/compiler/optimizing/code_generator_mips64.h
+++ b/compiler/optimizing/code_generator_mips64.h
@@ -279,6 +279,9 @@
Mips64Assembler* GetAssembler() OVERRIDE { return &assembler_; }
const Mips64Assembler& GetAssembler() const OVERRIDE { return assembler_; }
+ // Emit linker patches.
+ void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
+
void MarkGCCard(GpuRegister object, GpuRegister value, bool value_can_be_null);
// Register allocation.
@@ -357,7 +360,44 @@
void GenerateImplicitNullCheck(HNullCheck* instruction) OVERRIDE;
void GenerateExplicitNullCheck(HNullCheck* instruction) OVERRIDE;
+ // The PcRelativePatchInfo is used for PC-relative addressing of dex cache arrays,
+ // boot image strings and method calls. The only difference is the interpretation of
+ // the offset_or_index.
+ struct PcRelativePatchInfo {
+ PcRelativePatchInfo(const DexFile& dex_file, uint32_t off_or_idx)
+ : target_dex_file(dex_file), offset_or_index(off_or_idx) { }
+ PcRelativePatchInfo(PcRelativePatchInfo&& other) = default;
+
+ const DexFile& target_dex_file;
+ // Either the dex cache array element offset or the string/type/method index.
+ uint32_t offset_or_index;
+ // Label for the auipc instruction.
+ Mips64Label pc_rel_label;
+ };
+
+ PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
+ uint32_t element_offset);
+ PcRelativePatchInfo* NewPcRelativeCallPatch(const DexFile& dex_file,
+ uint32_t method_index);
+
+ void EmitPcRelativeAddressPlaceholderHigh(PcRelativePatchInfo* info, GpuRegister out);
+
private:
+ using Uint64ToLiteralMap = ArenaSafeMap<uint64_t, Literal*>;
+ using MethodToLiteralMap = ArenaSafeMap<MethodReference, Literal*, MethodReferenceComparator>;
+ Literal* DeduplicateUint64Literal(uint64_t value);
+ Literal* DeduplicateMethodLiteral(MethodReference target_method, MethodToLiteralMap* map);
+ Literal* DeduplicateMethodAddressLiteral(MethodReference target_method);
+ Literal* DeduplicateMethodCodeLiteral(MethodReference target_method);
+
+ PcRelativePatchInfo* NewPcRelativePatch(const DexFile& dex_file,
+ uint32_t offset_or_index,
+ ArenaDeque<PcRelativePatchInfo>* patches);
+
+ template <LinkerPatch (*Factory)(size_t, const DexFile*, uint32_t, uint32_t)>
+ void EmitPcRelativeLinkerPatches(const ArenaDeque<PcRelativePatchInfo>& infos,
+ ArenaVector<LinkerPatch>* linker_patches);
+
// Labels for each block that will be compiled.
Mips64Label* block_labels_; // Indexed by block id.
Mips64Label frame_entry_label_;
@@ -367,6 +407,16 @@
Mips64Assembler assembler_;
const Mips64InstructionSetFeatures& isa_features_;
+ // Deduplication map for 64-bit literals, used for non-patchable method address or method code
+ // address.
+ Uint64ToLiteralMap uint64_literals_;
+ // Method patch info, map MethodReference to a literal for method address and method code.
+ MethodToLiteralMap method_patches_;
+ MethodToLiteralMap call_patches_;
+ // PC-relative patch info.
+ ArenaDeque<PcRelativePatchInfo> pc_relative_dex_cache_patches_;
+ ArenaDeque<PcRelativePatchInfo> relative_call_patches_;
+
DISALLOW_COPY_AND_ASSIGN(CodeGeneratorMIPS64);
};
diff --git a/compiler/optimizing/code_generator_utils.h b/compiler/optimizing/code_generator_utils.h
index 7efed8c..a6b41c0 100644
--- a/compiler/optimizing/code_generator_utils.h
+++ b/compiler/optimizing/code_generator_utils.h
@@ -18,6 +18,8 @@
#define ART_COMPILER_OPTIMIZING_CODE_GENERATOR_UTILS_H_
#include <cstdint>
+#include <cstdlib>
+#include <limits>
namespace art {
@@ -32,6 +34,12 @@
// that it has been previously visited by the InstructionCodeGenerator.
bool IsBooleanValueOrMaterializedCondition(HInstruction* cond_input);
+template <typename T> T AbsOrMin(T value) {
+ return (value == std::numeric_limits<T>::min())
+ ? value
+ : std::abs(value);
+}
+
} // namespace art
#endif // ART_COMPILER_OPTIMIZING_CODE_GENERATOR_UTILS_H_
diff --git a/compiler/optimizing/code_generator_x86.cc b/compiler/optimizing/code_generator_x86.cc
index 7e4ad26..8612a67 100644
--- a/compiler/optimizing/code_generator_x86.cc
+++ b/compiler/optimizing/code_generator_x86.cc
@@ -225,7 +225,7 @@
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex();
+ const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
__ movl(calling_convention.GetRegisterAt(0), Immediate(string_index));
x86_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
@@ -265,7 +265,7 @@
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- __ movl(calling_convention.GetRegisterAt(0), Immediate(cls_->GetTypeIndex()));
+ __ movl(calling_convention.GetRegisterAt(0), Immediate(cls_->GetTypeIndex().index_));
x86_codegen->InvokeRuntime(do_clinit_ ? kQuickInitializeStaticStorage
: kQuickInitializeType,
at_, dex_pc_, this);
@@ -1012,6 +1012,8 @@
simple_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_class_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
constant_area_start_(-1),
fixups_to_jump_tables_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
method_address_offset_(-1) {
@@ -1058,6 +1060,11 @@
}
}
+ if (GetGraph()->HasShouldDeoptimizeFlag()) {
+ // Initialize should_deoptimize flag to 0.
+ __ movl(Address(ESP, -kShouldDeoptimizeFlagSize), Immediate(0));
+ }
+
int adjust = GetFrameSize() - FrameEntrySpillSize();
__ subl(ESP, Immediate(adjust));
__ cfi().AdjustCFAOffset(adjust);
@@ -1675,6 +1682,17 @@
/* false_target */ nullptr);
}
+void LocationsBuilderX86::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ LocationSummary* locations = new (GetGraph()->GetArena())
+ LocationSummary(flag, LocationSummary::kNoCall);
+ locations->SetOut(Location::RequiresRegister());
+}
+
+void InstructionCodeGeneratorX86::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ __ movl(flag->GetLocations()->Out().AsRegister<Register>(),
+ Address(ESP, codegen_->GetStackOffsetOfShouldDeoptimizeFlag()));
+}
+
static bool SelectCanUseCMOV(HSelect* select) {
// There are no conditional move instructions for XMMs.
if (Primitive::IsFloatingPointType(select->GetType())) {
@@ -4167,7 +4185,7 @@
void InstructionCodeGeneratorX86::VisitNewArray(HNewArray* instruction) {
InvokeRuntimeCallingConvention calling_convention;
- __ movl(calling_convention.GetRegisterAt(0), Immediate(instruction->GetTypeIndex()));
+ __ movl(calling_convention.GetRegisterAt(0), Immediate(instruction->GetTypeIndex().index_));
// Note: if heap poisoning is enabled, the entry point takes cares
// of poisoning the reference.
codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
@@ -4606,18 +4624,18 @@
void CodeGeneratorX86::RecordBootStringPatch(HLoadString* load_string) {
DCHECK(GetCompilerOptions().IsBootImage());
- string_patches_.emplace_back(load_string->GetDexFile(), load_string->GetStringIndex());
+ string_patches_.emplace_back(load_string->GetDexFile(), load_string->GetStringIndex().index_);
__ Bind(&string_patches_.back().label);
}
void CodeGeneratorX86::RecordTypePatch(HLoadClass* load_class) {
- type_patches_.emplace_back(load_class->GetDexFile(), load_class->GetTypeIndex());
+ type_patches_.emplace_back(load_class->GetDexFile(), load_class->GetTypeIndex().index_);
__ Bind(&type_patches_.back().label);
}
Label* CodeGeneratorX86::NewStringBssEntryPatch(HLoadString* load_string) {
DCHECK(!GetCompilerOptions().IsBootImage());
- string_patches_.emplace_back(load_string->GetDexFile(), load_string->GetStringIndex());
+ string_patches_.emplace_back(load_string->GetDexFile(), load_string->GetStringIndex().index_);
return &string_patches_.back().label;
}
@@ -6017,7 +6035,7 @@
break;
case HLoadClass::LoadKind::kBootImageAddress:
break;
- case HLoadClass::LoadKind::kDexCacheAddress:
+ case HLoadClass::LoadKind::kJitTableAddress:
DCHECK(Runtime::Current()->UseJitCompilation());
break;
case HLoadClass::LoadKind::kDexCacheViaMethod:
@@ -6056,10 +6074,20 @@
locations->SetOut(Location::RequiresRegister());
}
+Label* CodeGeneratorX86::NewJitRootClassPatch(const DexFile& dex_file,
+ dex::TypeIndex dex_index,
+ uint64_t address) {
+ jit_class_roots_.Overwrite(TypeReference(&dex_file, dex_index), address);
+ // Add a patch entry and return the label.
+ jit_class_patches_.emplace_back(dex_file, dex_index.index_);
+ PatchInfo<Label>* info = &jit_class_patches_.back();
+ return &info->label;
+}
+
void InstructionCodeGeneratorX86::VisitLoadClass(HLoadClass* cls) {
LocationSummary* locations = cls->GetLocations();
if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex());
+ codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
return;
@@ -6107,16 +6135,12 @@
codegen_->RecordSimplePatch();
break;
}
- case HLoadClass::LoadKind::kDexCacheAddress: {
- DCHECK_NE(cls->GetAddress(), 0u);
- uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+ case HLoadClass::LoadKind::kJitTableAddress: {
+ Address address = Address::Absolute(CodeGeneratorX86::kDummy32BitOffset);
+ Label* fixup_label = codegen_->NewJitRootClassPatch(
+ cls->GetDexFile(), cls->GetTypeIndex(), cls->GetAddress());
// /* GcRoot<mirror::Class> */ out = *address
- GenerateGcRootFieldLoad(cls,
- out_loc,
- Address::Absolute(address),
- /* fixup_label */ nullptr,
- read_barrier_option);
- generate_null_check = !cls->IsInDexCache();
+ GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, kCompilerReadBarrierOption);
break;
}
case HLoadClass::LoadKind::kDexCachePcRelative: {
@@ -6141,7 +6165,8 @@
// /* GcRoot<mirror::Class> */ out = out[type_index]
GenerateGcRootFieldLoad(cls,
out_loc,
- Address(out, CodeGenerator::GetCacheOffset(cls->GetTypeIndex())),
+ Address(out,
+ CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_)),
/* fixup_label */ nullptr,
read_barrier_option);
generate_null_check = !cls->IsInDexCache();
@@ -6218,16 +6243,15 @@
break;
case HLoadString::LoadKind::kDexCacheViaMethod:
break;
+ case HLoadString::LoadKind::kJitTableAddress:
+ DCHECK(Runtime::Current()->UseJitCompilation());
+ break;
}
return desired_string_load_kind;
}
void LocationsBuilderX86::VisitLoadString(HLoadString* load) {
- LocationSummary::CallKind call_kind = (load->NeedsEnvironment() || kEmitCompilerReadBarrier)
- ? ((load->GetLoadKind() == HLoadString::LoadKind::kDexCacheViaMethod)
- ? LocationSummary::kCallOnMainOnly
- : LocationSummary::kCallOnSlowPath)
- : LocationSummary::kNoCall;
+ LocationSummary::CallKind call_kind = CodeGenerator::GetLoadStringCallKind(load);
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(load, call_kind);
HLoadString::LoadKind load_kind = load->GetLoadKind();
if (load_kind == HLoadString::LoadKind::kBootImageLinkTimePcRelative ||
@@ -6252,6 +6276,15 @@
}
}
+Label* CodeGeneratorX86::NewJitRootStringPatch(const DexFile& dex_file,
+ dex::StringIndex dex_index) {
+ jit_string_roots_.Overwrite(StringReference(&dex_file, dex_index), /* placeholder */ 0u);
+ // Add a patch entry and return the label.
+ jit_string_patches_.emplace_back(dex_file, dex_index.index_);
+ PatchInfo<Label>* info = &jit_string_patches_.back();
+ return &info->label;
+}
+
void InstructionCodeGeneratorX86::VisitLoadString(HLoadString* load) {
LocationSummary* locations = load->GetLocations();
Location out_loc = locations->Out();
@@ -6280,7 +6313,7 @@
Register method_address = locations->InAt(0).AsRegister<Register>();
Address address = Address(method_address, CodeGeneratorX86::kDummy32BitOffset);
Label* fixup_label = codegen_->NewStringBssEntryPatch(load);
- // /* GcRoot<mirror::Class> */ out = *address /* PC-relative */
+ // /* GcRoot<mirror::String> */ out = *address /* PC-relative */
GenerateGcRootFieldLoad(load, out_loc, address, fixup_label, kCompilerReadBarrierOption);
SlowPathCode* slow_path = new (GetGraph()->GetArena()) LoadStringSlowPathX86(load);
codegen_->AddSlowPath(slow_path);
@@ -6289,6 +6322,14 @@
__ Bind(slow_path->GetExitLabel());
return;
}
+ case HLoadString::LoadKind::kJitTableAddress: {
+ Address address = Address::Absolute(CodeGeneratorX86::kDummy32BitOffset);
+ Label* fixup_label = codegen_->NewJitRootStringPatch(
+ load->GetDexFile(), load->GetStringIndex());
+ // /* GcRoot<mirror::String> */ out = *address
+ GenerateGcRootFieldLoad(load, out_loc, address, fixup_label, kCompilerReadBarrierOption);
+ return;
+ }
default:
break;
}
@@ -6296,7 +6337,7 @@
// TODO: Re-add the compiler code to do string dex cache lookup again.
InvokeRuntimeCallingConvention calling_convention;
DCHECK_EQ(calling_convention.GetRegisterAt(0), out);
- __ movl(calling_convention.GetRegisterAt(0), Immediate(load->GetStringIndex()));
+ __ movl(calling_convention.GetRegisterAt(0), Immediate(load->GetStringIndex().index_));
codegen_->InvokeRuntime(kQuickResolveString, load, load->GetDexPc());
CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
}
@@ -7736,6 +7777,34 @@
}
}
+void CodeGeneratorX86::PatchJitRootUse(uint8_t* code,
+ const uint8_t* roots_data,
+ const PatchInfo<Label>& info,
+ uint64_t index_in_table) const {
+ uint32_t code_offset = info.label.Position() - kLabelPositionToLiteralOffsetAdjustment;
+ uintptr_t address =
+ reinterpret_cast<uintptr_t>(roots_data) + index_in_table * sizeof(GcRoot<mirror::Object>);
+ typedef __attribute__((__aligned__(1))) uint32_t unaligned_uint32_t;
+ reinterpret_cast<unaligned_uint32_t*>(code + code_offset)[0] =
+ dchecked_integral_cast<uint32_t>(address);
+}
+
+void CodeGeneratorX86::EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) {
+ for (const PatchInfo<Label>& info : jit_string_patches_) {
+ const auto& it = jit_string_roots_.find(
+ StringReference(&info.dex_file, dex::StringIndex(info.index)));
+ DCHECK(it != jit_string_roots_.end());
+ PatchJitRootUse(code, roots_data, info, it->second);
+ }
+
+ for (const PatchInfo<Label>& info : jit_class_patches_) {
+ const auto& it = jit_class_roots_.find(
+ TypeReference(&info.dex_file, dex::TypeIndex(info.index)));
+ DCHECK(it != jit_class_roots_.end());
+ PatchJitRootUse(code, roots_data, info, it->second);
+ }
+}
+
#undef __
} // namespace x86
diff --git a/compiler/optimizing/code_generator_x86.h b/compiler/optimizing/code_generator_x86.h
index 164231b..c44da97 100644
--- a/compiler/optimizing/code_generator_x86.h
+++ b/compiler/optimizing/code_generator_x86.h
@@ -20,6 +20,7 @@
#include "arch/x86/instruction_set_features_x86.h"
#include "base/enums.h"
#include "code_generator.h"
+#include "dex_file_types.h"
#include "driver/compiler_options.h"
#include "nodes.h"
#include "parallel_move_resolver.h"
@@ -414,12 +415,20 @@
void RecordTypePatch(HLoadClass* load_class);
Label* NewStringBssEntryPatch(HLoadString* load_string);
Label* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file, uint32_t element_offset);
+ Label* NewJitRootStringPatch(const DexFile& dex_file, dex::StringIndex dex_index);
+ Label* NewJitRootClassPatch(const DexFile& dex_file, dex::TypeIndex dex_index, uint64_t address);
void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE;
// Emit linker patches.
void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
+ void PatchJitRootUse(uint8_t* code,
+ const uint8_t* roots_data,
+ const PatchInfo<Label>& info,
+ uint64_t index_in_table) const;
+ void EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) OVERRIDE;
+
// Emit a write barrier.
void MarkGCCard(Register temp,
Register card,
@@ -616,6 +625,12 @@
// Type patch locations.
ArenaDeque<PatchInfo<Label>> type_patches_;
+ // Patches for string root accesses in JIT compiled code.
+ ArenaDeque<PatchInfo<Label>> jit_string_patches_;
+
+ // Patches for class root accesses in JIT compiled code.
+ ArenaDeque<PatchInfo<Label>> jit_class_patches_;
+
// Offset to the start of the constant area in the assembled code.
// Used for fixups to the constant area.
int32_t constant_area_start_;
diff --git a/compiler/optimizing/code_generator_x86_64.cc b/compiler/optimizing/code_generator_x86_64.cc
index 19b3019..7dfc736 100644
--- a/compiler/optimizing/code_generator_x86_64.cc
+++ b/compiler/optimizing/code_generator_x86_64.cc
@@ -246,7 +246,8 @@
SaveLiveRegisters(codegen, locations);
InvokeRuntimeCallingConvention calling_convention;
- __ movl(CpuRegister(calling_convention.GetRegisterAt(0)), Immediate(cls_->GetTypeIndex()));
+ __ movl(CpuRegister(calling_convention.GetRegisterAt(0)),
+ Immediate(cls_->GetTypeIndex().index_));
x86_64_codegen->InvokeRuntime(do_clinit_ ? kQuickInitializeStaticStorage : kQuickInitializeType,
at_,
dex_pc_,
@@ -299,7 +300,7 @@
__ Bind(GetEntryLabel());
SaveLiveRegisters(codegen, locations);
- const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex();
+ const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
// Custom calling convention: RAX serves as both input and output.
__ movl(CpuRegister(RAX), Immediate(string_index));
x86_64_codegen->InvokeRuntime(kQuickResolveString,
@@ -1105,18 +1106,18 @@
void CodeGeneratorX86_64::RecordBootStringPatch(HLoadString* load_string) {
DCHECK(GetCompilerOptions().IsBootImage());
- string_patches_.emplace_back(load_string->GetDexFile(), load_string->GetStringIndex());
+ string_patches_.emplace_back(load_string->GetDexFile(), load_string->GetStringIndex().index_);
__ Bind(&string_patches_.back().label);
}
void CodeGeneratorX86_64::RecordTypePatch(HLoadClass* load_class) {
- type_patches_.emplace_back(load_class->GetDexFile(), load_class->GetTypeIndex());
+ type_patches_.emplace_back(load_class->GetDexFile(), load_class->GetTypeIndex().index_);
__ Bind(&type_patches_.back().label);
}
Label* CodeGeneratorX86_64::NewStringBssEntryPatch(HLoadString* load_string) {
DCHECK(!GetCompilerOptions().IsBootImage());
- string_patches_.emplace_back(load_string->GetDexFile(), load_string->GetStringIndex());
+ string_patches_.emplace_back(load_string->GetDexFile(), load_string->GetStringIndex().index_);
return &string_patches_.back().label;
}
@@ -1258,7 +1259,9 @@
simple_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
- fixups_to_jump_tables_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
+ fixups_to_jump_tables_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+ jit_class_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
AddAllocatedRegister(Location::RegisterLocation(kFakeReturnRegister));
}
@@ -1324,6 +1327,12 @@
}
}
+ if (GetGraph()->HasShouldDeoptimizeFlag()) {
+ // Initialize should_deoptimize flag to 0.
+ __ movl(Address(CpuRegister(RSP), xmm_spill_location - kShouldDeoptimizeFlagSize),
+ Immediate(0));
+ }
+
// Save the current method if we need it. Note that we do not
// do this in HCurrentMethod, as the instruction might have been removed
// in the SSA graph.
@@ -1745,6 +1754,17 @@
/* false_target */ nullptr);
}
+void LocationsBuilderX86_64::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ LocationSummary* locations = new (GetGraph()->GetArena())
+ LocationSummary(flag, LocationSummary::kNoCall);
+ locations->SetOut(Location::RequiresRegister());
+}
+
+void InstructionCodeGeneratorX86_64::VisitShouldDeoptimizeFlag(HShouldDeoptimizeFlag* flag) {
+ __ movl(flag->GetLocations()->Out().AsRegister<CpuRegister>(),
+ Address(CpuRegister(RSP), codegen_->GetStackOffsetOfShouldDeoptimizeFlag()));
+}
+
static bool SelectCanUseCMOV(HSelect* select) {
// There are no conditional move instructions for XMMs.
if (Primitive::IsFloatingPointType(select->GetType())) {
@@ -4097,7 +4117,7 @@
void InstructionCodeGeneratorX86_64::VisitNewArray(HNewArray* instruction) {
InvokeRuntimeCallingConvention calling_convention;
codegen_->Load64BitValue(CpuRegister(calling_convention.GetRegisterAt(0)),
- instruction->GetTypeIndex());
+ instruction->GetTypeIndex().index_);
// Note: if heap poisoning is enabled, the entry point takes cares
// of poisoning the reference.
codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
@@ -5441,8 +5461,7 @@
break;
case HLoadClass::LoadKind::kBootImageAddress:
break;
- case HLoadClass::LoadKind::kDexCacheAddress:
- DCHECK(Runtime::Current()->UseJitCompilation());
+ case HLoadClass::LoadKind::kJitTableAddress:
break;
case HLoadClass::LoadKind::kDexCachePcRelative:
DCHECK(!Runtime::Current()->UseJitCompilation());
@@ -5481,10 +5500,20 @@
locations->SetOut(Location::RequiresRegister());
}
+Label* CodeGeneratorX86_64::NewJitRootClassPatch(const DexFile& dex_file,
+ dex::TypeIndex dex_index,
+ uint64_t address) {
+ jit_class_roots_.Overwrite(TypeReference(&dex_file, dex_index), address);
+ // Add a patch entry and return the label.
+ jit_class_patches_.emplace_back(dex_file, dex_index.index_);
+ PatchInfo<Label>* info = &jit_class_patches_.back();
+ return &info->label;
+}
+
void InstructionCodeGeneratorX86_64::VisitLoadClass(HLoadClass* cls) {
LocationSummary* locations = cls->GetLocations();
if (cls->NeedsAccessCheck()) {
- codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex());
+ codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
return;
@@ -5524,26 +5553,13 @@
codegen_->RecordSimplePatch();
break;
}
- case HLoadClass::LoadKind::kDexCacheAddress: {
- DCHECK_NE(cls->GetAddress(), 0u);
+ case HLoadClass::LoadKind::kJitTableAddress: {
+ Address address = Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset,
+ /* no_rip */ true);
+ Label* fixup_label =
+ codegen_->NewJitRootClassPatch(cls->GetDexFile(), cls->GetTypeIndex(), cls->GetAddress());
// /* GcRoot<mirror::Class> */ out = *address
- if (IsUint<32>(cls->GetAddress())) {
- Address address = Address::Absolute(cls->GetAddress(), /* no_rip */ true);
- GenerateGcRootFieldLoad(cls,
- out_loc,
- address,
- /* fixup_label */ nullptr,
- read_barrier_option);
- } else {
- // TODO: Consider using opcode A1, i.e. movl eax, moff32 (with 64-bit address).
- __ movq(out, Immediate(cls->GetAddress()));
- GenerateGcRootFieldLoad(cls,
- out_loc,
- Address(out, 0),
- /* fixup_label */ nullptr,
- read_barrier_option);
- }
- generate_null_check = !cls->IsInDexCache();
+ GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, kCompilerReadBarrierOption);
break;
}
case HLoadClass::LoadKind::kDexCachePcRelative: {
@@ -5567,7 +5583,7 @@
GenerateGcRootFieldLoad(
cls,
out_loc,
- Address(out, CodeGenerator::GetCacheOffset(cls->GetTypeIndex())),
+ Address(out, CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_)),
/* fixup_label */ nullptr,
read_barrier_option);
generate_null_check = !cls->IsInDexCache();
@@ -5630,16 +5646,15 @@
break;
case HLoadString::LoadKind::kDexCacheViaMethod:
break;
+ case HLoadString::LoadKind::kJitTableAddress:
+ DCHECK(Runtime::Current()->UseJitCompilation());
+ break;
}
return desired_string_load_kind;
}
void LocationsBuilderX86_64::VisitLoadString(HLoadString* load) {
- LocationSummary::CallKind call_kind = load->NeedsEnvironment()
- ? ((load->GetLoadKind() == HLoadString::LoadKind::kDexCacheViaMethod)
- ? LocationSummary::kCallOnMainOnly
- : LocationSummary::kCallOnSlowPath)
- : LocationSummary::kNoCall;
+ LocationSummary::CallKind call_kind = CodeGenerator::GetLoadStringCallKind(load);
LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(load, call_kind);
if (load->GetLoadKind() == HLoadString::LoadKind::kDexCacheViaMethod) {
locations->SetOut(Location::RegisterLocation(RAX));
@@ -5659,6 +5674,15 @@
}
}
+Label* CodeGeneratorX86_64::NewJitRootStringPatch(const DexFile& dex_file,
+ dex::StringIndex dex_index) {
+ jit_string_roots_.Overwrite(StringReference(&dex_file, dex_index), /* placeholder */ 0u);
+ // Add a patch entry and return the label.
+ jit_string_patches_.emplace_back(dex_file, dex_index.index_);
+ PatchInfo<Label>* info = &jit_string_patches_.back();
+ return &info->label;
+}
+
void InstructionCodeGeneratorX86_64::VisitLoadString(HLoadString* load) {
LocationSummary* locations = load->GetLocations();
Location out_loc = locations->Out();
@@ -5690,13 +5714,22 @@
__ Bind(slow_path->GetExitLabel());
return;
}
+ case HLoadString::LoadKind::kJitTableAddress: {
+ Address address = Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset,
+ /* no_rip */ true);
+ Label* fixup_label =
+ codegen_->NewJitRootStringPatch(load->GetDexFile(), load->GetStringIndex());
+ // /* GcRoot<mirror::String> */ out = *address
+ GenerateGcRootFieldLoad(load, out_loc, address, fixup_label, kCompilerReadBarrierOption);
+ return;
+ }
default:
break;
}
// TODO: Re-add the compiler code to do string dex cache lookup again.
// Custom calling convention: RAX serves as both input and output.
- __ movl(CpuRegister(RAX), Immediate(load->GetStringIndex()));
+ __ movl(CpuRegister(RAX), Immediate(load->GetStringIndex().index_));
codegen_->InvokeRuntime(kQuickResolveString,
load,
load->GetDexPc());
@@ -7091,6 +7124,34 @@
}
}
+void CodeGeneratorX86_64::PatchJitRootUse(uint8_t* code,
+ const uint8_t* roots_data,
+ const PatchInfo<Label>& info,
+ uint64_t index_in_table) const {
+ uint32_t code_offset = info.label.Position() - kLabelPositionToLiteralOffsetAdjustment;
+ uintptr_t address =
+ reinterpret_cast<uintptr_t>(roots_data) + index_in_table * sizeof(GcRoot<mirror::Object>);
+ typedef __attribute__((__aligned__(1))) uint32_t unaligned_uint32_t;
+ reinterpret_cast<unaligned_uint32_t*>(code + code_offset)[0] =
+ dchecked_integral_cast<uint32_t>(address);
+}
+
+void CodeGeneratorX86_64::EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) {
+ for (const PatchInfo<Label>& info : jit_string_patches_) {
+ const auto& it = jit_string_roots_.find(
+ StringReference(&info.dex_file, dex::StringIndex(info.index)));
+ DCHECK(it != jit_string_roots_.end());
+ PatchJitRootUse(code, roots_data, info, it->second);
+ }
+
+ for (const PatchInfo<Label>& info : jit_class_patches_) {
+ const auto& it = jit_class_roots_.find(
+ TypeReference(&info.dex_file, dex::TypeIndex(info.index)));
+ DCHECK(it != jit_class_roots_.end());
+ PatchJitRootUse(code, roots_data, info, it->second);
+ }
+}
+
#undef __
} // namespace x86_64
diff --git a/compiler/optimizing/code_generator_x86_64.h b/compiler/optimizing/code_generator_x86_64.h
index e5a4152..391a23b 100644
--- a/compiler/optimizing/code_generator_x86_64.h
+++ b/compiler/optimizing/code_generator_x86_64.h
@@ -412,11 +412,20 @@
void RecordTypePatch(HLoadClass* load_class);
Label* NewStringBssEntryPatch(HLoadString* load_string);
Label* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file, uint32_t element_offset);
+ Label* NewJitRootStringPatch(const DexFile& dex_file, dex::StringIndex dex_index);
+ Label* NewJitRootClassPatch(const DexFile& dex_file, dex::TypeIndex dex_index, uint64_t address);
void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE;
void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
+ void PatchJitRootUse(uint8_t* code,
+ const uint8_t* roots_data,
+ const PatchInfo<Label>& info,
+ uint64_t index_in_table) const;
+
+ void EmitJitRootPatches(uint8_t* code, const uint8_t* roots_data) OVERRIDE;
+
const X86_64InstructionSetFeatures& GetInstructionSetFeatures() const {
return isa_features_;
}
@@ -602,6 +611,12 @@
// Fixups for jump tables need to be handled specially.
ArenaVector<JumpTableRIPFixup*> fixups_to_jump_tables_;
+ // Patches for string literals in JIT compiled code.
+ ArenaDeque<PatchInfo<Label>> jit_string_patches_;
+
+ // Patches for class literals in JIT compiled code.
+ ArenaDeque<PatchInfo<Label>> jit_class_patches_;
+
DISALLOW_COPY_AND_ASSIGN(CodeGeneratorX86_64);
};
diff --git a/compiler/optimizing/common_arm.h b/compiler/optimizing/common_arm.h
index 5129daf..21c3ae6 100644
--- a/compiler/optimizing/common_arm.h
+++ b/compiler/optimizing/common_arm.h
@@ -17,6 +17,11 @@
#ifndef ART_COMPILER_OPTIMIZING_COMMON_ARM_H_
#define ART_COMPILER_OPTIMIZING_COMMON_ARM_H_
+#include "debug/dwarf/register.h"
+#include "locations.h"
+#include "nodes.h"
+#include "utils/arm/constants_arm.h"
+
// TODO(VIXL): Make VIXL compile with -Wshadow.
#pragma GCC diagnostic push
#pragma GCC diagnostic ignored "-Wshadow"
@@ -117,10 +122,16 @@
if (type == Primitive::kPrimFloat) {
return InputSRegisterAt(instr, input_index);
} else {
+ DCHECK_EQ(type, Primitive::kPrimDouble);
return InputDRegisterAt(instr, input_index);
}
}
+inline vixl::aarch32::VRegister InputVRegister(HInstruction* instr) {
+ DCHECK_EQ(instr->InputCount(), 1u);
+ return InputVRegisterAt(instr, 0);
+}
+
inline vixl::aarch32::Register OutputRegister(HInstruction* instr) {
return RegisterFrom(instr->GetLocations()->Out(), instr->GetType());
}
@@ -135,16 +146,24 @@
return InputRegisterAt(instr, 0);
}
-inline int32_t Int32ConstantFrom(Location location) {
- HConstant* instr = location.GetConstant();
+inline int32_t Int32ConstantFrom(HInstruction* instr) {
if (instr->IsIntConstant()) {
return instr->AsIntConstant()->GetValue();
- } else {
- DCHECK(instr->IsNullConstant()) << instr->DebugName();
+ } else if (instr->IsNullConstant()) {
return 0;
+ } else {
+ DCHECK(instr->IsLongConstant()) << instr->DebugName();
+ const int64_t ret = instr->AsLongConstant()->GetValue();
+ DCHECK_GE(ret, std::numeric_limits<int32_t>::min());
+ DCHECK_LE(ret, std::numeric_limits<int32_t>::max());
+ return ret;
}
}
+inline int32_t Int32ConstantFrom(Location location) {
+ return Int32ConstantFrom(location.GetConstant());
+}
+
inline int64_t Int64ConstantFrom(Location location) {
HConstant* instr = location.GetConstant();
if (instr->IsIntConstant()) {
@@ -157,11 +176,16 @@
}
}
+inline uint64_t Uint64ConstantFrom(HInstruction* instr) {
+ DCHECK(instr->IsConstant()) << instr->DebugName();
+ return instr->AsConstant()->GetValueAsUint64();
+}
+
inline vixl::aarch32::Operand OperandFrom(Location location, Primitive::Type type) {
if (location.IsRegister()) {
return vixl::aarch32::Operand(RegisterFrom(location, type));
} else {
- return vixl::aarch32::Operand(Int64ConstantFrom(location));
+ return vixl::aarch32::Operand(Int32ConstantFrom(location));
}
}
diff --git a/compiler/optimizing/constant_folding_test.cc b/compiler/optimizing/constant_folding_test.cc
index 5fac3ac..7ef28ed 100644
--- a/compiler/optimizing/constant_folding_test.cc
+++ b/compiler/optimizing/constant_folding_test.cc
@@ -756,7 +756,7 @@
// Make various unsigned comparisons with zero against a parameter.
HInstruction* parameter = new (&allocator_) HParameterValue(
- graph_->GetDexFile(), 0, 0, Primitive::kPrimInt, true);
+ graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt, true);
entry_block->AddInstruction(parameter);
entry_block->AddInstruction(new (&allocator_) HGoto());
diff --git a/compiler/optimizing/dex_cache_array_fixups_arm.cc b/compiler/optimizing/dex_cache_array_fixups_arm.cc
index 82b8123..10a36c6 100644
--- a/compiler/optimizing/dex_cache_array_fixups_arm.cc
+++ b/compiler/optimizing/dex_cache_array_fixups_arm.cc
@@ -17,12 +17,24 @@
#include "dex_cache_array_fixups_arm.h"
#include "base/arena_containers.h"
+#ifdef ART_USE_VIXL_ARM_BACKEND
+#include "code_generator_arm_vixl.h"
+#include "intrinsics_arm_vixl.h"
+#else
#include "code_generator_arm.h"
#include "intrinsics_arm.h"
+#endif
#include "utils/dex_cache_arrays_layout-inl.h"
namespace art {
namespace arm {
+#ifdef ART_USE_VIXL_ARM_BACKEND
+typedef CodeGeneratorARMVIXL CodeGeneratorARMType;
+typedef IntrinsicLocationsBuilderARMVIXL IntrinsicLocationsBuilderARMType;
+#else
+typedef CodeGeneratorARM CodeGeneratorARMType;
+typedef IntrinsicLocationsBuilderARM IntrinsicLocationsBuilderARMType;
+#endif
/**
* Finds instructions that need the dex cache arrays base as an input.
@@ -31,7 +43,7 @@
public:
DexCacheArrayFixupsVisitor(HGraph* graph, CodeGenerator* codegen)
: HGraphVisitor(graph),
- codegen_(down_cast<CodeGeneratorARM*>(codegen)),
+ codegen_(down_cast<CodeGeneratorARMType*>(codegen)),
dex_cache_array_bases_(std::less<const DexFile*>(),
// Attribute memory use to code generator.
graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {}
@@ -66,7 +78,7 @@
// If this is an invoke with PC-relative access to the dex cache methods array,
// we need to add the dex cache arrays base as the special input.
if (invoke->HasPcRelativeDexCache() &&
- !IsCallFreeIntrinsic<IntrinsicLocationsBuilderARM>(invoke, codegen_)) {
+ !IsCallFreeIntrinsic<IntrinsicLocationsBuilderARMType>(invoke, codegen_)) {
HArmDexCacheArraysBase* base = GetOrCreateDexCacheArrayBase(invoke->GetDexFile());
// Update the element offset in base.
DexCacheArraysLayout layout(kArmPointerSize, &invoke->GetDexFile());
@@ -94,7 +106,7 @@
return base;
}
- CodeGeneratorARM* codegen_;
+ CodeGeneratorARMType* codegen_;
using DexCacheArraysBaseMap =
ArenaSafeMap<const DexFile*, HArmDexCacheArraysBase*, std::less<const DexFile*>>;
diff --git a/compiler/optimizing/emit_swap_mips_test.cc b/compiler/optimizing/emit_swap_mips_test.cc
index 9dc53e6..0d4e1c5 100644
--- a/compiler/optimizing/emit_swap_mips_test.cc
+++ b/compiler/optimizing/emit_swap_mips_test.cc
@@ -154,54 +154,54 @@
TEST_F(EmitSwapMipsTest, TwoFpuRegistersFloat) {
moves_->AddMove(
Location::FpuRegisterLocation(4),
- Location::FpuRegisterLocation(6),
+ Location::FpuRegisterLocation(2),
Primitive::kPrimFloat,
nullptr);
moves_->AddMove(
- Location::FpuRegisterLocation(6),
+ Location::FpuRegisterLocation(2),
Location::FpuRegisterLocation(4),
Primitive::kPrimFloat,
nullptr);
const char* expected =
- "mov.s $f8, $f6\n"
- "mov.s $f6, $f4\n"
- "mov.s $f4, $f8\n";
+ "mov.s $f6, $f2\n"
+ "mov.s $f2, $f4\n"
+ "mov.s $f4, $f6\n";
DriverWrapper(moves_, expected, "TwoFpuRegistersFloat");
}
TEST_F(EmitSwapMipsTest, TwoFpuRegistersDouble) {
moves_->AddMove(
Location::FpuRegisterLocation(4),
- Location::FpuRegisterLocation(6),
+ Location::FpuRegisterLocation(2),
Primitive::kPrimDouble,
nullptr);
moves_->AddMove(
- Location::FpuRegisterLocation(6),
+ Location::FpuRegisterLocation(2),
Location::FpuRegisterLocation(4),
Primitive::kPrimDouble,
nullptr);
const char* expected =
- "mov.d $f8, $f6\n"
- "mov.d $f6, $f4\n"
- "mov.d $f4, $f8\n";
+ "mov.d $f6, $f2\n"
+ "mov.d $f2, $f4\n"
+ "mov.d $f4, $f6\n";
DriverWrapper(moves_, expected, "TwoFpuRegistersDouble");
}
TEST_F(EmitSwapMipsTest, RegisterAndFpuRegister) {
moves_->AddMove(
Location::RegisterLocation(4),
- Location::FpuRegisterLocation(6),
+ Location::FpuRegisterLocation(2),
Primitive::kPrimFloat,
nullptr);
moves_->AddMove(
- Location::FpuRegisterLocation(6),
+ Location::FpuRegisterLocation(2),
Location::RegisterLocation(4),
Primitive::kPrimFloat,
nullptr);
const char* expected =
"or $t8, $a0, $zero\n"
- "mfc1 $a0, $f6\n"
- "mtc1 $t8, $f6\n";
+ "mfc1 $a0, $f2\n"
+ "mtc1 $t8, $f2\n";
DriverWrapper(moves_, expected, "RegisterAndFpuRegister");
}
@@ -327,9 +327,9 @@
Primitive::kPrimFloat,
nullptr);
const char* expected =
- "mov.s $f8, $f4\n"
+ "mov.s $f6, $f4\n"
"lwc1 $f4, 48($sp)\n"
- "swc1 $f8, 48($sp)\n";
+ "swc1 $f6, 48($sp)\n";
DriverWrapper(moves_, expected, "FpuRegisterAndStackSlot");
}
@@ -345,9 +345,9 @@
Primitive::kPrimDouble,
nullptr);
const char* expected =
- "mov.d $f8, $f4\n"
+ "mov.d $f6, $f4\n"
"ldc1 $f4, 48($sp)\n"
- "sdc1 $f8, 48($sp)\n";
+ "sdc1 $f6, 48($sp)\n";
DriverWrapper(moves_, expected, "FpuRegisterAndDoubleStackSlot");
}
diff --git a/compiler/optimizing/escape.cc b/compiler/optimizing/escape.cc
new file mode 100644
index 0000000..9df5bf1
--- /dev/null
+++ b/compiler/optimizing/escape.cc
@@ -0,0 +1,103 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "escape.h"
+
+#include "nodes.h"
+
+namespace art {
+
+void CalculateEscape(HInstruction* reference,
+ bool (*no_escape)(HInstruction*, HInstruction*),
+ /*out*/ bool* is_singleton,
+ /*out*/ bool* is_singleton_and_not_returned,
+ /*out*/ bool* is_singleton_and_not_deopt_visible) {
+ // For references not allocated in the method, don't assume anything.
+ if (!reference->IsNewInstance() && !reference->IsNewArray()) {
+ *is_singleton = false;
+ *is_singleton_and_not_returned = false;
+ *is_singleton_and_not_deopt_visible = false;
+ return;
+ }
+ // Assume the best until proven otherwise.
+ *is_singleton = true;
+ *is_singleton_and_not_returned = true;
+ *is_singleton_and_not_deopt_visible = true;
+ // Visit all uses to determine if this reference can escape into the heap,
+ // a method call, an alias, etc.
+ for (const HUseListNode<HInstruction*>& use : reference->GetUses()) {
+ HInstruction* user = use.GetUser();
+ if (no_escape != nullptr && (*no_escape)(reference, user)) {
+ // Client supplied analysis says there is no escape.
+ continue;
+ } else if (user->IsBoundType() || user->IsNullCheck()) {
+ // BoundType shouldn't normally be necessary for an allocation. Just be conservative
+ // for the uncommon cases. Similarly, null checks are eventually eliminated for explicit
+ // allocations, but if we see one before it is simplified, assume an alias.
+ *is_singleton = false;
+ *is_singleton_and_not_returned = false;
+ *is_singleton_and_not_deopt_visible = false;
+ return;
+ } else if (user->IsPhi() || user->IsSelect() || user->IsInvoke() ||
+ (user->IsInstanceFieldSet() && (reference == user->InputAt(1))) ||
+ (user->IsUnresolvedInstanceFieldSet() && (reference == user->InputAt(1))) ||
+ (user->IsStaticFieldSet() && (reference == user->InputAt(1))) ||
+ (user->IsUnresolvedStaticFieldSet() && (reference == user->InputAt(0))) ||
+ (user->IsArraySet() && (reference == user->InputAt(2)))) {
+ // The reference is merged to HPhi/HSelect, passed to a callee, or stored to heap.
+ // Hence, the reference is no longer the only name that can refer to its value.
+ *is_singleton = false;
+ *is_singleton_and_not_returned = false;
+ *is_singleton_and_not_deopt_visible = false;
+ return;
+ } else if ((user->IsUnresolvedInstanceFieldGet() && (reference == user->InputAt(0))) ||
+ (user->IsUnresolvedInstanceFieldSet() && (reference == user->InputAt(0)))) {
+ // The field is accessed in an unresolved way. We mark the object as a non-singleton.
+ // Note that we could optimize this case and still perform some optimizations until
+ // we hit the unresolved access, but the conservative assumption is the simplest.
+ *is_singleton = false;
+ *is_singleton_and_not_returned = false;
+ *is_singleton_and_not_deopt_visible = false;
+ return;
+ } else if (user->IsReturn()) {
+ *is_singleton_and_not_returned = false;
+ }
+ }
+
+ // Look at the environment uses if it's for HDeoptimize. Other environment uses are fine,
+ // as long as client optimizations that rely on this information are disabled for debuggable.
+ for (const HUseListNode<HEnvironment*>& use : reference->GetEnvUses()) {
+ HEnvironment* user = use.GetUser();
+ if (user->GetHolder()->IsDeoptimize()) {
+ *is_singleton_and_not_deopt_visible = false;
+ break;
+ }
+ }
+}
+
+bool DoesNotEscape(HInstruction* reference, bool (*no_escape)(HInstruction*, HInstruction*)) {
+ bool is_singleton = false;
+ bool is_singleton_and_not_returned = false;
+ bool is_singleton_and_not_deopt_visible = false; // not relevant for escape
+ CalculateEscape(reference,
+ no_escape,
+ &is_singleton,
+ &is_singleton_and_not_returned,
+ &is_singleton_and_not_deopt_visible);
+ return is_singleton_and_not_returned;
+}
+
+} // namespace art
diff --git a/compiler/optimizing/escape.h b/compiler/optimizing/escape.h
new file mode 100644
index 0000000..75e37b0
--- /dev/null
+++ b/compiler/optimizing/escape.h
@@ -0,0 +1,68 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_COMPILER_OPTIMIZING_ESCAPE_H_
+#define ART_COMPILER_OPTIMIZING_ESCAPE_H_
+
+namespace art {
+
+class HInstruction;
+
+/*
+ * Methods related to escape analysis, i.e. determining whether an object
+ * allocation is visible outside ('escapes') its immediate method context.
+ */
+
+/*
+ * Performs escape analysis on the given instruction, typically a reference to an
+ * allocation. The method assigns true to parameter 'is_singleton' if the reference
+ * is the only name that can refer to its value during the lifetime of the method,
+ * meaning that the reference is not aliased with something else, is not stored to
+ * heap memory, and not passed to another method. In addition, the method assigns
+ * true to parameter 'is_singleton_and_not_returned' if the reference is a singleton
+ * and not returned to the caller and to parameter 'is_singleton_and_not_deopt_visible'
+ * if the reference is a singleton and not used as an environment local of an
+ * HDeoptimize instruction (clients of the final value must run after BCE to ensure
+ * all such instructions have been introduced already).
+ *
+ * Note that being visible to a HDeoptimize instruction does not count for ordinary
+ * escape analysis, since switching between compiled code and interpreted code keeps
+ * non escaping references restricted to the lifetime of the method and the thread
+ * executing it. This property only concerns optimizations that are interested in
+ * escape analysis with respect to the *compiled* code (such as LSE).
+ *
+ * When set, the no_escape function is applied to any use of the allocation instruction
+ * prior to any built-in escape analysis. This allows clients to define better escape
+ * analysis in certain case-specific circumstances. If 'no_escape(reference, user)'
+ * returns true, the user is assumed *not* to cause any escape right away. The return
+ * value false means the client cannot provide a definite answer and built-in escape
+ * analysis is applied to the user instead.
+ */
+void CalculateEscape(HInstruction* reference,
+ bool (*no_escape)(HInstruction*, HInstruction*),
+ /*out*/ bool* is_singleton,
+ /*out*/ bool* is_singleton_and_not_returned,
+ /*out*/ bool* is_singleton_and_not_deopt_visible);
+
+/*
+ * Convenience method for testing the singleton and not returned properties at once.
+ * Callers should be aware that this method invokes the full analysis at each call.
+ */
+bool DoesNotEscape(HInstruction* reference, bool (*no_escape)(HInstruction*, HInstruction*));
+
+} // namespace art
+
+#endif // ART_COMPILER_OPTIMIZING_ESCAPE_H_
diff --git a/compiler/optimizing/graph_checker.cc b/compiler/optimizing/graph_checker.cc
index c8cba20..34b52a8 100644
--- a/compiler/optimizing/graph_checker.cc
+++ b/compiler/optimizing/graph_checker.cc
@@ -20,13 +20,15 @@
#include <string>
#include <sstream>
+#include "android-base/stringprintf.h"
+
#include "base/arena_containers.h"
#include "base/bit_vector-inl.h"
-#include "base/stringprintf.h"
-#include "handle_scope-inl.h"
namespace art {
+using android::base::StringPrintf;
+
static bool IsAllowedToJumpToExitBlock(HInstruction* instruction) {
return instruction->IsThrow() || instruction->IsReturn() || instruction->IsReturnVoid();
}
@@ -448,7 +450,6 @@
// Ensure that reference type instructions have reference type info.
if (instruction->GetType() == Primitive::kPrimNot) {
- ScopedObjectAccess soa(Thread::Current());
if (!instruction->GetReferenceTypeInfo().IsValid()) {
AddError(StringPrintf("Reference type instruction %s:%d does not have "
"valid reference type information.",
@@ -1011,7 +1012,6 @@
void GraphChecker::VisitBoundType(HBoundType* instruction) {
VisitInstruction(instruction);
- ScopedObjectAccess soa(Thread::Current());
if (!instruction->GetUpperBound().IsValid()) {
AddError(StringPrintf(
"%s %d does not have a valid upper bound RTI.",
diff --git a/compiler/optimizing/graph_test.cc b/compiler/optimizing/graph_test.cc
index d530564..28ee3a5 100644
--- a/compiler/optimizing/graph_test.cc
+++ b/compiler/optimizing/graph_test.cc
@@ -15,7 +15,6 @@
*/
#include "base/arena_allocator.h"
-#include "base/stringprintf.h"
#include "builder.h"
#include "nodes.h"
#include "optimizing_unit_test.h"
diff --git a/compiler/optimizing/gvn_test.cc b/compiler/optimizing/gvn_test.cc
index 6abf00e..437d35c 100644
--- a/compiler/optimizing/gvn_test.cc
+++ b/compiler/optimizing/gvn_test.cc
@@ -35,7 +35,7 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter = new (&allocator) HParameterValue(graph->GetDexFile(),
- 0,
+ dex::TypeIndex(0),
0,
Primitive::kPrimNot);
entry->AddInstruction(parameter);
@@ -120,7 +120,7 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter = new (&allocator) HParameterValue(graph->GetDexFile(),
- 0,
+ dex::TypeIndex(0),
0,
Primitive::kPrimNot);
entry->AddInstruction(parameter);
@@ -204,7 +204,7 @@
graph->SetEntryBlock(entry);
HInstruction* parameter = new (&allocator) HParameterValue(graph->GetDexFile(),
- 0,
+ dex::TypeIndex(0),
0,
Primitive::kPrimNot);
entry->AddInstruction(parameter);
@@ -352,7 +352,7 @@
inner_loop_exit->AddSuccessor(outer_loop_header);
HInstruction* parameter = new (&allocator) HParameterValue(graph->GetDexFile(),
- 0,
+ dex::TypeIndex(0),
0,
Primitive::kPrimBoolean);
entry->AddInstruction(parameter);
diff --git a/compiler/optimizing/induction_var_analysis.cc b/compiler/optimizing/induction_var_analysis.cc
index f2602fb..b21bc09 100644
--- a/compiler/optimizing/induction_var_analysis.cc
+++ b/compiler/optimizing/induction_var_analysis.cc
@@ -211,27 +211,30 @@
void HInductionVarAnalysis::ClassifyTrivial(HLoopInformation* loop, HInstruction* instruction) {
InductionInfo* info = nullptr;
if (instruction->IsPhi()) {
- info = TransferPhi(loop, instruction, /* input_index */ 0);
+ info = TransferPhi(loop, instruction, /*input_index*/ 0, /*adjust_input_size*/ 0);
} else if (instruction->IsAdd()) {
info = TransferAddSub(LookupInfo(loop, instruction->InputAt(0)),
LookupInfo(loop, instruction->InputAt(1)), kAdd);
} else if (instruction->IsSub()) {
info = TransferAddSub(LookupInfo(loop, instruction->InputAt(0)),
LookupInfo(loop, instruction->InputAt(1)), kSub);
+ } else if (instruction->IsNeg()) {
+ info = TransferNeg(LookupInfo(loop, instruction->InputAt(0)));
} else if (instruction->IsMul()) {
info = TransferMul(LookupInfo(loop, instruction->InputAt(0)),
LookupInfo(loop, instruction->InputAt(1)));
} else if (instruction->IsShl()) {
- info = TransferShl(LookupInfo(loop, instruction->InputAt(0)),
- LookupInfo(loop, instruction->InputAt(1)),
- instruction->InputAt(0)->GetType());
- } else if (instruction->IsNeg()) {
- info = TransferNeg(LookupInfo(loop, instruction->InputAt(0)));
+ HInstruction* mulc = GetShiftConstant(loop, instruction, /*initial*/ nullptr);
+ if (mulc != nullptr) {
+ info = TransferMul(LookupInfo(loop, instruction->InputAt(0)),
+ LookupInfo(loop, mulc));
+ }
+ } else if (instruction->IsSelect()) {
+ info = TransferPhi(loop, instruction, /*input_index*/ 0, /*adjust_input_size*/ 1);
} else if (instruction->IsTypeConversion()) {
info = TransferCnv(LookupInfo(loop, instruction->InputAt(0)),
instruction->AsTypeConversion()->GetInputType(),
instruction->AsTypeConversion()->GetResultType());
-
} else if (instruction->IsBoundsCheck()) {
info = LookupInfo(loop, instruction->InputAt(0)); // Pass-through.
}
@@ -269,9 +272,14 @@
// Singleton is wrap-around induction if all internal links have the same meaning.
if (size == 1) {
- InductionInfo* update = TransferPhi(loop, phi, /* input_index */ 1);
+ InductionInfo* update = TransferPhi(loop, phi, /*input_index*/ 1, /*adjust_input_size*/ 0);
if (update != nullptr) {
- AssignInfo(loop, phi, CreateInduction(kWrapAround, initial, update, type_));
+ AssignInfo(loop, phi, CreateInduction(kWrapAround,
+ kNop,
+ initial,
+ update,
+ /*fetch*/ nullptr,
+ type_));
}
return;
}
@@ -289,12 +297,34 @@
} else if (instruction->IsSub()) {
update = SolveAddSub(
loop, phi, instruction, instruction->InputAt(0), instruction->InputAt(1), kSub, true);
+ } else if (instruction->IsMul()) {
+ update = SolveOp(
+ loop, phi, instruction, instruction->InputAt(0), instruction->InputAt(1), kMul);
+ } else if (instruction->IsDiv()) {
+ update = SolveOp(
+ loop, phi, instruction, instruction->InputAt(0), instruction->InputAt(1), kDiv);
+ } else if (instruction->IsRem()) {
+ update = SolveOp(
+ loop, phi, instruction, instruction->InputAt(0), instruction->InputAt(1), kRem);
+ } else if (instruction->IsShl()) {
+ HInstruction* mulc = GetShiftConstant(loop, instruction, /*initial*/ nullptr);
+ if (mulc != nullptr) {
+ update = SolveOp(loop, phi, instruction, instruction->InputAt(0), mulc, kMul);
+ }
+ } else if (instruction->IsShr() || instruction->IsUShr()) {
+ HInstruction* divc = GetShiftConstant(loop, instruction, initial);
+ if (divc != nullptr) {
+ update = SolveOp(loop, phi, instruction, instruction->InputAt(0), divc, kDiv);
+ }
} else if (instruction->IsXor()) {
- update = SolveXor(loop, phi, instruction, instruction->InputAt(0), instruction->InputAt(1));
+ update = SolveOp(
+ loop, phi, instruction, instruction->InputAt(0), instruction->InputAt(1), kXor);
} else if (instruction->IsEqual()) {
update = SolveTest(loop, phi, instruction, 0);
} else if (instruction->IsNotEqual()) {
update = SolveTest(loop, phi, instruction, 1);
+ } else if (instruction->IsSelect()) {
+ update = SolvePhi(instruction, /*input_index*/ 0, /*adjust_input_size*/ 1); // acts like Phi
} else if (instruction->IsTypeConversion()) {
update = SolveCnv(instruction->AsTypeConversion());
}
@@ -305,13 +335,19 @@
}
// Success if all internal links received the same temporary meaning.
- InductionInfo* induction = SolvePhi(phi, /* input_index */ 1);
+ InductionInfo* induction = SolvePhi(phi, /*input_index*/ 1, /*adjust_input_size*/ 0);
if (induction != nullptr) {
switch (induction->induction_class) {
case kInvariant:
+ // Construct combined stride of the linear induction.
+ induction = CreateInduction(kLinear, kNop, induction, initial, /*fetch*/ nullptr, type_);
+ FALLTHROUGH_INTENDED;
+ case kPolynomial:
+ case kGeometric:
+ case kWrapAround:
// Classify first phi and then the rest of the cycle "on-demand".
// Statements are scanned in order.
- AssignInfo(loop, phi, CreateInduction(kLinear, induction, initial, type_));
+ AssignInfo(loop, phi, induction);
for (size_t i = 1; i < size; i++) {
ClassifyTrivial(loop, scc_[i]);
}
@@ -341,20 +377,30 @@
// (b, c, d, e, a)
// in preparation of assigning this to the previous variable in the sequence.
if (induction->induction_class == kInvariant) {
- return CreateInduction(kPeriodic, induction, last, type_);
+ return CreateInduction(kPeriodic,
+ kNop,
+ induction,
+ last,
+ /*fetch*/ nullptr,
+ type_);
}
- return CreateInduction(
- kPeriodic, induction->op_a, RotatePeriodicInduction(induction->op_b, last), type_);
+ return CreateInduction(kPeriodic,
+ kNop,
+ induction->op_a,
+ RotatePeriodicInduction(induction->op_b, last),
+ /*fetch*/ nullptr,
+ type_);
}
HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::TransferPhi(HLoopInformation* loop,
HInstruction* phi,
- size_t input_index) {
+ size_t input_index,
+ size_t adjust_input_size) {
// Match all phi inputs from input_index onwards exactly.
HInputsRef inputs = phi->GetInputs();
DCHECK_LT(input_index, inputs.size());
InductionInfo* a = LookupInfo(loop, inputs[input_index]);
- for (size_t i = input_index + 1; i < inputs.size(); i++) {
+ for (size_t i = input_index + 1, n = inputs.size() - adjust_input_size; i < n; i++) {
InductionInfo* b = LookupInfo(loop, inputs[i]);
if (!InductionEqual(a, b)) {
return nullptr;
@@ -366,36 +412,56 @@
HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::TransferAddSub(InductionInfo* a,
InductionInfo* b,
InductionOp op) {
- // Transfer over an addition or subtraction: any invariant, linear, wrap-around, or periodic
- // can be combined with an invariant to yield a similar result. Even two linear inputs can
- // be combined. All other combinations fail, however.
+ // Transfer over an addition or subtraction: any invariant, linear, polynomial, geometric,
+ // wrap-around, or periodic can be combined with an invariant to yield a similar result.
+ // Two linear or two polynomial inputs can be combined too. Other combinations fail.
if (a != nullptr && b != nullptr) {
type_ = Narrowest(type_, Narrowest(a->type, b->type));
if (a->induction_class == kInvariant && b->induction_class == kInvariant) {
return CreateInvariantOp(op, a, b);
- } else if (a->induction_class == kLinear && b->induction_class == kLinear) {
- return CreateInduction(kLinear,
+ } else if ((a->induction_class == kLinear && b->induction_class == kLinear) ||
+ (a->induction_class == kPolynomial && b->induction_class == kPolynomial)) {
+ return CreateInduction(a->induction_class,
+ a->operation,
TransferAddSub(a->op_a, b->op_a, op),
TransferAddSub(a->op_b, b->op_b, op),
+ /*fetch*/ nullptr,
type_);
} else if (a->induction_class == kInvariant) {
InductionInfo* new_a = b->op_a;
InductionInfo* new_b = TransferAddSub(a, b->op_b, op);
- if (b->induction_class != kLinear) {
- DCHECK(b->induction_class == kWrapAround || b->induction_class == kPeriodic);
+ if (b->induction_class == kWrapAround || b->induction_class == kPeriodic) {
new_a = TransferAddSub(a, new_a, op);
} else if (op == kSub) { // Negation required.
new_a = TransferNeg(new_a);
}
- return CreateInduction(b->induction_class, new_a, new_b, type_);
+ return CreateInduction(b->induction_class, b->operation, new_a, new_b, b->fetch, type_);
} else if (b->induction_class == kInvariant) {
InductionInfo* new_a = a->op_a;
InductionInfo* new_b = TransferAddSub(a->op_b, b, op);
- if (a->induction_class != kLinear) {
- DCHECK(a->induction_class == kWrapAround || a->induction_class == kPeriodic);
+ if (a->induction_class == kWrapAround || a->induction_class == kPeriodic) {
new_a = TransferAddSub(new_a, b, op);
}
- return CreateInduction(a->induction_class, new_a, new_b, type_);
+ return CreateInduction(a->induction_class, a->operation, new_a, new_b, a->fetch, type_);
+ }
+ }
+ return nullptr;
+}
+
+HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::TransferNeg(InductionInfo* a) {
+ // Transfer over a unary negation: an invariant, linear, polynomial, geometric (mul),
+ // wrap-around, or periodic input yields a similar but negated induction as result.
+ if (a != nullptr) {
+ type_ = Narrowest(type_, a->type);
+ if (a->induction_class == kInvariant) {
+ return CreateInvariantOp(kNeg, nullptr, a);
+ } else if (a->induction_class != kGeometric || a->operation == kMul) {
+ return CreateInduction(a->induction_class,
+ a->operation,
+ TransferNeg(a->op_a),
+ TransferNeg(a->op_b),
+ a->fetch,
+ type_);
}
}
return nullptr;
@@ -403,85 +469,59 @@
HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::TransferMul(InductionInfo* a,
InductionInfo* b) {
- // Transfer over a multiplication: any invariant, linear, wrap-around, or periodic
- // can be multiplied with an invariant to yield a similar but multiplied result.
- // Two non-invariant inputs cannot be multiplied, however.
+ // Transfer over a multiplication: any invariant, linear, polynomial, geometric (mul),
+ // wrap-around, or periodic can be multiplied with an invariant to yield a similar
+ // but multiplied result. Two non-invariant inputs cannot be multiplied, however.
if (a != nullptr && b != nullptr) {
type_ = Narrowest(type_, Narrowest(a->type, b->type));
if (a->induction_class == kInvariant && b->induction_class == kInvariant) {
return CreateInvariantOp(kMul, a, b);
- } else if (a->induction_class == kInvariant) {
+ } else if (a->induction_class == kInvariant && (b->induction_class != kGeometric ||
+ b->operation == kMul)) {
return CreateInduction(b->induction_class,
+ b->operation,
TransferMul(a, b->op_a),
TransferMul(a, b->op_b),
+ b->fetch,
type_);
- } else if (b->induction_class == kInvariant) {
+ } else if (b->induction_class == kInvariant && (a->induction_class != kGeometric ||
+ a->operation == kMul)) {
return CreateInduction(a->induction_class,
+ a->operation,
TransferMul(a->op_a, b),
TransferMul(a->op_b, b),
+ a->fetch,
type_);
}
}
return nullptr;
}
-HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::TransferShl(InductionInfo* a,
- InductionInfo* b,
- Primitive::Type type) {
- // Transfer over a shift left: treat shift by restricted constant as equivalent multiplication.
- int64_t value = -1;
- if (a != nullptr && IsExact(b, &value)) {
- // Obtain the constant needed for the multiplication. This yields an existing instruction
- // if the constants is already there. Otherwise, this has a side effect on the HIR.
- // The restriction on the shift factor avoids generating a negative constant
- // (viz. 1 << 31 and 1L << 63 set the sign bit). The code assumes that generalization
- // for shift factors outside [0,32) and [0,64) ranges is done by earlier simplification.
- if ((type == Primitive::kPrimInt && 0 <= value && value < 31) ||
- (type == Primitive::kPrimLong && 0 <= value && value < 63)) {
- return TransferMul(a, CreateConstant(1 << value, type));
- }
- }
- return nullptr;
-}
-
-HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::TransferNeg(InductionInfo* a) {
- // Transfer over a unary negation: an invariant, linear, wrap-around, or periodic input
- // yields a similar but negated induction as result.
- if (a != nullptr) {
- type_ = Narrowest(type_, a->type);
- if (a->induction_class == kInvariant) {
- return CreateInvariantOp(kNeg, nullptr, a);
- }
- return CreateInduction(a->induction_class, TransferNeg(a->op_a), TransferNeg(a->op_b), type_);
- }
- return nullptr;
-}
-
HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::TransferCnv(InductionInfo* a,
Primitive::Type from,
Primitive::Type to) {
if (a != nullptr) {
- // Allow narrowing conversion in certain cases.
+ // Allow narrowing conversion on linear induction in certain cases.
if (IsNarrowingIntegralConversion(from, to)) {
if (a->induction_class == kLinear) {
if (a->type == to || (a->type == from && IsNarrowingIntegralConversion(from, to))) {
- return CreateInduction(kLinear, a->op_a, a->op_b, to);
+ return CreateInduction(kLinear, kNop, a->op_a, a->op_b, /*fetch*/ nullptr, to);
}
}
- // TODO: other cases useful too?
}
}
return nullptr;
}
HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::SolvePhi(HInstruction* phi,
- size_t input_index) {
+ size_t input_index,
+ size_t adjust_input_size) {
// Match all phi inputs from input_index onwards exactly.
HInputsRef inputs = phi->GetInputs();
DCHECK_LT(input_index, inputs.size());
auto ita = cycle_.find(inputs[input_index]);
if (ita != cycle_.end()) {
- for (size_t i = input_index + 1; i < inputs.size(); i++) {
+ for (size_t i = input_index + 1, n = inputs.size() - adjust_input_size; i < n; i++) {
auto itb = cycle_.find(inputs[i]);
if (itb == cycle_.end() ||
!HInductionVarAnalysis::InductionEqual(ita->second, itb->second)) {
@@ -498,7 +538,7 @@
HInstruction* entry_phi,
HInstruction* phi) {
// Match all phi inputs.
- InductionInfo* match = SolvePhi(phi, /* input_index */ 0);
+ InductionInfo* match = SolvePhi(phi, /*input_index*/ 0, /*adjust_input_size*/ 0);
if (match != nullptr) {
return match;
}
@@ -511,11 +551,11 @@
if (a != nullptr && a->induction_class == kInvariant) {
if (phi->InputAt(1) == entry_phi) {
InductionInfo* initial = LookupInfo(loop, entry_phi->InputAt(0));
- return CreateInduction(kPeriodic, a, initial, type_);
+ return CreateInduction(kPeriodic, kNop, a, initial, /*fetch*/ nullptr, type_);
}
- InductionInfo* b = SolvePhi(phi, /* input_index */ 1);
+ InductionInfo* b = SolvePhi(phi, /*input_index*/ 1, /*adjust_input_size*/ 0);
if (b != nullptr && b->induction_class == kPeriodic) {
- return CreateInduction(kPeriodic, a, b, type_);
+ return CreateInduction(kPeriodic, kNop, a, b, /*fetch*/ nullptr, type_);
}
}
}
@@ -529,18 +569,33 @@
HInstruction* y,
InductionOp op,
bool is_first_call) {
- // Solve within a cycle over an addition or subtraction: adding or subtracting an
- // invariant value, seeded from phi, keeps adding to the stride of the induction.
+ // Solve within a cycle over an addition or subtraction.
InductionInfo* b = LookupInfo(loop, y);
- if (b != nullptr && b->induction_class == kInvariant) {
- if (x == entry_phi) {
- return (op == kAdd) ? b : CreateInvariantOp(kNeg, nullptr, b);
- }
- auto it = cycle_.find(x);
- if (it != cycle_.end()) {
- InductionInfo* a = it->second;
- if (a->induction_class == kInvariant) {
- return CreateInvariantOp(op, a, b);
+ if (b != nullptr) {
+ if (b->induction_class == kInvariant) {
+ // Adding or subtracting an invariant value, seeded from phi,
+ // keeps adding to the stride of the linear induction.
+ if (x == entry_phi) {
+ return (op == kAdd) ? b : CreateInvariantOp(kNeg, nullptr, b);
+ }
+ auto it = cycle_.find(x);
+ if (it != cycle_.end()) {
+ InductionInfo* a = it->second;
+ if (a->induction_class == kInvariant) {
+ return CreateInvariantOp(op, a, b);
+ }
+ }
+ } else if (b->induction_class == kLinear) {
+ // Solve within a tight cycle that adds a term that is already classified as a linear
+ // induction for a polynomial induction k = k + i (represented as sum over linear terms).
+ if (x == entry_phi && entry_phi->InputCount() == 2 && instruction == entry_phi->InputAt(1)) {
+ InductionInfo* initial = LookupInfo(loop, entry_phi->InputAt(0));
+ return CreateInduction(kPolynomial,
+ kNop,
+ op == kAdd ? b : TransferNeg(b),
+ initial,
+ /*fetch*/ nullptr,
+ type_);
}
}
}
@@ -553,34 +608,77 @@
}
} else if (op == kSub) {
// Solve within a tight cycle that is formed by exactly two instructions,
- // one phi and one update, for a periodic idiom of the form k = c - k;
+ // one phi and one update, for a periodic idiom of the form k = c - k.
if (y == entry_phi && entry_phi->InputCount() == 2 && instruction == entry_phi->InputAt(1)) {
InductionInfo* a = LookupInfo(loop, x);
if (a != nullptr && a->induction_class == kInvariant) {
InductionInfo* initial = LookupInfo(loop, entry_phi->InputAt(0));
- return CreateInduction(kPeriodic, CreateInvariantOp(kSub, a, initial), initial, type_);
+ return CreateInduction(kPeriodic,
+ kNop,
+ CreateInvariantOp(kSub, a, initial),
+ initial,
+ /*fetch*/ nullptr,
+ type_);
}
}
}
-
return nullptr;
}
-HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::SolveXor(HLoopInformation* loop,
+HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::SolveOp(HLoopInformation* loop,
HInstruction* entry_phi,
HInstruction* instruction,
HInstruction* x,
- HInstruction* y) {
- // Solve within a tight cycle on x = c ^ x or x = x ^ c.
+ HInstruction* y,
+ InductionOp op) {
+ // Solve within a tight cycle for a binary operation k = k op c or, for some op, k = c op k.
if (entry_phi->InputCount() == 2 && instruction == entry_phi->InputAt(1)) {
- InductionInfo* initial = LookupInfo(loop, entry_phi->InputAt(0));
- InductionInfo* a = LookupInfo(loop, x);
- if (a != nullptr && a->induction_class == kInvariant && entry_phi == y) {
- return CreateInduction(kPeriodic, CreateInvariantOp(kXor, a, initial), initial, type_);
- }
+ InductionInfo* c = nullptr;
InductionInfo* b = LookupInfo(loop, y);
if (b != nullptr && b->induction_class == kInvariant && entry_phi == x) {
- return CreateInduction(kPeriodic, CreateInvariantOp(kXor, initial, b), initial, type_);
+ c = b;
+ } else if (op != kDiv && op != kRem) {
+ InductionInfo* a = LookupInfo(loop, x);
+ if (a != nullptr && a->induction_class == kInvariant && entry_phi == y) {
+ c = a;
+ }
+ }
+ // Found suitable operand left or right?
+ if (c != nullptr) {
+ InductionInfo* initial = LookupInfo(loop, entry_phi->InputAt(0));
+ switch (op) {
+ case kMul:
+ case kDiv:
+ // Restrict base of geometric induction to direct fetch.
+ if (c->operation == kFetch) {
+ return CreateInduction(kGeometric,
+ op,
+ initial,
+ CreateConstant(0, type_),
+ c->fetch,
+ type_);
+ };
+ break;
+ case kRem:
+ // Idiomatic MOD wrap-around induction.
+ return CreateInduction(kWrapAround,
+ kNop,
+ initial,
+ CreateInvariantOp(kRem, initial, c),
+ /*fetch*/ nullptr,
+ type_);
+ case kXor:
+ // Idiomatic XOR periodic induction.
+ return CreateInduction(kPeriodic,
+ kNop,
+ CreateInvariantOp(kXor, initial, c),
+ initial,
+ /*fetch*/ nullptr,
+ type_);
+ default:
+ CHECK(false) << op;
+ break;
+ }
}
}
return nullptr;
@@ -590,14 +688,14 @@
HInstruction* entry_phi,
HInstruction* instruction,
int64_t opposite_value) {
- // Detect hidden XOR construction in tight cycles on x = (x == 0) or x = (x != 1).
+ // Detect hidden XOR construction in x = (x == false) or x = (x != true).
int64_t value = -1;
HInstruction* x = instruction->InputAt(0);
HInstruction* y = instruction->InputAt(1);
if (IsExact(LookupInfo(loop, x), &value) && value == opposite_value) {
- return SolveXor(loop, entry_phi, instruction, graph_->GetIntConstant(1), y);
+ return SolveOp(loop, entry_phi, instruction, graph_->GetIntConstant(1), y, kXor);
} else if (IsExact(LookupInfo(loop, y), &value) && value == opposite_value) {
- return SolveXor(loop, entry_phi, instruction, x, graph_->GetIntConstant(1));
+ return SolveOp(loop, entry_phi, instruction, x, graph_->GetIntConstant(1), kXor);
}
return nullptr;
}
@@ -881,11 +979,14 @@
HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::CreateConstant(int64_t value,
Primitive::Type type) {
- if (type == Primitive::kPrimInt) {
- return CreateInvariantFetch(graph_->GetIntConstant(value));
+ HInstruction* constant;
+ switch (type) {
+ case Primitive::kPrimDouble: constant = graph_->GetDoubleConstant(value); break;
+ case Primitive::kPrimFloat: constant = graph_->GetFloatConstant(value); break;
+ case Primitive::kPrimLong: constant = graph_->GetLongConstant(value); break;
+ default: constant = graph_->GetIntConstant(value); break;
}
- DCHECK_EQ(type, Primitive::kPrimLong);
- return CreateInvariantFetch(graph_->GetLongConstant(value));
+ return CreateInvariantFetch(constant);
}
HInductionVarAnalysis::InductionInfo* HInductionVarAnalysis::CreateSimplifiedInvariant(
@@ -948,6 +1049,36 @@
return new (graph_->GetArena()) InductionInfo(kInvariant, op, a, b, nullptr, b->type);
}
+HInstruction* HInductionVarAnalysis::GetShiftConstant(HLoopInformation* loop,
+ HInstruction* instruction,
+ InductionInfo* initial) {
+ DCHECK(instruction->IsShl() || instruction->IsShr() || instruction->IsUShr());
+ // Shift-rights are only the same as division for non-negative initial inputs.
+ // Otherwise we would round incorrectly.
+ if (initial != nullptr) {
+ int64_t value = -1;
+ if (!IsAtLeast(initial, &value) || value < 0) {
+ return nullptr;
+ }
+ }
+ // Obtain the constant needed to treat shift as equivalent multiplication or division.
+ // This yields an existing instruction if the constant is already there. Otherwise, this
+ // has a side effect on the HIR. The restriction on the shift factor avoids generating a
+ // negative constant (viz. 1 << 31 and 1L << 63 set the sign bit). The code assumes that
+ // generalization for shift factors outside [0,32) and [0,64) ranges is done earlier.
+ InductionInfo* b = LookupInfo(loop, instruction->InputAt(1));
+ int64_t value = -1;
+ if (IsExact(b, &value)) {
+ Primitive::Type type = instruction->InputAt(0)->GetType();
+ if (type == Primitive::kPrimInt && 0 <= value && value < 31) {
+ return graph_->GetIntConstant(1 << value);
+ }
+ if (type == Primitive::kPrimLong && 0 <= value && value < 63) {
+ return graph_->GetLongConstant(1L << value);
+ }
+ }
+ return nullptr;
+}
void HInductionVarAnalysis::AssignCycle(HPhi* phi) {
ArenaSet<HInstruction*>* set = &cycles_.Put(phi, ArenaSet<HInstruction*>(
@@ -993,6 +1124,16 @@
return info1 == info2;
}
+std::string HInductionVarAnalysis::FetchToString(HInstruction* fetch) {
+ DCHECK(fetch != nullptr);
+ if (fetch->IsIntConstant()) {
+ return std::to_string(fetch->AsIntConstant()->GetValue());
+ } else if (fetch->IsLongConstant()) {
+ return std::to_string(fetch->AsLongConstant()->GetValue());
+ }
+ return std::to_string(fetch->GetId()) + ":" + fetch->DebugName();
+}
+
std::string HInductionVarAnalysis::InductionToString(InductionInfo* info) {
if (info != nullptr) {
if (info->induction_class == kInvariant) {
@@ -1005,21 +1146,13 @@
case kNeg: inv += " - "; break;
case kMul: inv += " * "; break;
case kDiv: inv += " / "; break;
+ case kRem: inv += " % "; break;
case kXor: inv += " ^ "; break;
case kLT: inv += " < "; break;
case kLE: inv += " <= "; break;
case kGT: inv += " > "; break;
case kGE: inv += " >= "; break;
- case kFetch:
- DCHECK(info->fetch);
- if (info->fetch->IsIntConstant()) {
- inv += std::to_string(info->fetch->AsIntConstant()->GetValue());
- } else if (info->fetch->IsLongConstant()) {
- inv += std::to_string(info->fetch->AsLongConstant()->GetValue());
- } else {
- inv += std::to_string(info->fetch->GetId()) + ":" + info->fetch->DebugName();
- }
- break;
+ case kFetch: inv += FetchToString(info->fetch); break;
case kTripCountInLoop: inv += " (TC-loop) "; break;
case kTripCountInBody: inv += " (TC-body) "; break;
case kTripCountInLoopUnsafe: inv += " (TC-loop-unsafe) "; break;
@@ -1029,16 +1162,31 @@
inv += ")";
return inv;
} else {
- DCHECK(info->operation == kNop);
if (info->induction_class == kLinear) {
+ DCHECK(info->operation == kNop);
return "(" + InductionToString(info->op_a) + " * i + " +
InductionToString(info->op_b) + "):" +
Primitive::PrettyDescriptor(info->type);
+ } else if (info->induction_class == kPolynomial) {
+ DCHECK(info->operation == kNop);
+ return "poly(sum_lt(" + InductionToString(info->op_a) + ") + " +
+ InductionToString(info->op_b) + "):" +
+ Primitive::PrettyDescriptor(info->type);
+ } else if (info->induction_class == kGeometric) {
+ DCHECK(info->operation == kMul || info->operation == kDiv);
+ DCHECK(info->fetch != nullptr);
+ return "geo(" + InductionToString(info->op_a) + " * " +
+ FetchToString(info->fetch) +
+ (info->operation == kMul ? " ^ i + " : " ^ -i + ") +
+ InductionToString(info->op_b) + "):" +
+ Primitive::PrettyDescriptor(info->type);
} else if (info->induction_class == kWrapAround) {
+ DCHECK(info->operation == kNop);
return "wrap(" + InductionToString(info->op_a) + ", " +
InductionToString(info->op_b) + "):" +
Primitive::PrettyDescriptor(info->type);
} else if (info->induction_class == kPeriodic) {
+ DCHECK(info->operation == kNop);
return "periodic(" + InductionToString(info->op_a) + ", " +
InductionToString(info->op_b) + "):" +
Primitive::PrettyDescriptor(info->type);
diff --git a/compiler/optimizing/induction_var_analysis.h b/compiler/optimizing/induction_var_analysis.h
index 7027179..293aa70 100644
--- a/compiler/optimizing/induction_var_analysis.h
+++ b/compiler/optimizing/induction_var_analysis.h
@@ -51,19 +51,21 @@
enum InductionClass {
kInvariant,
kLinear,
+ kPolynomial,
+ kGeometric,
kWrapAround,
kPeriodic
};
enum InductionOp {
- // No-operation: a true induction.
+ // Operations.
kNop,
- // Various invariant operations.
kAdd,
kSub,
kNeg,
kMul,
kDiv,
+ kRem,
kXor,
kFetch,
// Trip-counts.
@@ -81,16 +83,18 @@
/**
* Defines a detected induction as:
* (1) invariant:
- * operation: a + b, a - b, -b, a * b, a / b
- * or:
- * fetch: fetch from HIR
+ * op: a + b, a - b, -b, a * b, a / b, a % b, a ^ b, fetch
* (2) linear:
* nop: a * i + b
- * (3) wrap-around
+ * (3) polynomial:
+ * nop: sum_lt(a) + b, for linear a
+ * (4) geometric:
+ * op: a * fetch^i + b, a * fetch^-i + b
+ * (5) wrap-around
* nop: a, then defined by b
- * (4) periodic
+ * (6) periodic
* nop: a, then defined by b (repeated when exhausted)
- * (5) trip-count:
+ * (7) trip-count:
* tc: defined by a, taken-test in b
*/
struct InductionInfo : public ArenaObject<kArenaAllocInductionVarAnalysis> {
@@ -111,7 +115,7 @@
InductionInfo* op_a;
InductionInfo* op_b;
HInstruction* fetch;
- Primitive::Type type; // precision of induction
+ Primitive::Type type; // precision of operation
};
bool IsVisitedNode(HInstruction* instruction) const {
@@ -138,11 +142,13 @@
}
InductionInfo* CreateInduction(InductionClass ic,
+ InductionOp op,
InductionInfo* a,
InductionInfo* b,
+ HInstruction* f,
Primitive::Type type) {
DCHECK(a != nullptr && b != nullptr);
- return new (graph_->GetArena()) InductionInfo(ic, kNop, a, b, nullptr, type);
+ return new (graph_->GetArena()) InductionInfo(ic, op, a, b, f, type);
}
// Methods for analysis.
@@ -154,15 +160,17 @@
InductionInfo* RotatePeriodicInduction(InductionInfo* induction, InductionInfo* last);
// Transfer operations.
- InductionInfo* TransferPhi(HLoopInformation* loop, HInstruction* phi, size_t input_index);
+ InductionInfo* TransferPhi(HLoopInformation* loop,
+ HInstruction* phi,
+ size_t input_index,
+ size_t adjust_input_size);
InductionInfo* TransferAddSub(InductionInfo* a, InductionInfo* b, InductionOp op);
- InductionInfo* TransferMul(InductionInfo* a, InductionInfo* b);
- InductionInfo* TransferShl(InductionInfo* a, InductionInfo* b, Primitive::Type type);
InductionInfo* TransferNeg(InductionInfo* a);
+ InductionInfo* TransferMul(InductionInfo* a, InductionInfo* b);
InductionInfo* TransferCnv(InductionInfo* a, Primitive::Type from, Primitive::Type to);
// Solvers.
- InductionInfo* SolvePhi(HInstruction* phi, size_t input_index);
+ InductionInfo* SolvePhi(HInstruction* phi, size_t input_index, size_t adjust_input_size);
InductionInfo* SolvePhiAllInputs(HLoopInformation* loop,
HInstruction* entry_phi,
HInstruction* phi);
@@ -173,11 +181,12 @@
HInstruction* y,
InductionOp op,
bool is_first_call); // possibly swaps x and y to try again
- InductionInfo* SolveXor(HLoopInformation* loop,
- HInstruction* entry_phi,
- HInstruction* instruction,
- HInstruction* x,
- HInstruction* y);
+ InductionInfo* SolveOp(HLoopInformation* loop,
+ HInstruction* entry_phi,
+ HInstruction* instruction,
+ HInstruction* x,
+ HInstruction* y,
+ InductionOp op);
InductionInfo* SolveTest(HLoopInformation* loop,
HInstruction* entry_phi,
HInstruction* instruction,
@@ -214,6 +223,9 @@
InductionInfo* LookupInfo(HLoopInformation* loop, HInstruction* instruction);
InductionInfo* CreateConstant(int64_t value, Primitive::Type type);
InductionInfo* CreateSimplifiedInvariant(InductionOp op, InductionInfo* a, InductionInfo* b);
+ HInstruction* GetShiftConstant(HLoopInformation* loop,
+ HInstruction* instruction,
+ InductionInfo* initial);
void AssignCycle(HPhi* phi);
ArenaSet<HInstruction*>* LookupCycle(HPhi* phi);
@@ -224,6 +236,7 @@
// Helpers.
static bool InductionEqual(InductionInfo* info1, InductionInfo* info2);
+ static std::string FetchToString(HInstruction* fetch);
static std::string InductionToString(InductionInfo* info);
// TODO: fine tune the following data structures, only keep relevant data.
diff --git a/compiler/optimizing/induction_var_analysis_test.cc b/compiler/optimizing/induction_var_analysis_test.cc
index 031f1d7..f52a1aa 100644
--- a/compiler/optimizing/induction_var_analysis_test.cc
+++ b/compiler/optimizing/induction_var_analysis_test.cc
@@ -80,11 +80,14 @@
// Provide entry and exit instructions.
parameter_ = new (&allocator_) HParameterValue(
- graph_->GetDexFile(), 0, 0, Primitive::kPrimNot, true);
+ graph_->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot, true);
entry_->AddInstruction(parameter_);
constant0_ = graph_->GetIntConstant(0);
constant1_ = graph_->GetIntConstant(1);
+ constant2_ = graph_->GetIntConstant(2);
+ constant7_ = graph_->GetIntConstant(7);
constant100_ = graph_->GetIntConstant(100);
+ constantm1_ = graph_->GetIntConstant(-1);
float_constant0_ = graph_->GetFloatConstant(0.0f);
return_->AddInstruction(new (&allocator_) HReturnVoid());
exit_->AddInstruction(new (&allocator_) HExit());
@@ -191,7 +194,10 @@
HInstruction* parameter_; // "this"
HInstruction* constant0_;
HInstruction* constant1_;
+ HInstruction* constant2_;
+ HInstruction* constant7_;
HInstruction* constant100_;
+ HInstruction* constantm1_;
HInstruction* float_constant0_;
// Loop specifics.
@@ -252,11 +258,11 @@
TEST_F(InductionVarAnalysisTest, FindDerivedInduction) {
// Setup:
// for (int i = 0; i < 100; i++) {
- // k = 100 + i;
- // k = 100 - i;
- // k = 100 * i;
- // k = i << 1;
- // k = - i;
+ // t = 100 + i;
+ // t = 100 - i;
+ // t = 100 * i;
+ // t = i << 1;
+ // t = - i;
// }
BuildLoopNest(1);
HInstruction* add = InsertInstruction(
@@ -288,18 +294,20 @@
// a[k] = 0;
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant0_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant0_);
HInstruction* add = InsertInstruction(
- new (&allocator_) HAdd(Primitive::kPrimInt, k, constant100_), 0);
+ new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant100_), 0);
HInstruction* store1 = InsertArrayStore(add, 0);
HInstruction* sub = InsertInstruction(
new (&allocator_) HSub(Primitive::kPrimInt, add, constant1_), 0);
HInstruction* store2 = InsertArrayStore(sub, 0);
- k->AddInput(sub);
+ k_header->AddInput(sub);
PerformInductionVarAnalysis();
+ EXPECT_STREQ("(((100) - (1)) * i + (0)):PrimInt",
+ GetInductionInfo(k_header, 0).c_str());
EXPECT_STREQ("(((100) - (1)) * i + (100)):PrimInt",
GetInductionInfo(store1->InputAt(1), 0).c_str());
EXPECT_STREQ("(((100) - (1)) * i + ((100) - (1))):PrimInt",
@@ -335,6 +343,7 @@
k_header->AddInput(k_body);
PerformInductionVarAnalysis();
+ EXPECT_STREQ("((1) * i + (0)):PrimInt", GetInductionInfo(k_header, 0).c_str());
EXPECT_STREQ("((1) * i + (1)):PrimInt", GetInductionInfo(store->InputAt(1), 0).c_str());
// Both increments get same induction.
@@ -367,6 +376,321 @@
PerformInductionVarAnalysis();
EXPECT_STREQ("((1) * i + (1)):PrimInt", GetInductionInfo(store->InputAt(1), 0).c_str());
+
+ // Both increments get same induction.
+ EXPECT_TRUE(HaveSameInduction(store->InputAt(1), inc1));
+ EXPECT_TRUE(HaveSameInduction(store->InputAt(1), inc2));
+}
+
+TEST_F(InductionVarAnalysisTest, AddLinear) {
+ // Setup:
+ // for (int i = 0; i < 100; i++) {
+ // t1 = i + i;
+ // t2 = 7 + i;
+ // t3 = t1 + t2;
+ // }
+ BuildLoopNest(1);
+
+ HInstruction* add1 = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, basic_[0], basic_[0]), 0);
+ HInstruction* add2 = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, constant7_, basic_[0]), 0);
+ HInstruction* add3 = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, add1, add2), 0);
+ PerformInductionVarAnalysis();
+
+ EXPECT_STREQ("((1) * i + (0)):PrimInt", GetInductionInfo(basic_[0], 0).c_str());
+ EXPECT_STREQ("(((1) + (1)) * i + (0)):PrimInt", GetInductionInfo(add1, 0).c_str());
+ EXPECT_STREQ("((1) * i + (7)):PrimInt", GetInductionInfo(add2, 0).c_str());
+ EXPECT_STREQ("((((1) + (1)) + (1)) * i + (7)):PrimInt", GetInductionInfo(add3, 0).c_str());
+}
+
+TEST_F(InductionVarAnalysisTest, FindPolynomialInduction) {
+ // Setup:
+ // k = 1;
+ // for (int i = 0; i < 100; i++) {
+ // t = i * 2;
+ // t = 100 + t
+ // k = t + k; // polynomial
+ // }
+ BuildLoopNest(1);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant1_);
+
+ HInstruction* mul = InsertInstruction(
+ new (&allocator_) HMul(Primitive::kPrimInt, basic_[0], constant2_), 0);
+ HInstruction* add = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, constant100_, mul), 0);
+ HInstruction* pol = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, add, k_header), 0);
+ k_header->AddInput(pol);
+ PerformInductionVarAnalysis();
+
+ // Note, only the phi in the cycle and the base linear induction are classified.
+ EXPECT_STREQ("poly(sum_lt(((2) * i + (100)):PrimInt) + (1)):PrimInt",
+ GetInductionInfo(k_header, 0).c_str());
+ EXPECT_STREQ("((2) * i + (100)):PrimInt", GetInductionInfo(add, 0).c_str());
+ EXPECT_STREQ("", GetInductionInfo(pol, 0).c_str());
+}
+
+TEST_F(InductionVarAnalysisTest, FindPolynomialInductionAndDerived) {
+ // Setup:
+ // k = 1;
+ // for (int i = 0; i < 100; i++) {
+ // t = k + 100;
+ // t = k - 1;
+ // t = - t
+ // t = k * 2;
+ // t = k << 2;
+ // k = k + i; // polynomial
+ // }
+ BuildLoopNest(1);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant1_);
+
+ HInstruction* add = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant100_), 0);
+ HInstruction* sub = InsertInstruction(
+ new (&allocator_) HSub(Primitive::kPrimInt, k_header, constant1_), 0);
+ HInstruction* neg = InsertInstruction(
+ new (&allocator_) HNeg(Primitive::kPrimInt, sub), 0);
+ HInstruction* mul = InsertInstruction(
+ new (&allocator_) HMul(Primitive::kPrimInt, k_header, constant2_), 0);
+ HInstruction* shl = InsertInstruction(
+ new (&allocator_) HShl(Primitive::kPrimInt, k_header, constant2_), 0);
+ HInstruction* pol = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, k_header, basic_[0]), 0);
+ k_header->AddInput(pol);
+ PerformInductionVarAnalysis();
+
+ // Note, only the phi in the cycle and derived are classified.
+ EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):PrimInt) + (1)):PrimInt",
+ GetInductionInfo(k_header, 0).c_str());
+ EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):PrimInt) + ((1) + (100))):PrimInt",
+ GetInductionInfo(add, 0).c_str());
+ EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):PrimInt) + ((1) - (1))):PrimInt",
+ GetInductionInfo(sub, 0).c_str());
+ EXPECT_STREQ("poly(sum_lt((( - (1)) * i + (0)):PrimInt) + ((1) - (1))):PrimInt",
+ GetInductionInfo(neg, 0).c_str());
+ EXPECT_STREQ("poly(sum_lt(((2) * i + (0)):PrimInt) + (2)):PrimInt",
+ GetInductionInfo(mul, 0).c_str());
+ EXPECT_STREQ("poly(sum_lt(((4) * i + (0)):PrimInt) + (4)):PrimInt",
+ GetInductionInfo(shl, 0).c_str());
+ EXPECT_STREQ("", GetInductionInfo(pol, 0).c_str());
+}
+
+TEST_F(InductionVarAnalysisTest, AddPolynomial) {
+ // Setup:
+ // k = 7;
+ // for (int i = 0; i < 100; i++) {
+ // t = k + k;
+ // t = t + k;
+ // k = k + i
+ // }
+ BuildLoopNest(1);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant7_);
+
+ HInstruction* add1 = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, k_header, k_header), 0);
+ HInstruction* add2 = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, add1, k_header), 0);
+ HInstruction* add3 = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, k_header, basic_[0]), 0);
+ k_header->AddInput(add3);
+ PerformInductionVarAnalysis();
+
+ // Note, only the phi in the cycle and added-derived are classified.
+ EXPECT_STREQ("poly(sum_lt(((1) * i + (0)):PrimInt) + (7)):PrimInt",
+ GetInductionInfo(k_header, 0).c_str());
+ EXPECT_STREQ("poly(sum_lt((((1) + (1)) * i + (0)):PrimInt) + ((7) + (7))):PrimInt",
+ GetInductionInfo(add1, 0).c_str());
+ EXPECT_STREQ(
+ "poly(sum_lt(((((1) + (1)) + (1)) * i + (0)):PrimInt) + (((7) + (7)) + (7))):PrimInt",
+ GetInductionInfo(add2, 0).c_str());
+ EXPECT_STREQ("", GetInductionInfo(add3, 0).c_str());
+}
+
+TEST_F(InductionVarAnalysisTest, FindGeometricMulInduction) {
+ // Setup:
+ // k = 1;
+ // for (int i = 0; i < 100; i++) {
+ // k = k * 100; // geometric (x 100)
+ // }
+ BuildLoopNest(1);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant1_);
+
+ HInstruction* mul = InsertInstruction(
+ new (&allocator_) HMul(Primitive::kPrimInt, k_header, constant100_), 0);
+ k_header->AddInput(mul);
+ PerformInductionVarAnalysis();
+
+ EXPECT_STREQ("geo((1) * 100 ^ i + (0)):PrimInt", GetInductionInfo(k_header, 0).c_str());
+ EXPECT_STREQ("geo((100) * 100 ^ i + (0)):PrimInt", GetInductionInfo(mul, 0).c_str());
+}
+
+TEST_F(InductionVarAnalysisTest, FindGeometricShlInductionAndDerived) {
+ // Setup:
+ // k = 1;
+ // for (int i = 0; i < 100; i++) {
+ // t = k + 1;
+ // k = k << 1; // geometric (x 2)
+ // t = k + 100;
+ // t = k - 1;
+ // t = - t;
+ // t = k * 2;
+ // t = k << 2;
+ // }
+ BuildLoopNest(1);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant1_);
+
+ HInstruction* add1 = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant1_), 0);
+ HInstruction* shl1 = InsertInstruction(
+ new (&allocator_) HShl(Primitive::kPrimInt, k_header, constant1_), 0);
+ HInstruction* add2 = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, shl1, constant100_), 0);
+ HInstruction* sub = InsertInstruction(
+ new (&allocator_) HSub(Primitive::kPrimInt, shl1, constant1_), 0);
+ HInstruction* neg = InsertInstruction(
+ new (&allocator_) HNeg(Primitive::kPrimInt, sub), 0);
+ HInstruction* mul = InsertInstruction(
+ new (&allocator_) HMul(Primitive::kPrimInt, shl1, constant2_), 0);
+ HInstruction* shl2 = InsertInstruction(
+ new (&allocator_) HShl(Primitive::kPrimInt, shl1, constant2_), 0);
+ k_header->AddInput(shl1);
+ PerformInductionVarAnalysis();
+
+ EXPECT_STREQ("geo((1) * 2 ^ i + (0)):PrimInt", GetInductionInfo(k_header, 0).c_str());
+ EXPECT_STREQ("geo((1) * 2 ^ i + (1)):PrimInt", GetInductionInfo(add1, 0).c_str());
+ EXPECT_STREQ("geo((2) * 2 ^ i + (0)):PrimInt", GetInductionInfo(shl1, 0).c_str());
+ EXPECT_STREQ("geo((2) * 2 ^ i + (100)):PrimInt", GetInductionInfo(add2, 0).c_str());
+ EXPECT_STREQ("geo((2) * 2 ^ i + ((0) - (1))):PrimInt", GetInductionInfo(sub, 0).c_str());
+ EXPECT_STREQ("geo(( - (2)) * 2 ^ i + ( - ((0) - (1)))):PrimInt",
+ GetInductionInfo(neg, 0).c_str());
+ EXPECT_STREQ("geo(((2) * (2)) * 2 ^ i + (0)):PrimInt", GetInductionInfo(mul, 0).c_str());
+ EXPECT_STREQ("geo(((2) * (4)) * 2 ^ i + (0)):PrimInt", GetInductionInfo(shl2, 0).c_str());
+}
+
+TEST_F(InductionVarAnalysisTest, FindGeometricDivInductionAndDerived) {
+ // Setup:
+ // k = 1;
+ // for (int i = 0; i < 100; i++) {
+ // t = k + 100;
+ // t = k - 1;
+ // t = - t
+ // t = k * 2;
+ // t = k << 2;
+ // k = k / 100; // geometric (/ 100)
+ // }
+ BuildLoopNest(1);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant1_);
+
+ HInstruction* add = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant100_), 0);
+ HInstruction* sub = InsertInstruction(
+ new (&allocator_) HSub(Primitive::kPrimInt, k_header, constant1_), 0);
+ HInstruction* neg = InsertInstruction(
+ new (&allocator_) HNeg(Primitive::kPrimInt, sub), 0);
+ HInstruction* mul = InsertInstruction(
+ new (&allocator_) HMul(Primitive::kPrimInt, k_header, constant2_), 0);
+ HInstruction* shl = InsertInstruction(
+ new (&allocator_) HShl(Primitive::kPrimInt, k_header, constant2_), 0);
+ HInstruction* div = InsertInstruction(
+ new (&allocator_) HDiv(Primitive::kPrimInt, k_header, constant100_, kNoDexPc), 0);
+ k_header->AddInput(div);
+ PerformInductionVarAnalysis();
+
+ // Note, only the phi in the cycle and direct additive derived are classified.
+ EXPECT_STREQ("geo((1) * 100 ^ -i + (0)):PrimInt", GetInductionInfo(k_header, 0).c_str());
+ EXPECT_STREQ("geo((1) * 100 ^ -i + (100)):PrimInt", GetInductionInfo(add, 0).c_str());
+ EXPECT_STREQ("geo((1) * 100 ^ -i + ((0) - (1))):PrimInt", GetInductionInfo(sub, 0).c_str());
+ EXPECT_STREQ("", GetInductionInfo(neg, 0).c_str());
+ EXPECT_STREQ("", GetInductionInfo(mul, 0).c_str());
+ EXPECT_STREQ("", GetInductionInfo(shl, 0).c_str());
+ EXPECT_STREQ("", GetInductionInfo(div, 0).c_str());
+}
+
+TEST_F(InductionVarAnalysisTest, FindGeometricShrInduction) {
+ // Setup:
+ // k = 100;
+ // for (int i = 0; i < 100; i++) {
+ // k = k >> 1; // geometric (/ 2)
+ // }
+ BuildLoopNest(1);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant100_);
+
+ HInstruction* shr = InsertInstruction(
+ new (&allocator_) HShr(Primitive::kPrimInt, k_header, constant1_), 0);
+ k_header->AddInput(shr);
+ PerformInductionVarAnalysis();
+
+ // Note, only the phi in the cycle is classified.
+ EXPECT_STREQ("geo((100) * 2 ^ -i + (0)):PrimInt", GetInductionInfo(k_header, 0).c_str());
+ EXPECT_STREQ("", GetInductionInfo(shr, 0).c_str());
+}
+
+TEST_F(InductionVarAnalysisTest, FindNotGeometricShrInduction) {
+ // Setup:
+ // k = -1;
+ // for (int i = 0; i < 100; i++) {
+ // k = k >> 1; // initial value is negative
+ // }
+ BuildLoopNest(1);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constantm1_);
+
+ HInstruction* shr = InsertInstruction(
+ new (&allocator_) HShr(Primitive::kPrimInt, k_header, constant1_), 0);
+ k_header->AddInput(shr);
+ PerformInductionVarAnalysis();
+
+ EXPECT_STREQ("", GetInductionInfo(k_header, 0).c_str());
+ EXPECT_STREQ("", GetInductionInfo(shr, 0).c_str());
+}
+
+TEST_F(InductionVarAnalysisTest, FindRemWrapAroundInductionAndDerived) {
+ // Setup:
+ // k = 100;
+ // for (int i = 0; i < 100; i++) {
+ // t = k + 100;
+ // t = k - 1;
+ // t = -t
+ // t = k * 2;
+ // t = k << 2;
+ // k = k % 7;
+ // }
+ BuildLoopNest(1);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant100_);
+
+ HInstruction* add = InsertInstruction(
+ new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant100_), 0);
+ HInstruction* sub = InsertInstruction(
+ new (&allocator_) HSub(Primitive::kPrimInt, k_header, constant1_), 0);
+ HInstruction* neg = InsertInstruction(
+ new (&allocator_) HNeg(Primitive::kPrimInt, sub), 0);
+ HInstruction* mul = InsertInstruction(
+ new (&allocator_) HMul(Primitive::kPrimInt, k_header, constant2_), 0);
+ HInstruction* shl = InsertInstruction(
+ new (&allocator_) HShl(Primitive::kPrimInt, k_header, constant2_), 0);
+ HInstruction* rem = InsertInstruction(
+ new (&allocator_) HRem(Primitive::kPrimInt, k_header, constant7_, kNoDexPc), 0);
+ k_header->AddInput(rem);
+ PerformInductionVarAnalysis();
+
+ // Note, only the phi in the cycle and derived are classified.
+ EXPECT_STREQ("wrap((100), ((100) % (7))):PrimInt", GetInductionInfo(k_header, 0).c_str());
+ EXPECT_STREQ("wrap(((100) + (100)), (((100) % (7)) + (100))):PrimInt", GetInductionInfo(add, 0).c_str());
+ EXPECT_STREQ("wrap(((100) - (1)), (((100) % (7)) - (1))):PrimInt", GetInductionInfo(sub, 0).c_str());
+ EXPECT_STREQ("wrap(( - ((100) - (1))), ( - (((100) % (7)) - (1)))):PrimInt", GetInductionInfo(neg, 0).c_str());
+ EXPECT_STREQ("wrap(((100) * (2)), (((100) % (7)) * (2))):PrimInt", GetInductionInfo(mul, 0).c_str());
+ EXPECT_STREQ("wrap(((100) * (4)), (((100) % (7)) * (4))):PrimInt", GetInductionInfo(shl, 0).c_str());
+ EXPECT_STREQ("", GetInductionInfo(rem, 0).c_str());
}
TEST_F(InductionVarAnalysisTest, FindFirstOrderWrapAroundInduction) {
@@ -377,17 +701,20 @@
// k = 100 - i;
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant0_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant0_);
- HInstruction* store = InsertArrayStore(k, 0);
+ HInstruction* store = InsertArrayStore(k_header, 0);
HInstruction* sub = InsertInstruction(
new (&allocator_) HSub(Primitive::kPrimInt, constant100_, basic_[0]), 0);
- k->AddInput(sub);
+ k_header->AddInput(sub);
PerformInductionVarAnalysis();
EXPECT_STREQ("wrap((0), (( - (1)) * i + (100)):PrimInt):PrimInt",
+ GetInductionInfo(k_header, 0).c_str());
+ EXPECT_STREQ("wrap((0), (( - (1)) * i + (100)):PrimInt):PrimInt",
GetInductionInfo(store->InputAt(1), 0).c_str());
+ EXPECT_STREQ("(( - (1)) * i + (100)):PrimInt", GetInductionInfo(sub, 0).c_str());
}
TEST_F(InductionVarAnalysisTest, FindSecondOrderWrapAroundInduction) {
@@ -400,13 +727,13 @@
// t = 100 - i;
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant0_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant0_);
HPhi* t = InsertLoopPhi(1, 0);
t->AddInput(constant100_);
- HInstruction* store = InsertArrayStore(k, 0);
- k->AddInput(t);
+ HInstruction* store = InsertArrayStore(k_header, 0);
+ k_header->AddInput(t);
HInstruction* sub = InsertInstruction(
new (&allocator_) HSub(Primitive::kPrimInt, constant100_, basic_[0], 0), 0);
t->AddInput(sub);
@@ -426,23 +753,27 @@
// t = k << 1;
// t = - k;
// k = i << 1;
+ // t = - k;
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant0_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant0_);
HInstruction* add = InsertInstruction(
- new (&allocator_) HAdd(Primitive::kPrimInt, k, constant100_), 0);
+ new (&allocator_) HAdd(Primitive::kPrimInt, k_header, constant100_), 0);
HInstruction* sub = InsertInstruction(
- new (&allocator_) HSub(Primitive::kPrimInt, k, constant100_), 0);
+ new (&allocator_) HSub(Primitive::kPrimInt, k_header, constant100_), 0);
HInstruction* mul = InsertInstruction(
- new (&allocator_) HMul(Primitive::kPrimInt, k, constant100_), 0);
- HInstruction* shl = InsertInstruction(
- new (&allocator_) HShl(Primitive::kPrimInt, k, constant1_), 0);
- HInstruction* neg = InsertInstruction(
- new (&allocator_) HNeg(Primitive::kPrimInt, k), 0);
- k->AddInput(
- InsertInstruction(new (&allocator_) HShl(Primitive::kPrimInt, basic_[0], constant1_), 0));
+ new (&allocator_) HMul(Primitive::kPrimInt, k_header, constant100_), 0);
+ HInstruction* shl1 = InsertInstruction(
+ new (&allocator_) HShl(Primitive::kPrimInt, k_header, constant1_), 0);
+ HInstruction* neg1 = InsertInstruction(
+ new (&allocator_) HNeg(Primitive::kPrimInt, k_header), 0);
+ HInstruction* shl2 = InsertInstruction(
+ new (&allocator_) HShl(Primitive::kPrimInt, basic_[0], constant1_), 0);
+ HInstruction* neg2 = InsertInstruction(
+ new (&allocator_) HNeg(Primitive::kPrimInt, shl2), 0);
+ k_header->AddInput(shl2);
PerformInductionVarAnalysis();
EXPECT_STREQ("wrap((100), ((2) * i + (100)):PrimInt):PrimInt",
@@ -452,9 +783,11 @@
EXPECT_STREQ("wrap((0), (((2) * (100)) * i + (0)):PrimInt):PrimInt",
GetInductionInfo(mul, 0).c_str());
EXPECT_STREQ("wrap((0), (((2) * (2)) * i + (0)):PrimInt):PrimInt",
- GetInductionInfo(shl, 0).c_str());
+ GetInductionInfo(shl1, 0).c_str());
EXPECT_STREQ("wrap((0), (( - (2)) * i + (0)):PrimInt):PrimInt",
- GetInductionInfo(neg, 0).c_str());
+ GetInductionInfo(neg1, 0).c_str());
+ EXPECT_STREQ("((2) * i + (0)):PrimInt", GetInductionInfo(shl2, 0).c_str());
+ EXPECT_STREQ("(( - (2)) * i + (0)):PrimInt", GetInductionInfo(neg2, 0).c_str());
}
TEST_F(InductionVarAnalysisTest, FindPeriodicInduction) {
@@ -470,15 +803,15 @@
// k = d;
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant0_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant0_);
HPhi* t = InsertLoopPhi(1, 0);
t->AddInput(constant100_);
- HInstruction* store1 = InsertArrayStore(k, 0);
+ HInstruction* store1 = InsertArrayStore(k_header, 0);
HInstruction* store2 = InsertArrayStore(t, 0);
- k->AddInput(t);
- t->AddInput(k);
+ k_header->AddInput(t);
+ t->AddInput(k_header);
PerformInductionVarAnalysis();
EXPECT_STREQ("periodic((0), (100)):PrimInt", GetInductionInfo(store1->InputAt(1), 0).c_str());
@@ -493,13 +826,13 @@
// k = 1 - k;
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant0_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant0_);
- HInstruction* store = InsertArrayStore(k, 0);
+ HInstruction* store = InsertArrayStore(k_header, 0);
HInstruction* sub = InsertInstruction(
- new (&allocator_) HSub(Primitive::kPrimInt, constant1_, k), 0);
- k->AddInput(sub);
+ new (&allocator_) HSub(Primitive::kPrimInt, constant1_, k_header), 0);
+ k_header->AddInput(sub);
PerformInductionVarAnalysis();
EXPECT_STREQ("periodic((0), (1)):PrimInt", GetInductionInfo(store->InputAt(1), 0).c_str());
@@ -514,13 +847,13 @@
// k = k ^ 1;
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant0_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant0_);
- HInstruction* store = InsertArrayStore(k, 0);
+ HInstruction* store = InsertArrayStore(k_header, 0);
HInstruction* x = InsertInstruction(
- new (&allocator_) HXor(Primitive::kPrimInt, k, constant1_), 0);
- k->AddInput(x);
+ new (&allocator_) HXor(Primitive::kPrimInt, k_header, constant1_), 0);
+ k_header->AddInput(x);
PerformInductionVarAnalysis();
EXPECT_STREQ("periodic((0), (1)):PrimInt", GetInductionInfo(store->InputAt(1), 0).c_str());
@@ -534,14 +867,15 @@
// k = 1 ^ k;
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant1_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant1_);
HInstruction* x = InsertInstruction(
- new (&allocator_) HXor(Primitive::kPrimInt, constant1_, k), 0);
- k->AddInput(x);
+ new (&allocator_) HXor(Primitive::kPrimInt, constant1_, k_header), 0);
+ k_header->AddInput(x);
PerformInductionVarAnalysis();
+ EXPECT_STREQ("periodic((1), ((1) ^ (1))):PrimInt", GetInductionInfo(k_header, 0).c_str());
EXPECT_STREQ("periodic(((1) ^ (1)), (1)):PrimInt", GetInductionInfo(x, 0).c_str());
}
@@ -552,14 +886,15 @@
// k = k ^ 100;
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant1_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant1_);
HInstruction* x = InsertInstruction(
- new (&allocator_) HXor(Primitive::kPrimInt, k, constant100_), 0);
- k->AddInput(x);
+ new (&allocator_) HXor(Primitive::kPrimInt, k_header, constant100_), 0);
+ k_header->AddInput(x);
PerformInductionVarAnalysis();
+ EXPECT_STREQ("periodic((1), ((1) ^ (100))):PrimInt", GetInductionInfo(k_header, 0).c_str());
EXPECT_STREQ("periodic(((1) ^ (100)), (1)):PrimInt", GetInductionInfo(x, 0).c_str());
}
@@ -570,13 +905,14 @@
// k = (k == 0);
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant0_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant0_);
- HInstruction* x = InsertInstruction(new (&allocator_) HEqual(k, constant0_), 0);
- k->AddInput(x);
+ HInstruction* x = InsertInstruction(new (&allocator_) HEqual(k_header, constant0_), 0);
+ k_header->AddInput(x);
PerformInductionVarAnalysis();
+ EXPECT_STREQ("periodic((0), (1)):PrimBoolean", GetInductionInfo(k_header, 0).c_str());
EXPECT_STREQ("periodic((1), (0)):PrimBoolean", GetInductionInfo(x, 0).c_str());
}
@@ -587,13 +923,14 @@
// k = (0 == k);
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant0_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant0_);
- HInstruction* x = InsertInstruction(new (&allocator_) HEqual(constant0_, k), 0);
- k->AddInput(x);
+ HInstruction* x = InsertInstruction(new (&allocator_) HEqual(constant0_, k_header), 0);
+ k_header->AddInput(x);
PerformInductionVarAnalysis();
+ EXPECT_STREQ("periodic((0), (1)):PrimBoolean", GetInductionInfo(k_header, 0).c_str());
EXPECT_STREQ("periodic((1), (0)):PrimBoolean", GetInductionInfo(x, 0).c_str());
}
@@ -604,13 +941,14 @@
// k = (k != 1);
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant0_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant0_);
- HInstruction* x = InsertInstruction(new (&allocator_) HNotEqual(k, constant1_), 0);
- k->AddInput(x);
+ HInstruction* x = InsertInstruction(new (&allocator_) HNotEqual(k_header, constant1_), 0);
+ k_header->AddInput(x);
PerformInductionVarAnalysis();
+ EXPECT_STREQ("periodic((0), (1)):PrimBoolean", GetInductionInfo(k_header, 0).c_str());
EXPECT_STREQ("periodic((1), (0)):PrimBoolean", GetInductionInfo(x, 0).c_str());
}
@@ -621,13 +959,14 @@
// k = (1 != k);
// }
BuildLoopNest(1);
- HPhi* k = InsertLoopPhi(0, 0);
- k->AddInput(constant0_);
+ HPhi* k_header = InsertLoopPhi(0, 0);
+ k_header->AddInput(constant0_);
- HInstruction* x = InsertInstruction(new (&allocator_) HNotEqual(constant1_, k), 0);
- k->AddInput(x);
+ HInstruction* x = InsertInstruction(new (&allocator_) HNotEqual(constant1_, k_header), 0);
+ k_header->AddInput(x);
PerformInductionVarAnalysis();
+ EXPECT_STREQ("periodic((0), (1)):PrimBoolean", GetInductionInfo(k_header, 0).c_str());
EXPECT_STREQ("periodic((1), (0)):PrimBoolean", GetInductionInfo(x, 0).c_str());
}
@@ -635,6 +974,7 @@
// Setup:
// k = 0;
// for (int i = 0; i < 100; i++) {
+ // t = - k;
// k = 1 - k;
// t = k + 100;
// t = k - 100;
@@ -646,28 +986,31 @@
HPhi* k_header = InsertLoopPhi(0, 0);
k_header->AddInput(constant0_);
- HInstruction* k_body = InsertInstruction(
+ HInstruction* neg1 = InsertInstruction(
+ new (&allocator_) HNeg(Primitive::kPrimInt, k_header), 0);
+ HInstruction* idiom = InsertInstruction(
new (&allocator_) HSub(Primitive::kPrimInt, constant1_, k_header), 0);
- k_header->AddInput(k_body);
-
- // Derived expressions.
HInstruction* add = InsertInstruction(
- new (&allocator_) HAdd(Primitive::kPrimInt, k_body, constant100_), 0);
+ new (&allocator_) HAdd(Primitive::kPrimInt, idiom, constant100_), 0);
HInstruction* sub = InsertInstruction(
- new (&allocator_) HSub(Primitive::kPrimInt, k_body, constant100_), 0);
+ new (&allocator_) HSub(Primitive::kPrimInt, idiom, constant100_), 0);
HInstruction* mul = InsertInstruction(
- new (&allocator_) HMul(Primitive::kPrimInt, k_body, constant100_), 0);
+ new (&allocator_) HMul(Primitive::kPrimInt, idiom, constant100_), 0);
HInstruction* shl = InsertInstruction(
- new (&allocator_) HShl(Primitive::kPrimInt, k_body, constant1_), 0);
- HInstruction* neg = InsertInstruction(
- new (&allocator_) HNeg(Primitive::kPrimInt, k_body), 0);
+ new (&allocator_) HShl(Primitive::kPrimInt, idiom, constant1_), 0);
+ HInstruction* neg2 = InsertInstruction(
+ new (&allocator_) HNeg(Primitive::kPrimInt, idiom), 0);
+ k_header->AddInput(idiom);
PerformInductionVarAnalysis();
+ EXPECT_STREQ("periodic((0), (1)):PrimInt", GetInductionInfo(k_header, 0).c_str());
+ EXPECT_STREQ("periodic((0), ( - (1))):PrimInt", GetInductionInfo(neg1, 0).c_str());
+ EXPECT_STREQ("periodic((1), (0)):PrimInt", GetInductionInfo(idiom, 0).c_str());
EXPECT_STREQ("periodic(((1) + (100)), (100)):PrimInt", GetInductionInfo(add, 0).c_str());
EXPECT_STREQ("periodic(((1) - (100)), ((0) - (100))):PrimInt", GetInductionInfo(sub, 0).c_str());
EXPECT_STREQ("periodic((100), (0)):PrimInt", GetInductionInfo(mul, 0).c_str());
EXPECT_STREQ("periodic((2), (0)):PrimInt", GetInductionInfo(shl, 0).c_str());
- EXPECT_STREQ("periodic(( - (1)), (0)):PrimInt", GetInductionInfo(neg, 0).c_str());
+ EXPECT_STREQ("periodic(( - (1)), (0)):PrimInt", GetInductionInfo(neg2, 0).c_str());
}
TEST_F(InductionVarAnalysisTest, FindDeepLoopInduction) {
@@ -683,18 +1026,18 @@
// }
BuildLoopNest(10);
- HPhi* k[10];
+ HPhi* k_header[10];
for (int d = 0; d < 10; d++) {
- k[d] = InsertLoopPhi(0, d);
+ k_header[d] = InsertLoopPhi(0, d);
}
HInstruction* inc = InsertInstruction(
- new (&allocator_) HAdd(Primitive::kPrimInt, constant1_, k[9]), 9);
+ new (&allocator_) HAdd(Primitive::kPrimInt, constant1_, k_header[9]), 9);
HInstruction* store = InsertArrayStore(inc, 9);
for (int d = 0; d < 10; d++) {
- k[d]->AddInput((d != 0) ? k[d - 1] : constant0_);
- k[d]->AddInput((d != 9) ? k[d + 1] : inc);
+ k_header[d]->AddInput((d != 0) ? k_header[d - 1] : constant0_);
+ k_header[d]->AddInput((d != 9) ? k_header[d + 1] : inc);
}
PerformInductionVarAnalysis();
diff --git a/compiler/optimizing/induction_var_range.cc b/compiler/optimizing/induction_var_range.cc
index 235793d..7bcc384 100644
--- a/compiler/optimizing/induction_var_range.cc
+++ b/compiler/optimizing/induction_var_range.cc
@@ -57,6 +57,21 @@
return false;
}
+/** Returns b^e for b,e >= 1. */
+static int64_t IntPow(int64_t b, int64_t e) {
+ DCHECK_GE(b, 1);
+ DCHECK_GE(e, 1);
+ int64_t pow = 1;
+ while (e) {
+ if (e & 1) {
+ pow *= b;
+ }
+ e >>= 1;
+ b *= b;
+ }
+ return pow;
+}
+
/**
* Detects an instruction that is >= 0. As long as the value is carried by
* a single instruction, arithmetic wrap-around cannot occur.
@@ -399,6 +414,8 @@
/*out*/ HLoopInformation** loop,
/*out*/ HInductionVarAnalysis::InductionInfo** info,
/*out*/ HInductionVarAnalysis::InductionInfo** trip) const {
+ DCHECK(context != nullptr);
+ DCHECK(context->GetBlock() != nullptr);
HLoopInformation* lp = context->GetBlock()->GetLoopInformation(); // closest enveloping loop
if (lp != nullptr) {
HInductionVarAnalysis::InductionInfo* i = induction_analysis_->LookupInfo(lp, instruction);
@@ -443,6 +460,8 @@
if (info != nullptr) {
if (info->induction_class == HInductionVarAnalysis::kLinear) {
return IsConstant(info->op_a, kExact, stride_value);
+ } else if (info->induction_class == HInductionVarAnalysis::kPolynomial) {
+ return NeedsTripCount(info->op_a, stride_value);
} else if (info->induction_class == HInductionVarAnalysis::kWrapAround) {
return NeedsTripCount(info->op_b, stride_value);
}
@@ -474,6 +493,8 @@
HInductionVarAnalysis::InductionInfo* trip,
bool in_body,
bool is_min) const {
+ DCHECK(info != nullptr);
+ DCHECK_EQ(info->induction_class, HInductionVarAnalysis::kLinear);
// Detect common situation where an offset inside the trip-count cancels out during range
// analysis (finding max a * (TC - 1) + OFFSET for a == 1 and TC = UPPER - OFFSET or finding
// min a * (TC - 1) + OFFSET for a == -1 and TC = OFFSET - UPPER) to avoid losing information
@@ -520,6 +541,54 @@
GetVal(info->op_b, trip, in_body, is_min));
}
+InductionVarRange::Value InductionVarRange::GetPolynomial(HInductionVarAnalysis::InductionInfo* info,
+ HInductionVarAnalysis::InductionInfo* trip,
+ bool in_body,
+ bool is_min) const {
+ DCHECK(info != nullptr);
+ DCHECK_EQ(info->induction_class, HInductionVarAnalysis::kPolynomial);
+ int64_t a = 0;
+ int64_t b = 0;
+ if (IsConstant(info->op_a->op_a, kExact, &a) && CanLongValueFitIntoInt(a) && a >= 0 &&
+ IsConstant(info->op_a->op_b, kExact, &b) && CanLongValueFitIntoInt(b) && b >= 0) {
+ // Evaluate bounds on sum_i=0^m-1(a * i + b) + c with a,b >= 0 for known
+ // maximum index value m as a * (m * (m-1)) / 2 + b * m + c.
+ Value c = GetVal(info->op_b, trip, in_body, is_min);
+ if (is_min) {
+ return c;
+ } else {
+ Value m = GetVal(trip, trip, in_body, is_min);
+ Value t = DivValue(MulValue(m, SubValue(m, Value(1))), Value(2));
+ Value x = MulValue(Value(a), t);
+ Value y = MulValue(Value(b), m);
+ return AddValue(AddValue(x, y), c);
+ }
+ }
+ return Value();
+}
+
+InductionVarRange::Value InductionVarRange::GetGeometric(HInductionVarAnalysis::InductionInfo* info,
+ HInductionVarAnalysis::InductionInfo* trip,
+ bool in_body,
+ bool is_min) const {
+ DCHECK(info != nullptr);
+ DCHECK_EQ(info->induction_class, HInductionVarAnalysis::kGeometric);
+ int64_t a = 0;
+ int64_t f = 0;
+ if (IsConstant(info->op_a, kExact, &a) &&
+ CanLongValueFitIntoInt(a) &&
+ IsIntAndGet(info->fetch, &f) && f >= 1) {
+ // Conservative bounds on a * f^-i + b with f >= 1 can be computed without
+ // trip count. Other forms would require a much more elaborate evaluation.
+ const bool is_min_a = a >= 0 ? is_min : !is_min;
+ if (info->operation == HInductionVarAnalysis::kDiv) {
+ Value b = GetVal(info->op_b, trip, in_body, is_min);
+ return is_min_a ? b : AddValue(Value(a), b);
+ }
+ }
+ return Value();
+}
+
InductionVarRange::Value InductionVarRange::GetFetch(HInstruction* instruction,
HInductionVarAnalysis::InductionInfo* trip,
bool in_body,
@@ -529,7 +598,7 @@
if (chase_hint_ == nullptr && in_body && trip != nullptr && instruction == trip->op_a->fetch) {
if (is_min) {
return Value(1);
- } else if (!IsUnsafeTripCount(trip)) {
+ } else if (!instruction->IsConstant() && !IsUnsafeTripCount(trip)) {
return Value(std::numeric_limits<int32_t>::max());
}
}
@@ -607,6 +676,8 @@
return GetMul(info->op_a, info->op_b, trip, in_body, is_min);
case HInductionVarAnalysis::kDiv:
return GetDiv(info->op_a, info->op_b, trip, in_body, is_min);
+ case HInductionVarAnalysis::kRem:
+ return GetRem(info->op_a, info->op_b);
case HInductionVarAnalysis::kXor:
return GetXor(info->op_a, info->op_b);
case HInductionVarAnalysis::kFetch:
@@ -631,6 +702,10 @@
break;
case HInductionVarAnalysis::kLinear:
return CorrectForType(GetLinear(info, trip, in_body, is_min), info->type);
+ case HInductionVarAnalysis::kPolynomial:
+ return GetPolynomial(info, trip, in_body, is_min);
+ case HInductionVarAnalysis::kGeometric:
+ return GetGeometric(info, trip, in_body, is_min);
case HInductionVarAnalysis::kWrapAround:
case HInductionVarAnalysis::kPeriodic:
return MergeVal(GetVal(info->op_a, trip, in_body, is_min),
@@ -710,6 +785,21 @@
return Value();
}
+InductionVarRange::Value InductionVarRange::GetRem(
+ HInductionVarAnalysis::InductionInfo* info1,
+ HInductionVarAnalysis::InductionInfo* info2) const {
+ int64_t v1 = 0;
+ int64_t v2 = 0;
+ // Only accept exact values.
+ if (IsConstant(info1, kExact, &v1) && IsConstant(info2, kExact, &v2) && v2 != 0) {
+ int64_t value = v1 % v2;
+ if (CanLongValueFitIntoInt(value)) {
+ return Value(static_cast<int32_t>(value));
+ }
+ }
+ return Value();
+}
+
InductionVarRange::Value InductionVarRange::GetXor(
HInductionVarAnalysis::InductionInfo* info1,
HInductionVarAnalysis::InductionInfo* info2) const {
@@ -842,17 +932,25 @@
*needs_taken_test = IsBodyTripCount(trip);
// Handle last value request.
if (is_last_value) {
- if (info->induction_class == HInductionVarAnalysis::kLinear) {
- if (*stride_value > 0) {
- lower = nullptr;
- } else {
- upper = nullptr;
- }
- } else if (info->induction_class == HInductionVarAnalysis::kPeriodic) {
- DCHECK(!in_body);
- return GenerateLastValuePeriodic(info, trip, graph, block, lower, needs_taken_test);
- } else {
- return false;
+ DCHECK(!in_body);
+ switch (info->induction_class) {
+ case HInductionVarAnalysis::kLinear:
+ if (*stride_value > 0) {
+ lower = nullptr;
+ } else {
+ upper = nullptr;
+ }
+ break;
+ case HInductionVarAnalysis::kPolynomial:
+ return GenerateLastValuePolynomial(info, trip, graph, block, lower);
+ case HInductionVarAnalysis::kGeometric:
+ return GenerateLastValueGeometric(info, trip, graph, block, lower);
+ case HInductionVarAnalysis::kWrapAround:
+ return GenerateLastValueWrapAround(info, trip, graph, block, lower);
+ case HInductionVarAnalysis::kPeriodic:
+ return GenerateLastValuePeriodic(info, trip, graph, block, lower, needs_taken_test);
+ default:
+ return false;
}
}
// Code generation for taken test: generate the code when requested or otherwise analyze
@@ -874,23 +972,123 @@
GenerateCode(info, trip, graph, block, upper, in_body, /* is_min */ false);
}
+bool InductionVarRange::GenerateLastValuePolynomial(HInductionVarAnalysis::InductionInfo* info,
+ HInductionVarAnalysis::InductionInfo* trip,
+ HGraph* graph,
+ HBasicBlock* block,
+ /*out*/HInstruction** result) const {
+ DCHECK(info != nullptr);
+ DCHECK_EQ(info->induction_class, HInductionVarAnalysis::kPolynomial);
+ // Detect known coefficients and trip count (always taken).
+ int64_t a = 0;
+ int64_t b = 0;
+ int64_t m = 0;
+ if (IsConstant(info->op_a->op_a, kExact, &a) &&
+ IsConstant(info->op_a->op_b, kExact, &b) &&
+ IsConstant(trip->op_a, kExact, &m) && m >= 1) {
+ // Evaluate bounds on sum_i=0^m-1(a * i + b) + c for known
+ // maximum index value m as a * (m * (m-1)) / 2 + b * m + c.
+ // TODO: generalize
+ HInstruction* c_instr = nullptr;
+ if (GenerateCode(info->op_b, nullptr, graph, block, graph ? &c_instr : nullptr, false, false)) {
+ if (graph != nullptr) {
+ int64_t sum = a * ((m * (m - 1)) / 2) + b * m;
+ *result = Insert(block, new (graph->GetArena()) HAdd(info->type,
+ graph->GetIntConstant(sum), c_instr));
+ }
+ return true;
+ }
+ }
+ return false;
+}
+
+bool InductionVarRange::GenerateLastValueGeometric(HInductionVarAnalysis::InductionInfo* info,
+ HInductionVarAnalysis::InductionInfo* trip,
+ HGraph* graph,
+ HBasicBlock* block,
+ /*out*/HInstruction** result) const {
+ DCHECK(info != nullptr);
+ DCHECK_EQ(info->induction_class, HInductionVarAnalysis::kGeometric);
+ // Detect known base and trip count (always taken).
+ int64_t f = 0;
+ int64_t t = 0;
+ if (IsIntAndGet(info->fetch, &f) && f >= 1 && IsConstant(trip->op_a, kExact, &t) && t >= 1) {
+ HInstruction* opa = nullptr;
+ HInstruction* opb = nullptr;
+ if (GenerateCode(info->op_a, nullptr, graph, block, &opa, false, false) &&
+ GenerateCode(info->op_b, nullptr, graph, block, &opb, false, false)) {
+ // Compute f ^ t.
+ int64_t fpowt = IntPow(f, t);
+ if (graph != nullptr) {
+ DCHECK(info->type == Primitive::kPrimInt); // due to codegen, generalize?
+ if (fpowt == 0) {
+ // Special case: repeated mul/div always yields zero.
+ *result = graph->GetIntConstant(0);
+ } else if (info->operation == HInductionVarAnalysis::kMul) {
+ // Last value multiplication: a * f ^ t + b.
+ HInstruction* mul = Insert(block,
+ new (graph->GetArena()) HMul(info->type,
+ opa,
+ graph->GetIntConstant(fpowt)));
+ *result = Insert(block, new (graph->GetArena()) HAdd(info->type, mul, opb));
+ } else {
+ // Last value multiplication: a * f ^ -t + b.
+ DCHECK_EQ(info->operation, HInductionVarAnalysis::kDiv);
+ HInstruction* div = Insert(block,
+ new (graph->GetArena()) HDiv(info->type,
+ opa,
+ graph->GetIntConstant(fpowt),
+ kNoDexPc));
+ *result = Insert(block, new (graph->GetArena()) HAdd(info->type, div, opb));
+ }
+ }
+ return true;
+ }
+ }
+ return false;
+}
+
+bool InductionVarRange::GenerateLastValueWrapAround(HInductionVarAnalysis::InductionInfo* info,
+ HInductionVarAnalysis::InductionInfo* trip,
+ HGraph* graph,
+ HBasicBlock* block,
+ /*out*/HInstruction** result) const {
+ DCHECK(info != nullptr);
+ DCHECK_EQ(info->induction_class, HInductionVarAnalysis::kWrapAround);
+ // Count depth.
+ int32_t depth = 0;
+ for (; info->induction_class == HInductionVarAnalysis::kWrapAround;
+ info = info->op_b, ++depth) {}
+ // Handle wrap(x, wrap(.., y)) if trip count reaches an invariant at end.
+ // TODO: generalize
+ int64_t t = 0;
+ if (info->induction_class == HInductionVarAnalysis::kInvariant &&
+ IsConstant(trip->op_a, kExact, &t) && t >= depth &&
+ GenerateCode(info, nullptr, graph, block, result, false, false)) {
+ return true;
+ }
+ return false;
+}
+
bool InductionVarRange::GenerateLastValuePeriodic(HInductionVarAnalysis::InductionInfo* info,
HInductionVarAnalysis::InductionInfo* trip,
HGraph* graph,
HBasicBlock* block,
/*out*/HInstruction** result,
/*out*/bool* needs_taken_test) const {
- DCHECK(info->induction_class == HInductionVarAnalysis::kPeriodic);
+ DCHECK(info != nullptr);
+ DCHECK_EQ(info->induction_class, HInductionVarAnalysis::kPeriodic);
// Count period.
int32_t period = 1;
for (HInductionVarAnalysis::InductionInfo* p = info;
p->induction_class == HInductionVarAnalysis::kPeriodic;
p = p->op_b, ++period) {}
// Handle periodic(x, y) case for restricted types.
+ // TODO: generalize
if (period != 2 ||
trip->op_a->type != Primitive::kPrimInt ||
(info->type != Primitive::kPrimInt && info->type != Primitive::kPrimBoolean)) {
- return false; // TODO: easy to generalize
+ return false;
}
HInstruction* x_instr = nullptr;
HInstruction* y_instr = nullptr;
@@ -937,6 +1135,7 @@
return true;
}
// Verify type safety.
+ // TODO: generalize
Primitive::Type type = Primitive::kPrimInt;
if (info->type != Primitive::kPrimInt && info->type != Primitive::kPrimBoolean) {
return false;
@@ -950,6 +1149,7 @@
// invariants, some effort is made to keep this parameter consistent).
switch (info->operation) {
case HInductionVarAnalysis::kAdd:
+ case HInductionVarAnalysis::kRem: // no proper is_min for second arg
case HInductionVarAnalysis::kXor: // no proper is_min for second arg
case HInductionVarAnalysis::kLT:
case HInductionVarAnalysis::kLE:
@@ -962,6 +1162,8 @@
switch (info->operation) {
case HInductionVarAnalysis::kAdd:
operation = new (graph->GetArena()) HAdd(type, opa, opb); break;
+ case HInductionVarAnalysis::kRem:
+ operation = new (graph->GetArena()) HRem(type, opa, opb, kNoDexPc); break;
case HInductionVarAnalysis::kXor:
operation = new (graph->GetArena()) HXor(type, opa, opb); break;
case HInductionVarAnalysis::kLT:
@@ -1058,6 +1260,9 @@
}
break;
}
+ case HInductionVarAnalysis::kPolynomial:
+ case HInductionVarAnalysis::kGeometric:
+ break;
case HInductionVarAnalysis::kWrapAround:
case HInductionVarAnalysis::kPeriodic: {
// Wrap-around and periodic inductions are restricted to constants only, so that extreme
@@ -1071,8 +1276,6 @@
}
break;
}
- default:
- break;
}
}
return false;
diff --git a/compiler/optimizing/induction_var_range.h b/compiler/optimizing/induction_var_range.h
index 034cf32..ba14847 100644
--- a/compiler/optimizing/induction_var_range.h
+++ b/compiler/optimizing/induction_var_range.h
@@ -190,6 +190,14 @@
HInductionVarAnalysis::InductionInfo* trip,
bool in_body,
bool is_min) const;
+ Value GetPolynomial(HInductionVarAnalysis::InductionInfo* info,
+ HInductionVarAnalysis::InductionInfo* trip,
+ bool in_body,
+ bool is_min) const;
+ Value GetGeometric(HInductionVarAnalysis::InductionInfo* info,
+ HInductionVarAnalysis::InductionInfo* trip,
+ bool in_body,
+ bool is_min) const;
Value GetFetch(HInstruction* instruction,
HInductionVarAnalysis::InductionInfo* trip,
bool in_body,
@@ -208,6 +216,8 @@
HInductionVarAnalysis::InductionInfo* trip,
bool in_body,
bool is_min) const;
+ Value GetRem(HInductionVarAnalysis::InductionInfo* info1,
+ HInductionVarAnalysis::InductionInfo* info2) const;
Value GetXor(HInductionVarAnalysis::InductionInfo* info1,
HInductionVarAnalysis::InductionInfo* info2) const;
@@ -245,6 +255,24 @@
/*out*/ bool* needs_finite_test,
/*out*/ bool* needs_taken_test) const;
+ bool GenerateLastValuePolynomial(HInductionVarAnalysis::InductionInfo* info,
+ HInductionVarAnalysis::InductionInfo* trip,
+ HGraph* graph,
+ HBasicBlock* block,
+ /*out*/HInstruction** result) const;
+
+ bool GenerateLastValueGeometric(HInductionVarAnalysis::InductionInfo* info,
+ HInductionVarAnalysis::InductionInfo* trip,
+ HGraph* graph,
+ HBasicBlock* block,
+ /*out*/HInstruction** result) const;
+
+ bool GenerateLastValueWrapAround(HInductionVarAnalysis::InductionInfo* info,
+ HInductionVarAnalysis::InductionInfo* trip,
+ HGraph* graph,
+ HBasicBlock* block,
+ /*out*/HInstruction** result) const;
+
bool GenerateLastValuePeriodic(HInductionVarAnalysis::InductionInfo* info,
HInductionVarAnalysis::InductionInfo* trip,
HGraph* graph,
diff --git a/compiler/optimizing/induction_var_range_test.cc b/compiler/optimizing/induction_var_range_test.cc
index 8bbdd4a..aa3e1aa 100644
--- a/compiler/optimizing/induction_var_range_test.cc
+++ b/compiler/optimizing/induction_var_range_test.cc
@@ -62,9 +62,15 @@
graph_->SetEntryBlock(entry_block_);
graph_->SetExitBlock(exit_block_);
// Two parameters.
- x_ = new (&allocator_) HParameterValue(graph_->GetDexFile(), 0, 0, Primitive::kPrimInt);
+ x_ = new (&allocator_) HParameterValue(graph_->GetDexFile(),
+ dex::TypeIndex(0),
+ 0,
+ Primitive::kPrimInt);
entry_block_->AddInstruction(x_);
- y_ = new (&allocator_) HParameterValue(graph_->GetDexFile(), 0, 0, Primitive::kPrimInt);
+ y_ = new (&allocator_) HParameterValue(graph_->GetDexFile(),
+ dex::TypeIndex(0),
+ 0,
+ Primitive::kPrimInt);
entry_block_->AddInstruction(y_);
// Set arbitrary range analysis hint while testing private methods.
SetHint(x_);
@@ -129,6 +135,8 @@
case 'n': op = HInductionVarAnalysis::kNeg; break;
case '*': op = HInductionVarAnalysis::kMul; break;
case '/': op = HInductionVarAnalysis::kDiv; break;
+ case '%': op = HInductionVarAnalysis::kRem; break;
+ case '^': op = HInductionVarAnalysis::kXor; break;
case '<': op = HInductionVarAnalysis::kLT; break;
default: op = HInductionVarAnalysis::kNop; break;
}
@@ -164,22 +172,55 @@
/** Constructs a linear a * i + b induction. */
HInductionVarAnalysis::InductionInfo* CreateLinear(int32_t a, int32_t b) {
- return iva_->CreateInduction(
- HInductionVarAnalysis::kLinear, CreateConst(a), CreateConst(b), Primitive::kPrimInt);
+ return iva_->CreateInduction(HInductionVarAnalysis::kLinear,
+ HInductionVarAnalysis::kNop,
+ CreateConst(a),
+ CreateConst(b),
+ nullptr,
+ Primitive::kPrimInt);
+ }
+
+ /** Constructs a polynomial sum(a * i + b) + c induction. */
+ HInductionVarAnalysis::InductionInfo* CreatePolynomial(int32_t a, int32_t b, int32_t c) {
+ return iva_->CreateInduction(HInductionVarAnalysis::kPolynomial,
+ HInductionVarAnalysis::kNop,
+ CreateLinear(a, b),
+ CreateConst(c),
+ nullptr,
+ Primitive::kPrimInt);
+ }
+
+ /** Constructs a geometric a * f^i + b induction. */
+ HInductionVarAnalysis::InductionInfo* CreateGeometric(int32_t a, int32_t b, int32_t f, char op) {
+ return iva_->CreateInduction(HInductionVarAnalysis::kGeometric,
+ op == '*' ? HInductionVarAnalysis::kMul
+ : HInductionVarAnalysis::kDiv,
+ CreateConst(a),
+ CreateConst(b),
+ graph_->GetIntConstant(f),
+ Primitive::kPrimInt);
}
/** Constructs a range [lo, hi] using a periodic induction. */
HInductionVarAnalysis::InductionInfo* CreateRange(int32_t lo, int32_t hi) {
- return iva_->CreateInduction(
- HInductionVarAnalysis::kPeriodic, CreateConst(lo), CreateConst(hi), Primitive::kPrimInt);
+ return iva_->CreateInduction(HInductionVarAnalysis::kPeriodic,
+ HInductionVarAnalysis::kNop,
+ CreateConst(lo),
+ CreateConst(hi),
+ nullptr,
+ Primitive::kPrimInt);
}
- /** Constructs a wrap-around induction consisting of a constant, followed info */
+ /** Constructs a wrap-around induction consisting of a constant, followed by info. */
HInductionVarAnalysis::InductionInfo* CreateWrapAround(
int32_t initial,
HInductionVarAnalysis::InductionInfo* info) {
- return iva_->CreateInduction(
- HInductionVarAnalysis::kWrapAround, CreateConst(initial), info, Primitive::kPrimInt);
+ return iva_->CreateInduction(HInductionVarAnalysis::kWrapAround,
+ HInductionVarAnalysis::kNop,
+ CreateConst(initial),
+ info,
+ nullptr,
+ Primitive::kPrimInt);
}
/** Constructs a wrap-around induction consisting of a constant, followed by a range. */
@@ -226,6 +267,16 @@
return range_.GetDiv(info1, info2, nullptr, /* in_body */ true, is_min);
}
+ Value GetRem(HInductionVarAnalysis::InductionInfo* info1,
+ HInductionVarAnalysis::InductionInfo* info2) {
+ return range_.GetRem(info1, info2);
+ }
+
+ Value GetXor(HInductionVarAnalysis::InductionInfo* info1,
+ HInductionVarAnalysis::InductionInfo* info2) {
+ return range_.GetXor(info1, info2);
+ }
+
bool IsExact(HInductionVarAnalysis::InductionInfo* info, int64_t* value) {
return range_.IsConstant(info, InductionVarRange::kExact, value);
}
@@ -408,6 +459,43 @@
ExpectEqual(Value(20), GetMax(CreateWrapAround(20, -1, 10), nullptr));
}
+TEST_F(InductionVarRangeTest, GetMinMaxPolynomial) {
+ ExpectEqual(Value(7), GetMin(CreatePolynomial(3, 5, 7), nullptr));
+ ExpectEqual(Value(), GetMax(CreatePolynomial(3, 5, 7), nullptr));
+ ExpectEqual(Value(7), GetMin(CreatePolynomial(3, 5, 7), CreateTripCount(5, true, true)));
+ ExpectEqual(Value(45), GetMax(CreatePolynomial(3, 5, 7), CreateTripCount(5, true, true)));
+ ExpectEqual(Value(7), GetMin(CreatePolynomial(3, 5, 7), CreateTripCount(10, true, true)));
+ ExpectEqual(Value(160), GetMax(CreatePolynomial(3, 5, 7), CreateTripCount(10, true, true)));
+ ExpectEqual(Value(-7), GetMin(CreatePolynomial(11, 13, -7),
+ CreateTripCount(5, true, true)));
+ ExpectEqual(Value(111), GetMax(CreatePolynomial(11, 13, -7),
+ CreateTripCount(5, true, true)));
+ ExpectEqual(Value(-7), GetMin(CreatePolynomial(11, 13, -7),
+ CreateTripCount(10, true, true)));
+ ExpectEqual(Value(506), GetMax(CreatePolynomial(11, 13, -7),
+ CreateTripCount(10, true, true)));
+ ExpectEqual(Value(), GetMin(CreatePolynomial(-3, 5, 7), CreateTripCount(10, true, true)));
+ ExpectEqual(Value(), GetMax(CreatePolynomial(-3, 5, 7), CreateTripCount(10, true, true)));
+ ExpectEqual(Value(), GetMin(CreatePolynomial(3, -5, 7), CreateTripCount(10, true, true)));
+ ExpectEqual(Value(), GetMax(CreatePolynomial(3, -5, 7), CreateTripCount(10, true, true)));
+}
+
+TEST_F(InductionVarRangeTest, GetMinMaxGeometricMul) {
+ ExpectEqual(Value(), GetMin(CreateGeometric(1, 1, 1, '*'), nullptr));
+ ExpectEqual(Value(), GetMax(CreateGeometric(1, 1, 1, '*'), nullptr));
+}
+
+TEST_F(InductionVarRangeTest, GetMinMaxGeometricDiv) {
+ ExpectEqual(Value(5), GetMin(CreateGeometric(11, 5, 3, '/'), nullptr));
+ ExpectEqual(Value(16), GetMax(CreateGeometric(11, 5, 3, '/'), nullptr));
+ ExpectEqual(Value(-5), GetMin(CreateGeometric(11, -5, 3, '/'), nullptr));
+ ExpectEqual(Value(6), GetMax(CreateGeometric(11, -5, 3, '/'), nullptr));
+ ExpectEqual(Value(-6), GetMin(CreateGeometric(-11, 5, 3, '/'), nullptr));
+ ExpectEqual(Value(5), GetMax(CreateGeometric(-11, 5, 3, '/'), nullptr));
+ ExpectEqual(Value(-16), GetMin(CreateGeometric(-11, -5, 3, '/'), nullptr));
+ ExpectEqual(Value(-5), GetMax(CreateGeometric(-11, -5, 3, '/'), nullptr));
+}
+
TEST_F(InductionVarRangeTest, GetMinMaxPeriodic) {
ExpectEqual(Value(-2), GetMin(CreateRange(-2, 99), nullptr));
ExpectEqual(Value(99), GetMax(CreateRange(-2, 99), nullptr));
@@ -473,6 +561,46 @@
ExpectEqual(Value(), GetDiv(CreateRange(-1, 1), CreateRange(-1, 1), false));
}
+TEST_F(InductionVarRangeTest, GetMinMaxRem) {
+ ExpectEqual(Value(), GetMin(CreateInvariant('%', CreateConst(2), CreateRange(10, 20)), nullptr));
+ ExpectEqual(Value(), GetMax(CreateInvariant('%', CreateConst(2), CreateRange(10, 20)), nullptr));
+ ExpectEqual(Value(), GetMin(CreateInvariant('%', CreateRange(10, 20), CreateConst(2)), nullptr));
+ ExpectEqual(Value(), GetMax(CreateInvariant('%', CreateRange(10, 20), CreateConst(2)), nullptr));
+ ExpectEqual(Value(2), GetMin(CreateInvariant('%', CreateConst(2), CreateConst(5)), nullptr));
+ ExpectEqual(Value(2), GetMax(CreateInvariant('%', CreateConst(2), CreateConst(5)), nullptr));
+ ExpectEqual(Value(1), GetMin(CreateInvariant('%', CreateConst(11), CreateConst(5)), nullptr));
+ ExpectEqual(Value(1), GetMax(CreateInvariant('%', CreateConst(11), CreateConst(5)), nullptr));
+}
+
+TEST_F(InductionVarRangeTest, GetRem) {
+ ExpectEqual(Value(0), GetRem(CreateConst(1), CreateConst(1)));
+ ExpectEqual(Value(2), GetRem(CreateConst(2), CreateConst(5)));
+ ExpectEqual(Value(1), GetRem(CreateConst(11), CreateConst(5)));
+ ExpectEqual(Value(-2), GetRem(CreateConst(-2), CreateConst(5)));
+ ExpectEqual(Value(-1), GetRem(CreateConst(-11), CreateConst(5)));
+ ExpectEqual(Value(2), GetRem(CreateConst(2), CreateConst(-5)));
+ ExpectEqual(Value(1), GetRem(CreateConst(11), CreateConst(-5)));
+ ExpectEqual(Value(-2), GetRem(CreateConst(-2), CreateConst(-5)));
+ ExpectEqual(Value(-1), GetRem(CreateConst(-11), CreateConst(-5)));
+ ExpectEqual(Value(), GetRem(CreateConst(1), CreateConst(0)));
+}
+
+TEST_F(InductionVarRangeTest, GetMinMaxXor) {
+ ExpectEqual(Value(), GetMin(CreateInvariant('^', CreateConst(2), CreateRange(10, 20)), nullptr));
+ ExpectEqual(Value(), GetMax(CreateInvariant('^', CreateConst(2), CreateRange(10, 20)), nullptr));
+ ExpectEqual(Value(), GetMin(CreateInvariant('^', CreateRange(10, 20), CreateConst(2)), nullptr));
+ ExpectEqual(Value(), GetMax(CreateInvariant('^', CreateRange(10, 20), CreateConst(2)), nullptr));
+ ExpectEqual(Value(3), GetMin(CreateInvariant('^', CreateConst(1), CreateConst(2)), nullptr));
+ ExpectEqual(Value(3), GetMax(CreateInvariant('^', CreateConst(1), CreateConst(2)), nullptr));
+}
+
+TEST_F(InductionVarRangeTest, GetXor) {
+ ExpectEqual(Value(0), GetXor(CreateConst(1), CreateConst(1)));
+ ExpectEqual(Value(3), GetXor(CreateConst(1), CreateConst(2)));
+ ExpectEqual(Value(-2), GetXor(CreateConst(1), CreateConst(-1)));
+ ExpectEqual(Value(0), GetXor(CreateConst(-1), CreateConst(-1)));
+}
+
TEST_F(InductionVarRangeTest, AddValue) {
ExpectEqual(Value(110), AddValue(Value(10), Value(100)));
ExpectEqual(Value(-5), AddValue(Value(x_, 1, -4), Value(x_, -1, -1)));
@@ -572,7 +700,8 @@
HInstruction* new_array = new (&allocator_)
HNewArray(x_,
graph_->GetCurrentMethod(),
- 0, Primitive::kPrimInt,
+ 0,
+ dex::TypeIndex(Primitive::kPrimInt),
graph_->GetDexFile(),
kQuickAllocArray);
entry_block_->AddInstruction(new_array);
diff --git a/compiler/optimizing/inliner.cc b/compiler/optimizing/inliner.cc
index 7fe54b9..fe4662a 100644
--- a/compiler/optimizing/inliner.cc
+++ b/compiler/optimizing/inliner.cc
@@ -197,15 +197,15 @@
}
}
-static uint32_t FindClassIndexIn(mirror::Class* cls,
- const DexFile& dex_file,
- Handle<mirror::DexCache> dex_cache)
+static dex::TypeIndex FindClassIndexIn(mirror::Class* cls,
+ const DexFile& dex_file,
+ Handle<mirror::DexCache> dex_cache)
REQUIRES_SHARED(Locks::mutator_lock_) {
- uint32_t index = DexFile::kDexNoIndex;
+ dex::TypeIndex index;
if (cls->GetDexCache() == nullptr) {
DCHECK(cls->IsArrayClass()) << cls->PrettyClass();
index = cls->FindTypeIndexInOtherDexFile(dex_file);
- } else if (cls->GetDexTypeIndex() == DexFile::kDexNoIndex16) {
+ } else if (!cls->GetDexTypeIndex().IsValid()) {
DCHECK(cls->IsProxyClass()) << cls->PrettyClass();
// TODO: deal with proxy classes.
} else if (IsSameDexFile(cls->GetDexFile(), dex_file)) {
@@ -223,8 +223,8 @@
// We cannot guarantee the entry in the dex cache will resolve to the same class,
// as there may be different class loaders. So only return the index if it's
// the right class in the dex cache already.
- if (index != DexFile::kDexNoIndex && dex_cache->GetResolvedType(index) != cls) {
- index = DexFile::kDexNoIndex;
+ if (index.IsValid() && dex_cache->GetResolvedType(index) != cls) {
+ index = dex::TypeIndex::Invalid();
}
}
@@ -258,6 +258,55 @@
ProfilingInfo* const profiling_info_;
};
+static bool IsMonomorphic(Handle<mirror::ObjectArray<mirror::Class>> classes)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ DCHECK_GE(InlineCache::kIndividualCacheSize, 2);
+ return classes->Get(0) != nullptr && classes->Get(1) == nullptr;
+}
+
+static bool IsMegamorphic(Handle<mirror::ObjectArray<mirror::Class>> classes)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ for (size_t i = 0; i < InlineCache::kIndividualCacheSize; ++i) {
+ if (classes->Get(i) == nullptr) {
+ return false;
+ }
+ }
+ return true;
+}
+
+static mirror::Class* GetMonomorphicType(Handle<mirror::ObjectArray<mirror::Class>> classes)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ DCHECK(classes->Get(0) != nullptr);
+ return classes->Get(0);
+}
+
+static bool IsUninitialized(Handle<mirror::ObjectArray<mirror::Class>> classes)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ return classes->Get(0) == nullptr;
+}
+
+static bool IsPolymorphic(Handle<mirror::ObjectArray<mirror::Class>> classes)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ DCHECK_GE(InlineCache::kIndividualCacheSize, 3);
+ return classes->Get(1) != nullptr &&
+ classes->Get(InlineCache::kIndividualCacheSize - 1) == nullptr;
+}
+
+ArtMethod* HInliner::TryCHADevirtualization(ArtMethod* resolved_method) {
+ if (!resolved_method->HasSingleImplementation()) {
+ return nullptr;
+ }
+ if (Runtime::Current()->IsAotCompiler()) {
+ // No CHA-based devirtulization for AOT compiler (yet).
+ return nullptr;
+ }
+ if (outermost_graph_->IsCompilingOsr()) {
+ // We do not support HDeoptimize in OSR methods.
+ return nullptr;
+ }
+ return resolved_method->GetSingleImplementation();
+}
+
bool HInliner::TryInline(HInvoke* invoke_instruction) {
if (invoke_instruction->IsInvokeUnresolved()) {
return false; // Don't bother to move further if we know the method is unresolved.
@@ -283,10 +332,29 @@
actual_method = FindVirtualOrInterfaceTarget(invoke_instruction, resolved_method);
}
+ bool cha_devirtualize = false;
+ if (actual_method == nullptr) {
+ ArtMethod* method = TryCHADevirtualization(resolved_method);
+ if (method != nullptr) {
+ cha_devirtualize = true;
+ actual_method = method;
+ }
+ }
+
if (actual_method != nullptr) {
- bool result = TryInlineAndReplace(invoke_instruction, actual_method, /* do_rtp */ true);
+ bool result = TryInlineAndReplace(invoke_instruction,
+ actual_method,
+ /* do_rtp */ true,
+ cha_devirtualize);
if (result && !invoke_instruction->IsInvokeStaticOrDirect()) {
- MaybeRecordStat(kInlinedInvokeVirtualOrInterface);
+ if (cha_devirtualize) {
+ // Add dependency due to devirtulization. We've assumed resolved_method
+ // has single implementation.
+ outermost_graph_->AddCHASingleImplementationDependency(resolved_method);
+ MaybeRecordStat(kCHAInline);
+ } else {
+ MaybeRecordStat(kInlinedInvokeVirtualOrInterface);
+ }
}
return result;
}
@@ -301,31 +369,48 @@
ScopedProfilingInfoInlineUse spiis(caller, soa.Self());
ProfilingInfo* profiling_info = spiis.GetProfilingInfo();
if (profiling_info != nullptr) {
- const InlineCache& ic = *profiling_info->GetInlineCache(invoke_instruction->GetDexPc());
- if (ic.IsUninitialized()) {
- VLOG(compiler) << "Interface or virtual call to "
- << caller_dex_file.PrettyMethod(method_index)
- << " is not hit and not inlined";
+ StackHandleScope<1> hs(soa.Self());
+ ClassLinker* class_linker = caller_compilation_unit_.GetClassLinker();
+ Handle<mirror::ObjectArray<mirror::Class>> inline_cache = hs.NewHandle(
+ mirror::ObjectArray<mirror::Class>::Alloc(
+ soa.Self(),
+ class_linker->GetClassRoot(ClassLinker::kClassArrayClass),
+ InlineCache::kIndividualCacheSize));
+ if (inline_cache.Get() == nullptr) {
+ // We got an OOME. Just clear the exception, and don't inline.
+ DCHECK(soa.Self()->IsExceptionPending());
+ soa.Self()->ClearException();
+ VLOG(compiler) << "Out of memory in the compiler when trying to inline";
return false;
- } else if (ic.IsMonomorphic()) {
- MaybeRecordStat(kMonomorphicCall);
- if (outermost_graph_->IsCompilingOsr()) {
- // If we are compiling OSR, we pretend this call is polymorphic, as we may come from the
- // interpreter and it may have seen different receiver types.
- return TryInlinePolymorphicCall(invoke_instruction, resolved_method, ic);
- } else {
- return TryInlineMonomorphicCall(invoke_instruction, resolved_method, ic);
- }
- } else if (ic.IsPolymorphic()) {
- MaybeRecordStat(kPolymorphicCall);
- return TryInlinePolymorphicCall(invoke_instruction, resolved_method, ic);
} else {
- DCHECK(ic.IsMegamorphic());
- VLOG(compiler) << "Interface or virtual call to "
- << caller_dex_file.PrettyMethod(method_index)
- << " is megamorphic and not inlined";
- MaybeRecordStat(kMegamorphicCall);
- return false;
+ Runtime::Current()->GetJit()->GetCodeCache()->CopyInlineCacheInto(
+ *profiling_info->GetInlineCache(invoke_instruction->GetDexPc()),
+ inline_cache);
+ if (IsUninitialized(inline_cache)) {
+ VLOG(compiler) << "Interface or virtual call to "
+ << caller_dex_file.PrettyMethod(method_index)
+ << " is not hit and not inlined";
+ return false;
+ } else if (IsMonomorphic(inline_cache)) {
+ MaybeRecordStat(kMonomorphicCall);
+ if (outermost_graph_->IsCompilingOsr()) {
+ // If we are compiling OSR, we pretend this call is polymorphic, as we may come from the
+ // interpreter and it may have seen different receiver types.
+ return TryInlinePolymorphicCall(invoke_instruction, resolved_method, inline_cache);
+ } else {
+ return TryInlineMonomorphicCall(invoke_instruction, resolved_method, inline_cache);
+ }
+ } else if (IsPolymorphic(inline_cache)) {
+ MaybeRecordStat(kPolymorphicCall);
+ return TryInlinePolymorphicCall(invoke_instruction, resolved_method, inline_cache);
+ } else {
+ DCHECK(IsMegamorphic(inline_cache));
+ VLOG(compiler) << "Interface or virtual call to "
+ << caller_dex_file.PrettyMethod(method_index)
+ << " is megamorphic and not inlined";
+ MaybeRecordStat(kMegamorphicCall);
+ return false;
+ }
}
}
}
@@ -358,14 +443,14 @@
bool HInliner::TryInlineMonomorphicCall(HInvoke* invoke_instruction,
ArtMethod* resolved_method,
- const InlineCache& ic) {
+ Handle<mirror::ObjectArray<mirror::Class>> classes) {
DCHECK(invoke_instruction->IsInvokeVirtual() || invoke_instruction->IsInvokeInterface())
<< invoke_instruction->DebugName();
const DexFile& caller_dex_file = *caller_compilation_unit_.GetDexFile();
- uint32_t class_index = FindClassIndexIn(
- ic.GetMonomorphicType(), caller_dex_file, caller_compilation_unit_.GetDexCache());
- if (class_index == DexFile::kDexNoIndex) {
+ dex::TypeIndex class_index = FindClassIndexIn(
+ GetMonomorphicType(classes), caller_dex_file, caller_compilation_unit_.GetDexCache());
+ if (!class_index.IsValid()) {
VLOG(compiler) << "Call to " << ArtMethod::PrettyMethod(resolved_method)
<< " from inline cache is not inlined because its class is not"
<< " accessible to the caller";
@@ -375,11 +460,11 @@
ClassLinker* class_linker = caller_compilation_unit_.GetClassLinker();
PointerSize pointer_size = class_linker->GetImagePointerSize();
if (invoke_instruction->IsInvokeInterface()) {
- resolved_method = ic.GetMonomorphicType()->FindVirtualMethodForInterface(
+ resolved_method = GetMonomorphicType(classes)->FindVirtualMethodForInterface(
resolved_method, pointer_size);
} else {
DCHECK(invoke_instruction->IsInvokeVirtual());
- resolved_method = ic.GetMonomorphicType()->FindVirtualMethodForVirtual(
+ resolved_method = GetMonomorphicType(classes)->FindVirtualMethodForVirtual(
resolved_method, pointer_size);
}
DCHECK(resolved_method != nullptr);
@@ -387,13 +472,16 @@
HInstruction* cursor = invoke_instruction->GetPrevious();
HBasicBlock* bb_cursor = invoke_instruction->GetBlock();
- if (!TryInlineAndReplace(invoke_instruction, resolved_method, /* do_rtp */ false)) {
+ if (!TryInlineAndReplace(invoke_instruction,
+ resolved_method,
+ /* do_rtp */ false,
+ /* cha_devirtualize */ false)) {
return false;
}
// We successfully inlined, now add a guard.
bool is_referrer =
- (ic.GetMonomorphicType() == outermost_graph_->GetArtMethod()->GetDeclaringClass());
+ (GetMonomorphicType(classes) == outermost_graph_->GetArtMethod()->GetDeclaringClass());
AddTypeGuard(receiver,
cursor,
bb_cursor,
@@ -414,10 +502,29 @@
return true;
}
+void HInliner::AddCHAGuard(HInstruction* invoke_instruction,
+ uint32_t dex_pc,
+ HInstruction* cursor,
+ HBasicBlock* bb_cursor) {
+ HInstruction* deopt_flag = new (graph_->GetArena()) HShouldDeoptimizeFlag(dex_pc);
+ HInstruction* should_deopt = new (graph_->GetArena()) HNotEqual(
+ deopt_flag, graph_->GetIntConstant(0, dex_pc));
+ HInstruction* deopt = new (graph_->GetArena()) HDeoptimize(should_deopt, dex_pc);
+
+ if (cursor != nullptr) {
+ bb_cursor->InsertInstructionAfter(deopt_flag, cursor);
+ } else {
+ bb_cursor->InsertInstructionBefore(deopt_flag, bb_cursor->GetFirstInstruction());
+ }
+ bb_cursor->InsertInstructionAfter(should_deopt, deopt_flag);
+ bb_cursor->InsertInstructionAfter(deopt, should_deopt);
+ deopt->CopyEnvironmentFrom(invoke_instruction->GetEnvironment());
+}
+
HInstruction* HInliner::AddTypeGuard(HInstruction* receiver,
HInstruction* cursor,
HBasicBlock* bb_cursor,
- uint32_t class_index,
+ dex::TypeIndex class_index,
bool is_referrer,
HInstruction* invoke_instruction,
bool with_deoptimization) {
@@ -457,11 +564,11 @@
bool HInliner::TryInlinePolymorphicCall(HInvoke* invoke_instruction,
ArtMethod* resolved_method,
- const InlineCache& ic) {
+ Handle<mirror::ObjectArray<mirror::Class>> classes) {
DCHECK(invoke_instruction->IsInvokeVirtual() || invoke_instruction->IsInvokeInterface())
<< invoke_instruction->DebugName();
- if (TryInlinePolymorphicCallToSameTarget(invoke_instruction, resolved_method, ic)) {
+ if (TryInlinePolymorphicCallToSameTarget(invoke_instruction, resolved_method, classes)) {
return true;
}
@@ -472,16 +579,16 @@
bool all_targets_inlined = true;
bool one_target_inlined = false;
for (size_t i = 0; i < InlineCache::kIndividualCacheSize; ++i) {
- if (ic.GetTypeAt(i) == nullptr) {
+ if (classes->Get(i) == nullptr) {
break;
}
ArtMethod* method = nullptr;
if (invoke_instruction->IsInvokeInterface()) {
- method = ic.GetTypeAt(i)->FindVirtualMethodForInterface(
+ method = classes->Get(i)->FindVirtualMethodForInterface(
resolved_method, pointer_size);
} else {
DCHECK(invoke_instruction->IsInvokeVirtual());
- method = ic.GetTypeAt(i)->FindVirtualMethodForVirtual(
+ method = classes->Get(i)->FindVirtualMethodForVirtual(
resolved_method, pointer_size);
}
@@ -489,21 +596,21 @@
HInstruction* cursor = invoke_instruction->GetPrevious();
HBasicBlock* bb_cursor = invoke_instruction->GetBlock();
- uint32_t class_index = FindClassIndexIn(
- ic.GetTypeAt(i), caller_dex_file, caller_compilation_unit_.GetDexCache());
+ dex::TypeIndex class_index = FindClassIndexIn(
+ classes->Get(i), caller_dex_file, caller_compilation_unit_.GetDexCache());
HInstruction* return_replacement = nullptr;
- if (class_index == DexFile::kDexNoIndex ||
+ if (!class_index.IsValid() ||
!TryBuildAndInline(invoke_instruction, method, &return_replacement)) {
all_targets_inlined = false;
} else {
one_target_inlined = true;
- bool is_referrer = (ic.GetTypeAt(i) == outermost_graph_->GetArtMethod()->GetDeclaringClass());
+ bool is_referrer = (classes->Get(i) == outermost_graph_->GetArtMethod()->GetDeclaringClass());
// If we have inlined all targets before, and this receiver is the last seen,
// we deoptimize instead of keeping the original invoke instruction.
bool deoptimize = all_targets_inlined &&
(i != InlineCache::kIndividualCacheSize - 1) &&
- (ic.GetTypeAt(i + 1) == nullptr);
+ (classes->Get(i + 1) == nullptr);
if (outermost_graph_->IsCompilingOsr()) {
// We do not support HDeoptimize in OSR methods.
@@ -618,9 +725,10 @@
merge, original_invoke_block, /* replace_if_back_edge */ true);
}
-bool HInliner::TryInlinePolymorphicCallToSameTarget(HInvoke* invoke_instruction,
- ArtMethod* resolved_method,
- const InlineCache& ic) {
+bool HInliner::TryInlinePolymorphicCallToSameTarget(
+ HInvoke* invoke_instruction,
+ ArtMethod* resolved_method,
+ Handle<mirror::ObjectArray<mirror::Class>> classes) {
// This optimization only works under JIT for now.
DCHECK(Runtime::Current()->UseJitCompilation());
if (graph_->GetInstructionSet() == kMips64) {
@@ -639,12 +747,12 @@
// Check whether we are actually calling the same method among
// the different types seen.
for (size_t i = 0; i < InlineCache::kIndividualCacheSize; ++i) {
- if (ic.GetTypeAt(i) == nullptr) {
+ if (classes->Get(i) == nullptr) {
break;
}
ArtMethod* new_method = nullptr;
if (invoke_instruction->IsInvokeInterface()) {
- new_method = ic.GetTypeAt(i)->GetImt(pointer_size)->Get(
+ new_method = classes->Get(i)->GetImt(pointer_size)->Get(
method_index, pointer_size);
if (new_method->IsRuntimeMethod()) {
// Bail out as soon as we see a conflict trampoline in one of the target's
@@ -653,7 +761,7 @@
}
} else {
DCHECK(invoke_instruction->IsInvokeVirtual());
- new_method = ic.GetTypeAt(i)->GetEmbeddedVTableEntry(method_index, pointer_size);
+ new_method = classes->Get(i)->GetEmbeddedVTableEntry(method_index, pointer_size);
}
DCHECK(new_method != nullptr);
if (actual_method == nullptr) {
@@ -735,8 +843,14 @@
return true;
}
-bool HInliner::TryInlineAndReplace(HInvoke* invoke_instruction, ArtMethod* method, bool do_rtp) {
+bool HInliner::TryInlineAndReplace(HInvoke* invoke_instruction,
+ ArtMethod* method,
+ bool do_rtp,
+ bool cha_devirtualize) {
HInstruction* return_replacement = nullptr;
+ uint32_t dex_pc = invoke_instruction->GetDexPc();
+ HInstruction* cursor = invoke_instruction->GetPrevious();
+ HBasicBlock* bb_cursor = invoke_instruction->GetBlock();
if (!TryBuildAndInline(invoke_instruction, method, &return_replacement)) {
if (invoke_instruction->IsInvokeInterface()) {
// Turn an invoke-interface into an invoke-virtual. An invoke-virtual is always
@@ -774,6 +888,9 @@
return false;
}
}
+ if (cha_devirtualize) {
+ AddCHAGuard(invoke_instruction, dex_pc, cursor, bb_cursor);
+ }
if (return_replacement != nullptr) {
invoke_instruction->ReplaceWith(return_replacement);
}
@@ -1327,7 +1444,7 @@
// optimization that could lead to a HDeoptimize. The following optimizations do not.
HDeadCodeElimination dce(callee_graph, stats_, "dead_code_elimination$inliner");
HConstantFolding fold(callee_graph, "constant_folding$inliner");
- HSharpening sharpening(callee_graph, codegen_, dex_compilation_unit, compiler_driver_);
+ HSharpening sharpening(callee_graph, codegen_, dex_compilation_unit, compiler_driver_, handles_);
InstructionSimplifier simplify(callee_graph, stats_);
IntrinsicsRecognizer intrinsics(callee_graph, stats_);
diff --git a/compiler/optimizing/inliner.h b/compiler/optimizing/inliner.h
index a1dcd58..ffebd97 100644
--- a/compiler/optimizing/inliner.h
+++ b/compiler/optimizing/inliner.h
@@ -17,6 +17,7 @@
#ifndef ART_COMPILER_OPTIMIZING_INLINER_H_
#define ART_COMPILER_OPTIMIZING_INLINER_H_
+#include "dex_file_types.h"
#include "invoke_type.h"
#include "optimization.h"
@@ -27,7 +28,6 @@
class DexCompilationUnit;
class HGraph;
class HInvoke;
-class InlineCache;
class OptimizingCompilerStats;
class HInliner : public HOptimization {
@@ -62,8 +62,12 @@
// Try to inline `resolved_method` in place of `invoke_instruction`. `do_rtp` is whether
// reference type propagation can run after the inlining. If the inlining is successful, this
- // method will replace and remove the `invoke_instruction`.
- bool TryInlineAndReplace(HInvoke* invoke_instruction, ArtMethod* resolved_method, bool do_rtp)
+ // method will replace and remove the `invoke_instruction`. If `cha_devirtualize` is true,
+ // a CHA guard needs to be added for the inlining.
+ bool TryInlineAndReplace(HInvoke* invoke_instruction,
+ ArtMethod* resolved_method,
+ bool do_rtp,
+ bool cha_devirtualize)
REQUIRES_SHARED(Locks::mutator_lock_);
bool TryBuildAndInline(HInvoke* invoke_instruction,
@@ -104,20 +108,32 @@
// ... // inlined code
bool TryInlineMonomorphicCall(HInvoke* invoke_instruction,
ArtMethod* resolved_method,
- const InlineCache& ic)
+ Handle<mirror::ObjectArray<mirror::Class>> classes)
REQUIRES_SHARED(Locks::mutator_lock_);
// Try to inline targets of a polymorphic call.
bool TryInlinePolymorphicCall(HInvoke* invoke_instruction,
ArtMethod* resolved_method,
- const InlineCache& ic)
+ Handle<mirror::ObjectArray<mirror::Class>> classes)
REQUIRES_SHARED(Locks::mutator_lock_);
bool TryInlinePolymorphicCallToSameTarget(HInvoke* invoke_instruction,
ArtMethod* resolved_method,
- const InlineCache& ic)
+ Handle<mirror::ObjectArray<mirror::Class>> classes)
REQUIRES_SHARED(Locks::mutator_lock_);
+ // Try CHA-based devirtualization to change virtual method calls into
+ // direct calls.
+ // Returns the actual method that resolved_method can be devirtualized to.
+ ArtMethod* TryCHADevirtualization(ArtMethod* resolved_method)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // Add a CHA guard for a CHA-based devirtualized call. A CHA guard checks a
+ // should_deoptimize flag and if it's true, does deoptimization.
+ void AddCHAGuard(HInstruction* invoke_instruction,
+ uint32_t dex_pc,
+ HInstruction* cursor,
+ HBasicBlock* bb_cursor);
HInstanceFieldGet* BuildGetReceiverClass(ClassLinker* class_linker,
HInstruction* receiver,
@@ -150,7 +166,7 @@
HInstruction* AddTypeGuard(HInstruction* receiver,
HInstruction* cursor,
HBasicBlock* bb_cursor,
- uint32_t class_index,
+ dex::TypeIndex class_index,
bool is_referrer,
HInstruction* invoke_instruction,
bool with_deoptimization)
diff --git a/compiler/optimizing/instruction_builder.cc b/compiler/optimizing/instruction_builder.cc
index b44137d..b97581b 100644
--- a/compiler/optimizing/instruction_builder.cc
+++ b/compiler/optimizing/instruction_builder.cc
@@ -908,7 +908,7 @@
false /* is_unresolved */);
}
-bool HInstructionBuilder::BuildNewInstance(uint16_t type_index, uint32_t dex_pc) {
+bool HInstructionBuilder::BuildNewInstance(dex::TypeIndex type_index, uint32_t dex_pc) {
ScopedObjectAccess soa(Thread::Current());
StackHandleScope<1> hs(soa.Self());
Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
@@ -1004,7 +1004,7 @@
Handle<mirror::Class> resolved_method_class(hs.NewHandle(resolved_method->GetDeclaringClass()));
// The index at which the method's class is stored in the DexCache's type array.
- uint32_t storage_index = DexFile::kDexNoIndex;
+ dex::TypeIndex storage_index;
bool is_outer_class = (resolved_method->GetDeclaringClass() == outer_class.Get());
if (is_outer_class) {
storage_index = outer_class->GetDexTypeIndex();
@@ -1021,7 +1021,7 @@
if (IsInitialized(resolved_method_class)) {
*clinit_check_requirement = HInvokeStaticOrDirect::ClinitCheckRequirement::kNone;
- } else if (storage_index != DexFile::kDexNoIndex) {
+ } else if (storage_index.IsValid()) {
*clinit_check_requirement = HInvokeStaticOrDirect::ClinitCheckRequirement::kExplicit;
HLoadClass* load_class = new (arena_) HLoadClass(
graph_->GetCurrentMethod(),
@@ -1297,7 +1297,7 @@
return GetClassFrom(compiler_driver_, *dex_compilation_unit_);
}
-bool HInstructionBuilder::IsOutermostCompilingClass(uint16_t type_index) const {
+bool HInstructionBuilder::IsOutermostCompilingClass(dex::TypeIndex type_index) const {
ScopedObjectAccess soa(Thread::Current());
StackHandleScope<3> hs(soa.Self());
Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
@@ -1360,7 +1360,7 @@
Handle<mirror::Class> outer_class(hs.NewHandle(GetOutermostCompilingClass()));
// The index at which the field's class is stored in the DexCache's type array.
- uint32_t storage_index;
+ dex::TypeIndex storage_index;
bool is_outer_class = (outer_class.Get() == resolved_field->GetDeclaringClass());
if (is_outer_class) {
storage_index = outer_class->GetDexTypeIndex();
@@ -1497,7 +1497,7 @@
}
void HInstructionBuilder::BuildFilledNewArray(uint32_t dex_pc,
- uint32_t type_index,
+ dex::TypeIndex type_index,
uint32_t number_of_vreg_arguments,
bool is_range,
uint32_t* args,
@@ -1644,7 +1644,7 @@
void HInstructionBuilder::BuildTypeCheck(const Instruction& instruction,
uint8_t destination,
uint8_t reference,
- uint16_t type_index,
+ dex::TypeIndex type_index,
uint32_t dex_pc) {
ScopedObjectAccess soa(Thread::Current());
StackHandleScope<1> hs(soa.Self());
@@ -1684,14 +1684,14 @@
}
}
-bool HInstructionBuilder::NeedsAccessCheck(uint32_t type_index,
+bool HInstructionBuilder::NeedsAccessCheck(dex::TypeIndex type_index,
Handle<mirror::DexCache> dex_cache,
bool* finalizable) const {
return !compiler_driver_->CanAccessInstantiableTypeWithoutChecks(
dex_compilation_unit_->GetDexMethodIndex(), dex_cache, type_index, finalizable);
}
-bool HInstructionBuilder::NeedsAccessCheck(uint32_t type_index, bool* finalizable) const {
+bool HInstructionBuilder::NeedsAccessCheck(dex::TypeIndex type_index, bool* finalizable) const {
ScopedObjectAccess soa(Thread::Current());
Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
return NeedsAccessCheck(type_index, dex_cache, finalizable);
@@ -2449,7 +2449,7 @@
}
case Instruction::NEW_INSTANCE: {
- if (!BuildNewInstance(instruction.VRegB_21c(), dex_pc)) {
+ if (!BuildNewInstance(dex::TypeIndex(instruction.VRegB_21c()), dex_pc)) {
return false;
}
UpdateLocal(instruction.VRegA(), current_block_->GetLastInstruction());
@@ -2457,7 +2457,7 @@
}
case Instruction::NEW_ARRAY: {
- uint16_t type_index = instruction.VRegC_22c();
+ dex::TypeIndex type_index(instruction.VRegC_22c());
HInstruction* length = LoadLocal(instruction.VRegB_22c(), Primitive::kPrimInt);
bool finalizable;
QuickEntrypointEnum entrypoint = NeedsAccessCheck(type_index, &finalizable)
@@ -2475,7 +2475,7 @@
case Instruction::FILLED_NEW_ARRAY: {
uint32_t number_of_vreg_arguments = instruction.VRegA_35c();
- uint32_t type_index = instruction.VRegB_35c();
+ dex::TypeIndex type_index(instruction.VRegB_35c());
uint32_t args[5];
instruction.GetVarArgs(args);
BuildFilledNewArray(dex_pc, type_index, number_of_vreg_arguments, false, args, 0);
@@ -2484,7 +2484,7 @@
case Instruction::FILLED_NEW_ARRAY_RANGE: {
uint32_t number_of_vreg_arguments = instruction.VRegA_3rc();
- uint32_t type_index = instruction.VRegB_3rc();
+ dex::TypeIndex type_index(instruction.VRegB_3rc());
uint32_t register_index = instruction.VRegC_3rc();
BuildFilledNewArray(
dex_pc, type_index, number_of_vreg_arguments, true, nullptr, register_index);
@@ -2625,7 +2625,7 @@
}
case Instruction::CONST_STRING: {
- uint32_t string_index = instruction.VRegB_21c();
+ dex::StringIndex string_index(instruction.VRegB_21c());
AppendInstruction(
new (arena_) HLoadString(graph_->GetCurrentMethod(), string_index, *dex_file_, dex_pc));
UpdateLocal(instruction.VRegA_21c(), current_block_->GetLastInstruction());
@@ -2633,7 +2633,7 @@
}
case Instruction::CONST_STRING_JUMBO: {
- uint32_t string_index = instruction.VRegB_31c();
+ dex::StringIndex string_index(instruction.VRegB_31c());
AppendInstruction(
new (arena_) HLoadString(graph_->GetCurrentMethod(), string_index, *dex_file_, dex_pc));
UpdateLocal(instruction.VRegA_31c(), current_block_->GetLastInstruction());
@@ -2641,7 +2641,7 @@
}
case Instruction::CONST_CLASS: {
- uint16_t type_index = instruction.VRegB_21c();
+ dex::TypeIndex type_index(instruction.VRegB_21c());
// `CanAccessTypeWithoutChecks` will tell whether the method being
// built is trying to access its own class, so that the generated
// code can optimize for this case. However, the optimization does not
@@ -2682,14 +2682,14 @@
case Instruction::INSTANCE_OF: {
uint8_t destination = instruction.VRegA_22c();
uint8_t reference = instruction.VRegB_22c();
- uint16_t type_index = instruction.VRegC_22c();
+ dex::TypeIndex type_index(instruction.VRegC_22c());
BuildTypeCheck(instruction, destination, reference, type_index, dex_pc);
break;
}
case Instruction::CHECK_CAST: {
uint8_t reference = instruction.VRegA_21c();
- uint16_t type_index = instruction.VRegB_21c();
+ dex::TypeIndex type_index(instruction.VRegB_21c());
BuildTypeCheck(instruction, -1, reference, type_index, dex_pc);
break;
}
diff --git a/compiler/optimizing/instruction_builder.h b/compiler/optimizing/instruction_builder.h
index aa34ddd..f29e522 100644
--- a/compiler/optimizing/instruction_builder.h
+++ b/compiler/optimizing/instruction_builder.h
@@ -20,6 +20,7 @@
#include "base/arena_containers.h"
#include "base/arena_object.h"
#include "block_builder.h"
+#include "dex_file_types.h"
#include "driver/compiler_driver.h"
#include "driver/compiler_driver-inl.h"
#include "driver/dex_compilation_unit.h"
@@ -100,11 +101,11 @@
// Returns whether the current method needs access check for the type.
// Output parameter finalizable is set to whether the type is finalizable.
- bool NeedsAccessCheck(uint32_t type_index,
+ bool NeedsAccessCheck(dex::TypeIndex type_index,
Handle<mirror::DexCache> dex_cache,
/*out*/bool* finalizable) const
REQUIRES_SHARED(Locks::mutator_lock_);
- bool NeedsAccessCheck(uint32_t type_index, /*out*/bool* finalizable) const;
+ bool NeedsAccessCheck(dex::TypeIndex type_index, /*out*/bool* finalizable) const;
template<typename T>
void Unop_12x(const Instruction& instruction, Primitive::Type type, uint32_t dex_pc);
@@ -176,7 +177,7 @@
// Builds a new array node and the instructions that fill it.
void BuildFilledNewArray(uint32_t dex_pc,
- uint32_t type_index,
+ dex::TypeIndex type_index,
uint32_t number_of_vreg_arguments,
bool is_range,
uint32_t* args,
@@ -205,7 +206,7 @@
void BuildTypeCheck(const Instruction& instruction,
uint8_t destination,
uint8_t reference,
- uint16_t type_index,
+ dex::TypeIndex type_index,
uint32_t dex_pc);
// Builds an instruction sequence for a switch statement.
@@ -218,7 +219,7 @@
mirror::Class* GetCompilingClass() const;
// Returns whether `type_index` points to the outer-most compiling method's class.
- bool IsOutermostCompilingClass(uint16_t type_index) const;
+ bool IsOutermostCompilingClass(dex::TypeIndex type_index) const;
void PotentiallySimplifyFakeString(uint16_t original_dex_register,
uint32_t dex_pc,
@@ -258,7 +259,7 @@
REQUIRES_SHARED(Locks::mutator_lock_);
// Build a HNewInstance instruction.
- bool BuildNewInstance(uint16_t type_index, uint32_t dex_pc);
+ bool BuildNewInstance(dex::TypeIndex type_index, uint32_t dex_pc);
// Return whether the compiler can assume `cls` is initialized.
bool IsInitialized(Handle<mirror::Class> cls) const
diff --git a/compiler/optimizing/instruction_simplifier.cc b/compiler/optimizing/instruction_simplifier.cc
index 85b461d..439e3b6 100644
--- a/compiler/optimizing/instruction_simplifier.cc
+++ b/compiler/optimizing/instruction_simplifier.cc
@@ -16,6 +16,7 @@
#include "instruction_simplifier.h"
+#include "escape.h"
#include "intrinsics.h"
#include "mirror/class-inl.h"
#include "scoped_thread_state_change-inl.h"
@@ -107,6 +108,8 @@
void SimplifyStringCharAt(HInvoke* invoke);
void SimplifyStringIsEmptyOrLength(HInvoke* invoke);
void SimplifyNPEOnArgN(HInvoke* invoke, size_t);
+ void SimplifyReturnThis(HInvoke* invoke);
+ void SimplifyAllocationIntrinsic(HInvoke* invoke);
void SimplifyMemBarrier(HInvoke* invoke, MemBarrierKind barrier_kind);
OptimizingCompilerStats* stats_;
@@ -1182,6 +1185,18 @@
RecordSimplification();
}
+// Return whether x / divisor == x * (1.0f / divisor), for every float x.
+static constexpr bool CanDivideByReciprocalMultiplyFloat(int32_t divisor) {
+ // True, if the most significant bits of divisor are 0.
+ return ((divisor & 0x7fffff) == 0);
+}
+
+// Return whether x / divisor == x * (1.0 / divisor), for every double x.
+static constexpr bool CanDivideByReciprocalMultiplyDouble(int64_t divisor) {
+ // True, if the most significant bits of divisor are 0.
+ return ((divisor & ((UINT64_C(1) << 52) - 1)) == 0);
+}
+
void InstructionSimplifierVisitor::VisitDiv(HDiv* instruction) {
HConstant* input_cst = instruction->GetConstantRight();
HInstruction* input_other = instruction->GetLeastConstantLeft();
@@ -1864,11 +1879,62 @@
// is provably non-null, we can clear the flag.
void InstructionSimplifierVisitor::SimplifyNPEOnArgN(HInvoke* invoke, size_t n) {
HInstruction* arg = invoke->InputAt(n);
- if (!arg->CanBeNull()) {
+ if (invoke->CanThrow() && !arg->CanBeNull()) {
invoke->SetCanThrow(false);
}
}
+// Methods that return "this" can replace the returned value with the receiver.
+void InstructionSimplifierVisitor::SimplifyReturnThis(HInvoke* invoke) {
+ if (invoke->HasUses()) {
+ HInstruction* receiver = invoke->InputAt(0);
+ invoke->ReplaceWith(receiver);
+ RecordSimplification();
+ }
+}
+
+// Helper method for StringBuffer escape analysis.
+static bool NoEscapeForStringBufferReference(HInstruction* reference, HInstruction* user) {
+ if (user->IsInvokeStaticOrDirect()) {
+ // Any constructor on StringBuffer is okay.
+ return user->AsInvokeStaticOrDirect()->GetResolvedMethod() != nullptr &&
+ user->AsInvokeStaticOrDirect()->GetResolvedMethod()->IsConstructor() &&
+ user->InputAt(0) == reference;
+ } else if (user->IsInvokeVirtual()) {
+ switch (user->AsInvokeVirtual()->GetIntrinsic()) {
+ case Intrinsics::kStringBufferLength:
+ case Intrinsics::kStringBufferToString:
+ DCHECK_EQ(user->InputAt(0), reference);
+ return true;
+ case Intrinsics::kStringBufferAppend:
+ // Returns "this", so only okay if no further uses.
+ DCHECK_EQ(user->InputAt(0), reference);
+ DCHECK_NE(user->InputAt(1), reference);
+ return !user->HasUses();
+ default:
+ break;
+ }
+ }
+ return false;
+}
+
+// Certain allocation intrinsics are not removed by dead code elimination
+// because of potentially throwing an OOM exception or other side effects.
+// This method removes such intrinsics when special circumstances allow.
+void InstructionSimplifierVisitor::SimplifyAllocationIntrinsic(HInvoke* invoke) {
+ if (!invoke->HasUses()) {
+ // Instruction has no uses. If unsynchronized, we can remove right away, safely ignoring
+ // the potential OOM of course. Otherwise, we must ensure the receiver object of this
+ // call does not escape since only thread-local synchronization may be removed.
+ bool is_synchronized = invoke->GetIntrinsic() == Intrinsics::kStringBufferToString;
+ HInstruction* receiver = invoke->InputAt(0);
+ if (!is_synchronized || DoesNotEscape(receiver, NoEscapeForStringBufferReference)) {
+ invoke->GetBlock()->RemoveInstruction(invoke);
+ RecordSimplification();
+ }
+ }
+}
+
void InstructionSimplifierVisitor::SimplifyMemBarrier(HInvoke* invoke, MemBarrierKind barrier_kind) {
uint32_t dex_pc = invoke->GetDexPc();
HMemoryBarrier* mem_barrier = new (GetGraph()->GetArena()) HMemoryBarrier(barrier_kind, dex_pc);
@@ -1926,6 +1992,14 @@
case Intrinsics::kStringStringIndexOfAfter:
SimplifyNPEOnArgN(instruction, 1); // 0th has own NullCheck
break;
+ case Intrinsics::kStringBufferAppend:
+ case Intrinsics::kStringBuilderAppend:
+ SimplifyReturnThis(instruction);
+ break;
+ case Intrinsics::kStringBufferToString:
+ case Intrinsics::kStringBuilderToString:
+ SimplifyAllocationIntrinsic(instruction);
+ break;
case Intrinsics::kUnsafeLoadFence:
SimplifyMemBarrier(instruction, MemBarrierKind::kLoadAny);
break;
diff --git a/compiler/optimizing/intrinsics_arm.cc b/compiler/optimizing/intrinsics_arm.cc
index 8234b24..8f64fae 100644
--- a/compiler/optimizing/intrinsics_arm.cc
+++ b/compiler/optimizing/intrinsics_arm.cc
@@ -2613,6 +2613,12 @@
UNIMPLEMENTED_INTRINSIC(ARM, StringStringIndexOf);
UNIMPLEMENTED_INTRINSIC(ARM, StringStringIndexOfAfter);
+UNIMPLEMENTED_INTRINSIC(ARM, StringBufferAppend);
+UNIMPLEMENTED_INTRINSIC(ARM, StringBufferLength);
+UNIMPLEMENTED_INTRINSIC(ARM, StringBufferToString);
+UNIMPLEMENTED_INTRINSIC(ARM, StringBuilderAppend);
+UNIMPLEMENTED_INTRINSIC(ARM, StringBuilderLength);
+UNIMPLEMENTED_INTRINSIC(ARM, StringBuilderToString);
// 1.8.
UNIMPLEMENTED_INTRINSIC(ARM, UnsafeGetAndAddInt)
diff --git a/compiler/optimizing/intrinsics_arm64.cc b/compiler/optimizing/intrinsics_arm64.cc
index 451abc5..d8a896e 100644
--- a/compiler/optimizing/intrinsics_arm64.cc
+++ b/compiler/optimizing/intrinsics_arm64.cc
@@ -2165,11 +2165,11 @@
__ Cbz(dst, slow_path->GetEntryLabel());
if (!length.IsConstant()) {
- // If the length is negative, bail out.
- __ Tbnz(WRegisterFrom(length), kWRegSize - 1, slow_path->GetEntryLabel());
- // If the length > 32 then (currently) prefer libcore's native implementation.
+ // Merge the following two comparisons into one:
+ // If the length is negative, bail out (delegate to libcore's native implementation).
+ // If the length > 32 then (currently) prefer libcore's native implementation.
__ Cmp(WRegisterFrom(length), kSystemArrayCopyCharThreshold);
- __ B(slow_path->GetEntryLabel(), gt);
+ __ B(slow_path->GetEntryLabel(), hi);
} else {
// We have already checked in the LocationsBuilder for the constant case.
DCHECK_GE(length.GetConstant()->AsIntConstant()->GetValue(), 0);
@@ -2379,11 +2379,11 @@
if (!length.IsConstant() &&
!optimizations.GetCountIsSourceLength() &&
!optimizations.GetCountIsDestinationLength()) {
- // If the length is negative, bail out.
- __ Tbnz(WRegisterFrom(length), kWRegSize - 1, intrinsic_slow_path->GetEntryLabel());
- // If the length >= 128 then (currently) prefer native implementation.
+ // Merge the following two comparisons into one:
+ // If the length is negative, bail out (delegate to libcore's native implementation).
+ // If the length >= 128 then (currently) prefer native implementation.
__ Cmp(WRegisterFrom(length), kSystemArrayCopyThreshold);
- __ B(intrinsic_slow_path->GetEntryLabel(), ge);
+ __ B(intrinsic_slow_path->GetEntryLabel(), hs);
}
// Validity checks: source.
CheckSystemArrayCopyPosition(masm,
@@ -2781,6 +2781,12 @@
UNIMPLEMENTED_INTRINSIC(ARM64, StringStringIndexOf);
UNIMPLEMENTED_INTRINSIC(ARM64, StringStringIndexOfAfter);
+UNIMPLEMENTED_INTRINSIC(ARM64, StringBufferAppend);
+UNIMPLEMENTED_INTRINSIC(ARM64, StringBufferLength);
+UNIMPLEMENTED_INTRINSIC(ARM64, StringBufferToString);
+UNIMPLEMENTED_INTRINSIC(ARM64, StringBuilderAppend);
+UNIMPLEMENTED_INTRINSIC(ARM64, StringBuilderLength);
+UNIMPLEMENTED_INTRINSIC(ARM64, StringBuilderToString);
// 1.8.
UNIMPLEMENTED_INTRINSIC(ARM64, UnsafeGetAndAddInt)
diff --git a/compiler/optimizing/intrinsics_arm_vixl.cc b/compiler/optimizing/intrinsics_arm_vixl.cc
index e4bef34..641a5c9 100644
--- a/compiler/optimizing/intrinsics_arm_vixl.cc
+++ b/compiler/optimizing/intrinsics_arm_vixl.cc
@@ -47,6 +47,9 @@
using namespace vixl::aarch32; // NOLINT(build/namespaces)
+using vixl::ExactAssemblyScope;
+using vixl::CodeBufferCheckScope;
+
ArmVIXLAssembler* IntrinsicCodeGeneratorARMVIXL::GetAssembler() {
return codegen_->GetAssembler();
}
@@ -71,7 +74,7 @@
: SlowPathCodeARMVIXL(invoke), invoke_(invoke) {}
Location MoveArguments(CodeGenerator* codegen) {
- InvokeDexCallingConventionVisitorARM calling_convention_visitor;
+ InvokeDexCallingConventionVisitorARMVIXL calling_convention_visitor;
IntrinsicVisitor::MoveArguments(invoke_, codegen, &calling_convention_visitor);
return calling_convention_visitor.GetMethodLocation();
}
@@ -303,7 +306,7 @@
vixl32::Register in_reg_hi = HighRegisterFrom(in);
vixl32::Label end;
__ Clz(out, in_reg_hi);
- __ Cbnz(in_reg_hi, &end);
+ __ CompareAndBranchIfNonZero(in_reg_hi, &end, /* far_target */ false);
__ Clz(out, in_reg_lo);
__ Add(out, out, 32);
__ Bind(&end);
@@ -345,7 +348,7 @@
vixl32::Label end;
__ Rbit(out, in_reg_lo);
__ Clz(out, out);
- __ Cbnz(in_reg_lo, &end);
+ __ CompareAndBranchIfNonZero(in_reg_lo, &end, /* far_target */ false);
__ Rbit(out, in_reg_hi);
__ Clz(out, out);
__ Add(out, out, 32);
@@ -467,9 +470,9 @@
__ Cmp(op1, op2);
{
- AssemblerAccurateScope aas(assembler->GetVIXLAssembler(),
- 3 * kMaxInstructionSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope aas(assembler->GetVIXLAssembler(),
+ 3 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ ite(is_min ? lt : gt);
__ mov(is_min ? lt : gt, out, op1);
@@ -518,7 +521,7 @@
void IntrinsicCodeGeneratorARMVIXL::VisitMemoryPeekByte(HInvoke* invoke) {
ArmVIXLAssembler* assembler = GetAssembler();
// Ignore upper 4B of long address.
- __ Ldrsb(OutputRegister(invoke), LowRegisterFrom(invoke->GetLocations()->InAt(0)));
+ __ Ldrsb(OutputRegister(invoke), MemOperand(LowRegisterFrom(invoke->GetLocations()->InAt(0))));
}
void IntrinsicLocationsBuilderARMVIXL::VisitMemoryPeekIntNative(HInvoke* invoke) {
@@ -528,7 +531,7 @@
void IntrinsicCodeGeneratorARMVIXL::VisitMemoryPeekIntNative(HInvoke* invoke) {
ArmVIXLAssembler* assembler = GetAssembler();
// Ignore upper 4B of long address.
- __ Ldr(OutputRegister(invoke), LowRegisterFrom(invoke->GetLocations()->InAt(0)));
+ __ Ldr(OutputRegister(invoke), MemOperand(LowRegisterFrom(invoke->GetLocations()->InAt(0))));
}
void IntrinsicLocationsBuilderARMVIXL::VisitMemoryPeekLongNative(HInvoke* invoke) {
@@ -545,9 +548,9 @@
vixl32::Register hi = HighRegisterFrom(invoke->GetLocations()->Out());
if (addr.Is(lo)) {
__ Ldr(hi, MemOperand(addr, 4));
- __ Ldr(lo, addr);
+ __ Ldr(lo, MemOperand(addr));
} else {
- __ Ldr(lo, addr);
+ __ Ldr(lo, MemOperand(addr));
__ Ldr(hi, MemOperand(addr, 4));
}
}
@@ -559,7 +562,7 @@
void IntrinsicCodeGeneratorARMVIXL::VisitMemoryPeekShortNative(HInvoke* invoke) {
ArmVIXLAssembler* assembler = GetAssembler();
// Ignore upper 4B of long address.
- __ Ldrsh(OutputRegister(invoke), LowRegisterFrom(invoke->GetLocations()->InAt(0)));
+ __ Ldrsh(OutputRegister(invoke), MemOperand(LowRegisterFrom(invoke->GetLocations()->InAt(0))));
}
static void CreateIntIntToVoidLocations(ArenaAllocator* arena, HInvoke* invoke) {
@@ -576,7 +579,7 @@
void IntrinsicCodeGeneratorARMVIXL::VisitMemoryPokeByte(HInvoke* invoke) {
ArmVIXLAssembler* assembler = GetAssembler();
- __ Strb(InputRegisterAt(invoke, 1), LowRegisterFrom(invoke->GetLocations()->InAt(0)));
+ __ Strb(InputRegisterAt(invoke, 1), MemOperand(LowRegisterFrom(invoke->GetLocations()->InAt(0))));
}
void IntrinsicLocationsBuilderARMVIXL::VisitMemoryPokeIntNative(HInvoke* invoke) {
@@ -585,7 +588,7 @@
void IntrinsicCodeGeneratorARMVIXL::VisitMemoryPokeIntNative(HInvoke* invoke) {
ArmVIXLAssembler* assembler = GetAssembler();
- __ Str(InputRegisterAt(invoke, 1), LowRegisterFrom(invoke->GetLocations()->InAt(0)));
+ __ Str(InputRegisterAt(invoke, 1), MemOperand(LowRegisterFrom(invoke->GetLocations()->InAt(0))));
}
void IntrinsicLocationsBuilderARMVIXL::VisitMemoryPokeLongNative(HInvoke* invoke) {
@@ -598,7 +601,7 @@
vixl32::Register addr = LowRegisterFrom(invoke->GetLocations()->InAt(0));
// Worst case: Control register bit SCTLR.A = 0. Then unaligned accesses throw a processor
// exception. So we can't use ldrd as addr may be unaligned.
- __ Str(LowRegisterFrom(invoke->GetLocations()->InAt(1)), addr);
+ __ Str(LowRegisterFrom(invoke->GetLocations()->InAt(1)), MemOperand(addr));
__ Str(HighRegisterFrom(invoke->GetLocations()->InAt(1)), MemOperand(addr, 4));
}
@@ -608,7 +611,7 @@
void IntrinsicCodeGeneratorARMVIXL::VisitMemoryPokeShortNative(HInvoke* invoke) {
ArmVIXLAssembler* assembler = GetAssembler();
- __ Strh(InputRegisterAt(invoke, 1), LowRegisterFrom(invoke->GetLocations()->InAt(0)));
+ __ Strh(InputRegisterAt(invoke, 1), MemOperand(LowRegisterFrom(invoke->GetLocations()->InAt(0))));
}
void IntrinsicLocationsBuilderARMVIXL::VisitThreadCurrentThread(HInvoke* invoke) {
@@ -677,7 +680,10 @@
vixl32::Register trg_lo = LowRegisterFrom(trg_loc);
vixl32::Register trg_hi = HighRegisterFrom(trg_loc);
if (is_volatile && !codegen->GetInstructionSetFeatures().HasAtomicLdrdAndStrd()) {
- __ Ldrexd(trg_lo, trg_hi, MemOperand(base, offset));
+ UseScratchRegisterScope temps(assembler->GetVIXLAssembler());
+ const vixl32::Register temp_reg = temps.Acquire();
+ __ Add(temp_reg, base, offset);
+ __ Ldrexd(trg_lo, trg_hi, MemOperand(temp_reg));
} else {
__ Ldrd(trg_lo, trg_hi, MemOperand(base, offset));
}
@@ -842,8 +848,8 @@
__ Add(temp_reg, base, offset);
vixl32::Label loop_head;
__ Bind(&loop_head);
- __ Ldrexd(temp_lo, temp_hi, temp_reg);
- __ Strexd(temp_lo, value_lo, value_hi, temp_reg);
+ __ Ldrexd(temp_lo, temp_hi, MemOperand(temp_reg));
+ __ Strexd(temp_lo, value_lo, value_hi, MemOperand(temp_reg));
__ Cmp(temp_lo, 0);
__ B(ne, &loop_head);
} else {
@@ -1042,17 +1048,17 @@
vixl32::Label loop_head;
__ Bind(&loop_head);
- __ Ldrex(tmp, tmp_ptr);
+ __ Ldrex(tmp, MemOperand(tmp_ptr));
__ Subs(tmp, tmp, expected);
{
- AssemblerAccurateScope aas(assembler->GetVIXLAssembler(),
- 3 * kMaxInstructionSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope aas(assembler->GetVIXLAssembler(),
+ 3 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ itt(eq);
- __ strex(eq, tmp, value, tmp_ptr);
+ __ strex(eq, tmp, value, MemOperand(tmp_ptr));
__ cmp(eq, tmp, 1);
}
@@ -1063,9 +1069,9 @@
__ Rsbs(out, tmp, 1);
{
- AssemblerAccurateScope aas(assembler->GetVIXLAssembler(),
- 2 * kMaxInstructionSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope aas(assembler->GetVIXLAssembler(),
+ 2 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ it(cc);
__ mov(cc, out, 0);
@@ -1158,7 +1164,7 @@
if (can_slow_path) {
slow_path = new (GetAllocator()) IntrinsicSlowPathARMVIXL(invoke);
codegen_->AddSlowPath(slow_path);
- __ Cbz(arg, slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(arg, slow_path->GetEntryLabel());
}
// Reference equality check, return 0 if same reference.
@@ -1182,16 +1188,18 @@
// temp0 = min(len(str), len(arg)).
{
- AssemblerAccurateScope aas(assembler->GetVIXLAssembler(),
- 2 * kMaxInstructionSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope aas(assembler->GetVIXLAssembler(),
+ 2 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ it(gt);
__ mov(gt, temp0, temp1);
}
// Shorter string is empty?
- __ Cbz(temp0, &end);
+ // Note that mirror::kUseStringCompression==true introduces lots of instructions,
+ // which makes &end label far away from this branch and makes it not 'CBZ-encodable'.
+ __ CompareAndBranchIfZero(temp0, &end, mirror::kUseStringCompression);
if (mirror::kUseStringCompression) {
// Check if both strings using same compression style to use this comparison loop.
@@ -1202,9 +1210,9 @@
// This could in theory exceed INT32_MAX, so treat temp0 as unsigned.
__ Lsls(temp3, temp3, 31u); // Extract purely the compression flag.
- AssemblerAccurateScope aas(assembler->GetVIXLAssembler(),
- 2 * kMaxInstructionSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope aas(assembler->GetVIXLAssembler(),
+ 2 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ it(ne);
__ add(ne, temp0, temp0, temp0);
@@ -1218,7 +1226,7 @@
static_assert(IsAligned<8>(kObjectAlignment),
"String data must be 8-byte aligned for unrolled CompareTo loop.");
- const size_t char_size = Primitive::ComponentSize(Primitive::kPrimChar);
+ const unsigned char_size = Primitive::ComponentSize(Primitive::kPrimChar);
DCHECK_EQ(char_size, 2u);
UseScratchRegisterScope temps(assembler->GetVIXLAssembler());
@@ -1281,20 +1289,20 @@
// For compressed strings we need to clear 0x7 from temp1, for uncompressed we need to clear
// 0xf. We also need to prepare the character extraction mask `uncompressed ? 0xffffu : 0xffu`.
// The compression flag is now in the highest bit of temp3, so let's play some tricks.
- __ orr(temp3, temp3, 0xffu << 23); // uncompressed ? 0xff800000u : 0x7ff80000u
- __ bic(temp1, temp1, Operand(temp3, vixl32::LSR, 31 - 3)); // &= ~(uncompressed ? 0xfu : 0x7u)
+ __ Orr(temp3, temp3, 0xffu << 23); // uncompressed ? 0xff800000u : 0x7ff80000u
+ __ Bic(temp1, temp1, Operand(temp3, vixl32::LSR, 31 - 3)); // &= ~(uncompressed ? 0xfu : 0x7u)
__ Asr(temp3, temp3, 7u); // uncompressed ? 0xffff0000u : 0xff0000u.
__ Lsr(temp2, temp2, temp1); // Extract second character.
__ Lsr(temp3, temp3, 16u); // uncompressed ? 0xffffu : 0xffu
__ Lsr(out, temp_reg, temp1); // Extract first character.
- __ and_(temp2, temp2, temp3);
- __ and_(out, out, temp3);
+ __ And(temp2, temp2, temp3);
+ __ And(out, out, temp3);
} else {
- __ bic(temp1, temp1, 0xf);
+ __ Bic(temp1, temp1, 0xf);
__ Lsr(temp2, temp2, temp1);
__ Lsr(out, temp_reg, temp1);
- __ movt(temp2, 0);
- __ movt(out, 0);
+ __ Movt(temp2, 0);
+ __ Movt(out, 0);
}
__ Sub(out, out, temp2);
@@ -1313,24 +1321,24 @@
// need to treat as unsigned. Start by freeing the bit with an ADD and continue
// further down by a LSRS+SBC which will flip the meaning of the flag but allow
// `subs temp0, #2; bhi different_compression_loop` to serve as the loop condition.
- __ add(temp0, temp0, temp0); // Unlike LSL, this ADD is always 16-bit.
+ __ Add(temp0, temp0, temp0); // Unlike LSL, this ADD is always 16-bit.
// `temp1` will hold the compressed data pointer, `temp2` the uncompressed data pointer.
- __ mov(temp1, str);
- __ mov(temp2, arg);
+ __ Mov(temp1, str);
+ __ Mov(temp2, arg);
__ Lsrs(temp3, temp3, 1u); // Continue the move of the compression flag.
{
- AssemblerAccurateScope aas(assembler->GetVIXLAssembler(),
- 3 * kMaxInstructionSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope aas(assembler->GetVIXLAssembler(),
+ 3 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ itt(cs); // Interleave with selection of temp1 and temp2.
__ mov(cs, temp1, arg); // Preserves flags.
__ mov(cs, temp2, str); // Preserves flags.
}
- __ sbc(temp0, temp0, 0); // Complete the move of the compression flag.
+ __ Sbc(temp0, temp0, 0); // Complete the move of the compression flag.
// Adjust temp1 and temp2 from string pointers to data pointers.
- __ add(temp1, temp1, value_offset);
- __ add(temp2, temp2, value_offset);
+ __ Add(temp1, temp1, value_offset);
+ __ Add(temp2, temp2, value_offset);
vixl32::Label different_compression_loop;
vixl32::Label different_compression_diff;
@@ -1340,7 +1348,7 @@
__ Bind(&different_compression_loop);
__ Ldrb(temp_reg, MemOperand(temp1, c_char_size, PostIndex));
__ Ldrh(temp3, MemOperand(temp2, char_size, PostIndex));
- __ cmp(temp_reg, temp3);
+ __ Cmp(temp_reg, temp3);
__ B(ne, &different_compression_diff);
__ Subs(temp0, temp0, 2);
__ B(hi, &different_compression_loop);
@@ -1356,9 +1364,9 @@
static_assert(static_cast<uint32_t>(mirror::StringCompressionFlag::kCompressed) == 0u,
"Expecting 0=compressed, 1=uncompressed");
- AssemblerAccurateScope aas(assembler->GetVIXLAssembler(),
- 2 * kMaxInstructionSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope aas(assembler->GetVIXLAssembler(),
+ 2 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ it(cc);
__ rsb(cc, out, out, 0);
}
@@ -1414,7 +1422,7 @@
StringEqualsOptimizations optimizations(invoke);
if (!optimizations.GetArgumentNotNull()) {
// Check if input is null, return false if it is.
- __ Cbz(arg, &return_false);
+ __ CompareAndBranchIfZero(arg, &return_false, /* far_target */ false);
}
// Reference equality check, return true if same reference.
@@ -1442,7 +1450,7 @@
// Return true if both strings are empty. Even with string compression `count == 0` means empty.
static_assert(static_cast<uint32_t>(mirror::StringCompressionFlag::kCompressed) == 0u,
"Expecting 0=compressed, 1=uncompressed");
- __ Cbz(temp, &return_true);
+ __ CompareAndBranchIfZero(temp, &return_true, /* far_target */ false);
// Assertions that must hold in order to compare strings 4 bytes at a time.
DCHECK_ALIGNED(value_offset, 4);
@@ -1452,9 +1460,9 @@
// For string compression, calculate the number of bytes to compare (not chars).
// This could in theory exceed INT32_MAX, so treat temp as unsigned.
__ Lsrs(temp, temp, 1u); // Extract length and check compression flag.
- AssemblerAccurateScope aas(assembler->GetVIXLAssembler(),
- 2 * kMaxInstructionSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope aas(assembler->GetVIXLAssembler(),
+ 2 * kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
__ it(cs); // If uncompressed,
__ add(cs, temp, temp, temp); // double the byte count.
}
@@ -1467,7 +1475,7 @@
__ Bind(&loop);
__ Ldr(out, MemOperand(str, temp1));
__ Ldr(temp2, MemOperand(arg, temp1));
- __ Add(temp1, temp1, sizeof(uint32_t));
+ __ Add(temp1, temp1, Operand::From(sizeof(uint32_t)));
__ Cmp(out, temp2);
__ B(ne, &return_false);
// With string compression, we have compared 4 bytes, otherwise 2 chars.
@@ -1501,7 +1509,7 @@
SlowPathCodeARMVIXL* slow_path = nullptr;
HInstruction* code_point = invoke->InputAt(1);
if (code_point->IsIntConstant()) {
- if (static_cast<uint32_t>(code_point->AsIntConstant()->GetValue()) >
+ if (static_cast<uint32_t>(Int32ConstantFrom(code_point)) >
std::numeric_limits<uint16_t>::max()) {
// Always needs the slow-path. We could directly dispatch to it, but this case should be
// rare, so for simplicity just put the full slow-path down and branch unconditionally.
@@ -1718,7 +1726,7 @@
} else if (length_is_input_length) {
// The only way the copy can succeed is if pos is zero.
vixl32::Register pos_reg = RegisterFrom(pos);
- __ Cbnz(pos_reg, slow_path->GetEntryLabel());
+ __ CompareAndBranchIfNonZero(pos_reg, slow_path->GetEntryLabel());
} else {
// Check that pos >= 0.
vixl32::Register pos_reg = RegisterFrom(pos);
@@ -1815,12 +1823,12 @@
if (!optimizations.GetSourceIsNotNull()) {
// Bail out if the source is null.
- __ Cbz(src, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(src, intrinsic_slow_path->GetEntryLabel());
}
if (!optimizations.GetDestinationIsNotNull() && !optimizations.GetDestinationIsSource()) {
// Bail out if the destination is null.
- __ Cbz(dest, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(dest, intrinsic_slow_path->GetEntryLabel());
}
// If the length is negative, bail out.
@@ -1865,13 +1873,13 @@
// /* HeapReference<Class> */ temp1 = temp1->component_type_
codegen_->GenerateFieldLoadWithBakerReadBarrier(
invoke, temp1_loc, temp1, component_offset, temp2_loc, /* needs_null_check */ false);
- __ Cbz(temp1, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(temp1, intrinsic_slow_path->GetEntryLabel());
// If heap poisoning is enabled, `temp1` has been unpoisoned
// by the the previous call to GenerateFieldLoadWithBakerReadBarrier.
// /* uint16_t */ temp1 = static_cast<uint16>(temp1->primitive_type_);
__ Ldrh(temp1, MemOperand(temp1, primitive_offset));
static_assert(Primitive::kPrimNot == 0, "Expected 0 for kPrimNot");
- __ Cbnz(temp1, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfNonZero(temp1, intrinsic_slow_path->GetEntryLabel());
}
// /* HeapReference<Class> */ temp1 = dest->klass_
@@ -1889,13 +1897,13 @@
// /* HeapReference<Class> */ temp2 = temp1->component_type_
codegen_->GenerateFieldLoadWithBakerReadBarrier(
invoke, temp2_loc, temp1, component_offset, temp3_loc, /* needs_null_check */ false);
- __ Cbz(temp2, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(temp2, intrinsic_slow_path->GetEntryLabel());
// If heap poisoning is enabled, `temp2` has been unpoisoned
// by the the previous call to GenerateFieldLoadWithBakerReadBarrier.
// /* uint16_t */ temp2 = static_cast<uint16>(temp2->primitive_type_);
__ Ldrh(temp2, MemOperand(temp2, primitive_offset));
static_assert(Primitive::kPrimNot == 0, "Expected 0 for kPrimNot");
- __ Cbnz(temp2, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfNonZero(temp2, intrinsic_slow_path->GetEntryLabel());
}
// For the same reason given earlier, `temp1` is not trashed by the
@@ -1918,7 +1926,7 @@
// comparison with null below, and this reference is not
// kept afterwards.
__ Ldr(temp1, MemOperand(temp1, super_offset));
- __ Cbnz(temp1, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfNonZero(temp1, intrinsic_slow_path->GetEntryLabel());
__ Bind(&do_copy);
} else {
__ B(ne, intrinsic_slow_path->GetEntryLabel());
@@ -1944,24 +1952,24 @@
// Bail out if the destination is not a non primitive array.
// /* HeapReference<Class> */ temp3 = temp1->component_type_
__ Ldr(temp3, MemOperand(temp1, component_offset));
- __ Cbz(temp3, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(temp3, intrinsic_slow_path->GetEntryLabel());
assembler->MaybeUnpoisonHeapReference(temp3);
// /* uint16_t */ temp3 = static_cast<uint16>(temp3->primitive_type_);
__ Ldrh(temp3, MemOperand(temp3, primitive_offset));
static_assert(Primitive::kPrimNot == 0, "Expected 0 for kPrimNot");
- __ Cbnz(temp3, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfNonZero(temp3, intrinsic_slow_path->GetEntryLabel());
}
if (!optimizations.GetSourceIsNonPrimitiveArray()) {
// Bail out if the source is not a non primitive array.
// /* HeapReference<Class> */ temp3 = temp2->component_type_
__ Ldr(temp3, MemOperand(temp2, component_offset));
- __ Cbz(temp3, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(temp3, intrinsic_slow_path->GetEntryLabel());
assembler->MaybeUnpoisonHeapReference(temp3);
// /* uint16_t */ temp3 = static_cast<uint16>(temp3->primitive_type_);
__ Ldrh(temp3, MemOperand(temp3, primitive_offset));
static_assert(Primitive::kPrimNot == 0, "Expected 0 for kPrimNot");
- __ Cbnz(temp3, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfNonZero(temp3, intrinsic_slow_path->GetEntryLabel());
}
__ Cmp(temp1, temp2);
@@ -1978,7 +1986,7 @@
// /* HeapReference<Class> */ temp1 = temp1->super_class_
__ Ldr(temp1, MemOperand(temp1, super_offset));
// No need to unpoison the result, we're comparing against null.
- __ Cbnz(temp1, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfNonZero(temp1, intrinsic_slow_path->GetEntryLabel());
__ Bind(&do_copy);
} else {
__ B(ne, intrinsic_slow_path->GetEntryLabel());
@@ -1994,7 +2002,7 @@
// /* HeapReference<Class> */ temp3 = temp1->component_type_
codegen_->GenerateFieldLoadWithBakerReadBarrier(
invoke, temp3_loc, temp1, component_offset, temp2_loc, /* needs_null_check */ false);
- __ Cbz(temp3, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(temp3, intrinsic_slow_path->GetEntryLabel());
// If heap poisoning is enabled, `temp3` has been unpoisoned
// by the the previous call to GenerateFieldLoadWithBakerReadBarrier.
} else {
@@ -2003,13 +2011,13 @@
assembler->MaybeUnpoisonHeapReference(temp1);
// /* HeapReference<Class> */ temp3 = temp1->component_type_
__ Ldr(temp3, MemOperand(temp1, component_offset));
- __ Cbz(temp3, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfZero(temp3, intrinsic_slow_path->GetEntryLabel());
assembler->MaybeUnpoisonHeapReference(temp3);
}
// /* uint16_t */ temp3 = static_cast<uint16>(temp3->primitive_type_);
__ Ldrh(temp3, MemOperand(temp3, primitive_offset));
static_assert(Primitive::kPrimNot == 0, "Expected 0 for kPrimNot");
- __ Cbnz(temp3, intrinsic_slow_path->GetEntryLabel());
+ __ CompareAndBranchIfNonZero(temp3, intrinsic_slow_path->GetEntryLabel());
}
int32_t element_size = Primitive::ComponentSize(Primitive::kPrimNot);
@@ -2701,6 +2709,12 @@
UNIMPLEMENTED_INTRINSIC(ARMVIXL, StringStringIndexOf);
UNIMPLEMENTED_INTRINSIC(ARMVIXL, StringStringIndexOfAfter);
+UNIMPLEMENTED_INTRINSIC(ARMVIXL, StringBufferAppend);
+UNIMPLEMENTED_INTRINSIC(ARMVIXL, StringBufferLength);
+UNIMPLEMENTED_INTRINSIC(ARMVIXL, StringBufferToString);
+UNIMPLEMENTED_INTRINSIC(ARMVIXL, StringBuilderAppend);
+UNIMPLEMENTED_INTRINSIC(ARMVIXL, StringBuilderLength);
+UNIMPLEMENTED_INTRINSIC(ARMVIXL, StringBuilderToString);
// 1.8.
UNIMPLEMENTED_INTRINSIC(ARMVIXL, UnsafeGetAndAddInt)
diff --git a/compiler/optimizing/intrinsics_mips.cc b/compiler/optimizing/intrinsics_mips.cc
index 7c81588..9b5d7a0 100644
--- a/compiler/optimizing/intrinsics_mips.cc
+++ b/compiler/optimizing/intrinsics_mips.cc
@@ -2497,6 +2497,12 @@
UNIMPLEMENTED_INTRINSIC(MIPS, StringStringIndexOf);
UNIMPLEMENTED_INTRINSIC(MIPS, StringStringIndexOfAfter);
+UNIMPLEMENTED_INTRINSIC(MIPS, StringBufferAppend);
+UNIMPLEMENTED_INTRINSIC(MIPS, StringBufferLength);
+UNIMPLEMENTED_INTRINSIC(MIPS, StringBufferToString);
+UNIMPLEMENTED_INTRINSIC(MIPS, StringBuilderAppend);
+UNIMPLEMENTED_INTRINSIC(MIPS, StringBuilderLength);
+UNIMPLEMENTED_INTRINSIC(MIPS, StringBuilderToString);
// 1.8.
UNIMPLEMENTED_INTRINSIC(MIPS, UnsafeGetAndAddInt)
diff --git a/compiler/optimizing/intrinsics_mips64.cc b/compiler/optimizing/intrinsics_mips64.cc
index 2d4f417..5a99886 100644
--- a/compiler/optimizing/intrinsics_mips64.cc
+++ b/compiler/optimizing/intrinsics_mips64.cc
@@ -1949,6 +1949,12 @@
UNIMPLEMENTED_INTRINSIC(MIPS64, StringStringIndexOf);
UNIMPLEMENTED_INTRINSIC(MIPS64, StringStringIndexOfAfter);
+UNIMPLEMENTED_INTRINSIC(MIPS64, StringBufferAppend);
+UNIMPLEMENTED_INTRINSIC(MIPS64, StringBufferLength);
+UNIMPLEMENTED_INTRINSIC(MIPS64, StringBufferToString);
+UNIMPLEMENTED_INTRINSIC(MIPS64, StringBuilderAppend);
+UNIMPLEMENTED_INTRINSIC(MIPS64, StringBuilderLength);
+UNIMPLEMENTED_INTRINSIC(MIPS64, StringBuilderToString);
// 1.8.
UNIMPLEMENTED_INTRINSIC(MIPS64, UnsafeGetAndAddInt)
diff --git a/compiler/optimizing/intrinsics_x86.cc b/compiler/optimizing/intrinsics_x86.cc
index 06ab46f..922c3bc 100644
--- a/compiler/optimizing/intrinsics_x86.cc
+++ b/compiler/optimizing/intrinsics_x86.cc
@@ -3331,6 +3331,12 @@
UNIMPLEMENTED_INTRINSIC(X86, StringStringIndexOf);
UNIMPLEMENTED_INTRINSIC(X86, StringStringIndexOfAfter);
+UNIMPLEMENTED_INTRINSIC(X86, StringBufferAppend);
+UNIMPLEMENTED_INTRINSIC(X86, StringBufferLength);
+UNIMPLEMENTED_INTRINSIC(X86, StringBufferToString);
+UNIMPLEMENTED_INTRINSIC(X86, StringBuilderAppend);
+UNIMPLEMENTED_INTRINSIC(X86, StringBuilderLength);
+UNIMPLEMENTED_INTRINSIC(X86, StringBuilderToString);
// 1.8.
UNIMPLEMENTED_INTRINSIC(X86, UnsafeGetAndAddInt)
diff --git a/compiler/optimizing/intrinsics_x86_64.cc b/compiler/optimizing/intrinsics_x86_64.cc
index 2ea8670..05d270a 100644
--- a/compiler/optimizing/intrinsics_x86_64.cc
+++ b/compiler/optimizing/intrinsics_x86_64.cc
@@ -3000,6 +3000,12 @@
UNIMPLEMENTED_INTRINSIC(X86_64, StringStringIndexOf);
UNIMPLEMENTED_INTRINSIC(X86_64, StringStringIndexOfAfter);
+UNIMPLEMENTED_INTRINSIC(X86_64, StringBufferAppend);
+UNIMPLEMENTED_INTRINSIC(X86_64, StringBufferLength);
+UNIMPLEMENTED_INTRINSIC(X86_64, StringBufferToString);
+UNIMPLEMENTED_INTRINSIC(X86_64, StringBuilderAppend);
+UNIMPLEMENTED_INTRINSIC(X86_64, StringBuilderLength);
+UNIMPLEMENTED_INTRINSIC(X86_64, StringBuilderToString);
// 1.8.
UNIMPLEMENTED_INTRINSIC(X86_64, UnsafeGetAndAddInt)
diff --git a/compiler/optimizing/licm_test.cc b/compiler/optimizing/licm_test.cc
index 2a62643..8c34dc6 100644
--- a/compiler/optimizing/licm_test.cc
+++ b/compiler/optimizing/licm_test.cc
@@ -63,7 +63,10 @@
return_->AddSuccessor(exit_);
// Provide boiler-plate instructions.
- parameter_ = new (&allocator_) HParameterValue(graph_->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ parameter_ = new (&allocator_) HParameterValue(graph_->GetDexFile(),
+ dex::TypeIndex(0),
+ 0,
+ Primitive::kPrimNot);
entry_->AddInstruction(parameter_);
int_constant_ = graph_->GetIntConstant(42);
float_constant_ = graph_->GetFloatConstant(42.0f);
diff --git a/compiler/optimizing/linearize_test.cc b/compiler/optimizing/linearize_test.cc
index 13e14c5..3831aa6 100644
--- a/compiler/optimizing/linearize_test.cc
+++ b/compiler/optimizing/linearize_test.cc
@@ -18,7 +18,6 @@
#include "arch/x86/instruction_set_features_x86.h"
#include "base/arena_allocator.h"
-#include "base/stringprintf.h"
#include "builder.h"
#include "code_generator.h"
#include "code_generator_x86.h"
diff --git a/compiler/optimizing/load_store_elimination.cc b/compiler/optimizing/load_store_elimination.cc
index 15e6059..2856c3e 100644
--- a/compiler/optimizing/load_store_elimination.cc
+++ b/compiler/optimizing/load_store_elimination.cc
@@ -15,6 +15,8 @@
*/
#include "load_store_elimination.h"
+
+#include "escape.h"
#include "side_effects_analysis.h"
#include <iostream>
@@ -31,70 +33,17 @@
// whether it's a singleton, returned, etc.
class ReferenceInfo : public ArenaObject<kArenaAllocMisc> {
public:
- ReferenceInfo(HInstruction* reference, size_t pos) : reference_(reference), position_(pos) {
- is_singleton_ = true;
- is_singleton_and_non_escaping_ = true;
- if (!reference_->IsNewInstance() && !reference_->IsNewArray()) {
- // For references not allocated in the method, don't assume anything.
- is_singleton_ = false;
- is_singleton_and_non_escaping_ = false;
- return;
- }
-
- // Visit all uses to determine if this reference can spread into the heap,
- // a method call, etc.
- for (const HUseListNode<HInstruction*>& use : reference_->GetUses()) {
- HInstruction* user = use.GetUser();
- DCHECK(!user->IsNullCheck()) << "NullCheck should have been eliminated";
- if (user->IsBoundType()) {
- // BoundType shouldn't normally be necessary for a NewInstance.
- // Just be conservative for the uncommon cases.
- is_singleton_ = false;
- is_singleton_and_non_escaping_ = false;
- return;
- }
- if (user->IsPhi() || user->IsSelect() || user->IsInvoke() ||
- (user->IsInstanceFieldSet() && (reference_ == user->InputAt(1))) ||
- (user->IsUnresolvedInstanceFieldSet() && (reference_ == user->InputAt(1))) ||
- (user->IsStaticFieldSet() && (reference_ == user->InputAt(1))) ||
- (user->IsUnresolvedStaticFieldSet() && (reference_ == user->InputAt(0))) ||
- (user->IsArraySet() && (reference_ == user->InputAt(2)))) {
- // reference_ is merged to HPhi/HSelect, passed to a callee, or stored to heap.
- // reference_ isn't the only name that can refer to its value anymore.
- is_singleton_ = false;
- is_singleton_and_non_escaping_ = false;
- return;
- }
- if ((user->IsUnresolvedInstanceFieldGet() && (reference_ == user->InputAt(0))) ||
- (user->IsUnresolvedInstanceFieldSet() && (reference_ == user->InputAt(0)))) {
- // The field is accessed in an unresolved way. We mark the object as a non-singleton
- // to disable load/store optimizations on it.
- // Note that we could optimize this case and still perform some optimizations until
- // we hit the unresolved access, but disabling is the simplest.
- is_singleton_ = false;
- is_singleton_and_non_escaping_ = false;
- return;
- }
- if (user->IsReturn()) {
- is_singleton_and_non_escaping_ = false;
- }
- }
-
- if (!is_singleton_ || !is_singleton_and_non_escaping_) {
- return;
- }
-
- // Look at Environment uses and if it's for HDeoptimize, it's treated the same
- // as a return which escapes at the end of executing the compiled code. We don't
- // do store elimination for singletons that escape through HDeoptimize.
- // Other Environment uses are fine since LSE is disabled for debuggable.
- for (const HUseListNode<HEnvironment*>& use : reference_->GetEnvUses()) {
- HEnvironment* user = use.GetUser();
- if (user->GetHolder()->IsDeoptimize()) {
- is_singleton_and_non_escaping_ = false;
- break;
- }
- }
+ ReferenceInfo(HInstruction* reference, size_t pos)
+ : reference_(reference),
+ position_(pos),
+ is_singleton_(true),
+ is_singleton_and_not_returned_(true),
+ is_singleton_and_not_deopt_visible_(true) {
+ CalculateEscape(reference_,
+ nullptr,
+ &is_singleton_,
+ &is_singleton_and_not_returned_,
+ &is_singleton_and_not_deopt_visible_);
}
HInstruction* GetReference() const {
@@ -115,19 +64,17 @@
// Returns true if reference_ is a singleton and not returned to the caller or
// used as an environment local of an HDeoptimize instruction.
// The allocation and stores into reference_ may be eliminated for such cases.
- bool IsSingletonAndNonEscaping() const {
- return is_singleton_and_non_escaping_;
+ bool IsSingletonAndRemovable() const {
+ return is_singleton_and_not_returned_ && is_singleton_and_not_deopt_visible_;
}
private:
HInstruction* const reference_;
- const size_t position_; // position in HeapLocationCollector's ref_info_array_.
- bool is_singleton_; // can only be referred to by a single name in the method.
+ const size_t position_; // position in HeapLocationCollector's ref_info_array_.
- // reference_ is singleton and does not escape in the end either by
- // returning to the caller, or being used as an environment local of an
- // HDeoptimize instruction.
- bool is_singleton_and_non_escaping_;
+ bool is_singleton_; // can only be referred to by a single name in the method,
+ bool is_singleton_and_not_returned_; // and not returned to caller,
+ bool is_singleton_and_not_deopt_visible_; // and not used as an environment local of HDeoptimize.
DISALLOW_COPY_AND_ASSIGN(ReferenceInfo);
};
@@ -679,7 +626,7 @@
bool from_all_predecessors = true;
ReferenceInfo* ref_info = heap_location_collector_.GetHeapLocation(i)->GetReferenceInfo();
HInstruction* singleton_ref = nullptr;
- if (ref_info->IsSingletonAndNonEscaping()) {
+ if (ref_info->IsSingletonAndRemovable()) {
// We do more analysis of liveness when merging heap values for such
// cases since stores into such references may potentially be eliminated.
singleton_ref = ref_info->GetReference();
@@ -852,7 +799,7 @@
} else if (index != nullptr) {
// For array element, don't eliminate stores since it can be easily aliased
// with non-constant index.
- } else if (ref_info->IsSingletonAndNonEscaping()) {
+ } else if (ref_info->IsSingletonAndRemovable()) {
// Store into a field of a singleton that's not returned. The value cannot be
// killed due to aliasing/invocation. It can be redundant since future loads can
// directly get the value set by this instruction. The value can still be killed due to
@@ -1026,7 +973,7 @@
// new_instance isn't used for field accesses. No need to process it.
return;
}
- if (ref_info->IsSingletonAndNonEscaping() &&
+ if (ref_info->IsSingletonAndRemovable() &&
!new_instance->IsFinalizable() &&
!new_instance->NeedsAccessCheck()) {
singleton_new_instances_.push_back(new_instance);
diff --git a/compiler/optimizing/loop_optimization.cc b/compiler/optimizing/loop_optimization.cc
index f4616e3..9d73e29 100644
--- a/compiler/optimizing/loop_optimization.cc
+++ b/compiler/optimizing/loop_optimization.cc
@@ -64,7 +64,8 @@
top_loop_(nullptr),
last_loop_(nullptr),
iset_(nullptr),
- induction_simplication_count_(0) {
+ induction_simplication_count_(0),
+ simplified_(false) {
}
void HLoopOptimization::Run() {
@@ -169,9 +170,15 @@
if (current_induction_simplification_count != induction_simplication_count_) {
induction_range_.ReVisit(node->loop_info);
}
- SimplifyBlocks(node);
- SimplifyInduction(node);
- SimplifyBlocks(node);
+ // Repeat simplifications until no more changes occur. Note that since
+ // each simplification consists of eliminating code (without introducing
+ // new code), this process is always finite.
+ do {
+ simplified_ = false;
+ SimplifyBlocks(node);
+ SimplifyInduction(node);
+ } while (simplified_);
+ // Remove inner loops when empty.
if (node->inner == nullptr) {
RemoveIfEmptyInnerLoop(node);
}
@@ -198,63 +205,57 @@
for (HInstruction* i : *iset_) {
RemoveFromCycle(i);
}
+ simplified_ = true;
induction_simplication_count_++;
}
}
}
void HLoopOptimization::SimplifyBlocks(LoopNode* node) {
- // Repeat the block simplifications until no more changes occur. Note that since
- // each simplification consists of eliminating code (without introducing new code),
- // this process is always finite.
- bool changed;
- do {
- changed = false;
- // Iterate over all basic blocks in the loop-body.
- for (HBlocksInLoopIterator it(*node->loop_info); !it.Done(); it.Advance()) {
- HBasicBlock* block = it.Current();
- // Remove dead instructions from the loop-body.
- for (HBackwardInstructionIterator i(block->GetInstructions()); !i.Done(); i.Advance()) {
- HInstruction* instruction = i.Current();
- if (instruction->IsDeadAndRemovable()) {
- changed = true;
- block->RemoveInstruction(instruction);
- }
+ // Iterate over all basic blocks in the loop-body.
+ for (HBlocksInLoopIterator it(*node->loop_info); !it.Done(); it.Advance()) {
+ HBasicBlock* block = it.Current();
+ // Remove dead instructions from the loop-body.
+ for (HBackwardInstructionIterator i(block->GetInstructions()); !i.Done(); i.Advance()) {
+ HInstruction* instruction = i.Current();
+ if (instruction->IsDeadAndRemovable()) {
+ simplified_ = true;
+ block->RemoveInstruction(instruction);
}
- // Remove trivial control flow blocks from the loop-body.
- HBasicBlock* succ = nullptr;
- if (IsGotoBlock(block, &succ) && succ->GetPredecessors().size() == 1) {
- // Trivial goto block can be removed.
- HBasicBlock* pred = block->GetSinglePredecessor();
- changed = true;
- pred->ReplaceSuccessor(block, succ);
- block->RemoveDominatedBlock(succ);
- block->DisconnectAndDelete();
- pred->AddDominatedBlock(succ);
- succ->SetDominator(pred);
- } else if (block->GetSuccessors().size() == 2) {
- // Trivial if block can be bypassed to either branch.
- HBasicBlock* succ0 = block->GetSuccessors()[0];
- HBasicBlock* succ1 = block->GetSuccessors()[1];
- HBasicBlock* meet0 = nullptr;
- HBasicBlock* meet1 = nullptr;
- if (succ0 != succ1 &&
- IsGotoBlock(succ0, &meet0) &&
- IsGotoBlock(succ1, &meet1) &&
- meet0 == meet1 && // meets again
- meet0 != block && // no self-loop
- meet0->GetPhis().IsEmpty()) { // not used for merging
- changed = true;
- succ0->DisconnectAndDelete();
- if (block->Dominates(meet0)) {
- block->RemoveDominatedBlock(meet0);
- succ1->AddDominatedBlock(meet0);
- meet0->SetDominator(succ1);
- }
+ }
+ // Remove trivial control flow blocks from the loop-body.
+ HBasicBlock* succ = nullptr;
+ if (IsGotoBlock(block, &succ) && succ->GetPredecessors().size() == 1) {
+ // Trivial goto block can be removed.
+ HBasicBlock* pred = block->GetSinglePredecessor();
+ simplified_ = true;
+ pred->ReplaceSuccessor(block, succ);
+ block->RemoveDominatedBlock(succ);
+ block->DisconnectAndDelete();
+ pred->AddDominatedBlock(succ);
+ succ->SetDominator(pred);
+ } else if (block->GetSuccessors().size() == 2) {
+ // Trivial if block can be bypassed to either branch.
+ HBasicBlock* succ0 = block->GetSuccessors()[0];
+ HBasicBlock* succ1 = block->GetSuccessors()[1];
+ HBasicBlock* meet0 = nullptr;
+ HBasicBlock* meet1 = nullptr;
+ if (succ0 != succ1 &&
+ IsGotoBlock(succ0, &meet0) &&
+ IsGotoBlock(succ1, &meet1) &&
+ meet0 == meet1 && // meets again
+ meet0 != block && // no self-loop
+ meet0->GetPhis().IsEmpty()) { // not used for merging
+ simplified_ = true;
+ succ0->DisconnectAndDelete();
+ if (block->Dominates(meet0)) {
+ block->RemoveDominatedBlock(meet0);
+ succ1->AddDominatedBlock(meet0);
+ meet0->SetDominator(succ1);
}
}
}
- } while (changed);
+ }
}
void HLoopOptimization::RemoveIfEmptyInnerLoop(LoopNode* node) {
diff --git a/compiler/optimizing/loop_optimization.h b/compiler/optimizing/loop_optimization.h
index 3391bef..0f05b24 100644
--- a/compiler/optimizing/loop_optimization.h
+++ b/compiler/optimizing/loop_optimization.h
@@ -95,6 +95,9 @@
// when the induction of inner loops has changed.
int32_t induction_simplication_count_;
+ // Flag that tracks if any simplifications have occurred.
+ bool simplified_;
+
friend class LoopOptimizationTest;
DISALLOW_COPY_AND_ASSIGN(HLoopOptimization);
diff --git a/compiler/optimizing/loop_optimization_test.cc b/compiler/optimizing/loop_optimization_test.cc
index 7805a69..9a6b493 100644
--- a/compiler/optimizing/loop_optimization_test.cc
+++ b/compiler/optimizing/loop_optimization_test.cc
@@ -48,7 +48,10 @@
graph_->AddBlock(exit_block_);
graph_->SetEntryBlock(entry_block_);
graph_->SetExitBlock(exit_block_);
- parameter_ = new (&allocator_) HParameterValue(graph_->GetDexFile(), 0, 0, Primitive::kPrimInt);
+ parameter_ = new (&allocator_) HParameterValue(graph_->GetDexFile(),
+ dex::TypeIndex(0),
+ 0,
+ Primitive::kPrimInt);
entry_block_->AddInstruction(parameter_);
return_block_->AddInstruction(new (&allocator_) HReturnVoid());
exit_block_->AddInstruction(new (&allocator_) HExit());
diff --git a/compiler/optimizing/nodes.cc b/compiler/optimizing/nodes.cc
index 680381a..cabc078 100644
--- a/compiler/optimizing/nodes.cc
+++ b/compiler/optimizing/nodes.cc
@@ -1108,13 +1108,23 @@
return HasEnvironment() ? environment_->Size() : 0;
}
-void HPhi::AddInput(HInstruction* input) {
+void HVariableInputSizeInstruction::AddInput(HInstruction* input) {
DCHECK(input->GetBlock() != nullptr);
inputs_.push_back(HUserRecord<HInstruction*>(input));
input->AddUseAt(this, inputs_.size() - 1);
}
-void HPhi::RemoveInputAt(size_t index) {
+void HVariableInputSizeInstruction::InsertInputAt(size_t index, HInstruction* input) {
+ inputs_.insert(inputs_.begin() + index, HUserRecord<HInstruction*>(input));
+ input->AddUseAt(this, index);
+ // Update indexes in use nodes of inputs that have been pushed further back by the insert().
+ for (size_t i = index + 1u, e = inputs_.size(); i < e; ++i) {
+ DCHECK_EQ(inputs_[i].GetUseNode()->GetIndex(), i - 1u);
+ inputs_[i].GetUseNode()->SetIndex(i);
+ }
+}
+
+void HVariableInputSizeInstruction::RemoveInputAt(size_t index) {
RemoveAsUserOfInput(index);
inputs_.erase(inputs_.begin() + index);
// Update indexes in use nodes of inputs that have been pulled forward by the erase().
@@ -2386,26 +2396,6 @@
return !opt.GetDoesNotNeedDexCache();
}
-void HInvokeStaticOrDirect::InsertInputAt(size_t index, HInstruction* input) {
- inputs_.insert(inputs_.begin() + index, HUserRecord<HInstruction*>(input));
- input->AddUseAt(this, index);
- // Update indexes in use nodes of inputs that have been pushed further back by the insert().
- for (size_t i = index + 1u, e = inputs_.size(); i < e; ++i) {
- DCHECK_EQ(inputs_[i].GetUseNode()->GetIndex(), i - 1u);
- inputs_[i].GetUseNode()->SetIndex(i);
- }
-}
-
-void HInvokeStaticOrDirect::RemoveInputAt(size_t index) {
- RemoveAsUserOfInput(index);
- inputs_.erase(inputs_.begin() + index);
- // Update indexes in use nodes of inputs that have been pulled forward by the erase().
- for (size_t i = index, e = inputs_.size(); i < e; ++i) {
- DCHECK_EQ(inputs_[i].GetUseNode()->GetIndex(), i + 1u);
- inputs_[i].GetUseNode()->SetIndex(i);
- }
-}
-
std::ostream& operator<<(std::ostream& os, HInvokeStaticOrDirect::MethodLoadKind rhs) {
switch (rhs) {
case HInvokeStaticOrDirect::MethodLoadKind::kStringInit:
@@ -2440,6 +2430,17 @@
}
}
+// Helper for InstructionDataEquals to fetch the mirror Class out
+// from a kJitTableAddress LoadClass kind.
+// NO_THREAD_SAFETY_ANALYSIS because even though we're accessing
+// mirrors, they are stored in a variable size handle scope which is always
+// visited during a pause. Also, the only caller of this helper
+// only uses the mirror for pointer comparison.
+static inline mirror::Class* AsMirrorInternal(uint64_t address)
+ NO_THREAD_SAFETY_ANALYSIS {
+ return reinterpret_cast<StackReference<mirror::Class>*>(address)->AsMirrorPtr();
+}
+
bool HLoadClass::InstructionDataEquals(const HInstruction* other) const {
const HLoadClass* other_load_class = other->AsLoadClass();
// TODO: To allow GVN for HLoadClass from different dex files, we should compare the type
@@ -2448,16 +2449,14 @@
GetPackedFields() != other_load_class->GetPackedFields()) {
return false;
}
- LoadKind load_kind = GetLoadKind();
- if (HasAddress(load_kind)) {
- return GetAddress() == other_load_class->GetAddress();
- } else if (HasTypeReference(load_kind)) {
- return IsSameDexFile(GetDexFile(), other_load_class->GetDexFile());
- } else {
- DCHECK(HasDexCacheReference(load_kind)) << load_kind;
- // If the type indexes and dex files are the same, dex cache element offsets
- // must also be the same, so we don't need to compare them.
- return IsSameDexFile(GetDexFile(), other_load_class->GetDexFile());
+ switch (GetLoadKind()) {
+ case LoadKind::kBootImageAddress:
+ return GetAddress() == other_load_class->GetAddress();
+ case LoadKind::kJitTableAddress:
+ return AsMirrorInternal(GetAddress()) == AsMirrorInternal(other_load_class->GetAddress());
+ default:
+ DCHECK(HasTypeReference(GetLoadKind()) || HasDexCacheReference(GetLoadKind()));
+ return IsSameDexFile(GetDexFile(), other_load_class->GetDexFile());
}
}
@@ -2487,8 +2486,8 @@
return os << "BootImageLinkTimePcRelative";
case HLoadClass::LoadKind::kBootImageAddress:
return os << "BootImageAddress";
- case HLoadClass::LoadKind::kDexCacheAddress:
- return os << "DexCacheAddress";
+ case HLoadClass::LoadKind::kJitTableAddress:
+ return os << "JitTableAddress";
case HLoadClass::LoadKind::kDexCachePcRelative:
return os << "DexCachePcRelative";
case HLoadClass::LoadKind::kDexCacheViaMethod:
@@ -2543,6 +2542,8 @@
return os << "BssEntry";
case HLoadString::LoadKind::kDexCacheViaMethod:
return os << "DexCacheViaMethod";
+ case HLoadString::LoadKind::kJitTableAddress:
+ return os << "JitTableAddress";
default:
LOG(FATAL) << "Unknown HLoadString::LoadKind: " << static_cast<int>(rhs);
UNREACHABLE();
diff --git a/compiler/optimizing/nodes.h b/compiler/optimizing/nodes.h
index e0c582a..4a77bed 100644
--- a/compiler/optimizing/nodes.h
+++ b/compiler/optimizing/nodes.h
@@ -29,6 +29,7 @@
#include "base/stl_util.h"
#include "base/transform_array_ref.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "entrypoints/quick/quick_entrypoints_enum.h"
#include "handle.h"
#include "handle_scope.h"
@@ -124,6 +125,11 @@
kAnalysisSuccess,
};
+template <typename T>
+static inline typename std::make_unsigned<T>::type MakeUnsigned(T x) {
+ return static_cast<typename std::make_unsigned<T>::type>(x);
+}
+
class HInstructionList : public ValueObject {
public:
HInstructionList() : first_instruction_(nullptr), last_instruction_(nullptr) {}
@@ -332,7 +338,8 @@
cached_double_constants_(std::less<int64_t>(), arena->Adapter(kArenaAllocConstantsMap)),
cached_current_method_(nullptr),
inexact_object_rti_(ReferenceTypeInfo::CreateInvalid()),
- osr_(osr) {
+ osr_(osr),
+ cha_single_implementation_list_(arena->Adapter(kArenaAllocCHA)) {
blocks_.reserve(kDefaultNumberOfBlocks);
}
@@ -535,6 +542,20 @@
bool IsCompilingOsr() const { return osr_; }
+ ArenaSet<ArtMethod*>& GetCHASingleImplementationList() {
+ return cha_single_implementation_list_;
+ }
+
+ void AddCHASingleImplementationDependency(ArtMethod* method) {
+ cha_single_implementation_list_.insert(method);
+ }
+
+ bool HasShouldDeoptimizeFlag() const {
+ // TODO: if all CHA guards can be eliminated, there is no need for the flag
+ // even if cha_single_implementation_list_ is not empty.
+ return !cha_single_implementation_list_.empty();
+ }
+
bool HasTryCatch() const { return has_try_catch_; }
void SetHasTryCatch(bool value) { has_try_catch_ = value; }
@@ -671,6 +692,9 @@
// compiled code entries which the interpreter can directly jump to.
const bool osr_;
+ // List of methods that are assumed to have single implementation.
+ ArenaSet<ArtMethod*> cha_single_implementation_list_;
+
friend class SsaBuilder; // For caching constants.
friend class SsaLivenessAnalysis; // For the linear order.
friend class HInliner; // For the reverse post order.
@@ -800,7 +824,7 @@
}
// Catch block information constructor.
- TryCatchInformation(uint16_t catch_type_index, const DexFile& dex_file)
+ TryCatchInformation(dex::TypeIndex catch_type_index, const DexFile& dex_file)
: try_entry_(nullptr),
catch_dex_file_(&dex_file),
catch_type_index_(catch_type_index) {}
@@ -816,10 +840,10 @@
bool IsCatchAllTypeIndex() const {
DCHECK(IsCatchBlock());
- return catch_type_index_ == DexFile::kDexNoIndex16;
+ return !catch_type_index_.IsValid();
}
- uint16_t GetCatchTypeIndex() const {
+ dex::TypeIndex GetCatchTypeIndex() const {
DCHECK(IsCatchBlock());
return catch_type_index_;
}
@@ -836,7 +860,7 @@
// Exception type information. Only set for catch blocks.
const DexFile* catch_dex_file_;
- const uint16_t catch_type_index_;
+ const dex::TypeIndex catch_type_index_;
};
static constexpr size_t kNoLifetime = -1;
@@ -1239,6 +1263,7 @@
M(ClinitCheck, Instruction) \
M(Compare, BinaryOperation) \
M(CurrentMethod, Instruction) \
+ M(ShouldDeoptimizeFlag, Instruction) \
M(Deoptimize, Instruction) \
M(Div, BinaryOperation) \
M(DivZeroCheck, Instruction) \
@@ -2071,6 +2096,8 @@
#undef INSTRUCTION_TYPE_CHECK
// Returns whether the instruction can be moved within the graph.
+ // TODO: this method is used by LICM and GVN with possibly different
+ // meanings? split and rename?
virtual bool CanBeMoved() const { return false; }
// Returns whether the two instructions are of the same kind.
@@ -2320,6 +2347,27 @@
DISALLOW_COPY_AND_ASSIGN(HBackwardInstructionIterator);
};
+class HVariableInputSizeInstruction : public HInstruction {
+ public:
+ void AddInput(HInstruction* input);
+ void InsertInputAt(size_t index, HInstruction* input);
+ void RemoveInputAt(size_t index);
+
+ protected:
+ HVariableInputSizeInstruction(SideEffects side_effects,
+ uint32_t dex_pc,
+ ArenaAllocator* arena,
+ size_t number_of_inputs,
+ ArenaAllocKind kind)
+ : HInstruction(side_effects, dex_pc),
+ inputs_(number_of_inputs, arena->Adapter(kind)) {}
+
+ ArenaVector<HUserRecord<HInstruction*>> inputs_;
+
+ private:
+ DISALLOW_COPY_AND_ASSIGN(HVariableInputSizeInstruction);
+};
+
template<size_t N>
class HTemplateInstruction: public HInstruction {
public:
@@ -2411,15 +2459,19 @@
DISALLOW_COPY_AND_ASSIGN(HReturn);
};
-class HPhi FINAL : public HInstruction {
+class HPhi FINAL : public HVariableInputSizeInstruction {
public:
HPhi(ArenaAllocator* arena,
uint32_t reg_number,
size_t number_of_inputs,
Primitive::Type type,
uint32_t dex_pc = kNoDexPc)
- : HInstruction(SideEffects::None(), dex_pc),
- inputs_(number_of_inputs, arena->Adapter(kArenaAllocPhiInputs)),
+ : HVariableInputSizeInstruction(
+ SideEffects::None(),
+ dex_pc,
+ arena,
+ number_of_inputs,
+ kArenaAllocPhiInputs),
reg_number_(reg_number) {
SetPackedField<TypeField>(ToPhiType(type));
DCHECK_NE(GetType(), Primitive::kPrimVoid);
@@ -2442,9 +2494,6 @@
return ArrayRef<HUserRecord<HInstruction*>>(inputs_);
}
- void AddInput(HInstruction* input);
- void RemoveInputAt(size_t index);
-
Primitive::Type GetType() const OVERRIDE { return GetPackedField<TypeField>(); }
void SetType(Primitive::Type new_type) {
// Make sure that only valid type changes occur. The following are allowed:
@@ -2500,7 +2549,6 @@
static_assert(kNumberOfPhiPackedBits <= kMaxNumberOfPackedBits, "Too many packed fields.");
using TypeField = BitField<Primitive::Type, kFieldType, kFieldTypeSize>;
- ArenaVector<HUserRecord<HInstruction*>> inputs_;
const uint32_t reg_number_;
DISALLOW_COPY_AND_ASSIGN(HPhi);
@@ -2872,6 +2920,27 @@
DISALLOW_COPY_AND_ASSIGN(HDeoptimize);
};
+// Represents a should_deoptimize flag. Currently used for CHA-based devirtualization.
+// The compiled code checks this flag value in a guard before devirtualized call and
+// if it's true, starts to do deoptimization.
+// It has a 4-byte slot on stack.
+// TODO: allocate a register for this flag.
+class HShouldDeoptimizeFlag FINAL : public HExpression<0> {
+ public:
+ // TODO: use SideEffects to aid eliminating some CHA guards.
+ explicit HShouldDeoptimizeFlag(uint32_t dex_pc)
+ : HExpression(Primitive::kPrimInt, SideEffects::None(), dex_pc) {
+ }
+
+ // We don't eliminate CHA guards yet.
+ bool CanBeMoved() const OVERRIDE { return false; }
+
+ DECLARE_INSTRUCTION(ShouldDeoptimizeFlag);
+
+ private:
+ DISALLOW_COPY_AND_ASSIGN(HShouldDeoptimizeFlag);
+};
+
// Represents the ArtMethod that was passed as a first argument to
// the method. It is used by instructions that depend on it, like
// instructions that work with the dex cache.
@@ -3671,7 +3740,7 @@
HNewInstance(HInstruction* cls,
HCurrentMethod* current_method,
uint32_t dex_pc,
- uint16_t type_index,
+ dex::TypeIndex type_index,
const DexFile& dex_file,
bool needs_access_check,
bool finalizable,
@@ -3686,7 +3755,7 @@
SetRawInputAt(1, current_method);
}
- uint16_t GetTypeIndex() const { return type_index_; }
+ dex::TypeIndex GetTypeIndex() const { return type_index_; }
const DexFile& GetDexFile() const { return dex_file_; }
// Calls runtime so needs an environment.
@@ -3719,7 +3788,7 @@
static_assert(kNumberOfNewInstancePackedBits <= kMaxNumberOfPackedBits,
"Too many packed fields.");
- const uint16_t type_index_;
+ const dex::TypeIndex type_index_;
const DexFile& dex_file_;
QuickEntrypointEnum entrypoint_;
@@ -3743,7 +3812,7 @@
kCanThrow // Intrinsic may throw exceptions.
};
-class HInvoke : public HInstruction {
+class HInvoke : public HVariableInputSizeInstruction {
public:
bool NeedsEnvironment() const OVERRIDE;
@@ -3788,7 +3857,7 @@
bool CanThrow() const OVERRIDE { return GetPackedFlag<kFlagCanThrow>(); }
- bool CanBeMoved() const OVERRIDE { return IsIntrinsic(); }
+ bool CanBeMoved() const OVERRIDE { return IsIntrinsic() && !DoesAnyWrite(); }
bool InstructionDataEquals(const HInstruction* other) const OVERRIDE {
return intrinsic_ != Intrinsics::kNone && intrinsic_ == other->AsInvoke()->intrinsic_;
@@ -3830,12 +3899,14 @@
uint32_t dex_method_index,
ArtMethod* resolved_method,
InvokeType invoke_type)
- : HInstruction(
- SideEffects::AllExceptGCDependency(), dex_pc), // Assume write/read on all fields/arrays.
+ : HVariableInputSizeInstruction(
+ SideEffects::AllExceptGCDependency(), // Assume write/read on all fields/arrays.
+ dex_pc,
+ arena,
+ number_of_arguments + number_of_other_inputs,
+ kArenaAllocInvokeInputs),
number_of_arguments_(number_of_arguments),
resolved_method_(resolved_method),
- inputs_(number_of_arguments + number_of_other_inputs,
- arena->Adapter(kArenaAllocInvokeInputs)),
dex_method_index_(dex_method_index),
intrinsic_(Intrinsics::kNone),
intrinsic_optimizations_(0) {
@@ -3846,7 +3917,6 @@
uint32_t number_of_arguments_;
ArtMethod* const resolved_method_;
- ArenaVector<HUserRecord<HInstruction*>> inputs_;
const uint32_t dex_method_index_;
Intrinsics intrinsic_;
@@ -4136,10 +4206,6 @@
DECLARE_INSTRUCTION(InvokeStaticOrDirect);
- protected:
- void InsertInputAt(size_t index, HInstruction* input);
- void RemoveInputAt(size_t index);
-
private:
static constexpr size_t kFieldClinitCheckRequirement = kNumberOfInvokePackedBits;
static constexpr size_t kFieldClinitCheckRequirementSize =
@@ -4180,6 +4246,19 @@
kVirtual),
vtable_index_(vtable_index) {}
+ bool CanBeNull() const OVERRIDE {
+ switch (GetIntrinsic()) {
+ case Intrinsics::kThreadCurrentThread:
+ case Intrinsics::kStringBufferAppend:
+ case Intrinsics::kStringBufferToString:
+ case Intrinsics::kStringBuilderAppend:
+ case Intrinsics::kStringBuilderToString:
+ return false;
+ default:
+ return HInvoke::CanBeNull();
+ }
+ }
+
bool CanDoImplicitNullCheckOn(HInstruction* obj) const OVERRIDE {
// TODO: Add implicit null checks in intrinsics.
return (obj == InputAt(0)) && !GetLocations()->Intrinsified();
@@ -4265,7 +4344,7 @@
HNewArray(HInstruction* length,
HCurrentMethod* current_method,
uint32_t dex_pc,
- uint16_t type_index,
+ dex::TypeIndex type_index,
const DexFile& dex_file,
QuickEntrypointEnum entrypoint)
: HExpression(Primitive::kPrimNot, SideEffects::CanTriggerGC(), dex_pc),
@@ -4276,7 +4355,7 @@
SetRawInputAt(1, current_method);
}
- uint16_t GetTypeIndex() const { return type_index_; }
+ dex::TypeIndex GetTypeIndex() const { return type_index_; }
const DexFile& GetDexFile() const { return dex_file_; }
// Calls runtime so needs an environment.
@@ -4292,7 +4371,7 @@
DECLARE_INSTRUCTION(NewArray);
private:
- const uint16_t type_index_;
+ const dex::TypeIndex type_index_;
const DexFile& dex_file_;
const QuickEntrypointEnum entrypoint_;
@@ -4829,7 +4908,7 @@
class HParameterValue FINAL : public HExpression<0> {
public:
HParameterValue(const DexFile& dex_file,
- uint16_t type_index,
+ dex::TypeIndex type_index,
uint8_t index,
Primitive::Type parameter_type,
bool is_this = false)
@@ -4842,7 +4921,7 @@
}
const DexFile& GetDexFile() const { return dex_file_; }
- uint16_t GetTypeIndex() const { return type_index_; }
+ dex::TypeIndex GetTypeIndex() const { return type_index_; }
uint8_t GetIndex() const { return index_; }
bool IsThis() const { return GetPackedFlag<kFlagIsThis>(); }
@@ -4860,7 +4939,7 @@
"Too many packed fields.");
const DexFile& dex_file_;
- const uint16_t type_index_;
+ const dex::TypeIndex type_index_;
// The index of this parameter in the parameters list. Must be less
// than HGraph::number_of_in_vregs_.
const uint8_t index_;
@@ -5437,9 +5516,8 @@
// GetIncludePatchInformation().
kBootImageAddress,
- // Load from the resolved types array at an absolute address.
- // Used for classes outside the boot image referenced by JIT-compiled code.
- kDexCacheAddress,
+ // Load from the root table associated with the JIT compiled method.
+ kJitTableAddress,
// Load from resolved types array in the dex cache using a PC-relative load.
// Used for classes outside boot image when we know that we can access
@@ -5455,7 +5533,7 @@
};
HLoadClass(HCurrentMethod* current_method,
- uint16_t type_index,
+ dex::TypeIndex type_index,
const DexFile& dex_file,
bool is_referrers_class,
uint32_t dex_pc,
@@ -5487,7 +5565,7 @@
void SetLoadKindWithTypeReference(LoadKind load_kind,
const DexFile& dex_file,
- uint32_t type_index) {
+ dex::TypeIndex type_index) {
DCHECK(HasTypeReference(load_kind));
DCHECK(IsSameDexFile(dex_file_, dex_file));
DCHECK_EQ(type_index_, type_index);
@@ -5511,7 +5589,7 @@
bool InstructionDataEquals(const HInstruction* other) const;
- size_t ComputeHashCode() const OVERRIDE { return type_index_; }
+ size_t ComputeHashCode() const OVERRIDE { return type_index_.index_; }
bool CanBeNull() const OVERRIDE { return false; }
@@ -5532,7 +5610,6 @@
NeedsAccessCheck();
}
-
bool CanThrow() const OVERRIDE {
return CanCallRuntime();
}
@@ -5547,7 +5624,7 @@
loaded_class_rti_ = rti;
}
- uint32_t GetTypeIndex() const { return type_index_; }
+ dex::TypeIndex GetTypeIndex() const { return type_index_; }
const DexFile& GetDexFile() const { return dex_file_; }
uint32_t GetDexCacheElementOffset() const;
@@ -5557,7 +5634,9 @@
return load_data_.address;
}
- bool NeedsDexCacheOfDeclaringClass() const OVERRIDE { return !IsReferrersClass(); }
+ bool NeedsDexCacheOfDeclaringClass() const OVERRIDE {
+ return !IsReferrersClass();
+ }
static SideEffects SideEffectsForArchRuntimeCalls() {
return SideEffects::CanTriggerGC();
@@ -5616,7 +5695,8 @@
}
static bool HasAddress(LoadKind load_kind) {
- return load_kind == LoadKind::kBootImageAddress || load_kind == LoadKind::kDexCacheAddress;
+ return load_kind == LoadKind::kBootImageAddress ||
+ load_kind == LoadKind::kJitTableAddress;
}
static bool HasDexCacheReference(LoadKind load_kind) {
@@ -5630,12 +5710,12 @@
// for PC-relative loads, i.e. kDexCachePcRelative or kBootImageLinkTimePcRelative.
HUserRecord<HInstruction*> special_input_;
- const uint16_t type_index_;
+ const dex::TypeIndex type_index_;
const DexFile& dex_file_;
union {
uint32_t dex_cache_element_index; // Only for dex cache reference.
- uint64_t address; // Up to 64-bit, needed for kDexCacheAddress on 64-bit targets.
+ uint64_t address; // Up to 64-bit, needed for kJitTableAddress on 64-bit targets.
} load_data_;
ReferenceTypeInfo loaded_class_rti_;
@@ -5690,11 +5770,14 @@
// all other types are unavailable.
kDexCacheViaMethod,
- kLast = kDexCacheViaMethod
+ // Load from the root table associated with the JIT compiled method.
+ kJitTableAddress,
+
+ kLast = kJitTableAddress,
};
HLoadString(HCurrentMethod* current_method,
- uint32_t string_index,
+ dex::StringIndex string_index,
const DexFile& dex_file,
uint32_t dex_pc)
: HInstruction(SideEffectsForArchRuntimeCalls(), dex_pc),
@@ -5713,7 +5796,7 @@
void SetLoadKindWithStringReference(LoadKind load_kind,
const DexFile& dex_file,
- uint32_t string_index) {
+ dex::StringIndex string_index) {
DCHECK(HasStringReference(load_kind));
load_data_.dex_file_ = &dex_file;
string_index_ = string_index;
@@ -5726,7 +5809,7 @@
const DexFile& GetDexFile() const;
- uint32_t GetStringIndex() const {
+ dex::StringIndex GetStringIndex() const {
DCHECK(HasStringReference(GetLoadKind()) || /* For slow paths. */ !IsInDexCache());
return string_index_;
}
@@ -5740,7 +5823,7 @@
bool InstructionDataEquals(const HInstruction* other) const OVERRIDE;
- size_t ComputeHashCode() const OVERRIDE { return string_index_; }
+ size_t ComputeHashCode() const OVERRIDE { return string_index_.index_; }
// Will call the runtime if we need to load the string through
// the dex cache and the string is not guaranteed to be there yet.
@@ -5748,7 +5831,8 @@
LoadKind load_kind = GetLoadKind();
if (load_kind == LoadKind::kBootImageLinkTimeAddress ||
load_kind == LoadKind::kBootImageLinkTimePcRelative ||
- load_kind == LoadKind::kBootImageAddress) {
+ load_kind == LoadKind::kBootImageAddress ||
+ load_kind == LoadKind::kJitTableAddress) {
return false;
}
return !IsInDexCache();
@@ -5801,7 +5885,8 @@
return load_kind == LoadKind::kBootImageLinkTimeAddress ||
load_kind == LoadKind::kBootImageLinkTimePcRelative ||
load_kind == LoadKind::kBssEntry ||
- load_kind == LoadKind::kDexCacheViaMethod;
+ load_kind == LoadKind::kDexCacheViaMethod ||
+ load_kind == LoadKind::kJitTableAddress;
}
static bool HasAddress(LoadKind load_kind) {
@@ -5817,7 +5902,7 @@
// String index serves also as the hash code and it's also needed for slow-paths,
// so it must not be overwritten with other load data.
- uint32_t string_index_;
+ dex::StringIndex string_index_;
union {
const DexFile* dex_file_; // For string reference.
diff --git a/compiler/optimizing/nodes_test.cc b/compiler/optimizing/nodes_test.cc
index d4e2a58..5d9a652 100644
--- a/compiler/optimizing/nodes_test.cc
+++ b/compiler/optimizing/nodes_test.cc
@@ -35,7 +35,7 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter = new (&allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
entry->AddInstruction(parameter);
entry->AddInstruction(new (&allocator) HGoto());
@@ -78,9 +78,9 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter1 = new (&allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
HInstruction* parameter2 = new (&allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
entry->AddInstruction(parameter1);
entry->AddInstruction(parameter2);
entry->AddInstruction(new (&allocator) HExit());
@@ -106,7 +106,7 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter = new (&allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
entry->AddInstruction(parameter);
ASSERT_FALSE(parameter->HasUses());
@@ -127,7 +127,7 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter1 = new (&allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
HInstruction* with_environment = new (&allocator) HNullCheck(parameter1, 0);
entry->AddInstruction(parameter1);
entry->AddInstruction(with_environment);
diff --git a/compiler/optimizing/optimizing_cfi_test.cc b/compiler/optimizing/optimizing_cfi_test.cc
index 013e110..0e02311 100644
--- a/compiler/optimizing/optimizing_cfi_test.cc
+++ b/compiler/optimizing/optimizing_cfi_test.cc
@@ -24,12 +24,22 @@
#include "optimizing/code_generator.h"
#include "optimizing/optimizing_unit_test.h"
#include "utils/assembler.h"
+#ifdef ART_USE_VIXL_ARM_BACKEND
+#include "utils/arm/assembler_arm_vixl.h"
+#else
#include "utils/arm/assembler_thumb2.h"
+#endif
#include "utils/mips/assembler_mips.h"
#include "utils/mips64/assembler_mips64.h"
#include "optimizing/optimizing_cfi_test_expected.inc"
+#ifdef ART_USE_VIXL_ARM_BACKEND
+namespace vixl32 = vixl::aarch32;
+
+using vixl32::r0;
+#endif
+
namespace art {
// Run the tests only on host.
@@ -158,8 +168,7 @@
TestImpl(isa, #isa, expected_asm, expected_cfi); \
}
-// TODO(VIXL): Support this test for the VIXL backend.
-#if defined(ART_ENABLE_CODEGEN_arm) && !defined(ART_USE_VIXL_ARM_BACKEND)
+#ifdef ART_ENABLE_CODEGEN_arm
TEST_ISA(kThumb2)
#endif
#ifdef ART_ENABLE_CODEGEN_arm64
@@ -178,8 +187,7 @@
TEST_ISA(kMips64)
#endif
-// TODO(VIXL): Support this test for the VIXL backend.
-#if defined(ART_ENABLE_CODEGEN_arm) && !defined(ART_USE_VIXL_ARM_BACKEND)
+#ifdef ART_ENABLE_CODEGEN_arm
TEST_F(OptimizingCFITest, kThumb2Adjust) {
std::vector<uint8_t> expected_asm(
expected_asm_kThumb2_adjust,
@@ -188,6 +196,16 @@
expected_cfi_kThumb2_adjust,
expected_cfi_kThumb2_adjust + arraysize(expected_cfi_kThumb2_adjust));
SetUpFrame(kThumb2);
+#ifdef ART_USE_VIXL_ARM_BACKEND
+#define __ down_cast<arm::ArmVIXLAssembler*>(GetCodeGenerator() \
+ ->GetAssembler())->GetVIXLAssembler()->
+ vixl32::Label target;
+ __ CompareAndBranchIfZero(r0, &target);
+ // Push the target out of range of CBZ.
+ for (size_t i = 0; i != 65; ++i) {
+ __ Ldr(r0, vixl32::MemOperand(r0));
+ }
+#else
#define __ down_cast<arm::Thumb2Assembler*>(GetCodeGenerator()->GetAssembler())->
Label target;
__ CompareAndBranchIfZero(arm::R0, &target);
@@ -195,6 +213,7 @@
for (size_t i = 0; i != 65; ++i) {
__ ldr(arm::R0, arm::Address(arm::R0));
}
+#endif
__ Bind(&target);
#undef __
Finish();
diff --git a/compiler/optimizing/optimizing_cfi_test_expected.inc b/compiler/optimizing/optimizing_cfi_test_expected.inc
index f735dc8..82670c3 100644
--- a/compiler/optimizing/optimizing_cfi_test_expected.inc
+++ b/compiler/optimizing/optimizing_cfi_test_expected.inc
@@ -223,8 +223,16 @@
// 0x00000040: .cfi_def_cfa_offset: 64
static constexpr uint8_t expected_asm_kThumb2_adjust[] = {
+#ifdef ART_USE_VIXL_ARM_BACKEND
+ // VIXL emits an extra 2 bytes here for a 32-bit beq as there is no
+ // optimistic 16-bit emit and subsequent fixup for out of reach targets
+ // as with the current assembler.
+ 0x60, 0xB5, 0x2D, 0xED, 0x02, 0x8A, 0x8B, 0xB0, 0x00, 0x28, 0x00, 0xF0,
+ 0x41, 0x80, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68,
+#else
0x60, 0xB5, 0x2D, 0xED, 0x02, 0x8A, 0x8B, 0xB0, 0x00, 0x28,
0x40, 0xD0, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68,
+#endif
0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68,
0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68,
0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68, 0x00, 0x68,
@@ -239,7 +247,11 @@
};
static constexpr uint8_t expected_cfi_kThumb2_adjust[] = {
0x42, 0x0E, 0x0C, 0x85, 0x03, 0x86, 0x02, 0x8E, 0x01, 0x44, 0x0E, 0x14,
+#ifdef ART_USE_VIXL_ARM_BACKEND
+ 0x05, 0x50, 0x05, 0x05, 0x51, 0x04, 0x42, 0x0E, 0x40, 0x02, 0x88, 0x0A,
+#else
0x05, 0x50, 0x05, 0x05, 0x51, 0x04, 0x42, 0x0E, 0x40, 0x02, 0x86, 0x0A,
+#endif
0x42, 0x0E, 0x14, 0x44, 0x0E, 0x0C, 0x06, 0x50, 0x06, 0x51, 0x42, 0x0B,
0x0E, 0x40,
};
diff --git a/compiler/optimizing/optimizing_compiler.cc b/compiler/optimizing/optimizing_compiler.cc
index 499514d..0d0f62a 100644
--- a/compiler/optimizing/optimizing_compiler.cc
+++ b/compiler/optimizing/optimizing_compiler.cc
@@ -22,6 +22,8 @@
#include <stdint.h>
+#include "android-base/strings.h"
+
#ifdef ART_ENABLE_CODEGEN_arm
#include "dex_cache_array_fixups_arm.h"
#endif
@@ -61,6 +63,7 @@
#include "debug/method_debug_info.h"
#include "dex/verification_results.h"
#include "dex/verified_method.h"
+#include "dex_file_types.h"
#include "driver/compiler_driver-inl.h"
#include "driver/compiler_options.h"
#include "driver/dex_compilation_unit.h"
@@ -117,6 +120,7 @@
size_t GetSize() const { return size_; }
const ArenaVector<uint8_t>& GetMemory() const { return memory_; }
+ uint8_t* GetData() { return memory_.data(); }
private:
ArenaVector<uint8_t> memory_;
@@ -373,7 +377,8 @@
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache,
ArtMethod* method,
- bool osr) const;
+ bool osr,
+ VariableSizedHandleScope* handles) const;
void MaybeRunInliner(HGraph* graph,
CodeGenerator* codegen,
@@ -493,7 +498,7 @@
number_of_dex_registers,
/* depth */ 0);
} else if (opt_name == HSharpening::kSharpeningPassName) {
- return new (arena) HSharpening(graph, codegen, dex_compilation_unit, driver);
+ return new (arena) HSharpening(graph, codegen, dex_compilation_unit, driver, handles);
} else if (opt_name == HSelectGenerator::kSelectGeneratorPassName) {
return new (arena) HSelectGenerator(graph, stats);
} else if (opt_name == HInductionVarAnalysis::kInductionPassName) {
@@ -628,10 +633,8 @@
#if defined(ART_ENABLE_CODEGEN_arm)
case kThumb2:
case kArm: {
-#ifndef ART_USE_VIXL_ARM_BACKEND
arm::DexCacheArrayFixups* fixups =
new (arena) arm::DexCacheArrayFixups(graph, codegen, stats);
-#endif
arm::InstructionSimplifierArm* simplifier =
new (arena) arm::InstructionSimplifierArm(graph, stats);
SideEffectsAnalysis* side_effects = new (arena) SideEffectsAnalysis(graph);
@@ -640,9 +643,7 @@
simplifier,
side_effects,
gvn,
-#ifndef ART_USE_VIXL_ARM_BACKEND
fixups
-#endif
};
RunOptimizations(arm_optimizations, arraysize(arm_optimizations), pass_observer);
break;
@@ -769,7 +770,8 @@
HInductionVarAnalysis* induction = new (arena) HInductionVarAnalysis(graph);
BoundsCheckElimination* bce = new (arena) BoundsCheckElimination(graph, *side_effects, induction);
HLoopOptimization* loop = new (arena) HLoopOptimization(graph, induction);
- HSharpening* sharpening = new (arena) HSharpening(graph, codegen, dex_compilation_unit, driver);
+ HSharpening* sharpening = new (arena) HSharpening(
+ graph, codegen, dex_compilation_unit, driver, handles);
InstructionSimplifier* simplify2 = new (arena) InstructionSimplifier(
graph, stats, "instruction_simplifier$after_inlining");
InstructionSimplifier* simplify3 = new (arena) InstructionSimplifier(
@@ -868,7 +870,8 @@
const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache,
ArtMethod* method,
- bool osr) const {
+ bool osr,
+ VariableSizedHandleScope* handles) const {
MaybeRecordStat(MethodCompilationStat::kAttemptCompilation);
CompilerDriver* compiler_driver = GetCompilerDriver();
InstructionSet instruction_set = compiler_driver->GetInstructionSet();
@@ -947,7 +950,7 @@
graph->SetArtMethod(method);
ScopedObjectAccess soa(Thread::Current());
interpreter_metadata = method->GetQuickenedInfo(class_linker->GetImagePointerSize());
- uint16_t type_index = method->GetDeclaringClass()->GetDexTypeIndex();
+ dex::TypeIndex type_index = method->GetDeclaringClass()->GetDexTypeIndex();
// Update the dex cache if the type is not in it yet. Note that under AOT,
// the verifier must have set it, but under JIT, there's no guarantee, as we
@@ -978,64 +981,56 @@
compiler_driver,
dump_mutex_);
- VLOG(compiler) << "Building " << pass_observer.GetMethodName();
-
{
- ScopedObjectAccess soa(Thread::Current());
- VariableSizedHandleScope handles(soa.Self());
- // Do not hold `mutator_lock_` between optimizations.
- ScopedThreadSuspension sts(soa.Self(), kNative);
-
- {
- PassScope scope(HGraphBuilder::kBuilderPassName, &pass_observer);
- HGraphBuilder builder(graph,
- &dex_compilation_unit,
- &dex_compilation_unit,
- &dex_file,
- *code_item,
- compiler_driver,
- compilation_stats_.get(),
- interpreter_metadata,
- dex_cache,
- &handles);
- GraphAnalysisResult result = builder.BuildGraph();
- if (result != kAnalysisSuccess) {
- switch (result) {
- case kAnalysisSkipped:
- MaybeRecordStat(MethodCompilationStat::kNotCompiledSkipped);
- break;
- case kAnalysisInvalidBytecode:
- MaybeRecordStat(MethodCompilationStat::kNotCompiledInvalidBytecode);
- break;
- case kAnalysisFailThrowCatchLoop:
- MaybeRecordStat(MethodCompilationStat::kNotCompiledThrowCatchLoop);
- break;
- case kAnalysisFailAmbiguousArrayOp:
- MaybeRecordStat(MethodCompilationStat::kNotCompiledAmbiguousArrayOp);
- break;
- case kAnalysisSuccess:
- UNREACHABLE();
- }
- pass_observer.SetGraphInBadState();
- return nullptr;
+ VLOG(compiler) << "Building " << pass_observer.GetMethodName();
+ PassScope scope(HGraphBuilder::kBuilderPassName, &pass_observer);
+ HGraphBuilder builder(graph,
+ &dex_compilation_unit,
+ &dex_compilation_unit,
+ &dex_file,
+ *code_item,
+ compiler_driver,
+ compilation_stats_.get(),
+ interpreter_metadata,
+ dex_cache,
+ handles);
+ GraphAnalysisResult result = builder.BuildGraph();
+ if (result != kAnalysisSuccess) {
+ switch (result) {
+ case kAnalysisSkipped:
+ MaybeRecordStat(MethodCompilationStat::kNotCompiledSkipped);
+ break;
+ case kAnalysisInvalidBytecode:
+ MaybeRecordStat(MethodCompilationStat::kNotCompiledInvalidBytecode);
+ break;
+ case kAnalysisFailThrowCatchLoop:
+ MaybeRecordStat(MethodCompilationStat::kNotCompiledThrowCatchLoop);
+ break;
+ case kAnalysisFailAmbiguousArrayOp:
+ MaybeRecordStat(MethodCompilationStat::kNotCompiledAmbiguousArrayOp);
+ break;
+ case kAnalysisSuccess:
+ UNREACHABLE();
}
+ pass_observer.SetGraphInBadState();
+ return nullptr;
}
-
- RunOptimizations(graph,
- codegen.get(),
- compiler_driver,
- dex_compilation_unit,
- &pass_observer,
- &handles);
-
- RegisterAllocator::Strategy regalloc_strategy =
- compiler_options.GetRegisterAllocationStrategy();
- AllocateRegisters(graph, codegen.get(), &pass_observer, regalloc_strategy);
-
- codegen->Compile(code_allocator);
- pass_observer.DumpDisassembly();
}
+ RunOptimizations(graph,
+ codegen.get(),
+ compiler_driver,
+ dex_compilation_unit,
+ &pass_observer,
+ handles);
+
+ RegisterAllocator::Strategy regalloc_strategy =
+ compiler_options.GetRegisterAllocationStrategy();
+ AllocateRegisters(graph, codegen.get(), &pass_observer, regalloc_strategy);
+
+ codegen->Compile(code_allocator);
+ pass_observer.DumpDisassembly();
+
return codegen.release();
}
@@ -1057,19 +1052,27 @@
verified_method->GetEncounteredVerificationFailures())) {
ArenaAllocator arena(Runtime::Current()->GetArenaPool());
CodeVectorAllocator code_allocator(&arena);
- std::unique_ptr<CodeGenerator> codegen(
- TryCompile(&arena,
- &code_allocator,
- code_item,
- access_flags,
- invoke_type,
- class_def_idx,
- method_idx,
- jclass_loader,
- dex_file,
- dex_cache,
- nullptr,
- /* osr */ false));
+ std::unique_ptr<CodeGenerator> codegen;
+ {
+ ScopedObjectAccess soa(Thread::Current());
+ VariableSizedHandleScope handles(soa.Self());
+ // Go to native so that we don't block GC during compilation.
+ ScopedThreadSuspension sts(soa.Self(), kNative);
+ codegen.reset(
+ TryCompile(&arena,
+ &code_allocator,
+ code_item,
+ access_flags,
+ invoke_type,
+ class_def_idx,
+ method_idx,
+ jclass_loader,
+ dex_file,
+ dex_cache,
+ nullptr,
+ /* osr */ false,
+ &handles));
+ }
if (codegen.get() != nullptr) {
MaybeRecordStat(MethodCompilationStat::kCompiled);
method = Emit(&arena, &code_allocator, codegen.get(), compiler_driver, code_item);
@@ -1114,7 +1117,8 @@
bool IsCompilingWithCoreImage() {
const std::string& image = Runtime::Current()->GetImageLocation();
// TODO: This is under-approximating...
- if (EndsWith(image, "core.art") || EndsWith(image, "core-optimizing.art")) {
+ if (android::base::EndsWith(image, "core.art") ||
+ android::base::EndsWith(image, "core-optimizing.art")) {
return true;
}
return false;
@@ -1124,7 +1128,7 @@
jit::JitCodeCache* code_cache,
ArtMethod* method,
bool osr) {
- StackHandleScope<2> hs(self);
+ StackHandleScope<3> hs(self);
Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
method->GetDeclaringClass()->GetClassLoader()));
Handle<mirror::DexCache> dex_cache(hs.NewHandle(method->GetDexCache()));
@@ -1140,6 +1144,8 @@
ArenaAllocator arena(Runtime::Current()->GetJitArenaPool());
CodeVectorAllocator code_allocator(&arena);
+ VariableSizedHandleScope handles(self);
+
std::unique_ptr<CodeGenerator> codegen;
{
// Go to native so that we don't block GC during compilation.
@@ -1156,7 +1162,8 @@
*dex_file,
dex_cache,
method,
- osr));
+ osr,
+ &handles));
if (codegen.get() == nullptr) {
return false;
}
@@ -1170,25 +1177,49 @@
}
size_t stack_map_size = codegen->ComputeStackMapsSize();
- uint8_t* stack_map_data = code_cache->ReserveData(self, stack_map_size, method);
- if (stack_map_data == nullptr) {
+ size_t number_of_roots = codegen->GetNumberOfJitRoots();
+ ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+ // We allocate an object array to ensure the JIT roots that we will collect in EmitJitRoots
+ // will be visible by the GC between EmitLiterals and CommitCode. Once CommitCode is
+ // executed, this array is not needed.
+ Handle<mirror::ObjectArray<mirror::Object>> roots(
+ hs.NewHandle(mirror::ObjectArray<mirror::Object>::Alloc(
+ self, class_linker->GetClassRoot(ClassLinker::kObjectArrayClass), number_of_roots)));
+ if (roots.Get() == nullptr) {
+ // Out of memory, just clear the exception to avoid any Java exception uncaught problems.
+ DCHECK(self->IsExceptionPending());
+ self->ClearException();
+ return false;
+ }
+ uint8_t* stack_map_data = nullptr;
+ uint8_t* roots_data = nullptr;
+ uint32_t data_size = code_cache->ReserveData(
+ self, stack_map_size, number_of_roots, method, &stack_map_data, &roots_data);
+ if (stack_map_data == nullptr || roots_data == nullptr) {
return false;
}
MaybeRecordStat(MethodCompilationStat::kCompiled);
codegen->BuildStackMaps(MemoryRegion(stack_map_data, stack_map_size), *code_item);
+ codegen->EmitJitRoots(code_allocator.GetData(), roots, roots_data, dex_cache);
+
const void* code = code_cache->CommitCode(
self,
method,
stack_map_data,
+ roots_data,
codegen->HasEmptyFrame() ? 0 : codegen->GetFrameSize(),
codegen->GetCoreSpillMask(),
codegen->GetFpuSpillMask(),
code_allocator.GetMemory().data(),
code_allocator.GetSize(),
- osr);
+ data_size,
+ osr,
+ roots,
+ codegen->GetGraph()->HasShouldDeoptimizeFlag(),
+ codegen->GetGraph()->GetCHASingleImplementationList());
if (code == nullptr) {
- code_cache->ClearData(self, stack_map_data);
+ code_cache->ClearData(self, stack_map_data, roots_data);
return false;
}
diff --git a/compiler/optimizing/optimizing_compiler_stats.h b/compiler/optimizing/optimizing_compiler_stats.h
index c8d1ce0..203b1ec 100644
--- a/compiler/optimizing/optimizing_compiler_stats.h
+++ b/compiler/optimizing/optimizing_compiler_stats.h
@@ -27,6 +27,7 @@
enum MethodCompilationStat {
kAttemptCompilation = 0,
+ kCHAInline,
kCompiled,
kInlinedInvoke,
kReplacedInvokeWithSimplePattern,
@@ -106,6 +107,7 @@
std::string name;
switch (stat) {
case kAttemptCompilation : name = "AttemptCompilation"; break;
+ case kCHAInline : name = "CHAInline"; break;
case kCompiled : name = "Compiled"; break;
case kInlinedInvoke : name = "InlinedInvoke"; break;
case kReplacedInvokeWithSimplePattern: name = "ReplacedInvokeWithSimplePattern"; break;
diff --git a/compiler/optimizing/prepare_for_register_allocation.cc b/compiler/optimizing/prepare_for_register_allocation.cc
index 0db6088..f9ac3a0 100644
--- a/compiler/optimizing/prepare_for_register_allocation.cc
+++ b/compiler/optimizing/prepare_for_register_allocation.cc
@@ -143,7 +143,7 @@
// - or the load class has only one use.
if (instruction->IsFinalizable() || has_only_one_use || load_class->NeedsAccessCheck()) {
instruction->SetEntrypoint(kQuickAllocObject);
- instruction->ReplaceInput(GetGraph()->GetIntConstant(load_class->GetTypeIndex()), 0);
+ instruction->ReplaceInput(GetGraph()->GetIntConstant(load_class->GetTypeIndex().index_), 0);
if (has_only_one_use) {
// We've just removed the only use of the HLoadClass. Since we don't run DCE after this pass,
// do it manually if possible.
diff --git a/compiler/optimizing/pretty_printer.h b/compiler/optimizing/pretty_printer.h
index 5891350..c6579dc 100644
--- a/compiler/optimizing/pretty_printer.h
+++ b/compiler/optimizing/pretty_printer.h
@@ -17,7 +17,8 @@
#ifndef ART_COMPILER_OPTIMIZING_PRETTY_PRINTER_H_
#define ART_COMPILER_OPTIMIZING_PRETTY_PRINTER_H_
-#include "base/stringprintf.h"
+#include "android-base/stringprintf.h"
+
#include "nodes.h"
namespace art {
@@ -108,7 +109,7 @@
: HPrettyPrinter(graph), str_(""), current_block_(nullptr) { }
void PrintInt(int value) OVERRIDE {
- str_ += StringPrintf("%d", value);
+ str_ += android::base::StringPrintf("%d", value);
}
void PrintString(const char* value) OVERRIDE {
diff --git a/compiler/optimizing/pretty_printer_test.cc b/compiler/optimizing/pretty_printer_test.cc
index 951cdfb..1af94f3 100644
--- a/compiler/optimizing/pretty_printer_test.cc
+++ b/compiler/optimizing/pretty_printer_test.cc
@@ -15,7 +15,6 @@
*/
#include "base/arena_allocator.h"
-#include "base/stringprintf.h"
#include "builder.h"
#include "dex_file.h"
#include "dex_instruction.h"
diff --git a/compiler/optimizing/reference_type_propagation.cc b/compiler/optimizing/reference_type_propagation.cc
index d588dea..c191c66 100644
--- a/compiler/optimizing/reference_type_propagation.cc
+++ b/compiler/optimizing/reference_type_propagation.cc
@@ -96,7 +96,7 @@
void VisitBoundType(HBoundType* instr) OVERRIDE;
void VisitNullCheck(HNullCheck* instr) OVERRIDE;
void UpdateReferenceTypeInfo(HInstruction* instr,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
const DexFile& dex_file,
bool is_exact);
@@ -463,7 +463,7 @@
}
void ReferenceTypePropagation::RTPVisitor::UpdateReferenceTypeInfo(HInstruction* instr,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
const DexFile& dex_file,
bool is_exact) {
DCHECK_EQ(instr->GetType(), Primitive::kPrimNot);
@@ -484,7 +484,7 @@
static mirror::Class* GetClassFromDexCache(Thread* self,
const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
Handle<mirror::DexCache> hint_dex_cache)
REQUIRES_SHARED(Locks::mutator_lock_) {
mirror::DexCache* dex_cache = FindDexCacheWithHint(self, dex_file, hint_dex_cache);
diff --git a/compiler/optimizing/register_allocation_resolver.cc b/compiler/optimizing/register_allocation_resolver.cc
index 5991791..59523a9 100644
--- a/compiler/optimizing/register_allocation_resolver.cc
+++ b/compiler/optimizing/register_allocation_resolver.cc
@@ -87,6 +87,10 @@
// Adjust the stack slot, now that we know the number of them for each type.
// The way this implementation lays out the stack is the following:
// [parameter slots ]
+ // [art method (caller) ]
+ // [entry spill (core) ]
+ // [entry spill (float) ]
+ // [should_deoptimize flag] (this is optional)
// [catch phi spill slots ]
// [double spill slots ]
// [long spill slots ]
diff --git a/compiler/optimizing/register_allocator_graph_color.cc b/compiler/optimizing/register_allocator_graph_color.cc
index aa0d371..9064f86 100644
--- a/compiler/optimizing/register_allocator_graph_color.cc
+++ b/compiler/optimizing/register_allocator_graph_color.cc
@@ -1749,7 +1749,7 @@
bool RegisterAllocatorGraphColor::IsCallerSave(size_t reg, bool processing_core_regs) {
return processing_core_regs
? !codegen_->IsCoreCalleeSaveRegister(reg)
- : !codegen_->IsCoreCalleeSaveRegister(reg);
+ : !codegen_->IsFloatingPointCalleeSaveRegister(reg);
}
static bool RegisterIsAligned(size_t reg) {
diff --git a/compiler/optimizing/register_allocator_test.cc b/compiler/optimizing/register_allocator_test.cc
index 55ea99e..559f409 100644
--- a/compiler/optimizing/register_allocator_test.cc
+++ b/compiler/optimizing/register_allocator_test.cc
@@ -20,6 +20,7 @@
#include "code_generator.h"
#include "code_generator_x86.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "dex_instruction.h"
#include "driver/compiler_options.h"
#include "nodes.h"
@@ -495,7 +496,7 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter = new (allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
entry->AddInstruction(parameter);
HBasicBlock* block = new (allocator) HBasicBlock(graph);
@@ -658,7 +659,7 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter = new (allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimNot);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimNot);
entry->AddInstruction(parameter);
HBasicBlock* block = new (allocator) HBasicBlock(graph);
@@ -742,7 +743,7 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* parameter = new (allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimInt);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
entry->AddInstruction(parameter);
HInstruction* constant1 = graph->GetIntConstant(1);
@@ -821,9 +822,9 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* first = new (allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimInt);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
HInstruction* second = new (allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimInt);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
entry->AddInstruction(first);
entry->AddInstruction(second);
@@ -883,13 +884,13 @@
graph->AddBlock(entry);
graph->SetEntryBlock(entry);
HInstruction* one = new (&allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimInt);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
HInstruction* two = new (&allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimInt);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
HInstruction* three = new (&allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimInt);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
HInstruction* four = new (&allocator) HParameterValue(
- graph->GetDexFile(), 0, 0, Primitive::kPrimInt);
+ graph->GetDexFile(), dex::TypeIndex(0), 0, Primitive::kPrimInt);
entry->AddInstruction(one);
entry->AddInstruction(two);
entry->AddInstruction(three);
diff --git a/compiler/optimizing/sharpening.cc b/compiler/optimizing/sharpening.cc
index 63e4ca6..91efb80 100644
--- a/compiler/optimizing/sharpening.cc
+++ b/compiler/optimizing/sharpening.cc
@@ -147,11 +147,11 @@
DCHECK(!load_class->IsInBootImage()) << "HLoadClass should not be optimized before sharpening.";
const DexFile& dex_file = load_class->GetDexFile();
- uint32_t type_index = load_class->GetTypeIndex();
+ dex::TypeIndex type_index = load_class->GetTypeIndex();
bool is_in_dex_cache = false;
bool is_in_boot_image = false;
- HLoadClass::LoadKind desired_load_kind;
+ HLoadClass::LoadKind desired_load_kind = static_cast<HLoadClass::LoadKind>(-1);
uint64_t address = 0u; // Class or dex cache element address.
{
ScopedObjectAccess soa(Thread::Current());
@@ -190,18 +190,21 @@
// TODO: Use direct pointers for all non-moving spaces, not just boot image. Bug: 29530787
desired_load_kind = HLoadClass::LoadKind::kBootImageAddress;
address = reinterpret_cast64<uint64_t>(klass);
+ } else if (is_in_dex_cache) {
+ desired_load_kind = HLoadClass::LoadKind::kJitTableAddress;
+ // We store in the address field the location of the stack reference maintained
+ // by the handle. We do this now so that the code generation does not need to figure
+ // out which class loader to use.
+ address = reinterpret_cast<uint64_t>(handles_->NewHandle(klass).GetReference());
} else {
- // Note: If the class is not in the dex cache or isn't initialized, the
- // instruction needs environment and will not be inlined across dex files.
- // Within a dex file, the slow-path helper loads the correct class and
- // inlined frames are used correctly for OOM stack trace.
- // TODO: Write a test for this. Bug: 29416588
- desired_load_kind = HLoadClass::LoadKind::kDexCacheAddress;
- void* dex_cache_element_address = &dex_cache->GetResolvedTypes()[type_index];
- address = reinterpret_cast64<uint64_t>(dex_cache_element_address);
+ // Class not loaded yet. This happens when the dex code requesting
+ // this `HLoadClass` hasn't been executed in the interpreter.
+ // Fallback to the dex cache.
+ // TODO(ngeoffray): Generate HDeoptimize instead.
+ desired_load_kind = HLoadClass::LoadKind::kDexCacheViaMethod;
}
- // AOT app compilation. Check if the class is in the boot image.
} else if (is_in_boot_image && !codegen_->GetCompilerOptions().GetCompilePic()) {
+ // AOT app compilation. Check if the class is in the boot image.
desired_load_kind = HLoadClass::LoadKind::kBootImageAddress;
address = reinterpret_cast64<uint64_t>(klass);
} else {
@@ -215,6 +218,7 @@
}
}
}
+ DCHECK_NE(desired_load_kind, static_cast<HLoadClass::LoadKind>(-1));
if (is_in_boot_image) {
load_class->MarkInBootImage();
@@ -245,7 +249,7 @@
load_class->SetLoadKindWithTypeReference(load_kind, dex_file, type_index);
break;
case HLoadClass::LoadKind::kBootImageAddress:
- case HLoadClass::LoadKind::kDexCacheAddress:
+ case HLoadClass::LoadKind::kJitTableAddress:
DCHECK_NE(address, 0u);
load_class->SetLoadKindWithAddress(load_kind, address);
break;
@@ -267,7 +271,7 @@
DCHECK(!load_string->IsInDexCache());
const DexFile& dex_file = load_string->GetDexFile();
- uint32_t string_index = load_string->GetStringIndex();
+ dex::StringIndex string_index = load_string->GetStringIndex();
HLoadString::LoadKind desired_load_kind = HLoadString::LoadKind::kDexCacheViaMethod;
uint64_t address = 0u; // String or dex cache element address.
@@ -281,7 +285,8 @@
: hs.NewHandle(class_linker->FindDexCache(soa.Self(), dex_file));
if (codegen_->GetCompilerOptions().IsBootImage()) {
- // Compiling boot image. Resolve the string and allocate it if needed.
+ // Compiling boot image. Resolve the string and allocate it if needed, to ensure
+ // the string will be added to the boot image.
DCHECK(!runtime->UseJitCompilation());
mirror::String* string = class_linker->ResolveString(dex_file, string_index, dex_cache);
CHECK(string != nullptr);
@@ -297,10 +302,14 @@
} else if (runtime->UseJitCompilation()) {
// TODO: Make sure we don't set the "compile PIC" flag for JIT as that's bogus.
// DCHECK(!codegen_->GetCompilerOptions().GetCompilePic());
- mirror::String* string = dex_cache->GetResolvedString(string_index);
- if (string != nullptr && runtime->GetHeap()->ObjectIsInBootImageSpace(string)) {
- desired_load_kind = HLoadString::LoadKind::kBootImageAddress;
- address = reinterpret_cast64<uint64_t>(string);
+ mirror::String* string = class_linker->LookupString(dex_file, string_index, dex_cache);
+ if (string != nullptr) {
+ if (runtime->GetHeap()->ObjectIsInBootImageSpace(string)) {
+ desired_load_kind = HLoadString::LoadKind::kBootImageAddress;
+ address = reinterpret_cast64<uint64_t>(string);
+ } else {
+ desired_load_kind = HLoadString::LoadKind::kJitTableAddress;
+ }
}
} else {
// AOT app compilation. Try to lookup the string without allocating if not found.
@@ -322,6 +331,7 @@
case HLoadString::LoadKind::kBootImageLinkTimePcRelative:
case HLoadString::LoadKind::kBssEntry:
case HLoadString::LoadKind::kDexCacheViaMethod:
+ case HLoadString::LoadKind::kJitTableAddress:
load_string->SetLoadKindWithStringReference(load_kind, dex_file, string_index);
break;
case HLoadString::LoadKind::kBootImageAddress:
diff --git a/compiler/optimizing/sharpening.h b/compiler/optimizing/sharpening.h
index d35ae66..7418954 100644
--- a/compiler/optimizing/sharpening.h
+++ b/compiler/optimizing/sharpening.h
@@ -35,11 +35,13 @@
HSharpening(HGraph* graph,
CodeGenerator* codegen,
const DexCompilationUnit& compilation_unit,
- CompilerDriver* compiler_driver)
+ CompilerDriver* compiler_driver,
+ VariableSizedHandleScope* handles)
: HOptimization(graph, kSharpeningPassName),
codegen_(codegen),
compilation_unit_(compilation_unit),
- compiler_driver_(compiler_driver) { }
+ compiler_driver_(compiler_driver),
+ handles_(handles) { }
void Run() OVERRIDE;
@@ -53,6 +55,7 @@
CodeGenerator* codegen_;
const DexCompilationUnit& compilation_unit_;
CompilerDriver* compiler_driver_;
+ VariableSizedHandleScope* handles_;
};
} // namespace art
diff --git a/compiler/optimizing/ssa_test.cc b/compiler/optimizing/ssa_test.cc
index 4297634..f69f417 100644
--- a/compiler/optimizing/ssa_test.cc
+++ b/compiler/optimizing/ssa_test.cc
@@ -14,8 +14,9 @@
* limitations under the License.
*/
+#include "android-base/stringprintf.h"
+
#include "base/arena_allocator.h"
-#include "base/stringprintf.h"
#include "builder.h"
#include "dex_file.h"
#include "dex_instruction.h"
@@ -35,7 +36,7 @@
explicit SsaPrettyPrinter(HGraph* graph) : HPrettyPrinter(graph), str_("") {}
void PrintInt(int value) OVERRIDE {
- str_ += StringPrintf("%d", value);
+ str_ += android::base::StringPrintf("%d", value);
}
void PrintString(const char* value) OVERRIDE {
diff --git a/compiler/utils/arm/assembler_arm_vixl.cc b/compiler/utils/arm/assembler_arm_vixl.cc
index e3b9fb6..453c90a 100644
--- a/compiler/utils/arm/assembler_arm_vixl.cc
+++ b/compiler/utils/arm/assembler_arm_vixl.cc
@@ -23,6 +23,9 @@
using namespace vixl::aarch32; // NOLINT(build/namespaces)
+using vixl::ExactAssemblyScope;
+using vixl::CodeBufferCheckScope;
+
namespace art {
namespace arm {
@@ -43,12 +46,12 @@
}
const uint8_t* ArmVIXLAssembler::CodeBufferBaseAddress() const {
- return vixl_masm_.GetStartAddress<uint8_t*>();
+ return vixl_masm_.GetBuffer().GetStartAddress<const uint8_t*>();
}
void ArmVIXLAssembler::FinalizeInstructions(const MemoryRegion& region) {
// Copy the instructions from the buffer.
- MemoryRegion from(vixl_masm_.GetStartAddress<void*>(), CodeSize());
+ MemoryRegion from(vixl_masm_.GetBuffer()->GetStartAddress<void*>(), CodeSize());
region.CopyFrom(0, from);
}
@@ -365,7 +368,7 @@
if (stack_offset != 0) {
base = temps.Acquire();
DCHECK_EQ(regs & (1u << base.GetCode()), 0u);
- ___ Add(base, sp, stack_offset);
+ ___ Add(base, sp, Operand::From(stack_offset));
}
___ Stm(base, NO_WRITE_BACK, RegisterList(regs));
} else {
@@ -385,7 +388,7 @@
vixl32::Register base = sp;
if (stack_offset != 0) {
base = temps.Acquire();
- ___ Add(base, sp, stack_offset);
+ ___ Add(base, sp, Operand::From(stack_offset));
}
___ Ldm(base, NO_WRITE_BACK, RegisterList(regs));
} else {
@@ -429,5 +432,52 @@
}
}
+void ArmVIXLMacroAssembler::CompareAndBranchIfZero(vixl32::Register rn,
+ vixl32::Label* label,
+ bool is_far_target) {
+ if (!is_far_target && rn.IsLow() && !label->IsBound()) {
+ // In T32, Cbz/Cbnz instructions have following limitations:
+ // - There are only 7 bits (i:imm5:0) to encode branch target address (cannot be far target).
+ // - Only low registers (i.e R0 .. R7) can be encoded.
+ // - Only forward branches (unbound labels) are supported.
+ Cbz(rn, label);
+ return;
+ }
+ Cmp(rn, 0);
+ B(eq, label);
+}
+
+void ArmVIXLMacroAssembler::CompareAndBranchIfNonZero(vixl32::Register rn,
+ vixl32::Label* label,
+ bool is_far_target) {
+ if (!is_far_target && rn.IsLow() && !label->IsBound()) {
+ Cbnz(rn, label);
+ return;
+ }
+ Cmp(rn, 0);
+ B(ne, label);
+}
+
+void ArmVIXLMacroAssembler::B(vixl32::Label* label) {
+ if (!label->IsBound()) {
+ // Try to use 16-bit T2 encoding of B instruction.
+ DCHECK(OutsideITBlock());
+ ExactAssemblyScope ass(this,
+ kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ b(al, Narrow, label);
+ AddBranchLabel(label);
+ return;
+ }
+ MacroAssembler::B(label);
+}
+
+void ArmVIXLMacroAssembler::B(vixl32::Condition cond, vixl32::Label* label) {
+ // To further reduce the Bcc encoding size and use 16-bit T1 encoding,
+ // we can provide a hint to this function: i.e. far_target=false.
+ // By default this function uses 'EncodingSizeType::Best' which generates 32-bit T3 encoding.
+ MacroAssembler::B(cond, label);
+}
+
} // namespace arm
} // namespace art
diff --git a/compiler/utils/arm/assembler_arm_vixl.h b/compiler/utils/arm/assembler_arm_vixl.h
index e020628..5661249 100644
--- a/compiler/utils/arm/assembler_arm_vixl.h
+++ b/compiler/utils/arm/assembler_arm_vixl.h
@@ -37,6 +37,96 @@
namespace art {
namespace arm {
+class ArmVIXLMacroAssembler FINAL : public vixl32::MacroAssembler {
+ public:
+ // The following interfaces can generate CMP+Bcc or Cbz/Cbnz.
+ // CMP+Bcc are generated by default.
+ // If a hint is given (is_far_target = false) and rn and label can all fit into Cbz/Cbnz,
+ // then Cbz/Cbnz is generated.
+ // Prefer following interfaces to using vixl32::MacroAssembler::Cbz/Cbnz.
+ // In T32, Cbz/Cbnz instructions have following limitations:
+ // - Far targets, which are over 126 bytes away, are not supported.
+ // - Only low registers can be encoded.
+ // - Backward branches are not supported.
+ void CompareAndBranchIfZero(vixl32::Register rn,
+ vixl32::Label* label,
+ bool is_far_target = true);
+ void CompareAndBranchIfNonZero(vixl32::Register rn,
+ vixl32::Label* label,
+ bool is_far_target = true);
+
+ // In T32 some of the instructions (add, mov, etc) outside an IT block
+ // have only 32-bit encodings. But there are 16-bit flag setting
+ // versions of these instructions (adds, movs, etc). In most of the
+ // cases in ART we don't care if the instructions keep flags or not;
+ // thus we can benefit from smaller code size.
+ // VIXL will never generate flag setting versions (for example, adds
+ // for Add macro instruction) unless vixl32::DontCare option is
+ // explicitly specified. That's why we introduce wrappers to use
+ // DontCare option by default.
+#define WITH_FLAGS_DONT_CARE_RD_RN_OP(func_name) \
+ void (func_name)(vixl32::Register rd, vixl32::Register rn, const vixl32::Operand& operand) { \
+ MacroAssembler::func_name(vixl32::DontCare, rd, rn, operand); \
+ } \
+ using MacroAssembler::func_name
+
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Adc);
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Sub);
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Sbc);
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Rsb);
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Rsc);
+
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Eor);
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Orr);
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Orn);
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(And);
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Bic);
+
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Asr);
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Lsr);
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Lsl);
+ WITH_FLAGS_DONT_CARE_RD_RN_OP(Ror);
+
+#undef WITH_FLAGS_DONT_CARE_RD_RN_OP
+
+#define WITH_FLAGS_DONT_CARE_RD_OP(func_name) \
+ void (func_name)(vixl32::Register rd, const vixl32::Operand& operand) { \
+ MacroAssembler::func_name(vixl32::DontCare, rd, operand); \
+ } \
+ using MacroAssembler::func_name
+
+ WITH_FLAGS_DONT_CARE_RD_OP(Mvn);
+ WITH_FLAGS_DONT_CARE_RD_OP(Mov);
+
+#undef WITH_FLAGS_DONT_CARE_RD_OP
+
+ // The following two functions don't fall into above categories. Overload them separately.
+ void Rrx(vixl32::Register rd, vixl32::Register rn) {
+ MacroAssembler::Rrx(vixl32::DontCare, rd, rn);
+ }
+ using MacroAssembler::Rrx;
+
+ void Mul(vixl32::Register rd, vixl32::Register rn, vixl32::Register rm) {
+ MacroAssembler::Mul(vixl32::DontCare, rd, rn, rm);
+ }
+ using MacroAssembler::Mul;
+
+ // TODO: Remove when MacroAssembler::Add(FlagsUpdate, Condition, Register, Register, Operand)
+ // makes the right decision about 16-bit encodings.
+ void Add(vixl32::Register rd, vixl32::Register rn, const vixl32::Operand& operand) {
+ if (rd.Is(rn)) {
+ MacroAssembler::Add(rd, rn, operand);
+ } else {
+ MacroAssembler::Add(vixl32::DontCare, rd, rn, operand);
+ }
+ }
+ using MacroAssembler::Add;
+
+ // These interfaces try to use 16-bit T2 encoding of B instruction.
+ void B(vixl32::Label* label);
+ void B(vixl32::Condition cond, vixl32::Label* label);
+};
+
class ArmVIXLAssembler FINAL : public Assembler {
private:
class ArmException;
@@ -48,7 +138,7 @@
}
virtual ~ArmVIXLAssembler() {}
- vixl32::MacroAssembler* GetVIXLAssembler() { return &vixl_masm_; }
+ ArmVIXLMacroAssembler* GetVIXLAssembler() { return &vixl_masm_; }
void FinalizeCode() OVERRIDE;
// Size of generated code.
@@ -115,9 +205,18 @@
int32_t value,
vixl32::Condition cond = vixl32::al);
+ template <typename T>
+ vixl::aarch32::Literal<T>* CreateLiteralDestroyedWithPool(T value) {
+ vixl::aarch32::Literal<T>* literal =
+ new vixl::aarch32::Literal<T>(value,
+ vixl32::RawLiteral::kPlacedWhenUsed,
+ vixl32::RawLiteral::kDeletedOnPoolDestruction);
+ return literal;
+ }
+
private:
// VIXL assembler.
- vixl32::MacroAssembler vixl_masm_;
+ ArmVIXLMacroAssembler vixl_masm_;
};
// Thread register declaration.
diff --git a/compiler/utils/arm/assembler_thumb2_test.cc b/compiler/utils/arm/assembler_thumb2_test.cc
index 30e8f4e..0147a76 100644
--- a/compiler/utils/arm/assembler_thumb2_test.cc
+++ b/compiler/utils/arm/assembler_thumb2_test.cc
@@ -16,12 +16,15 @@
#include "assembler_thumb2.h"
+#include "android-base/stringprintf.h"
+
#include "base/stl_util.h"
-#include "base/stringprintf.h"
#include "utils/assembler_test.h"
namespace art {
+using android::base::StringPrintf;
+
class AssemblerThumb2Test : public AssemblerTest<arm::Thumb2Assembler,
arm::Register, arm::SRegister,
uint32_t> {
diff --git a/compiler/utils/arm/jni_macro_assembler_arm.cc b/compiler/utils/arm/jni_macro_assembler_arm.cc
index cf7a4d1..3f425df 100644
--- a/compiler/utils/arm/jni_macro_assembler_arm.cc
+++ b/compiler/utils/arm/jni_macro_assembler_arm.cc
@@ -594,6 +594,41 @@
__ b(slow->Entry(), NE);
}
+std::unique_ptr<JNIMacroLabel> ArmJNIMacroAssembler::CreateLabel() {
+ return std::unique_ptr<JNIMacroLabel>(new ArmJNIMacroLabel());
+}
+
+void ArmJNIMacroAssembler::Jump(JNIMacroLabel* label) {
+ CHECK(label != nullptr);
+ __ b(ArmJNIMacroLabel::Cast(label)->AsArm());
+}
+
+void ArmJNIMacroAssembler::Jump(JNIMacroLabel* label,
+ JNIMacroUnaryCondition condition,
+ ManagedRegister test) {
+ CHECK(label != nullptr);
+
+ arm::Condition arm_cond;
+ switch (condition) {
+ case JNIMacroUnaryCondition::kZero:
+ arm_cond = EQ;
+ break;
+ case JNIMacroUnaryCondition::kNotZero:
+ arm_cond = NE;
+ break;
+ default:
+ LOG(FATAL) << "Not implemented condition: " << static_cast<int>(condition);
+ UNREACHABLE();
+ }
+ __ cmp(test.AsArm().AsCoreRegister(), ShifterOperand(0));
+ __ b(ArmJNIMacroLabel::Cast(label)->AsArm(), arm_cond);
+}
+
+void ArmJNIMacroAssembler::Bind(JNIMacroLabel* label) {
+ CHECK(label != nullptr);
+ __ Bind(ArmJNIMacroLabel::Cast(label)->AsArm());
+}
+
#undef __
void ArmExceptionSlowPath::Emit(Assembler* sasm) {
diff --git a/compiler/utils/arm/jni_macro_assembler_arm.h b/compiler/utils/arm/jni_macro_assembler_arm.h
index 4471906..809ac8b 100644
--- a/compiler/utils/arm/jni_macro_assembler_arm.h
+++ b/compiler/utils/arm/jni_macro_assembler_arm.h
@@ -25,6 +25,7 @@
#include "base/enums.h"
#include "base/macros.h"
#include "utils/jni_macro_assembler.h"
+#include "utils/label.h"
#include "offsets.h"
namespace art {
@@ -159,10 +160,26 @@
void MemoryBarrier(ManagedRegister scratch) OVERRIDE;
+ // Create a new label that can be used with Jump/Bind calls.
+ std::unique_ptr<JNIMacroLabel> CreateLabel() OVERRIDE;
+ // Emit an unconditional jump to the label.
+ void Jump(JNIMacroLabel* label) OVERRIDE;
+ // Emit a conditional jump to the label by applying a unary condition test to the register.
+ void Jump(JNIMacroLabel* label, JNIMacroUnaryCondition cond, ManagedRegister test) OVERRIDE;
+ // Code at this offset will serve as the target for the Jump call.
+ void Bind(JNIMacroLabel* label) OVERRIDE;
+
private:
std::unique_ptr<ArmAssembler> asm_;
};
+class ArmJNIMacroLabel FINAL : public JNIMacroLabelCommon<ArmJNIMacroLabel, art::Label, kArm> {
+ public:
+ art::Label* AsArm() {
+ return AsPlatformLabel();
+ }
+};
+
} // namespace arm
} // namespace art
diff --git a/compiler/utils/arm/jni_macro_assembler_arm_vixl.cc b/compiler/utils/arm/jni_macro_assembler_arm_vixl.cc
index 23b2774..d07c047 100644
--- a/compiler/utils/arm/jni_macro_assembler_arm_vixl.cc
+++ b/compiler/utils/arm/jni_macro_assembler_arm_vixl.cc
@@ -24,6 +24,9 @@
using namespace vixl::aarch32; // NOLINT(build/namespaces)
namespace vixl32 = vixl::aarch32;
+using vixl::ExactAssemblyScope;
+using vixl::CodeBufferCheckScope;
+
namespace art {
namespace arm {
@@ -168,6 +171,8 @@
CHECK_EQ(0u, size);
} else if (src.IsCoreRegister()) {
CHECK_EQ(4u, size);
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(src.AsVIXLRegister());
asm_.StoreToOffset(kStoreWord, src.AsVIXLRegister(), sp, dest.Int32Value());
} else if (src.IsRegisterPair()) {
CHECK_EQ(8u, size);
@@ -186,12 +191,16 @@
void ArmVIXLJNIMacroAssembler::StoreRef(FrameOffset dest, ManagedRegister msrc) {
ArmManagedRegister src = msrc.AsArm();
CHECK(src.IsCoreRegister()) << src;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(src.AsVIXLRegister());
asm_.StoreToOffset(kStoreWord, src.AsVIXLRegister(), sp, dest.Int32Value());
}
void ArmVIXLJNIMacroAssembler::StoreRawPtr(FrameOffset dest, ManagedRegister msrc) {
ArmManagedRegister src = msrc.AsArm();
CHECK(src.IsCoreRegister()) << src;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(src.AsVIXLRegister());
asm_.StoreToOffset(kStoreWord, src.AsVIXLRegister(), sp, dest.Int32Value());
}
@@ -202,6 +211,8 @@
ArmManagedRegister src = msrc.AsArm();
ArmManagedRegister scratch = mscratch.AsArm();
asm_.StoreToOffset(kStoreWord, src.AsVIXLRegister(), sp, dest.Int32Value());
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(scratch.AsVIXLRegister());
asm_.LoadFromOffset(kLoadWord, scratch.AsVIXLRegister(), sp, in_off.Int32Value());
asm_.StoreToOffset(kStoreWord, scratch.AsVIXLRegister(), sp, dest.Int32Value() + 4);
}
@@ -210,6 +221,8 @@
FrameOffset src,
ManagedRegister mscratch) {
ArmManagedRegister scratch = mscratch.AsArm();
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(scratch.AsVIXLRegister());
asm_.LoadFromOffset(kLoadWord, scratch.AsVIXLRegister(), sp, src.Int32Value());
asm_.StoreToOffset(kStoreWord, scratch.AsVIXLRegister(), sp, dest.Int32Value());
}
@@ -220,6 +233,8 @@
bool unpoison_reference) {
ArmManagedRegister dst = dest.AsArm();
CHECK(dst.IsCoreRegister() && dst.IsCoreRegister()) << dst;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(dst.AsVIXLRegister(), base.AsArm().AsVIXLRegister());
asm_.LoadFromOffset(kLoadWord,
dst.AsVIXLRegister(),
base.AsArm().AsVIXLRegister(),
@@ -246,6 +261,8 @@
ManagedRegister scratch) {
ArmManagedRegister mscratch = scratch.AsArm();
CHECK(mscratch.IsCoreRegister()) << mscratch;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(mscratch.AsVIXLRegister());
asm_.LoadImmediate(mscratch.AsVIXLRegister(), imm);
asm_.StoreToOffset(kStoreWord, mscratch.AsVIXLRegister(), sp, dest.Int32Value());
}
@@ -263,6 +280,8 @@
void ArmVIXLJNIMacroAssembler::LoadRawPtrFromThread(ManagedRegister m_dst, ThreadOffset32 offs) {
ArmManagedRegister dst = m_dst.AsArm();
CHECK(dst.IsCoreRegister()) << dst;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(dst.AsVIXLRegister());
asm_.LoadFromOffset(kLoadWord, dst.AsVIXLRegister(), tr, offs.Int32Value());
}
@@ -271,6 +290,8 @@
ManagedRegister mscratch) {
ArmManagedRegister scratch = mscratch.AsArm();
CHECK(scratch.IsCoreRegister()) << scratch;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(scratch.AsVIXLRegister());
asm_.LoadFromOffset(kLoadWord, scratch.AsVIXLRegister(), tr, thr_offs.Int32Value());
asm_.StoreToOffset(kStoreWord, scratch.AsVIXLRegister(), sp, fr_offs.Int32Value());
}
@@ -286,6 +307,8 @@
ManagedRegister mscratch) {
ArmManagedRegister scratch = mscratch.AsArm();
CHECK(scratch.IsCoreRegister()) << scratch;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(scratch.AsVIXLRegister());
asm_.AddConstant(scratch.AsVIXLRegister(), sp, fr_offs.Int32Value());
asm_.StoreToOffset(kStoreWord, scratch.AsVIXLRegister(), tr, thr_offs.Int32Value());
}
@@ -312,6 +335,8 @@
if (!dst.Equals(src)) {
if (dst.IsCoreRegister()) {
CHECK(src.IsCoreRegister()) << src;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(dst.AsVIXLRegister());
___ Mov(dst.AsVIXLRegister(), src.AsVIXLRegister());
} else if (dst.IsDRegister()) {
if (src.IsDRegister()) {
@@ -351,6 +376,8 @@
ArmManagedRegister temp = scratch.AsArm();
CHECK(temp.IsCoreRegister()) << temp;
CHECK(size == 4 || size == 8) << size;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(temp.AsVIXLRegister());
if (size == 4) {
asm_.LoadFromOffset(kLoadWord, temp.AsVIXLRegister(), sp, src.Int32Value());
asm_.StoreToOffset(kStoreWord, temp.AsVIXLRegister(), sp, dest.Int32Value());
@@ -404,8 +431,6 @@
UNIMPLEMENTED(FATAL);
}
-static constexpr uint32_t kArmInstrMaxSizeInBytes = 4;
-
void ArmVIXLJNIMacroAssembler::CreateHandleScopeEntry(ManagedRegister mout_reg,
FrameOffset handle_scope_offset,
ManagedRegister min_reg,
@@ -414,6 +439,8 @@
ArmManagedRegister in_reg = min_reg.AsArm();
CHECK(in_reg.IsNoRegister() || in_reg.IsCoreRegister()) << in_reg;
CHECK(out_reg.IsCoreRegister()) << out_reg;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(out_reg.AsVIXLRegister());
if (null_allowed) {
// Null values get a handle scope entry value of 0. Otherwise, the handle scope entry is
// the address in the handle scope holding the reference.
@@ -425,20 +452,22 @@
handle_scope_offset.Int32Value());
in_reg = out_reg;
}
+
+ temps.Exclude(in_reg.AsVIXLRegister());
___ Cmp(in_reg.AsVIXLRegister(), 0);
if (asm_.ShifterOperandCanHold(ADD, handle_scope_offset.Int32Value(), kCcDontCare)) {
if (!out_reg.Equals(in_reg)) {
- AssemblerAccurateScope guard(asm_.GetVIXLAssembler(),
- 3 * kArmInstrMaxSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope guard(asm_.GetVIXLAssembler(),
+ 3 * vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
___ it(eq, 0xc);
___ mov(eq, out_reg.AsVIXLRegister(), 0);
asm_.AddConstantInIt(out_reg.AsVIXLRegister(), sp, handle_scope_offset.Int32Value(), ne);
} else {
- AssemblerAccurateScope guard(asm_.GetVIXLAssembler(),
- 2 * kArmInstrMaxSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope guard(asm_.GetVIXLAssembler(),
+ 2 * vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
___ it(ne, 0x8);
asm_.AddConstantInIt(out_reg.AsVIXLRegister(), sp, handle_scope_offset.Int32Value(), ne);
}
@@ -457,6 +486,8 @@
bool null_allowed) {
ArmManagedRegister scratch = mscratch.AsArm();
CHECK(scratch.IsCoreRegister()) << scratch;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(scratch.AsVIXLRegister());
if (null_allowed) {
asm_.LoadFromOffset(kLoadWord, scratch.AsVIXLRegister(), sp, handle_scope_offset.Int32Value());
// Null values get a handle scope entry value of 0. Otherwise, the handle scope entry is
@@ -465,9 +496,9 @@
___ Cmp(scratch.AsVIXLRegister(), 0);
if (asm_.ShifterOperandCanHold(ADD, handle_scope_offset.Int32Value(), kCcDontCare)) {
- AssemblerAccurateScope guard(asm_.GetVIXLAssembler(),
- 2 * kArmInstrMaxSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
+ ExactAssemblyScope guard(asm_.GetVIXLAssembler(),
+ 2 * vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
___ it(ne, 0x8);
asm_.AddConstantInIt(scratch.AsVIXLRegister(), sp, handle_scope_offset.Int32Value(), ne);
} else {
@@ -503,6 +534,8 @@
ArmManagedRegister scratch = mscratch.AsArm();
CHECK(base.IsCoreRegister()) << base;
CHECK(scratch.IsCoreRegister()) << scratch;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(scratch.AsVIXLRegister());
asm_.LoadFromOffset(kLoadWord,
scratch.AsVIXLRegister(),
base.AsVIXLRegister(),
@@ -514,6 +547,8 @@
void ArmVIXLJNIMacroAssembler::Call(FrameOffset base, Offset offset, ManagedRegister mscratch) {
ArmManagedRegister scratch = mscratch.AsArm();
CHECK(scratch.IsCoreRegister()) << scratch;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(scratch.AsVIXLRegister());
// Call *(*(SP + base) + offset)
asm_.LoadFromOffset(kLoadWord, scratch.AsVIXLRegister(), sp, base.Int32Value());
asm_.LoadFromOffset(kLoadWord,
@@ -530,6 +565,8 @@
}
void ArmVIXLJNIMacroAssembler::GetCurrentThread(ManagedRegister mtr) {
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(mtr.AsArm().AsVIXLRegister());
___ Mov(mtr.AsArm().AsVIXLRegister(), tr);
}
@@ -541,6 +578,8 @@
void ArmVIXLJNIMacroAssembler::ExceptionPoll(ManagedRegister m_scratch, size_t stack_adjust) {
CHECK_ALIGNED(stack_adjust, kStackAlignment);
ArmManagedRegister scratch = m_scratch.AsArm();
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(scratch.AsVIXLRegister());
exception_blocks_.emplace_back(
new ArmVIXLJNIMacroAssembler::ArmException(scratch, stack_adjust));
asm_.LoadFromOffset(kLoadWord,
@@ -550,10 +589,12 @@
___ Cmp(scratch.AsVIXLRegister(), 0);
{
- AssemblerAccurateScope guard(asm_.GetVIXLAssembler(),
- kArmInstrMaxSizeInBytes,
- CodeBufferCheckScope::kMaximumSize);
- ___ b(ne, Narrow, exception_blocks_.back()->Entry());
+ ExactAssemblyScope guard(asm_.GetVIXLAssembler(),
+ vixl32::kMaxInstructionSizeInBytes,
+ CodeBufferCheckScope::kMaximumSize);
+ vixl32::Label* label = exception_blocks_.back()->Entry();
+ ___ b(ne, Narrow, label);
+ ___ AddBranchLabel(label);
}
// TODO: think about using CBNZ here.
}
@@ -572,12 +613,16 @@
ManagedRegister test) {
CHECK(label != nullptr);
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(test.AsArm().AsVIXLRegister());
switch (condition) {
case JNIMacroUnaryCondition::kZero:
- ___ Cbz(test.AsArm().AsVIXLRegister(), ArmVIXLJNIMacroLabel::Cast(label)->AsArm());
+ ___ CompareAndBranchIfZero(test.AsArm().AsVIXLRegister(),
+ ArmVIXLJNIMacroLabel::Cast(label)->AsArm());
break;
case JNIMacroUnaryCondition::kNotZero:
- ___ Cbnz(test.AsArm().AsVIXLRegister(), ArmVIXLJNIMacroLabel::Cast(label)->AsArm());
+ ___ CompareAndBranchIfNonZero(test.AsArm().AsVIXLRegister(),
+ ArmVIXLJNIMacroLabel::Cast(label)->AsArm());
break;
default:
LOG(FATAL) << "Not implemented unary condition: " << static_cast<int>(condition);
@@ -596,11 +641,14 @@
if (exception->stack_adjust_ != 0) { // Fix up the frame.
DecreaseFrameSize(exception->stack_adjust_);
}
+
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(exception->scratch_.AsVIXLRegister());
// Pass exception object as argument.
// Don't care about preserving r0 as this won't return.
___ Mov(r0, exception->scratch_.AsVIXLRegister());
+ temps.Include(exception->scratch_.AsVIXLRegister());
// TODO: check that exception->scratch_ is dead by this point.
- UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
vixl32::Register temp = temps.Acquire();
___ Ldr(temp,
MemOperand(tr,
@@ -622,6 +670,9 @@
} else if (dest.IsCoreRegister()) {
CHECK(!dest.AsVIXLRegister().Is(sp)) << dest;
+ UseScratchRegisterScope temps(asm_.GetVIXLAssembler());
+ temps.Exclude(dest.AsVIXLRegister());
+
if (size == 1u) {
___ Ldrb(dest.AsVIXLRegister(), MemOperand(base, offset));
} else {
diff --git a/compiler/utils/arm64/assembler_arm64.cc b/compiler/utils/arm64/assembler_arm64.cc
index f91bcfa..6ed0e9b 100644
--- a/compiler/utils/arm64/assembler_arm64.cc
+++ b/compiler/utils/arm64/assembler_arm64.cc
@@ -40,12 +40,12 @@
}
const uint8_t* Arm64Assembler::CodeBufferBaseAddress() const {
- return vixl_masm_.GetStartAddress<uint8_t*>();
+ return vixl_masm_.GetBuffer().GetStartAddress<const uint8_t*>();
}
void Arm64Assembler::FinalizeInstructions(const MemoryRegion& region) {
// Copy the instructions from the buffer.
- MemoryRegion from(vixl_masm_.GetStartAddress<void*>(), CodeSize());
+ MemoryRegion from(vixl_masm_.GetBuffer()->GetStartAddress<void*>(), CodeSize());
region.CopyFrom(0, from);
}
diff --git a/compiler/utils/assembler_test_base.h b/compiler/utils/assembler_test_base.h
index ac24ee9..e7edf96 100644
--- a/compiler/utils/assembler_test_base.h
+++ b/compiler/utils/assembler_test_base.h
@@ -23,6 +23,8 @@
#include <iterator>
#include <sys/stat.h>
+#include "android-base/strings.h"
+
#include "common_runtime_test.h" // For ScratchFile
#include "utils.h"
@@ -221,7 +223,7 @@
args.push_back("-o");
args.push_back(to_file);
args.push_back(from_file);
- std::string cmd = Join(args, ' ');
+ std::string cmd = android::base::Join(args, ' ');
args.clear();
args.push_back("/bin/sh");
@@ -257,7 +259,7 @@
args.push_back(file);
args.push_back(">");
args.push_back(file+".dump");
- std::string cmd = Join(args, ' ');
+ std::string cmd = android::base::Join(args, ' ');
args.clear();
args.push_back("/bin/sh");
@@ -338,7 +340,7 @@
args.push_back("| sed -n \'/<.data>/,$p\' | sed -e \'s/.*://\'");
args.push_back(">");
args.push_back(file+".dis");
- std::string cmd = Join(args, ' ');
+ std::string cmd = android::base::Join(args, ' ');
args.clear();
args.push_back("/bin/sh");
@@ -500,7 +502,7 @@
std::string tmp_file = GetTmpnam();
args.push_back(">");
args.push_back(tmp_file);
- std::string sh_args = Join(args, ' ');
+ std::string sh_args = android::base::Join(args, ' ');
args.clear();
args.push_back("/bin/sh");
@@ -541,7 +543,7 @@
args.push_back("sort");
args.push_back(">");
args.push_back(tmp_file);
- std::string sh_args = Join(args, ' ');
+ std::string sh_args = android::base::Join(args, ' ');
args.clear();
args.push_back("/bin/sh");
diff --git a/compiler/utils/assembler_thumb_test.cc b/compiler/utils/assembler_thumb_test.cc
index 10bed13..4e9b619 100644
--- a/compiler/utils/assembler_thumb_test.cc
+++ b/compiler/utils/assembler_thumb_test.cc
@@ -1717,6 +1717,11 @@
__ ExceptionPoll(scratch_register, 0);
+ // Push the target out of range of branch emitted by ExceptionPoll.
+ for (int i = 0; i < 64; i++) {
+ __ Store(FrameOffset(2047), scratch_register, 4);
+ }
+
__ DecreaseFrameSize(4096);
__ DecreaseFrameSize(32);
__ RemoveFrame(frame_size, callee_save_regs);
@@ -1753,7 +1758,10 @@
__ LoadFromOffset(kLoadWordPair, R2, R4, 0x40400);
__ LoadFromOffset(kLoadWordPair, R4, R4, 0x40400);
+ vixl::aarch32::UseScratchRegisterScope temps(assembler.asm_.GetVIXLAssembler());
+ temps.Exclude(R12);
__ LoadFromOffset(kLoadWord, R0, R12, 12); // 32-bit because of R12.
+ temps.Include(R12);
__ LoadFromOffset(kLoadWord, R2, R4, 0xa4 - 0x100000);
__ LoadFromOffset(kLoadSignedByte, R2, R4, 12);
@@ -1783,7 +1791,10 @@
__ StoreToOffset(kStoreWordPair, R2, R4, 0x40400);
__ StoreToOffset(kStoreWordPair, R4, R4, 0x40400);
+ vixl::aarch32::UseScratchRegisterScope temps(assembler.asm_.GetVIXLAssembler());
+ temps.Exclude(R12);
__ StoreToOffset(kStoreWord, R0, R12, 12); // 32-bit because of R12.
+ temps.Include(R12);
__ StoreToOffset(kStoreWord, R2, R4, 0xa4 - 0x100000);
__ StoreToOffset(kStoreByte, R2, R4, 12);
diff --git a/compiler/utils/assembler_thumb_test_expected.cc.inc b/compiler/utils/assembler_thumb_test_expected.cc.inc
index 69e1d8f..b16d99a 100644
--- a/compiler/utils/assembler_thumb_test_expected.cc.inc
+++ b/compiler/utils/assembler_thumb_test_expected.cc.inc
@@ -5458,94 +5458,160 @@
};
const char* const VixlJniHelpersResults[] = {
- " 0: e92d 4de0 stmdb sp!, {r5, r6, r7, r8, sl, fp, lr}\n",
- " 4: ed2d 8a10 vpush {s16-s31}\n",
- " 8: b089 sub sp, #36 ; 0x24\n",
- " a: 9000 str r0, [sp, #0]\n",
- " c: 9121 str r1, [sp, #132] ; 0x84\n",
- " e: ed8d 0a22 vstr s0, [sp, #136] ; 0x88\n",
- " 12: 9223 str r2, [sp, #140] ; 0x8c\n",
- " 14: 9324 str r3, [sp, #144] ; 0x90\n",
- " 16: b088 sub sp, #32\n",
- " 18: f5ad 5d80 sub.w sp, sp, #4096 ; 0x1000\n",
- " 1c: 9808 ldr r0, [sp, #32]\n",
- " 1e: 981f ldr r0, [sp, #124] ; 0x7c\n",
- " 20: 9821 ldr r0, [sp, #132] ; 0x84\n",
- " 22: 98ff ldr r0, [sp, #1020] ; 0x3fc\n",
- " 24: f8dd 0400 ldr.w r0, [sp, #1024] ; 0x400\n",
- " 28: f8dd cffc ldr.w ip, [sp, #4092] ; 0xffc\n",
- " 2c: f50d 5c80 add.w ip, sp, #4096 ; 0x1000\n",
- " 30: f8dc c000 ldr.w ip, [ip]\n",
- " 34: f8d9 c200 ldr.w ip, [r9, #512] ; 0x200\n",
- " 38: f8dc 0080 ldr.w r0, [ip, #128] ; 0x80\n",
- " 3c: 9008 str r0, [sp, #32]\n",
- " 3e: 901f str r0, [sp, #124] ; 0x7c\n",
- " 40: 9021 str r0, [sp, #132] ; 0x84\n",
- " 42: 90ff str r0, [sp, #1020] ; 0x3fc\n",
- " 44: f8cd 0400 str.w r0, [sp, #1024] ; 0x400\n",
- " 48: f8cd cffc str.w ip, [sp, #4092] ; 0xffc\n",
- " 4c: f84d 5d04 str.w r5, [sp, #-4]!\n",
- " 50: f50d 5580 add.w r5, sp, #4096 ; 0x1000\n",
- " 54: f8c5 c004 str.w ip, [r5, #4]\n",
- " 58: f85d 5b04 ldr.w r5, [sp], #4\n",
- " 5c: f04f 0cff mov.w ip, #255 ; 0xff\n",
- " 60: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
- " 64: f06f 4c7f mvn.w ip, #4278190080 ; 0xff000000\n",
- " 68: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
- " 6c: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
- " 70: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
- " 74: 900c str r0, [sp, #48] ; 0x30\n",
- " 76: f8dd c030 ldr.w ip, [sp, #48] ; 0x30\n",
- " 7a: f8cd c034 str.w ip, [sp, #52] ; 0x34\n",
- " 7e: f50d 5c80 add.w ip, sp, #4096 ; 0x1000\n",
- " 82: f8c9 c200 str.w ip, [r9, #512] ; 0x200\n",
- " 86: f8c9 d200 str.w sp, [r9, #512] ; 0x200\n",
- " 8a: f8d0 c030 ldr.w ip, [r0, #48] ; 0x30\n",
- " 8e: 47e0 blx ip\n",
- " 90: f8dd c02c ldr.w ip, [sp, #44] ; 0x2c\n",
- " 94: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
- " 98: f8d9 c200 ldr.w ip, [r9, #512] ; 0x200\n",
- " 9c: f8cd c02c str.w ip, [sp, #44] ; 0x2c\n",
- " a0: f8dd c02c ldr.w ip, [sp, #44] ; 0x2c\n",
- " a4: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
- " a8: 4648 mov r0, r9\n",
- " aa: f8cd 9030 str.w r9, [sp, #48] ; 0x30\n",
- " ae: 4684 mov ip, r0\n",
- " b0: f1bc 0f00 cmp.w ip, #0\n",
- " b4: bf18 it ne\n",
- " b6: f10d 0c30 addne.w ip, sp, #48 ; 0x30\n",
- " ba: f10d 0c30 add.w ip, sp, #48 ; 0x30\n",
- " be: f1bc 0f00 cmp.w ip, #0\n",
- " c2: bf0c ite eq\n",
- " c4: 2000 moveq r0, #0\n",
- " c6: a80c addne r0, sp, #48 ; 0x30\n",
- " c8: f8dd c040 ldr.w ip, [sp, #64] ; 0x40\n",
- " cc: f1bc 0f00 cmp.w ip, #0\n",
- " d0: bf18 it ne\n",
- " d2: f10d 0c40 addne.w ip, sp, #64 ; 0x40\n",
- " d6: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
- " da: f1bc 0f00 cmp.w ip, #0\n",
- " de: bf0c ite eq\n",
- " e0: 2000 moveq r0, #0\n",
- " e2: 4668 movne r0, sp\n",
- " e4: f1bc 0f00 cmp.w ip, #0\n",
- " e8: bf0c ite eq\n",
- " ea: 2000 moveq r0, #0\n",
- " ec: f20d 4001 addwne r0, sp, #1025 ; 0x401\n",
- " f0: f1bc 0f00 cmp.w ip, #0\n",
- " f4: bf18 it ne\n",
- " f6: f20d 4c01 addwne ip, sp, #1025 ; 0x401\n",
- " fa: f8d9 c084 ldr.w ip, [r9, #132] ; 0x84\n",
- " fe: f1bc 0f00 cmp.w ip, #0\n",
- " 102: d107 bne.n 114 <VixlJniHelpers+0x114>\n",
- " 104: f50d 5d80 add.w sp, sp, #4096 ; 0x1000\n",
- " 108: b008 add sp, #32\n",
- " 10a: b009 add sp, #36 ; 0x24\n",
- " 10c: ecbd 8a10 vpop {s16-s31}\n",
- " 110: e8bd 8de0 ldmia.w sp!, {r5, r6, r7, r8, sl, fp, pc}\n",
- " 114: 4660 mov r0, ip\n",
- " 116: f8d9 c2b0 ldr.w ip, [r9, #688] ; 0x2b0\n",
- " 11a: 47e0 blx ip\n",
+ " 0: e92d 4de0 stmdb sp!, {r5, r6, r7, r8, sl, fp, lr}\n",
+ " 4: ed2d 8a10 vpush {s16-s31}\n",
+ " 8: b089 sub sp, #36 ; 0x24\n",
+ " a: 9000 str r0, [sp, #0]\n",
+ " c: 9121 str r1, [sp, #132] ; 0x84\n",
+ " e: ed8d 0a22 vstr s0, [sp, #136] ; 0x88\n",
+ " 12: 9223 str r2, [sp, #140] ; 0x8c\n",
+ " 14: 9324 str r3, [sp, #144] ; 0x90\n",
+ " 16: b088 sub sp, #32\n",
+ " 18: f5ad 5d80 sub.w sp, sp, #4096 ; 0x1000\n",
+ " 1c: 9808 ldr r0, [sp, #32]\n",
+ " 1e: 981f ldr r0, [sp, #124] ; 0x7c\n",
+ " 20: 9821 ldr r0, [sp, #132] ; 0x84\n",
+ " 22: 98ff ldr r0, [sp, #1020] ; 0x3fc\n",
+ " 24: f8dd 0400 ldr.w r0, [sp, #1024] ; 0x400\n",
+ " 28: f8dd cffc ldr.w ip, [sp, #4092] ; 0xffc\n",
+ " 2c: f50d 5c80 add.w ip, sp, #4096 ; 0x1000\n",
+ " 30: f8dc c000 ldr.w ip, [ip]\n",
+ " 34: f8d9 c200 ldr.w ip, [r9, #512] ; 0x200\n",
+ " 38: f8dc 0080 ldr.w r0, [ip, #128] ; 0x80\n",
+ " 3c: 9008 str r0, [sp, #32]\n",
+ " 3e: 901f str r0, [sp, #124] ; 0x7c\n",
+ " 40: 9021 str r0, [sp, #132] ; 0x84\n",
+ " 42: 90ff str r0, [sp, #1020] ; 0x3fc\n",
+ " 44: f8cd 0400 str.w r0, [sp, #1024] ; 0x400\n",
+ " 48: f8cd cffc str.w ip, [sp, #4092] ; 0xffc\n",
+ " 4c: f84d 5d04 str.w r5, [sp, #-4]!\n",
+ " 50: f50d 5580 add.w r5, sp, #4096 ; 0x1000\n",
+ " 54: f8c5 c004 str.w ip, [r5, #4]\n",
+ " 58: f85d 5b04 ldr.w r5, [sp], #4\n",
+ " 5c: f04f 0cff mov.w ip, #255 ; 0xff\n",
+ " 60: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
+ " 64: f06f 4c7f mvn.w ip, #4278190080 ; 0xff000000\n",
+ " 68: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
+ " 6c: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
+ " 70: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
+ " 74: 900c str r0, [sp, #48] ; 0x30\n",
+ " 76: f8dd c030 ldr.w ip, [sp, #48] ; 0x30\n",
+ " 7a: f8cd c034 str.w ip, [sp, #52] ; 0x34\n",
+ " 7e: f50d 5c80 add.w ip, sp, #4096 ; 0x1000\n",
+ " 82: f8c9 c200 str.w ip, [r9, #512] ; 0x200\n",
+ " 86: f8c9 d200 str.w sp, [r9, #512] ; 0x200\n",
+ " 8a: f8d0 c030 ldr.w ip, [r0, #48] ; 0x30\n",
+ " 8e: 47e0 blx ip\n",
+ " 90: f8dd c02c ldr.w ip, [sp, #44] ; 0x2c\n",
+ " 94: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
+ " 98: f8d9 c200 ldr.w ip, [r9, #512] ; 0x200\n",
+ " 9c: f8cd c02c str.w ip, [sp, #44] ; 0x2c\n",
+ " a0: f8dd c02c ldr.w ip, [sp, #44] ; 0x2c\n",
+ " a4: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
+ " a8: 4648 mov r0, r9\n",
+ " aa: f8cd 9030 str.w r9, [sp, #48] ; 0x30\n",
+ " ae: 4684 mov ip, r0\n",
+ " b0: f1bc 0f00 cmp.w ip, #0\n",
+ " b4: bf18 it ne\n",
+ " b6: f10d 0c30 addne.w ip, sp, #48 ; 0x30\n",
+ " ba: f10d 0c30 add.w ip, sp, #48 ; 0x30\n",
+ " be: f1bc 0f00 cmp.w ip, #0\n",
+ " c2: bf0c ite eq\n",
+ " c4: 2000 moveq r0, #0\n",
+ " c6: a80c addne r0, sp, #48 ; 0x30\n",
+ " c8: f8dd c040 ldr.w ip, [sp, #64] ; 0x40\n",
+ " cc: f1bc 0f00 cmp.w ip, #0\n",
+ " d0: bf18 it ne\n",
+ " d2: f10d 0c40 addne.w ip, sp, #64 ; 0x40\n",
+ " d6: f8cd c030 str.w ip, [sp, #48] ; 0x30\n",
+ " da: f1bc 0f00 cmp.w ip, #0\n",
+ " de: bf0c ite eq\n",
+ " e0: 2000 moveq r0, #0\n",
+ " e2: 4668 movne r0, sp\n",
+ " e4: f1bc 0f00 cmp.w ip, #0\n",
+ " e8: bf0c ite eq\n",
+ " ea: 2000 moveq r0, #0\n",
+ " ec: f20d 4001 addwne r0, sp, #1025 ; 0x401\n",
+ " f0: f1bc 0f00 cmp.w ip, #0\n",
+ " f4: bf18 it ne\n",
+ " f6: f20d 4c01 addwne ip, sp, #1025 ; 0x401\n",
+ " fa: f8d9 c084 ldr.w ip, [r9, #132] ; 0x84\n",
+ " fe: f1bc 0f00 cmp.w ip, #0\n",
+ " 102: d16f bne.n 1e4 <VixlJniHelpers+0x1e4>\n",
+ " 104: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 108: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 10c: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 110: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 114: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 118: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 11c: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 120: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 124: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 128: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 12c: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 130: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 134: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 138: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 13c: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 140: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 144: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 148: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 14c: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 150: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 154: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 158: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 15c: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 160: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 164: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 168: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 16c: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 170: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 174: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 178: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 17c: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 180: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 184: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 188: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 18c: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 190: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 194: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 198: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 19c: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1a0: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1a4: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1a8: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1ac: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1b0: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1b4: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1b8: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1bc: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1c0: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1c4: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1c8: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1cc: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1d0: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1d4: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1d8: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1dc: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1e0: f000 b802 b.w 1e8 <VixlJniHelpers+0x1e8>\n",
+ " 1e4: f000 b81a b.w 21c <VixlJniHelpers+0x21c>\n",
+ " 1e8: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1ec: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1f0: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1f4: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1f8: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 1fc: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 200: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 204: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 208: f8cd c7ff str.w ip, [sp, #2047] ; 0x7ff\n",
+ " 20c: f50d 5d80 add.w sp, sp, #4096 ; 0x1000\n",
+ " 210: b008 add sp, #32\n",
+ " 212: b009 add sp, #36 ; 0x24\n",
+ " 214: ecbd 8a10 vpop {s16-s31}\n",
+ " 218: e8bd 8de0 ldmia.w sp!, {r5, r6, r7, r8, sl, fp, pc}\n",
+ " 21c: 4660 mov r0, ip\n",
+ " 21e: f8d9 c2b0 ldr.w ip, [r9, #688] ; 0x2b0\n",
+ " 222: 47e0 blx ip\n",
nullptr
};
diff --git a/compiler/utils/atomic_method_ref_map-inl.h b/compiler/utils/atomic_method_ref_map-inl.h
new file mode 100644
index 0000000..d71c2fe
--- /dev/null
+++ b/compiler/utils/atomic_method_ref_map-inl.h
@@ -0,0 +1,92 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_COMPILER_UTILS_ATOMIC_METHOD_REF_MAP_INL_H_
+#define ART_COMPILER_UTILS_ATOMIC_METHOD_REF_MAP_INL_H_
+
+#include "atomic_method_ref_map.h"
+
+#include "dex_file-inl.h"
+
+namespace art {
+
+template <typename T>
+inline typename AtomicMethodRefMap<T>::InsertResult AtomicMethodRefMap<T>::Insert(
+ MethodReference ref,
+ const T& expected,
+ const T& desired) {
+ ElementArray* const array = GetArray(ref.dex_file);
+ if (array == nullptr) {
+ return kInsertResultInvalidDexFile;
+ }
+ return (*array)[ref.dex_method_index].CompareExchangeStrongSequentiallyConsistent(
+ expected, desired)
+ ? kInsertResultSuccess
+ : kInsertResultCASFailure;
+}
+
+template <typename T>
+inline bool AtomicMethodRefMap<T>::Get(MethodReference ref, T* out) const {
+ const ElementArray* const array = GetArray(ref.dex_file);
+ if (array == nullptr) {
+ return kInsertResultInvalidDexFile;
+ }
+ *out = (*array)[ref.dex_method_index].LoadRelaxed();
+ return true;
+}
+
+template <typename T>
+inline void AtomicMethodRefMap<T>::AddDexFile(const DexFile* dex_file) {
+ arrays_.Put(dex_file, std::move(ElementArray(dex_file->NumMethodIds())));
+}
+
+template <typename T>
+inline typename AtomicMethodRefMap<T>::ElementArray* AtomicMethodRefMap<T>::GetArray(
+ const DexFile* dex_file) {
+ auto it = arrays_.find(dex_file);
+ return (it != arrays_.end()) ? &it->second : nullptr;
+}
+
+template <typename T>
+inline const typename AtomicMethodRefMap<T>::ElementArray* AtomicMethodRefMap<T>::GetArray(
+ const DexFile* dex_file) const {
+ auto it = arrays_.find(dex_file);
+ return (it != arrays_.end()) ? &it->second : nullptr;
+}
+
+template <typename T> template <typename Visitor>
+inline void AtomicMethodRefMap<T>::Visit(const Visitor& visitor) {
+ for (auto& pair : arrays_) {
+ const DexFile* dex_file = pair.first;
+ const ElementArray& elements = pair.second;
+ for (size_t i = 0; i < elements.size(); ++i) {
+ visitor(MethodReference(dex_file, i), elements[i].LoadRelaxed());
+ }
+ }
+}
+
+template <typename T>
+inline void AtomicMethodRefMap<T>::ClearEntries() {
+ for (auto& it : arrays_) {
+ for (auto& element : it.second) {
+ element.StoreRelaxed(nullptr);
+ }
+ }
+}
+
+} // namespace art
+
+#endif // ART_COMPILER_UTILS_ATOMIC_METHOD_REF_MAP_INL_H_
diff --git a/compiler/utils/atomic_method_ref_map.h b/compiler/utils/atomic_method_ref_map.h
new file mode 100644
index 0000000..fed848f
--- /dev/null
+++ b/compiler/utils/atomic_method_ref_map.h
@@ -0,0 +1,73 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_COMPILER_UTILS_ATOMIC_METHOD_REF_MAP_H_
+#define ART_COMPILER_UTILS_ATOMIC_METHOD_REF_MAP_H_
+
+#include "base/dchecked_vector.h"
+#include "method_reference.h"
+#include "safe_map.h"
+
+namespace art {
+
+class DexFile;
+
+// Used by CompilerCallbacks to track verification information from the Runtime.
+template <typename T>
+class AtomicMethodRefMap {
+ public:
+ explicit AtomicMethodRefMap() {}
+ ~AtomicMethodRefMap() {}
+
+ // Atomically swap the element in if the existing value matches expected.
+ enum InsertResult {
+ kInsertResultInvalidDexFile,
+ kInsertResultCASFailure,
+ kInsertResultSuccess,
+ };
+ InsertResult Insert(MethodReference ref, const T& expected, const T& desired);
+
+ // Retreive an item, returns false if the dex file is not added.
+ bool Get(MethodReference ref, T* out) const;
+
+ // Dex files must be added before method references belonging to them can be used as keys. Not
+ // thread safe.
+ void AddDexFile(const DexFile* dex_file);
+
+ bool HaveDexFile(const DexFile* dex_file) const {
+ return arrays_.find(dex_file) != arrays_.end();
+ }
+
+ // Visit all of the dex files and elements.
+ template <typename Visitor>
+ void Visit(const Visitor& visitor);
+
+ void ClearEntries();
+
+ private:
+ // Verified methods. The method array is fixed to avoid needing a lock to extend it.
+ using ElementArray = dchecked_vector<Atomic<T>>;
+ using DexFileArrays = SafeMap<const DexFile*, ElementArray>;
+
+ const ElementArray* GetArray(const DexFile* dex_file) const;
+ ElementArray* GetArray(const DexFile* dex_file);
+
+ DexFileArrays arrays_;
+};
+
+} // namespace art
+
+#endif // ART_COMPILER_UTILS_ATOMIC_METHOD_REF_MAP_H_
diff --git a/compiler/utils/atomic_method_ref_map_test.cc b/compiler/utils/atomic_method_ref_map_test.cc
new file mode 100644
index 0000000..9e5bf4b
--- /dev/null
+++ b/compiler/utils/atomic_method_ref_map_test.cc
@@ -0,0 +1,71 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "atomic_method_ref_map-inl.h"
+
+#include <memory>
+
+#include "common_runtime_test.h"
+#include "dex_file-inl.h"
+#include "method_reference.h"
+#include "scoped_thread_state_change-inl.h"
+
+namespace art {
+
+class AtomicMethodRefMapTest : public CommonRuntimeTest {};
+
+TEST_F(AtomicMethodRefMapTest, RunTests) {
+ ScopedObjectAccess soa(Thread::Current());
+ std::unique_ptr<const DexFile> dex(OpenTestDexFile("Interfaces"));
+ ASSERT_TRUE(dex != nullptr);
+ using Map = AtomicMethodRefMap<int>;
+ Map map;
+ int value = 123;
+ // Error case: Not already inserted.
+ EXPECT_FALSE(map.Get(MethodReference(dex.get(), 1), &value));
+ EXPECT_FALSE(map.HaveDexFile(dex.get()));
+ // Error case: Dex file not registered.
+ EXPECT_TRUE(map.Insert(MethodReference(dex.get(), 1), 0, 1) == Map::kInsertResultInvalidDexFile);
+ map.AddDexFile(dex.get());
+ EXPECT_TRUE(map.HaveDexFile(dex.get()));
+ EXPECT_GT(dex->NumMethodIds(), 10u);
+ // After we have added the get should succeed but return the default value.
+ EXPECT_TRUE(map.Get(MethodReference(dex.get(), 1), &value));
+ EXPECT_EQ(value, 0);
+ // Actually insert an item and make sure we can retreive it.
+ static const int kInsertValue = 44;
+ EXPECT_TRUE(map.Insert(MethodReference(dex.get(), 1), 0, kInsertValue) ==
+ Map::kInsertResultSuccess);
+ EXPECT_TRUE(map.Get(MethodReference(dex.get(), 1), &value));
+ EXPECT_EQ(value, kInsertValue);
+ static const int kInsertValue2 = 123;
+ EXPECT_TRUE(map.Insert(MethodReference(dex.get(), 2), 0, kInsertValue2) ==
+ Map::kInsertResultSuccess);
+ EXPECT_TRUE(map.Get(MethodReference(dex.get(), 1), &value));
+ EXPECT_EQ(value, kInsertValue);
+ EXPECT_TRUE(map.Get(MethodReference(dex.get(), 2), &value));
+ EXPECT_EQ(value, kInsertValue2);
+ // Error case: Incorrect expected value for CAS.
+ EXPECT_TRUE(map.Insert(MethodReference(dex.get(), 1), 0, kInsertValue + 1) ==
+ Map::kInsertResultCASFailure);
+ // Correctly overwrite the value and verify.
+ EXPECT_TRUE(map.Insert(MethodReference(dex.get(), 1), kInsertValue, kInsertValue + 1) ==
+ Map::kInsertResultSuccess);
+ EXPECT_TRUE(map.Get(MethodReference(dex.get(), 1), &value));
+ EXPECT_EQ(value, kInsertValue + 1);
+}
+
+} // namespace art
diff --git a/compiler/utils/dedupe_set-inl.h b/compiler/utils/dedupe_set-inl.h
index ac54813..c06e9ca 100644
--- a/compiler/utils/dedupe_set-inl.h
+++ b/compiler/utils/dedupe_set-inl.h
@@ -23,10 +23,11 @@
#include <inttypes.h>
#include <unordered_map>
+#include "android-base/stringprintf.h"
+
#include "base/mutex.h"
#include "base/hash_set.h"
#include "base/stl_util.h"
-#include "base/stringprintf.h"
#include "base/time_utils.h"
namespace art {
@@ -238,13 +239,13 @@
for (HashType shard = 0; shard < kShard; ++shard) {
shards_[shard]->UpdateStats(self, &stats);
}
- return StringPrintf("%zu collisions, %zu max hash collisions, "
- "%zu/%zu probe distance, %" PRIu64 " ns hash time",
- stats.collision_sum,
- stats.collision_max,
- stats.total_probe_distance,
- stats.total_size,
- hash_time_);
+ return android::base::StringPrintf("%zu collisions, %zu max hash collisions, "
+ "%zu/%zu probe distance, %" PRIu64 " ns hash time",
+ stats.collision_sum,
+ stats.collision_max,
+ stats.total_probe_distance,
+ stats.total_size,
+ hash_time_);
}
diff --git a/compiler/utils/mips/assembler_mips.cc b/compiler/utils/mips/assembler_mips.cc
index b29974c..3dcad6a 100644
--- a/compiler/utils/mips/assembler_mips.cc
+++ b/compiler/utils/mips/assembler_mips.cc
@@ -3252,6 +3252,9 @@
CHECK_EQ(kMipsDoublewordSize, size) << dst;
LoadDFromOffset(dst.AsFRegister(), src_register, src_offset);
}
+ } else if (dst.IsDRegister()) {
+ CHECK_EQ(kMipsDoublewordSize, size) << dst;
+ LoadDFromOffset(dst.AsOverlappingDRegisterLow(), src_register, src_offset);
}
}
@@ -3396,6 +3399,9 @@
CHECK_EQ(kMipsDoublewordSize, size);
StoreDToOffset(src.AsFRegister(), SP, dest.Int32Value());
}
+ } else if (src.IsDRegister()) {
+ CHECK_EQ(kMipsDoublewordSize, size);
+ StoreDToOffset(src.AsOverlappingDRegisterLow(), SP, dest.Int32Value());
}
}
diff --git a/compiler/utils/mips64/assembler_mips64.cc b/compiler/utils/mips64/assembler_mips64.cc
index 1a21df9..84280b9 100644
--- a/compiler/utils/mips64/assembler_mips64.cc
+++ b/compiler/utils/mips64/assembler_mips64.cc
@@ -35,6 +35,7 @@
for (auto& exception_block : exception_blocks_) {
EmitExceptionPoll(&exception_block);
}
+ EmitLiterals();
PromoteBranches();
}
@@ -450,6 +451,21 @@
EmitI(0x27, rs, rt, imm16);
}
+void Mips64Assembler::Lwpc(GpuRegister rs, uint32_t imm19) {
+ CHECK(IsUint<19>(imm19)) << imm19;
+ EmitI21(0x3B, rs, (0x01 << 19) | imm19);
+}
+
+void Mips64Assembler::Lwupc(GpuRegister rs, uint32_t imm19) {
+ CHECK(IsUint<19>(imm19)) << imm19;
+ EmitI21(0x3B, rs, (0x02 << 19) | imm19);
+}
+
+void Mips64Assembler::Ldpc(GpuRegister rs, uint32_t imm18) {
+ CHECK(IsUint<18>(imm18)) << imm18;
+ EmitI21(0x3B, rs, (0x06 << 18) | imm18);
+}
+
void Mips64Assembler::Lui(GpuRegister rt, uint16_t imm16) {
EmitI(0xf, static_cast<GpuRegister>(0), rt, imm16);
}
@@ -548,6 +564,10 @@
EmitI26(0x32, imm26);
}
+void Mips64Assembler::Balc(uint32_t imm26) {
+ EmitI26(0x3A, imm26);
+}
+
void Mips64Assembler::Jic(GpuRegister rt, uint16_t imm16) {
EmitI(0x36, static_cast<GpuRegister>(0), rt, imm16);
}
@@ -1064,19 +1084,37 @@
type_ = (offset_size <= branch_info_[short_type].offset_size) ? short_type : long_type;
}
-void Mips64Assembler::Branch::InitializeType(bool is_call) {
+void Mips64Assembler::Branch::InitializeType(Type initial_type) {
OffsetBits offset_size = GetOffsetSizeNeeded(location_, target_);
- if (is_call) {
- InitShortOrLong(offset_size, kCall, kLongCall);
- } else if (condition_ == kUncond) {
- InitShortOrLong(offset_size, kUncondBranch, kLongUncondBranch);
- } else {
- if (condition_ == kCondEQZ || condition_ == kCondNEZ) {
- // Special case for beqzc/bnezc with longer offset than in other b<cond>c instructions.
- type_ = (offset_size <= kOffset23) ? kCondBranch : kLongCondBranch;
- } else {
- InitShortOrLong(offset_size, kCondBranch, kLongCondBranch);
- }
+ switch (initial_type) {
+ case kLabel:
+ case kLiteral:
+ case kLiteralUnsigned:
+ case kLiteralLong:
+ CHECK(!IsResolved());
+ type_ = initial_type;
+ break;
+ case kCall:
+ InitShortOrLong(offset_size, kCall, kLongCall);
+ break;
+ case kCondBranch:
+ switch (condition_) {
+ case kUncond:
+ InitShortOrLong(offset_size, kUncondBranch, kLongUncondBranch);
+ break;
+ case kCondEQZ:
+ case kCondNEZ:
+ // Special case for beqzc/bnezc with longer offset than in other b<cond>c instructions.
+ type_ = (offset_size <= kOffset23) ? kCondBranch : kLongCondBranch;
+ break;
+ default:
+ InitShortOrLong(offset_size, kCondBranch, kLongCondBranch);
+ break;
+ }
+ break;
+ default:
+ LOG(FATAL) << "Unexpected branch type " << initial_type;
+ UNREACHABLE();
}
old_type_ = type_;
}
@@ -1109,14 +1147,14 @@
}
}
-Mips64Assembler::Branch::Branch(uint32_t location, uint32_t target)
+Mips64Assembler::Branch::Branch(uint32_t location, uint32_t target, bool is_call)
: old_location_(location),
location_(location),
target_(target),
lhs_reg_(ZERO),
rhs_reg_(ZERO),
condition_(kUncond) {
- InitializeType(false);
+ InitializeType(is_call ? kCall : kCondBranch);
}
Mips64Assembler::Branch::Branch(uint32_t location,
@@ -1164,19 +1202,18 @@
// Branch condition is always true, make the branch unconditional.
condition_ = kUncond;
}
- InitializeType(false);
+ InitializeType(kCondBranch);
}
-Mips64Assembler::Branch::Branch(uint32_t location, uint32_t target, GpuRegister indirect_reg)
+Mips64Assembler::Branch::Branch(uint32_t location, GpuRegister dest_reg, Type label_or_literal_type)
: old_location_(location),
location_(location),
- target_(target),
- lhs_reg_(indirect_reg),
+ target_(kUnresolved),
+ lhs_reg_(dest_reg),
rhs_reg_(ZERO),
condition_(kUncond) {
- CHECK_NE(indirect_reg, ZERO);
- CHECK_NE(indirect_reg, AT);
- InitializeType(true);
+ CHECK_NE(dest_reg, ZERO);
+ InitializeType(label_or_literal_type);
}
Mips64Assembler::BranchCondition Mips64Assembler::Branch::OppositeCondition(
@@ -1278,11 +1315,23 @@
case kUncondBranch:
case kCondBranch:
case kCall:
+ // Near label.
+ case kLabel:
+ // Near literals.
+ case kLiteral:
+ case kLiteralUnsigned:
+ case kLiteralLong:
return false;
// Long branches.
case kLongUncondBranch:
case kLongCondBranch:
case kLongCall:
+ // Far label.
+ case kFarLabel:
+ // Far literals.
+ case kFarLiteral:
+ case kFarLiteralUnsigned:
+ case kFarLiteralLong:
return true;
}
UNREACHABLE();
@@ -1351,6 +1400,20 @@
case kCall:
type_ = kLongCall;
break;
+ // Near label.
+ case kLabel:
+ type_ = kFarLabel;
+ break;
+ // Near literals.
+ case kLiteral:
+ type_ = kFarLiteral;
+ break;
+ case kLiteralUnsigned:
+ type_ = kFarLiteralUnsigned;
+ break;
+ case kLiteralLong:
+ type_ = kFarLiteralLong;
+ break;
default:
// Note: 'type_' is already long.
break;
@@ -1397,7 +1460,15 @@
uint32_t ofs_mask = 0xFFFFFFFF >> (32 - GetOffsetSize());
// Calculate the byte distance between instructions and also account for
// different PC-relative origins.
- uint32_t offset = target_ - GetOffsetLocation() - branch_info_[type_].pc_org * sizeof(uint32_t);
+ uint32_t offset_location = GetOffsetLocation();
+ if (type_ == kLiteralLong) {
+ // Special case for the ldpc instruction, whose address (PC) is rounded down to
+ // a multiple of 8 before adding the offset.
+ // Note, branch promotion has already taken care of aligning `target_` to an
+ // address that's a multiple of 8.
+ offset_location = RoundDown(offset_location, sizeof(uint64_t));
+ }
+ uint32_t offset = target_ - offset_location - branch_info_[type_].pc_org * sizeof(uint32_t);
// Prepare the offset for encoding into the instruction(s).
offset = (offset & ofs_mask) >> branch_info_[type_].offset_shift;
return offset;
@@ -1444,7 +1515,7 @@
label->BindTo(bound_pc);
}
-uint32_t Mips64Assembler::GetLabelLocation(Mips64Label* label) const {
+uint32_t Mips64Assembler::GetLabelLocation(const Mips64Label* label) const {
CHECK(label->IsBound());
uint32_t target = label->Position();
if (label->prev_branch_id_plus_one_) {
@@ -1500,7 +1571,7 @@
void Mips64Assembler::Buncond(Mips64Label* label) {
uint32_t target = label->IsBound() ? GetLabelLocation(label) : Branch::kUnresolved;
- branches_.emplace_back(buffer_.Size(), target);
+ branches_.emplace_back(buffer_.Size(), target, /* is_call */ false);
FinalizeLabeledBranch(label);
}
@@ -1517,12 +1588,87 @@
FinalizeLabeledBranch(label);
}
-void Mips64Assembler::Call(Mips64Label* label, GpuRegister indirect_reg) {
+void Mips64Assembler::Call(Mips64Label* label) {
uint32_t target = label->IsBound() ? GetLabelLocation(label) : Branch::kUnresolved;
- branches_.emplace_back(buffer_.Size(), target, indirect_reg);
+ branches_.emplace_back(buffer_.Size(), target, /* is_call */ true);
FinalizeLabeledBranch(label);
}
+void Mips64Assembler::LoadLabelAddress(GpuRegister dest_reg, Mips64Label* label) {
+ // Label address loads are treated as pseudo branches since they require very similar handling.
+ DCHECK(!label->IsBound());
+ branches_.emplace_back(buffer_.Size(), dest_reg, Branch::kLabel);
+ FinalizeLabeledBranch(label);
+}
+
+Literal* Mips64Assembler::NewLiteral(size_t size, const uint8_t* data) {
+ // We don't support byte and half-word literals.
+ if (size == 4u) {
+ literals_.emplace_back(size, data);
+ return &literals_.back();
+ } else {
+ DCHECK_EQ(size, 8u);
+ long_literals_.emplace_back(size, data);
+ return &long_literals_.back();
+ }
+}
+
+void Mips64Assembler::LoadLiteral(GpuRegister dest_reg,
+ LoadOperandType load_type,
+ Literal* literal) {
+ // Literal loads are treated as pseudo branches since they require very similar handling.
+ Branch::Type literal_type;
+ switch (load_type) {
+ case kLoadWord:
+ DCHECK_EQ(literal->GetSize(), 4u);
+ literal_type = Branch::kLiteral;
+ break;
+ case kLoadUnsignedWord:
+ DCHECK_EQ(literal->GetSize(), 4u);
+ literal_type = Branch::kLiteralUnsigned;
+ break;
+ case kLoadDoubleword:
+ DCHECK_EQ(literal->GetSize(), 8u);
+ literal_type = Branch::kLiteralLong;
+ break;
+ default:
+ LOG(FATAL) << "Unexpected literal load type " << load_type;
+ UNREACHABLE();
+ }
+ Mips64Label* label = literal->GetLabel();
+ DCHECK(!label->IsBound());
+ branches_.emplace_back(buffer_.Size(), dest_reg, literal_type);
+ FinalizeLabeledBranch(label);
+}
+
+void Mips64Assembler::EmitLiterals() {
+ if (!literals_.empty()) {
+ for (Literal& literal : literals_) {
+ Mips64Label* label = literal.GetLabel();
+ Bind(label);
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ DCHECK_EQ(literal.GetSize(), 4u);
+ for (size_t i = 0, size = literal.GetSize(); i != size; ++i) {
+ buffer_.Emit<uint8_t>(literal.GetData()[i]);
+ }
+ }
+ }
+ if (!long_literals_.empty()) {
+ // Reserve 4 bytes for potential alignment. If after the branch promotion the 64-bit
+ // literals don't end up 8-byte-aligned, they will be moved down 4 bytes.
+ Emit(0); // NOP.
+ for (Literal& literal : long_literals_) {
+ Mips64Label* label = literal.GetLabel();
+ Bind(label);
+ AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+ DCHECK_EQ(literal.GetSize(), 8u);
+ for (size_t i = 0, size = literal.GetSize(); i != size; ++i) {
+ buffer_.Emit<uint8_t>(literal.GetData()[i]);
+ }
+ }
+ }
+}
+
void Mips64Assembler::PromoteBranches() {
// Promote short branches to long as necessary.
bool changed;
@@ -1561,6 +1707,35 @@
end = branch.GetOldLocation();
}
}
+
+ // Align 64-bit literals by moving them down by 4 bytes if needed.
+ // This will reduce the PC-relative distance, which should be safe for both near and far literals.
+ if (!long_literals_.empty()) {
+ uint32_t first_literal_location = GetLabelLocation(long_literals_.front().GetLabel());
+ size_t lit_size = long_literals_.size() * sizeof(uint64_t);
+ size_t buf_size = buffer_.Size();
+ // 64-bit literals must be at the very end of the buffer.
+ CHECK_EQ(first_literal_location + lit_size, buf_size);
+ if (!IsAligned<sizeof(uint64_t)>(first_literal_location)) {
+ buffer_.Move(first_literal_location - sizeof(uint32_t), first_literal_location, lit_size);
+ // The 4 reserved bytes proved useless, reduce the buffer size.
+ buffer_.Resize(buf_size - sizeof(uint32_t));
+ // Reduce target addresses in literal and address loads by 4 bytes in order for correct
+ // offsets from PC to be generated.
+ for (auto& branch : branches_) {
+ uint32_t target = branch.GetTarget();
+ if (target >= first_literal_location) {
+ branch.Resolve(target - sizeof(uint32_t));
+ }
+ }
+ // If after this we ever call GetLabelLocation() to get the location of a 64-bit literal,
+ // we need to adjust the location of the literal's label as well.
+ for (Literal& literal : long_literals_) {
+ // Bound label's position is negative, hence incrementing it instead of decrementing.
+ literal.GetLabel()->position_ += sizeof(uint32_t);
+ }
+ }
+ }
}
// Note: make sure branch_info_[] and EmitBranch() are kept synchronized.
@@ -1569,11 +1744,23 @@
{ 1, 0, 1, Mips64Assembler::Branch::kOffset28, 2 }, // kUncondBranch
{ 2, 0, 1, Mips64Assembler::Branch::kOffset18, 2 }, // kCondBranch
// Exception: kOffset23 for beqzc/bnezc
- { 2, 0, 0, Mips64Assembler::Branch::kOffset21, 2 }, // kCall
+ { 1, 0, 1, Mips64Assembler::Branch::kOffset28, 2 }, // kCall
+ // Near label.
+ { 1, 0, 0, Mips64Assembler::Branch::kOffset21, 2 }, // kLabel
+ // Near literals.
+ { 1, 0, 0, Mips64Assembler::Branch::kOffset21, 2 }, // kLiteral
+ { 1, 0, 0, Mips64Assembler::Branch::kOffset21, 2 }, // kLiteralUnsigned
+ { 1, 0, 0, Mips64Assembler::Branch::kOffset21, 3 }, // kLiteralLong
// Long branches.
{ 2, 0, 0, Mips64Assembler::Branch::kOffset32, 0 }, // kLongUncondBranch
{ 3, 1, 0, Mips64Assembler::Branch::kOffset32, 0 }, // kLongCondBranch
- { 3, 0, 0, Mips64Assembler::Branch::kOffset32, 0 }, // kLongCall
+ { 2, 0, 0, Mips64Assembler::Branch::kOffset32, 0 }, // kLongCall
+ // Far label.
+ { 2, 0, 0, Mips64Assembler::Branch::kOffset32, 0 }, // kFarLabel
+ // Far literals.
+ { 2, 0, 0, Mips64Assembler::Branch::kOffset32, 0 }, // kFarLiteral
+ { 2, 0, 0, Mips64Assembler::Branch::kOffset32, 0 }, // kFarLiteralUnsigned
+ { 2, 0, 0, Mips64Assembler::Branch::kOffset32, 0 }, // kFarLiteralLong
};
// Note: make sure branch_info_[] and EmitBranch() are kept synchronized.
@@ -1597,8 +1784,26 @@
break;
case Branch::kCall:
CHECK_EQ(overwrite_location_, branch->GetOffsetLocation());
+ Balc(offset);
+ break;
+
+ // Near label.
+ case Branch::kLabel:
+ CHECK_EQ(overwrite_location_, branch->GetOffsetLocation());
Addiupc(lhs, offset);
- Jialc(lhs, 0);
+ break;
+ // Near literals.
+ case Branch::kLiteral:
+ CHECK_EQ(overwrite_location_, branch->GetOffsetLocation());
+ Lwpc(lhs, offset);
+ break;
+ case Branch::kLiteralUnsigned:
+ CHECK_EQ(overwrite_location_, branch->GetOffsetLocation());
+ Lwupc(lhs, offset);
+ break;
+ case Branch::kLiteralLong:
+ CHECK_EQ(overwrite_location_, branch->GetOffsetLocation());
+ Ldpc(lhs, offset);
break;
// Long branches.
@@ -1616,11 +1821,37 @@
Jic(AT, Low16Bits(offset));
break;
case Branch::kLongCall:
- offset += (offset & 0x8000) << 1; // Account for sign extension in daddiu.
+ offset += (offset & 0x8000) << 1; // Account for sign extension in jialc.
CHECK_EQ(overwrite_location_, branch->GetOffsetLocation());
- Auipc(lhs, High16Bits(offset));
- Daddiu(lhs, lhs, Low16Bits(offset));
- Jialc(lhs, 0);
+ Auipc(AT, High16Bits(offset));
+ Jialc(AT, Low16Bits(offset));
+ break;
+
+ // Far label.
+ case Branch::kFarLabel:
+ offset += (offset & 0x8000) << 1; // Account for sign extension in addiu.
+ CHECK_EQ(overwrite_location_, branch->GetOffsetLocation());
+ Auipc(AT, High16Bits(offset));
+ Addiu(lhs, AT, Low16Bits(offset));
+ break;
+ // Far literals.
+ case Branch::kFarLiteral:
+ offset += (offset & 0x8000) << 1; // Account for sign extension in lw.
+ CHECK_EQ(overwrite_location_, branch->GetOffsetLocation());
+ Auipc(AT, High16Bits(offset));
+ Lw(lhs, AT, Low16Bits(offset));
+ break;
+ case Branch::kFarLiteralUnsigned:
+ offset += (offset & 0x8000) << 1; // Account for sign extension in lwu.
+ CHECK_EQ(overwrite_location_, branch->GetOffsetLocation());
+ Auipc(AT, High16Bits(offset));
+ Lwu(lhs, AT, Low16Bits(offset));
+ break;
+ case Branch::kFarLiteralLong:
+ offset += (offset & 0x8000) << 1; // Account for sign extension in ld.
+ CHECK_EQ(overwrite_location_, branch->GetOffsetLocation());
+ Auipc(AT, High16Bits(offset));
+ Ld(lhs, AT, Low16Bits(offset));
break;
}
CHECK_EQ(overwrite_location_, branch->GetEndLocation());
@@ -1631,8 +1862,8 @@
Buncond(label);
}
-void Mips64Assembler::Jialc(Mips64Label* label, GpuRegister indirect_reg) {
- Call(label, indirect_reg);
+void Mips64Assembler::Balc(Mips64Label* label) {
+ Call(label);
}
void Mips64Assembler::Bltc(GpuRegister rs, GpuRegister rt, Mips64Label* label) {
diff --git a/compiler/utils/mips64/assembler_mips64.h b/compiler/utils/mips64/assembler_mips64.h
index 238cb9d..08a55ed 100644
--- a/compiler/utils/mips64/assembler_mips64.h
+++ b/compiler/utils/mips64/assembler_mips64.h
@@ -17,9 +17,11 @@
#ifndef ART_COMPILER_UTILS_MIPS64_ASSEMBLER_MIPS64_H_
#define ART_COMPILER_UTILS_MIPS64_ASSEMBLER_MIPS64_H_
+#include <deque>
#include <utility>
#include <vector>
+#include "base/arena_containers.h"
#include "base/enums.h"
#include "base/macros.h"
#include "constants_mips64.h"
@@ -312,6 +314,49 @@
DISALLOW_COPY_AND_ASSIGN(Mips64Label);
};
+// Assembler literal is a value embedded in code, retrieved using a PC-relative load.
+class Literal {
+ public:
+ static constexpr size_t kMaxSize = 8;
+
+ Literal(uint32_t size, const uint8_t* data)
+ : label_(), size_(size) {
+ DCHECK_LE(size, Literal::kMaxSize);
+ memcpy(data_, data, size);
+ }
+
+ template <typename T>
+ T GetValue() const {
+ DCHECK_EQ(size_, sizeof(T));
+ T value;
+ memcpy(&value, data_, sizeof(T));
+ return value;
+ }
+
+ uint32_t GetSize() const {
+ return size_;
+ }
+
+ const uint8_t* GetData() const {
+ return data_;
+ }
+
+ Mips64Label* GetLabel() {
+ return &label_;
+ }
+
+ const Mips64Label* GetLabel() const {
+ return &label_;
+ }
+
+ private:
+ Mips64Label label_;
+ const uint32_t size_;
+ uint8_t data_[kMaxSize];
+
+ DISALLOW_COPY_AND_ASSIGN(Literal);
+};
+
// Slowpath entered when Thread::Current()->_exception is non-null.
class Mips64ExceptionSlowPath {
public:
@@ -341,6 +386,8 @@
: Assembler(arena),
overwriting_(false),
overwrite_location_(0),
+ literals_(arena->Adapter(kArenaAllocAssembler)),
+ long_literals_(arena->Adapter(kArenaAllocAssembler)),
last_position_adjustment_(0),
last_old_position_(0),
last_branch_id_(0) {
@@ -386,18 +433,18 @@
void Nor(GpuRegister rd, GpuRegister rs, GpuRegister rt);
void Bitswap(GpuRegister rd, GpuRegister rt);
- void Dbitswap(GpuRegister rd, GpuRegister rt);
+ void Dbitswap(GpuRegister rd, GpuRegister rt); // MIPS64
void Seb(GpuRegister rd, GpuRegister rt);
void Seh(GpuRegister rd, GpuRegister rt);
- void Dsbh(GpuRegister rd, GpuRegister rt);
- void Dshd(GpuRegister rd, GpuRegister rt);
+ void Dsbh(GpuRegister rd, GpuRegister rt); // MIPS64
+ void Dshd(GpuRegister rd, GpuRegister rt); // MIPS64
void Dext(GpuRegister rs, GpuRegister rt, int pos, int size); // MIPS64
void Dinsu(GpuRegister rt, GpuRegister rs, int pos, int size); // MIPS64
void Wsbh(GpuRegister rd, GpuRegister rt);
void Sc(GpuRegister rt, GpuRegister base, int16_t imm9 = 0);
- void Scd(GpuRegister rt, GpuRegister base, int16_t imm9 = 0);
+ void Scd(GpuRegister rt, GpuRegister base, int16_t imm9 = 0); // MIPS64
void Ll(GpuRegister rt, GpuRegister base, int16_t imm9 = 0);
- void Lld(GpuRegister rt, GpuRegister base, int16_t imm9 = 0);
+ void Lld(GpuRegister rt, GpuRegister base, int16_t imm9 = 0); // MIPS64
void Sll(GpuRegister rd, GpuRegister rt, int shamt);
void Srl(GpuRegister rd, GpuRegister rt, int shamt);
@@ -409,7 +456,7 @@
void Srav(GpuRegister rd, GpuRegister rt, GpuRegister rs);
void Dsll(GpuRegister rd, GpuRegister rt, int shamt); // MIPS64
void Dsrl(GpuRegister rd, GpuRegister rt, int shamt); // MIPS64
- void Drotr(GpuRegister rd, GpuRegister rt, int shamt);
+ void Drotr(GpuRegister rd, GpuRegister rt, int shamt); // MIPS64
void Dsra(GpuRegister rd, GpuRegister rt, int shamt); // MIPS64
void Dsll32(GpuRegister rd, GpuRegister rt, int shamt); // MIPS64
void Dsrl32(GpuRegister rd, GpuRegister rt, int shamt); // MIPS64
@@ -427,6 +474,9 @@
void Lbu(GpuRegister rt, GpuRegister rs, uint16_t imm16);
void Lhu(GpuRegister rt, GpuRegister rs, uint16_t imm16);
void Lwu(GpuRegister rt, GpuRegister rs, uint16_t imm16); // MIPS64
+ void Lwpc(GpuRegister rs, uint32_t imm19);
+ void Lwupc(GpuRegister rs, uint32_t imm19); // MIPS64
+ void Ldpc(GpuRegister rs, uint32_t imm18); // MIPS64
void Lui(GpuRegister rt, uint16_t imm16);
void Dahi(GpuRegister rs, uint16_t imm16); // MIPS64
void Dati(GpuRegister rs, uint16_t imm16); // MIPS64
@@ -445,8 +495,8 @@
void Selnez(GpuRegister rd, GpuRegister rs, GpuRegister rt);
void Clz(GpuRegister rd, GpuRegister rs);
void Clo(GpuRegister rd, GpuRegister rs);
- void Dclz(GpuRegister rd, GpuRegister rs);
- void Dclo(GpuRegister rd, GpuRegister rs);
+ void Dclz(GpuRegister rd, GpuRegister rs); // MIPS64
+ void Dclo(GpuRegister rd, GpuRegister rs); // MIPS64
void Jalr(GpuRegister rd, GpuRegister rs);
void Jalr(GpuRegister rs);
@@ -454,6 +504,7 @@
void Auipc(GpuRegister rs, uint16_t imm16);
void Addiupc(GpuRegister rs, uint32_t imm19);
void Bc(uint32_t imm26);
+ void Balc(uint32_t imm26);
void Jic(GpuRegister rt, uint16_t imm16);
void Jialc(GpuRegister rt, uint16_t imm16);
void Bltc(GpuRegister rs, GpuRegister rt, uint16_t imm16);
@@ -605,8 +656,26 @@
UNREACHABLE();
}
+ // Create a new literal with a given value.
+ // NOTE: Force the template parameter to be explicitly specified.
+ template <typename T>
+ Literal* NewLiteral(typename Identity<T>::type value) {
+ static_assert(std::is_integral<T>::value, "T must be an integral type.");
+ return NewLiteral(sizeof(value), reinterpret_cast<const uint8_t*>(&value));
+ }
+
+ // Load label address using PC-relative loads. To be used with data labels in the literal /
+ // jump table area only and not with regular code labels.
+ void LoadLabelAddress(GpuRegister dest_reg, Mips64Label* label);
+
+ // Create a new literal with the given data.
+ Literal* NewLiteral(size_t size, const uint8_t* data);
+
+ // Load literal using PC-relative loads.
+ void LoadLiteral(GpuRegister dest_reg, LoadOperandType load_type, Literal* literal);
+
void Bc(Mips64Label* label);
- void Jialc(Mips64Label* label, GpuRegister indirect_reg);
+ void Balc(Mips64Label* label);
void Bltc(GpuRegister rs, GpuRegister rt, Mips64Label* label);
void Bltzc(GpuRegister rt, Mips64Label* label);
void Bgtzc(GpuRegister rt, Mips64Label* label);
@@ -756,12 +825,15 @@
// Returns the (always-)current location of a label (can be used in class CodeGeneratorMIPS64,
// must be used instead of Mips64Label::GetPosition()).
- uint32_t GetLabelLocation(Mips64Label* label) const;
+ uint32_t GetLabelLocation(const Mips64Label* label) const;
// Get the final position of a label after local fixup based on the old position
// recorded before FinalizeCode().
uint32_t GetAdjustedPosition(uint32_t old_position);
+ // Note that PC-relative literal loads are handled as pseudo branches because they need very
+ // similar relocation and may similarly expand in size to accomodate for larger offsets relative
+ // to PC.
enum BranchCondition {
kCondLT,
kCondGE,
@@ -791,10 +863,22 @@
kUncondBranch,
kCondBranch,
kCall,
+ // Near label.
+ kLabel,
+ // Near literals.
+ kLiteral,
+ kLiteralUnsigned,
+ kLiteralLong,
// Long branches.
kLongUncondBranch,
kLongCondBranch,
kLongCall,
+ // Far label.
+ kFarLabel,
+ // Far literals.
+ kFarLiteral,
+ kFarLiteralUnsigned,
+ kFarLiteralLong,
};
// Bit sizes of offsets defined as enums to minimize chance of typos.
@@ -830,16 +914,16 @@
};
static const BranchInfo branch_info_[/* Type */];
- // Unconditional branch.
- Branch(uint32_t location, uint32_t target);
+ // Unconditional branch or call.
+ Branch(uint32_t location, uint32_t target, bool is_call);
// Conditional branch.
Branch(uint32_t location,
uint32_t target,
BranchCondition condition,
GpuRegister lhs_reg,
- GpuRegister rhs_reg = ZERO);
- // Call (branch and link) that stores the target address in a given register (i.e. T9).
- Branch(uint32_t location, uint32_t target, GpuRegister indirect_reg);
+ GpuRegister rhs_reg);
+ // Label address (in literal area) or literal.
+ Branch(uint32_t location, GpuRegister dest_reg, Type label_or_literal_type);
// Some conditional branches with lhs = rhs are effectively NOPs, while some
// others are effectively unconditional. MIPSR6 conditional branches require lhs != rhs.
@@ -923,7 +1007,7 @@
private:
// Completes branch construction by determining and recording its type.
- void InitializeType(bool is_call);
+ void InitializeType(Type initial_type);
// Helper for the above.
void InitShortOrLong(OffsetBits ofs_size, Type short_type, Type long_type);
@@ -932,7 +1016,7 @@
uint32_t target_; // Offset into assembler buffer in bytes.
GpuRegister lhs_reg_; // Left-hand side register in conditional branches or
- // indirect call register.
+ // destination register in literals.
GpuRegister rhs_reg_; // Right-hand side register in conditional branches.
BranchCondition condition_; // Condition for conditional branches.
@@ -957,12 +1041,13 @@
BranchCondition condition,
GpuRegister lhs,
GpuRegister rhs = ZERO);
- void Call(Mips64Label* label, GpuRegister indirect_reg);
+ void Call(Mips64Label* label);
void FinalizeLabeledBranch(Mips64Label* label);
Branch* GetBranch(uint32_t branch_id);
const Branch* GetBranch(uint32_t branch_id) const;
+ void EmitLiterals();
void PromoteBranches();
void EmitBranch(Branch* branch);
void EmitBranches();
@@ -981,6 +1066,11 @@
// The current overwrite location.
uint32_t overwrite_location_;
+ // Use std::deque<> for literal labels to allow insertions at the end
+ // without invalidating pointers and references to existing elements.
+ ArenaDeque<Literal> literals_;
+ ArenaDeque<Literal> long_literals_; // 64-bit literals separated for alignment reasons.
+
// Data for AdjustedPosition(), see the description there.
uint32_t last_position_adjustment_;
uint32_t last_old_position_;
diff --git a/compiler/utils/mips64/assembler_mips64_test.cc b/compiler/utils/mips64/assembler_mips64_test.cc
index ba8f25e..f62822d 100644
--- a/compiler/utils/mips64/assembler_mips64_test.cc
+++ b/compiler/utils/mips64/assembler_mips64_test.cc
@@ -576,83 +576,83 @@
RepeatRRNoDupes(&mips64::Mips64Assembler::Jalr, "jalr ${reg1}, ${reg2}"), "jalr");
}
-TEST_F(AssemblerMIPS64Test, Jialc) {
+TEST_F(AssemblerMIPS64Test, Balc) {
mips64::Mips64Label label1, label2;
- __ Jialc(&label1, mips64::T9);
+ __ Balc(&label1);
constexpr size_t kAdduCount1 = 63;
for (size_t i = 0; i != kAdduCount1; ++i) {
__ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
}
__ Bind(&label1);
- __ Jialc(&label2, mips64::T9);
+ __ Balc(&label2);
constexpr size_t kAdduCount2 = 64;
for (size_t i = 0; i != kAdduCount2; ++i) {
__ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
}
__ Bind(&label2);
- __ Jialc(&label1, mips64::T9);
+ __ Balc(&label1);
std::string expected =
".set noreorder\n"
- "lapc $t9, 1f\n"
- "jialc $t9, 0\n" +
+ "balc 1f\n" +
RepeatInsn(kAdduCount1, "addu $zero, $zero, $zero\n") +
"1:\n"
- "lapc $t9, 2f\n"
- "jialc $t9, 0\n" +
+ "balc 2f\n" +
RepeatInsn(kAdduCount2, "addu $zero, $zero, $zero\n") +
"2:\n"
- "lapc $t9, 1b\n"
- "jialc $t9, 0\n";
- DriverStr(expected, "Jialc");
+ "balc 1b\n";
+ DriverStr(expected, "Balc");
}
-TEST_F(AssemblerMIPS64Test, LongJialc) {
+TEST_F(AssemblerMIPS64Test, LongBalc) {
+ constexpr uint32_t kNopCount1 = (1u << 25) + 1;
+ constexpr uint32_t kNopCount2 = (1u << 25) + 1;
+ constexpr uint32_t kRequiredCapacity = (kNopCount1 + kNopCount2 + 6u) * 4u;
+ ASSERT_LT(__ GetBuffer()->Capacity(), kRequiredCapacity);
+ __ GetBuffer()->ExtendCapacity(kRequiredCapacity);
mips64::Mips64Label label1, label2;
- __ Jialc(&label1, mips64::T9);
- constexpr uint32_t kAdduCount1 = (1u << 18) + 1;
- for (uint32_t i = 0; i != kAdduCount1; ++i) {
- __ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
+ __ Balc(&label1);
+ for (uint32_t i = 0; i != kNopCount1; ++i) {
+ __ Nop();
}
__ Bind(&label1);
- __ Jialc(&label2, mips64::T9);
- constexpr uint32_t kAdduCount2 = (1u << 18) + 1;
- for (uint32_t i = 0; i != kAdduCount2; ++i) {
- __ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
+ __ Balc(&label2);
+ for (uint32_t i = 0; i != kNopCount2; ++i) {
+ __ Nop();
}
__ Bind(&label2);
- __ Jialc(&label1, mips64::T9);
+ __ Balc(&label1);
- uint32_t offset_forward1 = 3 + kAdduCount1; // 3: account for auipc, daddiu and jic.
+ uint32_t offset_forward1 = 2 + kNopCount1; // 2: account for auipc and jialc.
offset_forward1 <<= 2;
- offset_forward1 += (offset_forward1 & 0x8000) << 1; // Account for sign extension in daddiu.
+ offset_forward1 += (offset_forward1 & 0x8000) << 1; // Account for sign extension in jialc.
- uint32_t offset_forward2 = 3 + kAdduCount2; // 3: account for auipc, daddiu and jic.
+ uint32_t offset_forward2 = 2 + kNopCount2; // 2: account for auipc and jialc.
offset_forward2 <<= 2;
- offset_forward2 += (offset_forward2 & 0x8000) << 1; // Account for sign extension in daddiu.
+ offset_forward2 += (offset_forward2 & 0x8000) << 1; // Account for sign extension in jialc.
- uint32_t offset_back = -(3 + kAdduCount2); // 3: account for auipc, daddiu and jic.
+ uint32_t offset_back = -(2 + kNopCount2); // 2: account for auipc and jialc.
offset_back <<= 2;
- offset_back += (offset_back & 0x8000) << 1; // Account for sign extension in daddiu.
+ offset_back += (offset_back & 0x8000) << 1; // Account for sign extension in jialc.
+ // Note, we're using the ".fill" directive to tell the assembler to generate many NOPs
+ // instead of generating them ourselves in the source code. This saves a few minutes
+ // of test time.
std::ostringstream oss;
oss <<
".set noreorder\n"
- "auipc $t9, 0x" << std::hex << High16Bits(offset_forward1) << "\n"
- "daddiu $t9, 0x" << std::hex << Low16Bits(offset_forward1) << "\n"
- "jialc $t9, 0\n" <<
- RepeatInsn(kAdduCount1, "addu $zero, $zero, $zero\n") <<
+ "auipc $at, 0x" << std::hex << High16Bits(offset_forward1) << "\n"
+ "jialc $at, 0x" << std::hex << Low16Bits(offset_forward1) << "\n"
+ ".fill 0x" << std::hex << kNopCount1 << " , 4, 0\n"
"1:\n"
- "auipc $t9, 0x" << std::hex << High16Bits(offset_forward2) << "\n"
- "daddiu $t9, 0x" << std::hex << Low16Bits(offset_forward2) << "\n"
- "jialc $t9, 0\n" <<
- RepeatInsn(kAdduCount2, "addu $zero, $zero, $zero\n") <<
+ "auipc $at, 0x" << std::hex << High16Bits(offset_forward2) << "\n"
+ "jialc $at, 0x" << std::hex << Low16Bits(offset_forward2) << "\n"
+ ".fill 0x" << std::hex << kNopCount2 << " , 4, 0\n"
"2:\n"
- "auipc $t9, 0x" << std::hex << High16Bits(offset_back) << "\n"
- "daddiu $t9, 0x" << std::hex << Low16Bits(offset_back) << "\n"
- "jialc $t9, 0\n";
+ "auipc $at, 0x" << std::hex << High16Bits(offset_back) << "\n"
+ "jialc $at, 0x" << std::hex << Low16Bits(offset_back) << "\n";
std::string expected = oss.str();
- DriverStr(expected, "LongJialc");
+ DriverStr(expected, "LongBalc");
}
TEST_F(AssemblerMIPS64Test, Bc) {
@@ -827,6 +827,258 @@
// MISC //
//////////
+TEST_F(AssemblerMIPS64Test, Lwpc) {
+ // Lwpc() takes an unsigned 19-bit immediate, while the GNU assembler needs a signed offset,
+ // hence the sign extension from bit 18 with `imm - ((imm & 0x40000) << 1)`.
+ // The GNU assembler also wants the offset to be a multiple of 4, which it will shift right
+ // by 2 positions when encoding, hence `<< 2` to compensate for that shift.
+ // We capture the value of the immediate with `.set imm, {imm}` because the value is needed
+ // twice for the sign extension, but `{imm}` is substituted only once.
+ const char* code = ".set imm, {imm}\nlw ${reg}, ((imm - ((imm & 0x40000) << 1)) << 2)($pc)";
+ DriverStr(RepeatRIb(&mips64::Mips64Assembler::Lwpc, 19, code), "Lwpc");
+}
+
+TEST_F(AssemblerMIPS64Test, Lwupc) {
+ // The comment for the Lwpc test applies here as well.
+ const char* code = ".set imm, {imm}\nlwu ${reg}, ((imm - ((imm & 0x40000) << 1)) << 2)($pc)";
+ DriverStr(RepeatRIb(&mips64::Mips64Assembler::Lwupc, 19, code), "Lwupc");
+}
+
+TEST_F(AssemblerMIPS64Test, Ldpc) {
+ // The comment for the Lwpc test applies here as well.
+ const char* code = ".set imm, {imm}\nld ${reg}, ((imm - ((imm & 0x20000) << 1)) << 3)($pc)";
+ DriverStr(RepeatRIb(&mips64::Mips64Assembler::Ldpc, 18, code), "Ldpc");
+}
+
+TEST_F(AssemblerMIPS64Test, LoadFarthestNearLabelAddress) {
+ mips64::Mips64Label label;
+ __ LoadLabelAddress(mips64::V0, &label);
+ constexpr uint32_t kAdduCount = 0x3FFDE;
+ for (uint32_t i = 0; i != kAdduCount; ++i) {
+ __ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
+ }
+ __ Bind(&label);
+
+ std::string expected =
+ "lapc $v0, 1f\n" +
+ RepeatInsn(kAdduCount, "addu $zero, $zero, $zero\n") +
+ "1:\n";
+ DriverStr(expected, "LoadFarthestNearLabelAddress");
+ EXPECT_EQ(__ GetLabelLocation(&label), (1 + kAdduCount) * 4);
+}
+
+TEST_F(AssemblerMIPS64Test, LoadNearestFarLabelAddress) {
+ mips64::Mips64Label label;
+ __ LoadLabelAddress(mips64::V0, &label);
+ constexpr uint32_t kAdduCount = 0x3FFDF;
+ for (uint32_t i = 0; i != kAdduCount; ++i) {
+ __ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
+ }
+ __ Bind(&label);
+
+ std::string expected =
+ "1:\n"
+ "auipc $at, %hi(2f - 1b)\n"
+ "addiu $v0, $at, %lo(2f - 1b)\n" +
+ RepeatInsn(kAdduCount, "addu $zero, $zero, $zero\n") +
+ "2:\n";
+ DriverStr(expected, "LoadNearestFarLabelAddress");
+ EXPECT_EQ(__ GetLabelLocation(&label), (2 + kAdduCount) * 4);
+}
+
+TEST_F(AssemblerMIPS64Test, LoadFarthestNearLiteral) {
+ mips64::Literal* literal = __ NewLiteral<uint32_t>(0x12345678);
+ __ LoadLiteral(mips64::V0, mips64::kLoadWord, literal);
+ constexpr uint32_t kAdduCount = 0x3FFDE;
+ for (uint32_t i = 0; i != kAdduCount; ++i) {
+ __ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
+ }
+
+ std::string expected =
+ "lwpc $v0, 1f\n" +
+ RepeatInsn(kAdduCount, "addu $zero, $zero, $zero\n") +
+ "1:\n"
+ ".word 0x12345678\n";
+ DriverStr(expected, "LoadFarthestNearLiteral");
+ EXPECT_EQ(__ GetLabelLocation(literal->GetLabel()), (1 + kAdduCount) * 4);
+}
+
+TEST_F(AssemblerMIPS64Test, LoadNearestFarLiteral) {
+ mips64::Literal* literal = __ NewLiteral<uint32_t>(0x12345678);
+ __ LoadLiteral(mips64::V0, mips64::kLoadWord, literal);
+ constexpr uint32_t kAdduCount = 0x3FFDF;
+ for (uint32_t i = 0; i != kAdduCount; ++i) {
+ __ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
+ }
+
+ std::string expected =
+ "1:\n"
+ "auipc $at, %hi(2f - 1b)\n"
+ "lw $v0, %lo(2f - 1b)($at)\n" +
+ RepeatInsn(kAdduCount, "addu $zero, $zero, $zero\n") +
+ "2:\n"
+ ".word 0x12345678\n";
+ DriverStr(expected, "LoadNearestFarLiteral");
+ EXPECT_EQ(__ GetLabelLocation(literal->GetLabel()), (2 + kAdduCount) * 4);
+}
+
+TEST_F(AssemblerMIPS64Test, LoadFarthestNearLiteralUnsigned) {
+ mips64::Literal* literal = __ NewLiteral<uint32_t>(0x12345678);
+ __ LoadLiteral(mips64::V0, mips64::kLoadUnsignedWord, literal);
+ constexpr uint32_t kAdduCount = 0x3FFDE;
+ for (uint32_t i = 0; i != kAdduCount; ++i) {
+ __ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
+ }
+
+ std::string expected =
+ "lwupc $v0, 1f\n" +
+ RepeatInsn(kAdduCount, "addu $zero, $zero, $zero\n") +
+ "1:\n"
+ ".word 0x12345678\n";
+ DriverStr(expected, "LoadFarthestNearLiteralUnsigned");
+ EXPECT_EQ(__ GetLabelLocation(literal->GetLabel()), (1 + kAdduCount) * 4);
+}
+
+TEST_F(AssemblerMIPS64Test, LoadNearestFarLiteralUnsigned) {
+ mips64::Literal* literal = __ NewLiteral<uint32_t>(0x12345678);
+ __ LoadLiteral(mips64::V0, mips64::kLoadUnsignedWord, literal);
+ constexpr uint32_t kAdduCount = 0x3FFDF;
+ for (uint32_t i = 0; i != kAdduCount; ++i) {
+ __ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
+ }
+
+ std::string expected =
+ "1:\n"
+ "auipc $at, %hi(2f - 1b)\n"
+ "lwu $v0, %lo(2f - 1b)($at)\n" +
+ RepeatInsn(kAdduCount, "addu $zero, $zero, $zero\n") +
+ "2:\n"
+ ".word 0x12345678\n";
+ DriverStr(expected, "LoadNearestFarLiteralUnsigned");
+ EXPECT_EQ(__ GetLabelLocation(literal->GetLabel()), (2 + kAdduCount) * 4);
+}
+
+TEST_F(AssemblerMIPS64Test, LoadFarthestNearLiteralLong) {
+ mips64::Literal* literal = __ NewLiteral<uint64_t>(UINT64_C(0x0123456789ABCDEF));
+ __ LoadLiteral(mips64::V0, mips64::kLoadDoubleword, literal);
+ constexpr uint32_t kAdduCount = 0x3FFDD;
+ for (uint32_t i = 0; i != kAdduCount; ++i) {
+ __ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
+ }
+
+ std::string expected =
+ "ldpc $v0, 1f\n" +
+ RepeatInsn(kAdduCount, "addu $zero, $zero, $zero\n") +
+ "1:\n"
+ ".dword 0x0123456789ABCDEF\n";
+ DriverStr(expected, "LoadFarthestNearLiteralLong");
+ EXPECT_EQ(__ GetLabelLocation(literal->GetLabel()), (1 + kAdduCount) * 4);
+}
+
+TEST_F(AssemblerMIPS64Test, LoadNearestFarLiteralLong) {
+ mips64::Literal* literal = __ NewLiteral<uint64_t>(UINT64_C(0x0123456789ABCDEF));
+ __ LoadLiteral(mips64::V0, mips64::kLoadDoubleword, literal);
+ constexpr uint32_t kAdduCount = 0x3FFDE;
+ for (uint32_t i = 0; i != kAdduCount; ++i) {
+ __ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
+ }
+
+ std::string expected =
+ "1:\n"
+ "auipc $at, %hi(2f - 1b)\n"
+ "ld $v0, %lo(2f - 1b)($at)\n" +
+ RepeatInsn(kAdduCount, "addu $zero, $zero, $zero\n") +
+ "2:\n"
+ ".dword 0x0123456789ABCDEF\n";
+ DriverStr(expected, "LoadNearestFarLiteralLong");
+ EXPECT_EQ(__ GetLabelLocation(literal->GetLabel()), (2 + kAdduCount) * 4);
+}
+
+TEST_F(AssemblerMIPS64Test, LongLiteralAlignmentNop) {
+ mips64::Literal* literal1 = __ NewLiteral<uint64_t>(UINT64_C(0x0123456789ABCDEF));
+ mips64::Literal* literal2 = __ NewLiteral<uint64_t>(UINT64_C(0x5555555555555555));
+ mips64::Literal* literal3 = __ NewLiteral<uint64_t>(UINT64_C(0xAAAAAAAAAAAAAAAA));
+ __ LoadLiteral(mips64::A1, mips64::kLoadDoubleword, literal1);
+ __ LoadLiteral(mips64::A2, mips64::kLoadDoubleword, literal2);
+ __ LoadLiteral(mips64::A3, mips64::kLoadDoubleword, literal3);
+ __ LoadLabelAddress(mips64::V0, literal1->GetLabel());
+ __ LoadLabelAddress(mips64::V1, literal2->GetLabel());
+ // A nop will be inserted here before the 64-bit literals.
+
+ std::string expected =
+ "ldpc $a1, 1f\n"
+ // The GNU assembler incorrectly requires the ldpc instruction to be located
+ // at an address that's a multiple of 8. TODO: Remove this workaround if/when
+ // the assembler is fixed.
+ // "ldpc $a2, 2f\n"
+ ".word 0xECD80004\n"
+ "ldpc $a3, 3f\n"
+ "lapc $v0, 1f\n"
+ "lapc $v1, 2f\n"
+ "nop\n"
+ "1:\n"
+ ".dword 0x0123456789ABCDEF\n"
+ "2:\n"
+ ".dword 0x5555555555555555\n"
+ "3:\n"
+ ".dword 0xAAAAAAAAAAAAAAAA\n";
+ DriverStr(expected, "LongLiteralAlignmentNop");
+ EXPECT_EQ(__ GetLabelLocation(literal1->GetLabel()), 6 * 4u);
+ EXPECT_EQ(__ GetLabelLocation(literal2->GetLabel()), 8 * 4u);
+ EXPECT_EQ(__ GetLabelLocation(literal3->GetLabel()), 10 * 4u);
+}
+
+TEST_F(AssemblerMIPS64Test, LongLiteralAlignmentNoNop) {
+ mips64::Literal* literal1 = __ NewLiteral<uint64_t>(UINT64_C(0x0123456789ABCDEF));
+ mips64::Literal* literal2 = __ NewLiteral<uint64_t>(UINT64_C(0x5555555555555555));
+ __ LoadLiteral(mips64::A1, mips64::kLoadDoubleword, literal1);
+ __ LoadLiteral(mips64::A2, mips64::kLoadDoubleword, literal2);
+ __ LoadLabelAddress(mips64::V0, literal1->GetLabel());
+ __ LoadLabelAddress(mips64::V1, literal2->GetLabel());
+
+ std::string expected =
+ "ldpc $a1, 1f\n"
+ // The GNU assembler incorrectly requires the ldpc instruction to be located
+ // at an address that's a multiple of 8. TODO: Remove this workaround if/when
+ // the assembler is fixed.
+ // "ldpc $a2, 2f\n"
+ ".word 0xECD80003\n"
+ "lapc $v0, 1f\n"
+ "lapc $v1, 2f\n"
+ "1:\n"
+ ".dword 0x0123456789ABCDEF\n"
+ "2:\n"
+ ".dword 0x5555555555555555\n";
+ DriverStr(expected, "LongLiteralAlignmentNoNop");
+ EXPECT_EQ(__ GetLabelLocation(literal1->GetLabel()), 4 * 4u);
+ EXPECT_EQ(__ GetLabelLocation(literal2->GetLabel()), 6 * 4u);
+}
+
+TEST_F(AssemblerMIPS64Test, FarLongLiteralAlignmentNop) {
+ mips64::Literal* literal = __ NewLiteral<uint64_t>(UINT64_C(0x0123456789ABCDEF));
+ __ LoadLiteral(mips64::V0, mips64::kLoadDoubleword, literal);
+ __ LoadLabelAddress(mips64::V1, literal->GetLabel());
+ constexpr uint32_t kAdduCount = 0x3FFDF;
+ for (uint32_t i = 0; i != kAdduCount; ++i) {
+ __ Addu(mips64::ZERO, mips64::ZERO, mips64::ZERO);
+ }
+ // A nop will be inserted here before the 64-bit literal.
+
+ std::string expected =
+ "1:\n"
+ "auipc $at, %hi(3f - 1b)\n"
+ "ld $v0, %lo(3f - 1b)($at)\n"
+ "2:\n"
+ "auipc $at, %hi(3f - 2b)\n"
+ "addiu $v1, $at, %lo(3f - 2b)\n" +
+ RepeatInsn(kAdduCount, "addu $zero, $zero, $zero\n") +
+ "nop\n"
+ "3:\n"
+ ".dword 0x0123456789ABCDEF\n";
+ DriverStr(expected, "FarLongLiteralAlignmentNop");
+ EXPECT_EQ(__ GetLabelLocation(literal->GetLabel()), (5 + kAdduCount) * 4);
+}
+
TEST_F(AssemblerMIPS64Test, Bitswap) {
DriverStr(RepeatRR(&mips64::Mips64Assembler::Bitswap, "bitswap ${reg1}, ${reg2}"), "bitswap");
}
diff --git a/compiler/utils/string_reference_test.cc b/compiler/utils/string_reference_test.cc
index 0fd9e5b..90335eb 100644
--- a/compiler/utils/string_reference_test.cc
+++ b/compiler/utils/string_reference_test.cc
@@ -18,6 +18,7 @@
#include <memory>
+#include "dex_file_types.h"
#include "gtest/gtest.h"
#include "utils/test_dex_file_builder.h"
@@ -34,15 +35,15 @@
builder1.AddString("String1");
std::unique_ptr<const DexFile> dex_file1 = builder1.Build("dummy location 1");
ASSERT_EQ(1u, dex_file1->NumStringIds());
- ASSERT_STREQ("String1", dex_file1->GetStringData(dex_file1->GetStringId(0)));
- StringReference sr1(dex_file1.get(), 0);
+ ASSERT_STREQ("String1", dex_file1->GetStringData(dex_file1->GetStringId(dex::StringIndex(0))));
+ StringReference sr1(dex_file1.get(), dex::StringIndex(0));
TestDexFileBuilder builder2;
builder2.AddString("String2");
std::unique_ptr<const DexFile> dex_file2 = builder2.Build("dummy location 2");
ASSERT_EQ(1u, dex_file2->NumStringIds());
- ASSERT_STREQ("String2", dex_file2->GetStringData(dex_file2->GetStringId(0)));
- StringReference sr2(dex_file2.get(), 0);
+ ASSERT_STREQ("String2", dex_file2->GetStringData(dex_file2->GetStringId(dex::StringIndex(0))));
+ StringReference sr2(dex_file2.get(), dex::StringIndex(0));
StringReferenceValueComparator cmp;
EXPECT_TRUE(cmp(sr1, sr2)); // "String1" < "String2" is true.
@@ -80,7 +81,8 @@
std::unique_ptr<const DexFile> dex_file1 = builder1.Build("dummy location 1");
ASSERT_EQ(arraysize(kDexFile1Strings), dex_file1->NumStringIds());
for (size_t index = 0; index != arraysize(kDexFile1Strings); ++index) {
- ASSERT_STREQ(kDexFile1Strings[index], dex_file1->GetStringData(dex_file1->GetStringId(index)));
+ ASSERT_STREQ(kDexFile1Strings[index],
+ dex_file1->GetStringData(dex_file1->GetStringId(dex::StringIndex(index))));
}
TestDexFileBuilder builder2;
@@ -90,14 +92,15 @@
std::unique_ptr<const DexFile> dex_file2 = builder2.Build("dummy location 1");
ASSERT_EQ(arraysize(kDexFile2Strings), dex_file2->NumStringIds());
for (size_t index = 0; index != arraysize(kDexFile2Strings); ++index) {
- ASSERT_STREQ(kDexFile2Strings[index], dex_file2->GetStringData(dex_file2->GetStringId(index)));
+ ASSERT_STREQ(kDexFile2Strings[index],
+ dex_file2->GetStringData(dex_file2->GetStringId(dex::StringIndex(index))));
}
StringReferenceValueComparator cmp;
for (size_t index1 = 0; index1 != arraysize(kDexFile1Strings); ++index1) {
for (size_t index2 = 0; index2 != arraysize(kDexFile2Strings); ++index2) {
- StringReference sr1(dex_file1.get(), index1);
- StringReference sr2(dex_file2.get(), index2);
+ StringReference sr1(dex_file1.get(), dex::StringIndex(index1));
+ StringReference sr2(dex_file2.get(), dex::StringIndex(index2));
EXPECT_EQ(expectedCmp12[index1][index2], cmp(sr1, sr2)) << index1 << " " << index2;
EXPECT_EQ(expectedCmp21[index2][index1], cmp(sr2, sr1)) << index1 << " " << index2;
}
diff --git a/compiler/utils/test_dex_file_builder_test.cc b/compiler/utils/test_dex_file_builder_test.cc
index da4ac79..c76739b 100644
--- a/compiler/utils/test_dex_file_builder_test.cc
+++ b/compiler/utils/test_dex_file_builder_test.cc
@@ -49,7 +49,8 @@
};
ASSERT_EQ(arraysize(expected_strings), dex_file->NumStringIds());
for (size_t i = 0; i != arraysize(expected_strings); ++i) {
- EXPECT_STREQ(expected_strings[i], dex_file->GetStringData(dex_file->GetStringId(i))) << i;
+ EXPECT_STREQ(expected_strings[i],
+ dex_file->GetStringData(dex_file->GetStringId(dex::StringIndex(i)))) << i;
}
static const char* const expected_types[] = {
@@ -62,7 +63,8 @@
};
ASSERT_EQ(arraysize(expected_types), dex_file->NumTypeIds());
for (size_t i = 0; i != arraysize(expected_types); ++i) {
- EXPECT_STREQ(expected_types[i], dex_file->GetTypeDescriptor(dex_file->GetTypeId(i))) << i;
+ EXPECT_STREQ(expected_types[i],
+ dex_file->GetTypeDescriptor(dex_file->GetTypeId(dex::TypeIndex(i)))) << i;
}
ASSERT_EQ(1u, dex_file->NumFieldIds());
diff --git a/compiler/utils/type_reference.h b/compiler/utils/type_reference.h
index d0c1656..a0fa1a4 100644
--- a/compiler/utils/type_reference.h
+++ b/compiler/utils/type_reference.h
@@ -20,6 +20,7 @@
#include <stdint.h>
#include "base/logging.h"
+#include "dex_file_types.h"
#include "string_reference.h"
namespace art {
@@ -28,10 +29,10 @@
// A type is located by its DexFile and the string_ids_ table index into that DexFile.
struct TypeReference {
- TypeReference(const DexFile* file, uint32_t index) : dex_file(file), type_index(index) { }
+ TypeReference(const DexFile* file, dex::TypeIndex index) : dex_file(file), type_index(index) { }
const DexFile* dex_file;
- uint32_t type_index;
+ dex::TypeIndex type_index;
};
// Compare the actual referenced type names. Used for type reference deduplication.
diff --git a/compiler/verifier_deps_test.cc b/compiler/verifier_deps_test.cc
index 6b690aa..52765f9 100644
--- a/compiler/verifier_deps_test.cc
+++ b/compiler/verifier_deps_test.cc
@@ -19,10 +19,14 @@
#include "class_linker.h"
#include "compiler/common_compiler_test.h"
+#include "compiler/dex/verification_results.h"
+#include "compiler/dex/verified_method.h"
#include "compiler/driver/compiler_options.h"
#include "compiler/driver/compiler_driver.h"
+#include "compiler/utils/atomic_method_ref_map-inl.h"
#include "compiler_callbacks.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "handle_scope-inl.h"
#include "verifier/method_verifier-inl.h"
#include "mirror/class_loader.h"
@@ -82,10 +86,21 @@
// The compiler driver handles the verifier deps in the callbacks, so
// remove what this class did for unit testing.
verifier_deps_.reset(nullptr);
- callbacks_->SetVerifierDeps(nullptr);
- compiler_driver_->Verify(class_loader_, dex_files_, deps, &timings);
+ callbacks_->SetVerifierDeps(deps);
+ compiler_driver_->Verify(class_loader_, dex_files_, &timings);
// The compiler driver may have updated the VerifierDeps in the callback object.
- verifier_deps_.reset(callbacks_->GetVerifierDeps());
+ if (callbacks_->GetVerifierDeps() != deps) {
+ verifier_deps_.reset(callbacks_->GetVerifierDeps());
+ }
+ callbacks_->SetVerifierDeps(nullptr);
+ // Clear entries in the verification results to avoid hitting a DCHECK that
+ // we always succeed inserting a new entry after verifying.
+ AtomicMethodRefMap<const VerifiedMethod*>* map =
+ &compiler_driver_->GetVerificationResults()->atomic_verified_methods_;
+ map->Visit([](const MethodReference& ref ATTRIBUTE_UNUSED, const VerifiedMethod* method) {
+ delete method;
+ });
+ map->ClearEntries();
}
void SetVerifierDeps(const std::vector<const DexFile*>& dex_files) {
@@ -108,6 +123,9 @@
for (const DexFile* dex_file : dex_files_) {
class_linker_->RegisterDexFile(*dex_file, loader.Get());
}
+ for (const DexFile* dex_file : dex_files_) {
+ compiler_driver_->GetVerificationResults()->AddDexFile(dex_file);
+ }
}
void LoadDexFile(ScopedObjectAccess* soa) REQUIRES_SHARED(Locks::mutator_lock_) {
@@ -153,6 +171,7 @@
}
CHECK(method != nullptr);
+ Thread::Current()->SetVerifierDeps(callbacks_->GetVerifierDeps());
MethodVerifier verifier(Thread::Current(),
primary_dex_file_,
dex_cache_handle,
@@ -168,6 +187,7 @@
false /* verify to dump */,
true /* allow_thread_suspension */);
verifier.Verify();
+ Thread::Current()->SetVerifierDeps(nullptr);
return !verifier.HasFailures();
}
@@ -207,8 +227,8 @@
hs.NewHandle(soa.Decode<mirror::ClassLoader>(class_loader_)));
MutableHandle<mirror::Class> cls(hs.NewHandle<mirror::Class>(nullptr));
for (const DexFile* dex_file : dex_files_) {
- const std::vector<uint16_t>& unverified_classes = deps.GetUnverifiedClasses(*dex_file);
- std::set<uint16_t> set(unverified_classes.begin(), unverified_classes.end());
+ const std::vector<dex::TypeIndex>& unverified_classes = deps.GetUnverifiedClasses(*dex_file);
+ std::set<dex::TypeIndex> set(unverified_classes.begin(), unverified_classes.end());
for (uint32_t i = 0; i < dex_file->NumClassDefs(); ++i) {
const DexFile::ClassDef& class_def = dex_file->GetClassDef(i);
const char* descriptor = dex_file->GetClassDescriptor(class_def);
@@ -228,10 +248,9 @@
bool HasUnverifiedClass(const std::string& cls) {
const DexFile::TypeId* type_id = primary_dex_file_->FindTypeId(cls.c_str());
DCHECK(type_id != nullptr);
- uint16_t index = primary_dex_file_->GetIndexForTypeId(*type_id);
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
+ dex::TypeIndex index = primary_dex_file_->GetIndexForTypeId(*type_id);
for (const auto& dex_dep : verifier_deps_->dex_deps_) {
- for (uint16_t entry : dex_dep.second->unverified_classes_) {
+ for (dex::TypeIndex entry : dex_dep.second->unverified_classes_) {
if (index == entry) {
return true;
}
@@ -245,7 +264,6 @@
bool HasAssignable(const std::string& expected_destination,
const std::string& expected_source,
bool expected_is_assignable) {
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
for (auto& dex_dep : verifier_deps_->dex_deps_) {
const DexFile& dex_file = *dex_dep.first;
auto& storage = expected_is_assignable ? dex_dep.second->assignable_types_
@@ -267,7 +285,6 @@
bool HasClass(const std::string& expected_klass,
bool expected_resolved,
const std::string& expected_access_flags = "") {
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
for (auto& dex_dep : verifier_deps_->dex_deps_) {
for (auto& entry : dex_dep.second->classes_) {
if (expected_resolved != entry.IsResolved()) {
@@ -302,7 +319,6 @@
bool expected_resolved,
const std::string& expected_access_flags = "",
const std::string& expected_decl_klass = "") {
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
for (auto& dex_dep : verifier_deps_->dex_deps_) {
for (auto& entry : dex_dep.second->fields_) {
if (expected_resolved != entry.IsResolved()) {
@@ -356,7 +372,6 @@
bool expected_resolved,
const std::string& expected_access_flags = "",
const std::string& expected_decl_klass = "") {
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
for (auto& dex_dep : verifier_deps_->dex_deps_) {
auto& storage = (expected_kind == "direct") ? dex_dep.second->direct_methods_
: (expected_kind == "virtual") ? dex_dep.second->virtual_methods_
@@ -405,13 +420,10 @@
}
size_t NumberOfCompiledDexFiles() {
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
return verifier_deps_->dex_deps_.size();
}
size_t HasEachKindOfRecord() {
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
-
bool has_strings = false;
bool has_assignability = false;
bool has_classes = false;
@@ -462,22 +474,20 @@
ScopedObjectAccess soa(Thread::Current());
LoadDexFile(&soa);
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
-
- uint32_t id_Main1 = verifier_deps_->GetIdFromString(*primary_dex_file_, "LMain;");
- ASSERT_LT(id_Main1, primary_dex_file_->NumStringIds());
+ dex::StringIndex id_Main1 = verifier_deps_->GetIdFromString(*primary_dex_file_, "LMain;");
+ ASSERT_LT(id_Main1.index_, primary_dex_file_->NumStringIds());
ASSERT_EQ("LMain;", verifier_deps_->GetStringFromId(*primary_dex_file_, id_Main1));
- uint32_t id_Main2 = verifier_deps_->GetIdFromString(*primary_dex_file_, "LMain;");
- ASSERT_LT(id_Main2, primary_dex_file_->NumStringIds());
+ dex::StringIndex id_Main2 = verifier_deps_->GetIdFromString(*primary_dex_file_, "LMain;");
+ ASSERT_LT(id_Main2.index_, primary_dex_file_->NumStringIds());
ASSERT_EQ("LMain;", verifier_deps_->GetStringFromId(*primary_dex_file_, id_Main2));
- uint32_t id_Lorem1 = verifier_deps_->GetIdFromString(*primary_dex_file_, "Lorem ipsum");
- ASSERT_GE(id_Lorem1, primary_dex_file_->NumStringIds());
+ dex::StringIndex id_Lorem1 = verifier_deps_->GetIdFromString(*primary_dex_file_, "Lorem ipsum");
+ ASSERT_GE(id_Lorem1.index_, primary_dex_file_->NumStringIds());
ASSERT_EQ("Lorem ipsum", verifier_deps_->GetStringFromId(*primary_dex_file_, id_Lorem1));
- uint32_t id_Lorem2 = verifier_deps_->GetIdFromString(*primary_dex_file_, "Lorem ipsum");
- ASSERT_GE(id_Lorem2, primary_dex_file_->NumStringIds());
+ dex::StringIndex id_Lorem2 = verifier_deps_->GetIdFromString(*primary_dex_file_, "Lorem ipsum");
+ ASSERT_GE(id_Lorem2.index_, primary_dex_file_->NumStringIds());
ASSERT_EQ("Lorem ipsum", verifier_deps_->GetStringFromId(*primary_dex_file_, id_Lorem2));
ASSERT_EQ(id_Main1, id_Main2);
@@ -1310,9 +1320,10 @@
bool found = false;
for (const auto& entry : deps->fields_) {
if (!entry.IsResolved()) {
+ constexpr dex::StringIndex kStringIndexZero(0); // We know there is a class there.
deps->fields_.insert(VerifierDeps::FieldResolution(0 /* we know there is a field there */,
VerifierDeps::kUnresolvedMarker - 1,
- 0 /* we know there is a class there */));
+ kStringIndexZero));
found = true;
break;
}
@@ -1345,7 +1356,7 @@
VerifierDeps::DexFileDeps* deps = decoded_deps.GetDexFileDeps(*primary_dex_file_);
bool found = false;
for (const auto& entry : deps->fields_) {
- static constexpr uint32_t kNewTypeIndex = 0;
+ constexpr dex::StringIndex kNewTypeIndex(0);
if (entry.GetDeclaringClassIndex() != kNewTypeIndex) {
deps->fields_.insert(VerifierDeps::FieldResolution(entry.GetDexFieldIndex(),
entry.GetAccessFlags(),
@@ -1388,9 +1399,10 @@
std::set<VerifierDeps::MethodResolution>* methods = GetMethods(deps, resolution_kind);
for (const auto& entry : *methods) {
if (!entry.IsResolved()) {
+ constexpr dex::StringIndex kStringIndexZero(0); // We know there is a class there.
methods->insert(VerifierDeps::MethodResolution(0 /* we know there is a method there */,
VerifierDeps::kUnresolvedMarker - 1,
- 0 /* we know there is a class there */));
+ kStringIndexZero));
found = true;
break;
}
@@ -1425,7 +1437,7 @@
bool found = false;
std::set<VerifierDeps::MethodResolution>* methods = GetMethods(deps, resolution_kind);
for (const auto& entry : *methods) {
- static constexpr uint32_t kNewTypeIndex = 0;
+ constexpr dex::StringIndex kNewTypeIndex(0);
if (entry.IsResolved() && entry.GetDeclaringClassIndex() != kNewTypeIndex) {
methods->insert(VerifierDeps::MethodResolution(entry.GetDexMethodIndex(),
entry.GetAccessFlags(),
diff --git a/dex2oat/Android.bp b/dex2oat/Android.bp
index 05a5d0f..0924aec 100644
--- a/dex2oat/Android.bp
+++ b/dex2oat/Android.bp
@@ -89,6 +89,7 @@
],
static_libs: [
"libart-compiler",
+ "libart-dexlayout",
"libart",
"libvixl-arm",
"libvixl-arm64",
@@ -118,6 +119,7 @@
],
static_libs: [
"libartd-compiler",
+ "libartd-dexlayout",
"libartd",
"libvixld-arm",
"libvixld-arm64",
diff --git a/dex2oat/dex2oat.cc b/dex2oat/dex2oat.cc
index 65703a2..2346635 100644
--- a/dex2oat/dex2oat.cc
+++ b/dex2oat/dex2oat.cc
@@ -33,6 +33,9 @@
#include <sys/utsname.h>
#endif
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
#include "arch/instruction_set_features.h"
#include "arch/mips/instruction_set_features_mips.h"
#include "art_method-inl.h"
@@ -78,12 +81,16 @@
#include "ScopedLocalRef.h"
#include "scoped_thread_state_change-inl.h"
#include "utils.h"
+#include "vdex_file.h"
#include "verifier/verifier_deps.h"
#include "well_known_classes.h"
#include "zip_archive.h"
namespace art {
+using android::base::StringAppendV;
+using android::base::StringPrintf;
+
static constexpr size_t kDefaultMinDexFilesForSwap = 2;
static constexpr size_t kDefaultMinDexFileCumulativeSizeForSwap = 20 * MB;
@@ -95,7 +102,7 @@
for (int i = 0; i < original_argc; ++i) {
command.push_back(original_argv[i]);
}
- return Join(command, ' ');
+ return android::base::Join(command, ' ');
}
// A stripped version. Remove some less essential parameters. If we see a "--zip-fd=" parameter, be
@@ -107,7 +114,7 @@
// Do a pre-pass to look for zip-fd.
bool saw_zip_fd = false;
for (int i = 0; i < original_argc; ++i) {
- if (StartsWith(original_argv[i], "--zip-fd=")) {
+ if (android::base::StartsWith(original_argv[i], "--zip-fd=")) {
saw_zip_fd = true;
break;
}
@@ -122,17 +129,17 @@
}
// Any instruction-setXXX is dropped.
- if (StartsWith(original_argv[i], "--instruction-set")) {
+ if (android::base::StartsWith(original_argv[i], "--instruction-set")) {
continue;
}
// The boot image is dropped.
- if (StartsWith(original_argv[i], "--boot-image=")) {
+ if (android::base::StartsWith(original_argv[i], "--boot-image=")) {
continue;
}
// The image format is dropped.
- if (StartsWith(original_argv[i], "--image-format=")) {
+ if (android::base::StartsWith(original_argv[i], "--image-format=")) {
continue;
}
@@ -141,11 +148,11 @@
// However, we prefer to drop this when we saw --zip-fd.
if (saw_zip_fd) {
// Drop anything --zip-X, --dex-X, --oat-X, --swap-X, or --app-image-X
- if (StartsWith(original_argv[i], "--zip-") ||
- StartsWith(original_argv[i], "--dex-") ||
- StartsWith(original_argv[i], "--oat-") ||
- StartsWith(original_argv[i], "--swap-") ||
- StartsWith(original_argv[i], "--app-image-")) {
+ if (android::base::StartsWith(original_argv[i], "--zip-") ||
+ android::base::StartsWith(original_argv[i], "--dex-") ||
+ android::base::StartsWith(original_argv[i], "--oat-") ||
+ android::base::StartsWith(original_argv[i], "--swap-") ||
+ android::base::StartsWith(original_argv[i], "--app-image-")) {
continue;
}
}
@@ -158,7 +165,7 @@
// It seems only "/system/bin/dex2oat" is left, or not even that. Use a pretty line.
return "Starting dex2oat.";
}
- return Join(command, ' ');
+ return android::base::Join(command, ' ');
}
static void UsageErrorV(const char* fmt, va_list ap) {
@@ -270,6 +277,7 @@
"|balanced"
"|speed-profile"
"|speed"
+ "|layout-profile"
"|everything-profile"
"|everything):");
UsageError(" select compiler filter.");
@@ -516,9 +524,11 @@
runtime_(nullptr),
thread_count_(sysconf(_SC_NPROCESSORS_CONF)),
start_ns_(NanoTime()),
+ start_cputime_ns_(ProcessCpuNanoTime()),
oat_fd_(-1),
input_vdex_fd_(-1),
output_vdex_fd_(-1),
+ input_vdex_file_(nullptr),
zip_fd_(-1),
image_base_(0U),
image_classes_zip_filename_(nullptr),
@@ -709,6 +719,10 @@
Usage("Output must be supplied with either --oat-file or --oat-fd");
}
+ if (input_vdex_fd_ != -1 && !input_vdex_.empty()) {
+ Usage("Can't have both --input-vdex-fd and --input-vdex");
+ }
+
if (!oat_filenames_.empty() && oat_fd_ != -1) {
Usage("--oat-file should not be used with --oat-fd");
}
@@ -991,7 +1005,7 @@
if (last_dex_dot != std::string::npos) {
dex_file = dex_file.substr(0, last_dex_dot);
}
- if (StartsWith(dex_file, "core-")) {
+ if (android::base::StartsWith(dex_file, "core-")) {
infix = dex_file.substr(strlen("core"));
}
}
@@ -1051,7 +1065,7 @@
in.insert(last_dot, infix);
}
}
- if (EndsWith(in, ".jar")) {
+ if (android::base::EndsWith(in, ".jar")) {
in = in.substr(0, in.length() - strlen(".jar")) +
(replace_suffix != nullptr ? replace_suffix : "");
}
@@ -1122,6 +1136,8 @@
zip_location_ = option.substr(strlen("--zip-location=")).data();
} else if (option.starts_with("--input-vdex-fd=")) {
ParseInputVdexFd(option);
+ } else if (option.starts_with("--input-vdex=")) {
+ input_vdex_ = option.substr(strlen("--input-vdex=")).data();
} else if (option.starts_with("--output-vdex-fd=")) {
ParseOutputVdexFd(option);
} else if (option.starts_with("--oat-file=")) {
@@ -1265,6 +1281,17 @@
return false;
}
oat_files_.push_back(std::move(oat_file));
+ DCHECK_EQ(input_vdex_fd_, -1);
+ if (!input_vdex_.empty()) {
+ std::string error_msg;
+ input_vdex_file_.reset(VdexFile::Open(input_vdex_,
+ /* writable */ false,
+ /* low_4gb */ false,
+ &error_msg));
+ if (input_vdex_file_ != nullptr && !input_vdex_file_->IsValid()) {
+ input_vdex_file_.reset(nullptr);
+ }
+ }
DCHECK_EQ(output_vdex_fd_, -1);
std::string vdex_filename = ReplaceFileExtension(oat_filename, "vdex");
@@ -1292,6 +1319,31 @@
}
oat_files_.push_back(std::move(oat_file));
+ DCHECK_NE(input_vdex_fd_, output_vdex_fd_);
+ if (input_vdex_fd_ != -1) {
+ struct stat s;
+ int rc = TEMP_FAILURE_RETRY(fstat(input_vdex_fd_, &s));
+ if (rc == -1) {
+ PLOG(WARNING) << "Failed getting length of vdex file";
+ } else {
+ std::string error_msg;
+ input_vdex_file_.reset(VdexFile::Open(input_vdex_fd_,
+ s.st_size,
+ "vdex",
+ /* writable */ false,
+ /* low_4gb */ false,
+ &error_msg));
+ // If there's any problem with the passed vdex, just warn and proceed
+ // without it.
+ if (input_vdex_file_ == nullptr) {
+ PLOG(WARNING) << "Failed opening vdex file " << error_msg;
+ } else if (!input_vdex_file_->IsValid()) {
+ PLOG(WARNING) << "Existing vdex file is invalid";
+ input_vdex_file_.reset(nullptr);
+ }
+ }
+ }
+
DCHECK_NE(output_vdex_fd_, -1);
std::string vdex_location = ReplaceFileExtension(oat_location_, "vdex");
std::unique_ptr<File> vdex_file(new File(output_vdex_fd_, vdex_location, /* check_usage */ true));
@@ -1387,7 +1439,6 @@
// boot class path.
bool Setup() {
TimingLogger::ScopedTiming t("dex2oat Setup", timings_);
- art::MemMap::Init(); // For ZipEntry::ExtractToMemMap.
if (!PrepareImageClasses() || !PrepareCompiledClasses() || !PrepareCompiledMethods()) {
return false;
@@ -1439,7 +1490,7 @@
for (const gc::space::ImageSpace* image_space : image_spaces) {
image_filenames.push_back(image_space->GetImageFilename());
}
- std::string image_file_location = Join(image_filenames, ':');
+ std::string image_file_location = android::base::Join(image_filenames, ':');
if (!image_file_location.empty()) {
key_value_store_->Put(OatHeader::kImageLocationKey, image_file_location);
}
@@ -1479,13 +1530,18 @@
// Unzip or copy dex files straight to the oat file.
std::unique_ptr<MemMap> opened_dex_files_map;
std::vector<std::unique_ptr<const DexFile>> opened_dex_files;
+ // No need to verify the dex file for:
+ // 1) dexlayout, which already verified it
+ // 2) when we have a vdex file, which means it was already verified.
+ bool verify = compiler_options_->GetCompilerFilter() != CompilerFilter::kLayoutProfile &&
+ (input_vdex_file_ == nullptr);
if (!oat_writers_[i]->WriteAndOpenDexFiles(
kIsVdexEnabled ? vdex_files_[i].get() : oat_files_[i].get(),
rodata_.back(),
instruction_set_,
instruction_set_features_.get(),
key_value_store_.get(),
- /* verify */ true,
+ verify,
&opened_dex_files_map,
&opened_dex_files)) {
return false;
@@ -1585,6 +1641,9 @@
dex_caches_.push_back(soa.AddLocalReference<jobject>(
class_linker->RegisterDexFile(*dex_file,
soa.Decode<mirror::ClassLoader>(class_loader_).Ptr())));
+ // Pre-register dex files so that we can access verification results without locks during
+ // compilation and verification.
+ verification_results_->AddDexFile(dex_file);
}
return true;
@@ -1634,7 +1693,7 @@
}
}
- if (StartsWith(dex_location, filter.c_str())) {
+ if (android::base::StartsWith(dex_location, filter.c_str())) {
VLOG(compiler) << "Disabling inlining from " << dex_file->GetLocation();
no_inline_from_dex_files_.push_back(dex_file);
break;
@@ -1662,7 +1721,7 @@
swap_fd_,
profile_compilation_info_.get()));
driver_->SetDexFilesForOatFile(dex_files_);
- driver_->CompileAll(class_loader_, dex_files_, /* verifier_deps */ nullptr, timings_);
+ driver_->CompileAll(class_loader_, dex_files_, input_vdex_file_.get(), timings_);
}
// Notes on the interleaving of creating the images and oat files to
@@ -1803,8 +1862,8 @@
return false;
}
- // VDEX finalized, seek back to the beginning and write the header.
- if (!oat_writers_[i]->WriteVdexHeader(vdex_out.get())) {
+ // VDEX finalized, seek back to the beginning and write checksums and the header.
+ if (!oat_writers_[i]->WriteChecksumsAndVdexHeader(vdex_out.get())) {
LOG(ERROR) << "Failed to write vdex header into VDEX " << vdex_file->GetPath();
return false;
}
@@ -2235,7 +2294,14 @@
bool AddDexFileSources() {
TimingLogger::ScopedTiming t2("AddDexFileSources", timings_);
- if (zip_fd_ != -1) {
+ if (input_vdex_file_ != nullptr) {
+ DCHECK_EQ(oat_writers_.size(), 1u);
+ const std::string& name = zip_location_.empty() ? dex_locations_[0] : zip_location_;
+ DCHECK(!name.empty());
+ if (!oat_writers_[0]->AddVdexDexFilesSource(*input_vdex_file_.get(), name.c_str())) {
+ return false;
+ }
+ } else if (zip_fd_ != -1) {
DCHECK_EQ(oat_writers_.size(), 1u);
if (!oat_writers_[0]->AddZippedDexFilesSource(File(zip_fd_, /* check_usage */ false),
zip_location_.c_str())) {
@@ -2273,7 +2339,9 @@
compiler_options_.get(),
oat_file.get()));
elf_writers_.back()->Start();
- oat_writers_.emplace_back(new OatWriter(IsBootImage(), timings_));
+ bool do_dexlayout = compiler_options_->GetCompilerFilter() == CompilerFilter::kLayoutProfile;
+ oat_writers_.emplace_back(new OatWriter(
+ IsBootImage(), timings_, do_dexlayout ? profile_compilation_info_.get() : nullptr));
}
}
@@ -2300,10 +2368,10 @@
RuntimeOptions raw_options;
if (boot_image_filename_.empty()) {
std::string boot_class_path = "-Xbootclasspath:";
- boot_class_path += Join(dex_filenames_, ':');
+ boot_class_path += android::base::Join(dex_filenames_, ':');
raw_options.push_back(std::make_pair(boot_class_path, nullptr));
std::string boot_class_path_locations = "-Xbootclasspath-locations:";
- boot_class_path_locations += Join(dex_locations_, ':');
+ boot_class_path_locations += android::base::Join(dex_locations_, ':');
raw_options.push_back(std::make_pair(boot_class_path_locations, nullptr));
} else {
std::string boot_image_option = "-Ximage:";
@@ -2517,7 +2585,7 @@
while (in_stream.good()) {
std::string dot;
std::getline(in_stream, dot);
- if (StartsWith(dot, "#") || dot.empty()) {
+ if (android::base::StartsWith(dot, "#") || dot.empty()) {
continue;
}
if (process != nullptr) {
@@ -2534,7 +2602,9 @@
// Note: when creation of a runtime fails, e.g., when trying to compile an app but when there
// is no image, there won't be a Runtime::Current().
// Note: driver creation can fail when loading an invalid dex file.
- LOG(INFO) << "dex2oat took " << PrettyDuration(NanoTime() - start_ns_)
+ LOG(INFO) << "dex2oat took "
+ << PrettyDuration(NanoTime() - start_ns_)
+ << " (" << PrettyDuration(ProcessCpuNanoTime() - start_cputime_ns_) << " cpu)"
<< " (threads: " << thread_count_ << ") "
<< ((Runtime::Current() != nullptr && driver_ != nullptr) ?
driver_->GetMemoryUsageString(kIsDebugBuild || VLOG_IS_ON(compiler)) :
@@ -2582,6 +2652,7 @@
size_t thread_count_;
uint64_t start_ns_;
+ uint64_t start_cputime_ns_;
std::unique_ptr<WatchDog> watchdog_;
std::vector<std::unique_ptr<File>> oat_files_;
std::vector<std::unique_ptr<File>> vdex_files_;
@@ -2591,6 +2662,8 @@
int oat_fd_;
int input_vdex_fd_;
int output_vdex_fd_;
+ std::string input_vdex_;
+ std::unique_ptr<VdexFile> input_vdex_file_;
std::vector<const char*> dex_filenames_;
std::vector<const char*> dex_locations_;
int zip_fd_;
@@ -2787,6 +2860,8 @@
}
}
+ art::MemMap::Init(); // For ZipEntry::ExtractToMemMap, and vdex.
+
// Check early that the result of compilation can be written
if (!dex2oat->OpenFile()) {
return EXIT_FAILURE;
diff --git a/dex2oat/dex2oat_test.cc b/dex2oat/dex2oat_test.cc
index fa32178..cdb3b9f 100644
--- a/dex2oat/dex2oat_test.cc
+++ b/dex2oat/dex2oat_test.cc
@@ -19,19 +19,22 @@
#include <string>
#include <vector>
+#include <sys/wait.h>
+#include <unistd.h>
+
+#include "android-base/stringprintf.h"
+
#include "common_runtime_test.h"
#include "base/logging.h"
#include "base/macros.h"
-#include "base/stringprintf.h"
+#include "dex_file-inl.h"
#include "dex2oat_environment_test.h"
+#include "jit/offline_profiling_info.h"
#include "oat.h"
#include "oat_file.h"
#include "utils.h"
-#include <sys/wait.h>
-#include <unistd.h>
-
namespace art {
class Dex2oatTest : public Dex2oatEnvironmentTest {
@@ -215,7 +218,7 @@
std::unique_ptr<ScratchFile> sf;
if (use_fd) {
sf.reset(new ScratchFile());
- copy.push_back(StringPrintf("--swap-fd=%d", sf->GetFd()));
+ copy.push_back(android::base::StringPrintf("--swap-fd=%d", sf->GetFd()));
} else {
std::string swap_location = GetOdexDir() + "/Dex2OatSwapTest.odex.swap";
copy.push_back("--swap-file=" + swap_location);
@@ -551,4 +554,108 @@
RunTest(CompilerFilter::kSpeed, true, { "--very-large-app-threshold=100" });
}
+class Dex2oatLayoutTest : public Dex2oatTest {
+ protected:
+ void CheckFilter(CompilerFilter::Filter input ATTRIBUTE_UNUSED,
+ CompilerFilter::Filter result ATTRIBUTE_UNUSED) OVERRIDE {
+ // Ignore, we'll do our own checks.
+ }
+
+ // Emits a profile with a single dex file with the given location and a single class index of 1.
+ void GenerateProfile(const std::string& test_profile,
+ const std::string& dex_location,
+ uint32_t checksum) {
+ int profile_test_fd = open(test_profile.c_str(), O_CREAT | O_TRUNC | O_WRONLY, 0644);
+ CHECK_GE(profile_test_fd, 0);
+
+ ProfileCompilationInfo info;
+ std::string profile_key = ProfileCompilationInfo::GetProfileDexFileKey(dex_location);
+ info.AddClassIndex(profile_key, checksum, dex::TypeIndex(1));
+ bool result = info.Save(profile_test_fd);
+ close(profile_test_fd);
+ ASSERT_TRUE(result);
+ }
+
+ void RunTest() {
+ std::string dex_location = GetScratchDir() + "/DexNoOat.jar";
+ std::string profile_location = GetScratchDir() + "/primary.prof";
+ std::string odex_location = GetOdexDir() + "/DexOdexNoOat.odex";
+
+ Copy(GetDexSrc2(), dex_location);
+ const char* location = dex_location.c_str();
+ std::string error_msg;
+ std::vector<std::unique_ptr<const DexFile>> dex_files;
+ ASSERT_TRUE(DexFile::Open(location, location, true, &error_msg, &dex_files));
+ EXPECT_EQ(dex_files.size(), 1U);
+ std::unique_ptr<const DexFile>& dex_file = dex_files[0];
+ GenerateProfile(profile_location, dex_location, dex_file->GetLocationChecksum());
+
+ const std::vector<std::string>& extra_args = { "--profile-file=" + profile_location };
+ GenerateOdexForTest(dex_location, odex_location, CompilerFilter::kLayoutProfile, extra_args);
+
+ CheckValidity();
+ ASSERT_TRUE(success_);
+ CheckResult(dex_location, odex_location);
+ }
+ void CheckResult(const std::string& dex_location, const std::string& odex_location) {
+ // Host/target independent checks.
+ std::string error_msg;
+ std::unique_ptr<OatFile> odex_file(OatFile::Open(odex_location.c_str(),
+ odex_location.c_str(),
+ nullptr,
+ nullptr,
+ false,
+ /*low_4gb*/false,
+ dex_location.c_str(),
+ &error_msg));
+ ASSERT_TRUE(odex_file.get() != nullptr) << error_msg;
+
+ const char* location = dex_location.c_str();
+ std::vector<std::unique_ptr<const DexFile>> dex_files;
+ ASSERT_TRUE(DexFile::Open(location, location, true, &error_msg, &dex_files));
+ EXPECT_EQ(dex_files.size(), 1U);
+ std::unique_ptr<const DexFile>& old_dex_file = dex_files[0];
+
+ for (const OatDexFile* oat_dex_file : odex_file->GetOatDexFiles()) {
+ std::unique_ptr<const DexFile> new_dex_file = oat_dex_file->OpenDexFile(&error_msg);
+ ASSERT_TRUE(new_dex_file != nullptr);
+ uint32_t class_def_count = new_dex_file->NumClassDefs();
+ ASSERT_LT(class_def_count, std::numeric_limits<uint16_t>::max());
+ ASSERT_GE(class_def_count, 2U);
+
+ // The new layout swaps the classes at indexes 0 and 1.
+ std::string old_class0 = old_dex_file->PrettyType(old_dex_file->GetClassDef(0).class_idx_);
+ std::string old_class1 = old_dex_file->PrettyType(old_dex_file->GetClassDef(1).class_idx_);
+ std::string new_class0 = new_dex_file->PrettyType(new_dex_file->GetClassDef(0).class_idx_);
+ std::string new_class1 = new_dex_file->PrettyType(new_dex_file->GetClassDef(1).class_idx_);
+ EXPECT_EQ(old_class0, new_class1);
+ EXPECT_EQ(old_class1, new_class0);
+ }
+
+ EXPECT_EQ(odex_file->GetCompilerFilter(), CompilerFilter::kLayoutProfile);
+ }
+
+ // Check whether the dex2oat run was really successful.
+ void CheckValidity() {
+ if (kIsTargetBuild) {
+ CheckTargetValidity();
+ } else {
+ CheckHostValidity();
+ }
+ }
+
+ void CheckTargetValidity() {
+ // TODO: Ignore for now.
+ }
+
+ // On the host, we can get the dex2oat output. Here, look for "dex2oat took."
+ void CheckHostValidity() {
+ EXPECT_NE(output_.find("dex2oat took"), std::string::npos) << output_;
+ }
+ };
+
+TEST_F(Dex2oatLayoutTest, TestLayout) {
+ RunTest();
+}
+
} // namespace art
diff --git a/dexdump/dexdump.cc b/dexdump/dexdump.cc
index 30de28e..d5776fa 100644
--- a/dexdump/dexdump.cc
+++ b/dexdump/dexdump.cc
@@ -42,9 +42,11 @@
#include <sstream>
#include <vector>
-#include "base/stringprintf.h"
+#include "android-base/stringprintf.h"
+
#include "dexdump_cfg.h"
#include "dex_file-inl.h"
+#include "dex_file_types.h"
#include "dex_instruction-inl.h"
namespace art {
@@ -474,15 +476,15 @@
case DexFile::kDexAnnotationString: {
const u4 idx = static_cast<u4>(readVarWidth(data, arg, false));
if (gOptions.outputFormat == OUTPUT_PLAIN) {
- dumpEscapedString(pDexFile->StringDataByIdx(idx));
+ dumpEscapedString(pDexFile->StringDataByIdx(dex::StringIndex(idx)));
} else {
- dumpXmlAttribute(pDexFile->StringDataByIdx(idx));
+ dumpXmlAttribute(pDexFile->StringDataByIdx(dex::StringIndex(idx)));
}
break;
}
case DexFile::kDexAnnotationType: {
const u4 str_idx = static_cast<u4>(readVarWidth(data, arg, false));
- fputs(pDexFile->StringByTypeIdx(str_idx), gOutFile);
+ fputs(pDexFile->StringByTypeIdx(dex::TypeIndex(str_idx)), gOutFile);
break;
}
case DexFile::kDexAnnotationField:
@@ -511,13 +513,13 @@
}
case DexFile::kDexAnnotationAnnotation: {
const u4 type_idx = DecodeUnsignedLeb128(data);
- fputs(pDexFile->StringByTypeIdx(type_idx), gOutFile);
+ fputs(pDexFile->StringByTypeIdx(dex::TypeIndex(type_idx)), gOutFile);
// Decode and display all name=value pairs.
const u4 size = DecodeUnsignedLeb128(data);
for (u4 i = 0; i < size; i++) {
const u4 name_idx = DecodeUnsignedLeb128(data);
fputc(' ', gOutFile);
- fputs(pDexFile->StringDataByIdx(name_idx), gOutFile);
+ fputs(pDexFile->StringDataByIdx(dex::StringIndex(name_idx)), gOutFile);
fputc('=', gOutFile);
dumpEncodedValue(pDexFile, data);
}
@@ -592,13 +594,13 @@
// General class information.
const DexFile::ClassDef& pClassDef = pDexFile->GetClassDef(idx);
fprintf(gOutFile, "Class #%d header:\n", idx);
- fprintf(gOutFile, "class_idx : %d\n", pClassDef.class_idx_);
+ fprintf(gOutFile, "class_idx : %d\n", pClassDef.class_idx_.index_);
fprintf(gOutFile, "access_flags : %d (0x%04x)\n",
pClassDef.access_flags_, pClassDef.access_flags_);
- fprintf(gOutFile, "superclass_idx : %d\n", pClassDef.superclass_idx_);
+ fprintf(gOutFile, "superclass_idx : %d\n", pClassDef.superclass_idx_.index_);
fprintf(gOutFile, "interfaces_off : %d (0x%06x)\n",
pClassDef.interfaces_off_, pClassDef.interfaces_off_);
- fprintf(gOutFile, "source_file_idx : %d\n", pClassDef.source_file_idx_);
+ fprintf(gOutFile, "source_file_idx : %d\n", pClassDef.source_file_idx_.index_);
fprintf(gOutFile, "annotations_off : %d (0x%06x)\n",
pClassDef.annotations_off_, pClassDef.annotations_off_);
fprintf(gOutFile, "class_data_off : %d (0x%06x)\n",
@@ -747,9 +749,8 @@
const u4 end = start + pTry->insn_count_;
fprintf(gOutFile, " 0x%04x - 0x%04x\n", start, end);
for (CatchHandlerIterator it(*pCode, *pTry); it.HasNext(); it.Next()) {
- const u2 tidx = it.GetHandlerTypeIndex();
- const char* descriptor =
- (tidx == DexFile::kDexNoIndex16) ? "<any>" : pDexFile->StringByTypeIdx(tidx);
+ const dex::TypeIndex tidx = it.GetHandlerTypeIndex();
+ const char* descriptor = (!tidx.IsValid()) ? "<any>" : pDexFile->StringByTypeIdx(tidx);
fprintf(gOutFile, " %s -> 0x%04x\n", descriptor, it.GetHandlerAddress());
} // for
} // for
@@ -834,7 +835,7 @@
break;
case Instruction::kIndexTypeRef:
if (index < pDexFile->GetHeader().type_ids_size_) {
- const char* tp = pDexFile->StringByTypeIdx(index);
+ const char* tp = pDexFile->StringByTypeIdx(dex::TypeIndex(index));
outSize = snprintf(buf.get(), bufSize, "%s // type@%0*x", tp, width, index);
} else {
outSize = snprintf(buf.get(), bufSize, "<type?> // type@%0*x", width, index);
@@ -842,7 +843,7 @@
break;
case Instruction::kIndexStringRef:
if (index < pDexFile->GetHeader().string_ids_size_) {
- const char* st = pDexFile->StringDataByIdx(index);
+ const char* st = pDexFile->StringDataByIdx(dex::StringIndex(index));
outSize = snprintf(buf.get(), bufSize, "\"%s\" // string@%0*x", st, width, index);
} else {
outSize = snprintf(buf.get(), bufSize, "<string?> // string@%0*x", width, index);
@@ -887,8 +888,10 @@
const char* name = pDexFile->StringDataByIdx(pMethodId.name_idx_);
const Signature signature = pDexFile->GetMethodSignature(pMethodId);
const char* backDescriptor = pDexFile->StringByTypeIdx(pMethodId.class_idx_);
- method = StringPrintf("%s.%s:%s",
- backDescriptor, name, signature.ToString().c_str());
+ method = android::base::StringPrintf("%s.%s:%s",
+ backDescriptor,
+ name,
+ signature.ToString().c_str());
}
if (secondary_index < pDexFile->GetHeader().proto_ids_size_) {
const DexFile::ProtoId& protoId = pDexFile->GetProtoId(secondary_index);
@@ -1461,7 +1464,7 @@
// General class information.
char* accessStr = createAccessFlagStr(pClassDef.access_flags_, kAccessForClass);
const char* superclassDescriptor;
- if (pClassDef.superclass_idx_ == DexFile::kDexNoIndex16) {
+ if (!pClassDef.superclass_idx_.IsValid()) {
superclassDescriptor = nullptr;
} else {
superclassDescriptor = pDexFile->StringByTypeIdx(pClassDef.superclass_idx_);
@@ -1564,13 +1567,13 @@
// End of class.
if (gOptions.outputFormat == OUTPUT_PLAIN) {
const char* fileName;
- if (pClassDef.source_file_idx_ != DexFile::kDexNoIndex) {
+ if (pClassDef.source_file_idx_.IsValid()) {
fileName = pDexFile->StringDataByIdx(pClassDef.source_file_idx_);
} else {
fileName = "unknown";
}
fprintf(gOutFile, " source_file_idx : %d (%s)\n\n",
- pClassDef.source_file_idx_, fileName);
+ pClassDef.source_file_idx_.index_, fileName);
} else if (gOptions.outputFormat == OUTPUT_XML) {
fprintf(gOutFile, "</class>\n");
}
diff --git a/dexdump/dexdump_test.cc b/dexdump/dexdump_test.cc
index d28ca28..53dda6a 100644
--- a/dexdump/dexdump_test.cc
+++ b/dexdump/dexdump_test.cc
@@ -21,7 +21,6 @@
#include <sys/types.h>
#include <unistd.h>
-#include "base/stringprintf.h"
#include "common_runtime_test.h"
#include "runtime/arch/instruction_set.h"
#include "runtime/os.h"
diff --git a/dexlayout/Android.bp b/dexlayout/Android.bp
index b9266f7..9ee9ebd 100644
--- a/dexlayout/Android.bp
+++ b/dexlayout/Android.bp
@@ -12,28 +12,46 @@
// See the License for the specific language governing permissions and
// limitations under the License.
-art_cc_binary {
- name: "dexlayout",
+art_cc_defaults {
+ name: "libart-dexlayout-defaults",
host_supported: true,
srcs: [
- "dexlayout_main.cc",
"dexlayout.cc",
"dex_ir.cc",
"dex_ir_builder.cc",
"dex_visualize.cc",
"dex_writer.cc",
],
+ export_include_dirs: ["."],
+ shared_libs: ["libbase"],
+ static_libs: ["libz"],
+}
+
+art_cc_library {
+ name: "libart-dexlayout",
+ defaults: ["libart-dexlayout-defaults"],
+ shared_libs: ["libart"],
+}
+
+art_cc_library {
+ name: "libartd-dexlayout",
+ defaults: ["libart-dexlayout-defaults"],
+ shared_libs: ["libartd"],
+}
+
+art_cc_binary {
+ name: "dexlayout",
+ host_supported: true,
+ srcs: ["dexlayout_main.cc"],
cflags: ["-Wall"],
shared_libs: [
"libart",
- "libbase",
+ "libart-dexlayout",
],
}
art_cc_test {
name: "art_dexlayout_tests",
- defaults: [
- "art_gtest_defaults",
- ],
+ defaults: ["art_gtest_defaults"],
srcs: ["dexlayout_test.cc"],
}
diff --git a/dexlayout/dex_ir.cc b/dexlayout/dex_ir.cc
index c3c763f..b1e66be 100644
--- a/dexlayout/dex_ir.cc
+++ b/dexlayout/dex_ir.cc
@@ -56,6 +56,36 @@
entry.end_address_, entry.reg_)));
}
+static uint32_t GetCodeItemSize(const DexFile& dex_file, const DexFile::CodeItem& disk_code_item) {
+ uintptr_t code_item_start = reinterpret_cast<uintptr_t>(&disk_code_item);
+ uint32_t insns_size = disk_code_item.insns_size_in_code_units_;
+ uint32_t tries_size = disk_code_item.tries_size_;
+ if (tries_size == 0) {
+ uintptr_t insns_end = reinterpret_cast<uintptr_t>(&disk_code_item.insns_[insns_size]);
+ return insns_end - code_item_start;
+ } else {
+ uint32_t last_handler_off = 0;
+ for (uint32_t i = 0; i < tries_size; ++i) {
+ // Iterate over the try items to find the last catch handler.
+ const DexFile::TryItem* disk_try_item = dex_file.GetTryItems(disk_code_item, i);
+ uint16_t handler_off = disk_try_item->handler_off_;
+ if (handler_off > last_handler_off) {
+ last_handler_off = handler_off;
+ }
+ }
+ // Decode the final handler to see where it ends.
+ const uint8_t* handler_data = DexFile::GetCatchHandlerData(disk_code_item, last_handler_off);
+ int32_t uleb128_count = DecodeSignedLeb128(&handler_data) * 2;
+ if (uleb128_count <= 0) {
+ uleb128_count = -uleb128_count + 1;
+ }
+ for (int32_t i = 0; i < uleb128_count; ++i) {
+ DecodeUnsignedLeb128(&handler_data);
+ }
+ return reinterpret_cast<uintptr_t>(handler_data) - code_item_start;
+ }
+}
+
static uint32_t GetDebugInfoStreamSize(const uint8_t* debug_info_stream) {
const uint8_t* stream = debug_info_stream;
DecodeUnsignedLeb128(&stream); // line_start
@@ -310,7 +340,7 @@
}
void Collections::CreateStringId(const DexFile& dex_file, uint32_t i) {
- const DexFile::StringId& disk_string_id = dex_file.GetStringId(i);
+ const DexFile::StringId& disk_string_id = dex_file.GetStringId(dex::StringIndex(i));
StringData* string_data = new StringData(dex_file.GetStringData(disk_string_id));
string_datas_.AddItem(string_data, disk_string_id.string_data_off_);
@@ -319,8 +349,8 @@
}
void Collections::CreateTypeId(const DexFile& dex_file, uint32_t i) {
- const DexFile::TypeId& disk_type_id = dex_file.GetTypeId(i);
- TypeId* type_id = new TypeId(GetStringId(disk_type_id.descriptor_idx_));
+ const DexFile::TypeId& disk_type_id = dex_file.GetTypeId(dex::TypeIndex(i));
+ TypeId* type_id = new TypeId(GetStringId(disk_type_id.descriptor_idx_.index_));
type_ids_.AddIndexedItem(type_id, TypeIdsOffset() + i * TypeId::ItemSize(), i);
}
@@ -329,38 +359,38 @@
const DexFile::TypeList* type_list = dex_file.GetProtoParameters(disk_proto_id);
TypeList* parameter_type_list = CreateTypeList(type_list, disk_proto_id.parameters_off_);
- ProtoId* proto_id = new ProtoId(GetStringId(disk_proto_id.shorty_idx_),
- GetTypeId(disk_proto_id.return_type_idx_),
+ ProtoId* proto_id = new ProtoId(GetStringId(disk_proto_id.shorty_idx_.index_),
+ GetTypeId(disk_proto_id.return_type_idx_.index_),
parameter_type_list);
proto_ids_.AddIndexedItem(proto_id, ProtoIdsOffset() + i * ProtoId::ItemSize(), i);
}
void Collections::CreateFieldId(const DexFile& dex_file, uint32_t i) {
const DexFile::FieldId& disk_field_id = dex_file.GetFieldId(i);
- FieldId* field_id = new FieldId(GetTypeId(disk_field_id.class_idx_),
- GetTypeId(disk_field_id.type_idx_),
- GetStringId(disk_field_id.name_idx_));
+ FieldId* field_id = new FieldId(GetTypeId(disk_field_id.class_idx_.index_),
+ GetTypeId(disk_field_id.type_idx_.index_),
+ GetStringId(disk_field_id.name_idx_.index_));
field_ids_.AddIndexedItem(field_id, FieldIdsOffset() + i * FieldId::ItemSize(), i);
}
void Collections::CreateMethodId(const DexFile& dex_file, uint32_t i) {
const DexFile::MethodId& disk_method_id = dex_file.GetMethodId(i);
- MethodId* method_id = new MethodId(GetTypeId(disk_method_id.class_idx_),
+ MethodId* method_id = new MethodId(GetTypeId(disk_method_id.class_idx_.index_),
GetProtoId(disk_method_id.proto_idx_),
- GetStringId(disk_method_id.name_idx_));
+ GetStringId(disk_method_id.name_idx_.index_));
method_ids_.AddIndexedItem(method_id, MethodIdsOffset() + i * MethodId::ItemSize(), i);
}
void Collections::CreateClassDef(const DexFile& dex_file, uint32_t i) {
const DexFile::ClassDef& disk_class_def = dex_file.GetClassDef(i);
- const TypeId* class_type = GetTypeId(disk_class_def.class_idx_);
+ const TypeId* class_type = GetTypeId(disk_class_def.class_idx_.index_);
uint32_t access_flags = disk_class_def.access_flags_;
- const TypeId* superclass = GetTypeIdOrNullPtr(disk_class_def.superclass_idx_);
+ const TypeId* superclass = GetTypeIdOrNullPtr(disk_class_def.superclass_idx_.index_);
const DexFile::TypeList* type_list = dex_file.GetInterfacesList(disk_class_def);
TypeList* interfaces_type_list = CreateTypeList(type_list, disk_class_def.interfaces_off_);
- const StringId* source_file = GetStringIdOrNullPtr(disk_class_def.source_file_idx_);
+ const StringId* source_file = GetStringIdOrNullPtr(disk_class_def.source_file_idx_.index_);
// Annotations.
AnnotationsDirectoryItem* annotations = nullptr;
const DexFile::AnnotationsDirectoryItem* disk_annotations_directory_item =
@@ -384,16 +414,14 @@
if (dex_type_list == nullptr) {
return nullptr;
}
- // TODO: Create more efficient lookup for existing type lists.
- for (std::unique_ptr<TypeList>& type_list : TypeLists()) {
- if (type_list->GetOffset() == offset) {
- return type_list.get();
- }
+ auto found_type_list = TypeLists().find(offset);
+ if (found_type_list != TypeLists().end()) {
+ return found_type_list->second.get();
}
TypeIdVector* type_vector = new TypeIdVector();
uint32_t size = dex_type_list->Size();
for (uint32_t index = 0; index < size; ++index) {
- type_vector->push_back(GetTypeId(dex_type_list->GetTypeItem(index).type_idx_));
+ type_vector->push_back(GetTypeId(dex_type_list->GetTypeItem(index).type_idx_.index_));
}
TypeList* new_type_list = new TypeList(type_vector);
type_lists_.AddItem(new_type_list, offset);
@@ -404,10 +432,9 @@
if (static_data == nullptr) {
return nullptr;
}
- for (std::unique_ptr<EncodedArrayItem>& existing_array_item : EncodedArrayItems()) {
- if (existing_array_item->GetOffset() == offset) {
- return existing_array_item.get();
- }
+ auto found_encoded_array_item = EncodedArrayItems().find(offset);
+ if (found_encoded_array_item != EncodedArrayItems().end()) {
+ return found_encoded_array_item->second.get();
}
uint32_t size = DecodeUnsignedLeb128(&static_data);
EncodedValueVector* values = new EncodedValueVector();
@@ -422,10 +449,9 @@
AnnotationItem* Collections::CreateAnnotationItem(const DexFile::AnnotationItem* annotation,
uint32_t offset) {
- for (std::unique_ptr<AnnotationItem>& existing_annotation_item : AnnotationItems()) {
- if (existing_annotation_item->GetOffset() == offset) {
- return existing_annotation_item.get();
- }
+ auto found_annotation_item = AnnotationItems().find(offset);
+ if (found_annotation_item != AnnotationItems().end()) {
+ return found_annotation_item->second.get();
}
uint8_t visibility = annotation->visibility_;
const uint8_t* annotation_data = annotation->annotation_;
@@ -444,10 +470,9 @@
if (disk_annotations_item.size_ == 0 && offset == 0) {
return nullptr;
}
- for (std::unique_ptr<AnnotationSetItem>& existing_anno_set_item : AnnotationSetItems()) {
- if (existing_anno_set_item->GetOffset() == offset) {
- return existing_anno_set_item.get();
- }
+ auto found_anno_set_item = AnnotationSetItems().find(offset);
+ if (found_anno_set_item != AnnotationSetItems().end()) {
+ return found_anno_set_item->second.get();
}
std::vector<AnnotationItem*>* items = new std::vector<AnnotationItem*>();
for (uint32_t i = 0; i < disk_annotations_item.size_; ++i) {
@@ -467,10 +492,9 @@
AnnotationsDirectoryItem* Collections::CreateAnnotationsDirectoryItem(const DexFile& dex_file,
const DexFile::AnnotationsDirectoryItem* disk_annotations_item, uint32_t offset) {
- for (std::unique_ptr<AnnotationsDirectoryItem>& anno_dir_item : AnnotationsDirectoryItems()) {
- if (anno_dir_item->GetOffset() == offset) {
- return anno_dir_item.get();
- }
+ auto found_anno_dir_item = AnnotationsDirectoryItems().find(offset);
+ if (found_anno_dir_item != AnnotationsDirectoryItems().end()) {
+ return found_anno_dir_item->second.get();
}
const DexFile::AnnotationSetItem* class_set_item =
dex_file.GetClassAnnotationSet(disk_annotations_item);
@@ -535,11 +559,9 @@
const DexFile& dex_file, MethodId* method_id,
const DexFile::AnnotationSetRefList* annotation_set_ref_list, uint32_t offset) {
AnnotationSetRefList* set_ref_list = nullptr;
- for (std::unique_ptr<AnnotationSetRefList>& existing_set_ref_list : AnnotationSetRefLists()) {
- if (existing_set_ref_list->GetOffset() == offset) {
- set_ref_list = existing_set_ref_list.get();
- break;
- }
+ auto found_set_ref_list = AnnotationSetRefLists().find(offset);
+ if (found_set_ref_list != AnnotationSetRefLists().end()) {
+ set_ref_list = found_set_ref_list->second.get();
}
if (set_ref_list == nullptr) {
std::vector<AnnotationSetItem*>* annotations = new std::vector<AnnotationSetItem*>();
@@ -597,8 +619,8 @@
bool catch_all = false;
TypeAddrPairVector* addr_pairs = new TypeAddrPairVector();
for (CatchHandlerIterator it(disk_code_item, *disk_try_item); it.HasNext(); it.Next()) {
- const uint16_t type_index = it.GetHandlerTypeIndex();
- const TypeId* type_id = GetTypeIdOrNullPtr(type_index);
+ const dex::TypeIndex type_index = it.GetHandlerTypeIndex();
+ const TypeId* type_id = GetTypeIdOrNullPtr(type_index.index_);
catch_all |= type_id == nullptr;
addr_pairs->push_back(std::unique_ptr<const TypeAddrPair>(
new TypeAddrPair(type_id, it.GetHandlerAddress())));
@@ -610,9 +632,10 @@
tries->push_back(std::unique_ptr<const TryItem>(try_item));
}
}
- // TODO: Calculate the size of the code item.
+ uint32_t size = GetCodeItemSize(dex_file, disk_code_item);
CodeItem* code_item = new CodeItem(
registers_size, ins_size, outs_size, debug_info, insns_size, insns, tries, handler_list);
+ code_item->SetSize(size);
code_items_.AddItem(code_item, offset);
// Add "fixup" references to types, strings, methods, and fields.
// This is temporary, as we will probably want more detailed parsing of the
@@ -690,8 +713,8 @@
virtual_methods->push_back(
std::unique_ptr<MethodItem>(GenerateMethodItem(dex_file, cdii)));
}
- // TODO: Calculate the size of the class data.
class_data = new ClassData(static_fields, instance_fields, direct_methods, virtual_methods);
+ class_data->SetSize(cdii.EndDataPointer() - encoded_data);
class_datas_.AddItem(class_data, offset);
}
return class_data;
diff --git a/dexlayout/dex_ir.h b/dexlayout/dex_ir.h
index 38eb0b1..a2d1190 100644
--- a/dexlayout/dex_ir.h
+++ b/dexlayout/dex_ir.h
@@ -19,6 +19,7 @@
#ifndef ART_DEXLAYOUT_DEX_IR_H_
#define ART_DEXLAYOUT_DEX_IR_H_
+#include <map>
#include <vector>
#include <stdint.h>
@@ -98,34 +99,52 @@
};
// Collections become owners of the objects added by moving them into unique pointers.
-template<class T> class CollectionWithOffset {
+template<class T> class CollectionBase {
public:
- CollectionWithOffset() = default;
- std::vector<std::unique_ptr<T>>& Collection() { return collection_; }
- // Read-time support methods
- void AddItem(T* object, uint32_t offset) {
- object->SetOffset(offset);
- collection_.push_back(std::unique_ptr<T>(object));
- }
+ CollectionBase() = default;
+
+ uint32_t GetOffset() const { return offset_; }
+ void SetOffset(uint32_t new_offset) { offset_ = new_offset; }
+
+ private:
+ uint32_t offset_ = 0;
+
+ DISALLOW_COPY_AND_ASSIGN(CollectionBase);
+};
+
+template<class T> class CollectionVector : public CollectionBase<T> {
+ public:
+ CollectionVector() = default;
+
void AddIndexedItem(T* object, uint32_t offset, uint32_t index) {
object->SetOffset(offset);
object->SetIndex(index);
collection_.push_back(std::unique_ptr<T>(object));
}
- // Ordinary object insertion into collection.
- void Insert(T object ATTRIBUTE_UNUSED) {
- // TODO(sehr): add ordered insertion support.
- UNIMPLEMENTED(FATAL) << "Insertion not ready";
- }
- uint32_t GetOffset() const { return offset_; }
- void SetOffset(uint32_t new_offset) { offset_ = new_offset; }
uint32_t Size() const { return collection_.size(); }
+ std::vector<std::unique_ptr<T>>& Collection() { return collection_; }
private:
std::vector<std::unique_ptr<T>> collection_;
- uint32_t offset_ = 0;
- DISALLOW_COPY_AND_ASSIGN(CollectionWithOffset);
+ DISALLOW_COPY_AND_ASSIGN(CollectionVector);
+};
+
+template<class T> class CollectionMap : public CollectionBase<T> {
+ public:
+ CollectionMap() = default;
+
+ void AddItem(T* object, uint32_t offset) {
+ object->SetOffset(offset);
+ collection_.emplace(offset, std::unique_ptr<T>(object));
+ }
+ uint32_t Size() const { return collection_.size(); }
+ std::map<uint32_t, std::unique_ptr<T>>& Collection() { return collection_; }
+
+ private:
+ std::map<uint32_t, std::unique_ptr<T>> collection_;
+
+ DISALLOW_COPY_AND_ASSIGN(CollectionMap);
};
class Collections {
@@ -138,22 +157,23 @@
std::vector<std::unique_ptr<FieldId>>& FieldIds() { return field_ids_.Collection(); }
std::vector<std::unique_ptr<MethodId>>& MethodIds() { return method_ids_.Collection(); }
std::vector<std::unique_ptr<ClassDef>>& ClassDefs() { return class_defs_.Collection(); }
- std::vector<std::unique_ptr<StringData>>& StringDatas() { return string_datas_.Collection(); }
- std::vector<std::unique_ptr<TypeList>>& TypeLists() { return type_lists_.Collection(); }
- std::vector<std::unique_ptr<EncodedArrayItem>>& EncodedArrayItems()
+ std::map<uint32_t, std::unique_ptr<StringData>>& StringDatas()
+ { return string_datas_.Collection(); }
+ std::map<uint32_t, std::unique_ptr<TypeList>>& TypeLists() { return type_lists_.Collection(); }
+ std::map<uint32_t, std::unique_ptr<EncodedArrayItem>>& EncodedArrayItems()
{ return encoded_array_items_.Collection(); }
- std::vector<std::unique_ptr<AnnotationItem>>& AnnotationItems()
+ std::map<uint32_t, std::unique_ptr<AnnotationItem>>& AnnotationItems()
{ return annotation_items_.Collection(); }
- std::vector<std::unique_ptr<AnnotationSetItem>>& AnnotationSetItems()
+ std::map<uint32_t, std::unique_ptr<AnnotationSetItem>>& AnnotationSetItems()
{ return annotation_set_items_.Collection(); }
- std::vector<std::unique_ptr<AnnotationSetRefList>>& AnnotationSetRefLists()
+ std::map<uint32_t, std::unique_ptr<AnnotationSetRefList>>& AnnotationSetRefLists()
{ return annotation_set_ref_lists_.Collection(); }
- std::vector<std::unique_ptr<AnnotationsDirectoryItem>>& AnnotationsDirectoryItems()
+ std::map<uint32_t, std::unique_ptr<AnnotationsDirectoryItem>>& AnnotationsDirectoryItems()
{ return annotations_directory_items_.Collection(); }
- std::vector<std::unique_ptr<DebugInfoItem>>& DebugInfoItems()
+ std::map<uint32_t, std::unique_ptr<DebugInfoItem>>& DebugInfoItems()
{ return debug_info_items_.Collection(); }
- std::vector<std::unique_ptr<CodeItem>>& CodeItems() { return code_items_.Collection(); }
- std::vector<std::unique_ptr<ClassData>>& ClassDatas() { return class_datas_.Collection(); }
+ std::map<uint32_t, std::unique_ptr<CodeItem>>& CodeItems() { return code_items_.Collection(); }
+ std::map<uint32_t, std::unique_ptr<ClassData>>& ClassDatas() { return class_datas_.Collection(); }
void CreateStringId(const DexFile& dex_file, uint32_t i);
void CreateTypeId(const DexFile& dex_file, uint32_t i);
@@ -204,7 +224,7 @@
uint32_t DebugInfoItemsOffset() const { return debug_info_items_.GetOffset(); }
uint32_t CodeItemsOffset() const { return code_items_.GetOffset(); }
uint32_t ClassDatasOffset() const { return class_datas_.GetOffset(); }
- uint32_t MapItemOffset() const { return map_item_offset_; }
+ uint32_t MapListOffset() const { return map_list_offset_; }
void SetStringIdsOffset(uint32_t new_offset) { string_ids_.SetOffset(new_offset); }
void SetTypeIdsOffset(uint32_t new_offset) { type_ids_.SetOffset(new_offset); }
@@ -226,7 +246,7 @@
void SetDebugInfoItemsOffset(uint32_t new_offset) { debug_info_items_.SetOffset(new_offset); }
void SetCodeItemsOffset(uint32_t new_offset) { code_items_.SetOffset(new_offset); }
void SetClassDatasOffset(uint32_t new_offset) { class_datas_.SetOffset(new_offset); }
- void SetMapItemOffset(uint32_t new_offset) { map_item_offset_ = new_offset; }
+ void SetMapListOffset(uint32_t new_offset) { map_list_offset_ = new_offset; }
uint32_t StringIdsSize() const { return string_ids_.Size(); }
uint32_t TypeIdsSize() const { return type_ids_.Size(); }
@@ -254,25 +274,25 @@
const DexFile::AnnotationSetRefList* annotation_set_ref_list, uint32_t offset);
MethodItem* GenerateMethodItem(const DexFile& dex_file, ClassDataItemIterator& cdii);
- CollectionWithOffset<StringId> string_ids_;
- CollectionWithOffset<TypeId> type_ids_;
- CollectionWithOffset<ProtoId> proto_ids_;
- CollectionWithOffset<FieldId> field_ids_;
- CollectionWithOffset<MethodId> method_ids_;
- CollectionWithOffset<ClassDef> class_defs_;
+ CollectionVector<StringId> string_ids_;
+ CollectionVector<TypeId> type_ids_;
+ CollectionVector<ProtoId> proto_ids_;
+ CollectionVector<FieldId> field_ids_;
+ CollectionVector<MethodId> method_ids_;
+ CollectionVector<ClassDef> class_defs_;
- CollectionWithOffset<StringData> string_datas_;
- CollectionWithOffset<TypeList> type_lists_;
- CollectionWithOffset<EncodedArrayItem> encoded_array_items_;
- CollectionWithOffset<AnnotationItem> annotation_items_;
- CollectionWithOffset<AnnotationSetItem> annotation_set_items_;
- CollectionWithOffset<AnnotationSetRefList> annotation_set_ref_lists_;
- CollectionWithOffset<AnnotationsDirectoryItem> annotations_directory_items_;
- CollectionWithOffset<DebugInfoItem> debug_info_items_;
- CollectionWithOffset<CodeItem> code_items_;
- CollectionWithOffset<ClassData> class_datas_;
+ CollectionMap<StringData> string_datas_;
+ CollectionMap<TypeList> type_lists_;
+ CollectionMap<EncodedArrayItem> encoded_array_items_;
+ CollectionMap<AnnotationItem> annotation_items_;
+ CollectionMap<AnnotationSetItem> annotation_set_items_;
+ CollectionMap<AnnotationSetRefList> annotation_set_ref_lists_;
+ CollectionMap<AnnotationsDirectoryItem> annotations_directory_items_;
+ CollectionMap<DebugInfoItem> debug_info_items_;
+ CollectionMap<CodeItem> code_items_;
+ CollectionMap<ClassData> class_datas_;
- uint32_t map_item_offset_ = 0;
+ uint32_t map_list_offset_ = 0;
DISALLOW_COPY_AND_ASSIGN(Collections);
};
@@ -539,20 +559,20 @@
class MethodItem : public Item {
public:
- MethodItem(uint32_t access_flags, const MethodId* method_id, const CodeItem* code)
+ MethodItem(uint32_t access_flags, const MethodId* method_id, CodeItem* code)
: access_flags_(access_flags), method_id_(method_id), code_(code) { }
~MethodItem() OVERRIDE { }
uint32_t GetAccessFlags() const { return access_flags_; }
const MethodId* GetMethodId() const { return method_id_; }
- const CodeItem* GetCodeItem() const { return code_; }
+ CodeItem* GetCodeItem() { return code_; }
void Accept(AbstractDispatcher* dispatch) { dispatch->Dispatch(this); }
private:
uint32_t access_flags_;
const MethodId* method_id_;
- const CodeItem* code_; // This can be nullptr.
+ CodeItem* code_; // This can be nullptr.
DISALLOW_COPY_AND_ASSIGN(MethodItem);
};
diff --git a/dexlayout/dex_ir_builder.cc b/dexlayout/dex_ir_builder.cc
index 68ff2a2..d0c5bf9 100644
--- a/dexlayout/dex_ir_builder.cc
+++ b/dexlayout/dex_ir_builder.cc
@@ -71,7 +71,7 @@
collections.CreateClassDef(dex_file, i);
}
// MapItem.
- collections.SetMapItemOffset(disk_header.map_off_);
+ collections.SetMapListOffset(disk_header.map_off_);
CheckAndSetRemainingOffsets(dex_file, &collections);
diff --git a/dexlayout/dex_visualize.cc b/dexlayout/dex_visualize.cc
index 7c55659..02274b2 100644
--- a/dexlayout/dex_visualize.cc
+++ b/dexlayout/dex_visualize.cc
@@ -263,11 +263,13 @@
DumpStringId(method_id->Name(), class_index);
}
- void DumpMethodItem(const dex_ir::MethodItem* method, const DexFile* dex_file, int class_index) {
- if (profile_info_ != nullptr) {
+ void DumpMethodItem(dex_ir::MethodItem* method,
+ const DexFile* dex_file,
+ int class_index,
+ ProfileCompilationInfo* profile_info) {
+ if (profile_info != nullptr) {
uint32_t method_idx = method->GetMethodId()->GetIndex();
- MethodReference mr(dex_file, method_idx);
- if (!profile_info_->ContainsMethod(mr)) {
+ if (!profile_info->ContainsMethod(MethodReference(dex_file, method_idx))) {
return;
}
}
@@ -344,14 +346,17 @@
* Dumps a gnuplot data file showing the parts of the dex_file that belong to each class.
* If profiling information is present, it dumps only those classes that are marked as hot.
*/
-void VisualizeDexLayout(dex_ir::Header* header, const DexFile* dex_file, size_t dex_file_index) {
+void VisualizeDexLayout(dex_ir::Header* header,
+ const DexFile* dex_file,
+ size_t dex_file_index,
+ ProfileCompilationInfo* profile_info) {
std::unique_ptr<Dumper> dumper(new Dumper(header->GetCollections(), dex_file_index));
const uint32_t class_defs_size = header->GetCollections().ClassDefsSize();
for (uint32_t class_index = 0; class_index < class_defs_size; class_index++) {
dex_ir::ClassDef* class_def = header->GetCollections().GetClassDef(class_index);
- uint16_t type_idx = class_def->ClassType()->GetIndex();
- if (profile_info_ != nullptr && !profile_info_->ContainsClass(*dex_file, type_idx)) {
+ dex::TypeIndex type_idx(class_def->ClassType()->GetIndex());
+ if (profile_info != nullptr && !profile_info->ContainsClass(*dex_file, type_idx)) {
continue;
}
dumper->DumpAddressRange(class_def, class_index);
@@ -384,12 +389,12 @@
}
if (class_data->DirectMethods()) {
for (auto& method_item : *class_data->DirectMethods()) {
- dumper->DumpMethodItem(method_item.get(), dex_file, class_index);
+ dumper->DumpMethodItem(method_item.get(), dex_file, class_index, profile_info);
}
}
if (class_data->VirtualMethods()) {
for (auto& method_item : *class_data->VirtualMethods()) {
- dumper->DumpMethodItem(method_item.get(), dex_file, class_index);
+ dumper->DumpMethodItem(method_item.get(), dex_file, class_index, profile_info);
}
}
}
diff --git a/dexlayout/dex_visualize.h b/dexlayout/dex_visualize.h
index b1d2ed7..09f8306 100644
--- a/dexlayout/dex_visualize.h
+++ b/dexlayout/dex_visualize.h
@@ -28,11 +28,15 @@
namespace art {
class DexFile;
+class ProfileCompilationInfo;
namespace dex_ir {
class Header;
} // namespace dex_ir
-void VisualizeDexLayout(dex_ir::Header* header, const DexFile* dex_file, size_t dex_file_index);
+void VisualizeDexLayout(dex_ir::Header* header,
+ const DexFile* dex_file,
+ size_t dex_file_index,
+ ProfileCompilationInfo* profile_info);
} // namespace art
diff --git a/dexlayout/dex_writer.cc b/dexlayout/dex_writer.cc
index dba5da0..7ffa38b 100644
--- a/dexlayout/dex_writer.cc
+++ b/dexlayout/dex_writer.cc
@@ -104,7 +104,9 @@
}
size_t DexWriter::Write(const void* buffer, size_t length, size_t offset) {
- return dex_file_->PwriteFully(buffer, length, offset) ? length : 0;
+ DCHECK_LE(offset + length, mem_map_->Size());
+ memcpy(mem_map_->Begin() + offset, buffer, length);
+ return length;
}
size_t DexWriter::WriteSleb128(uint32_t value, size_t offset) {
@@ -236,12 +238,13 @@
void DexWriter::WriteStrings() {
uint32_t string_data_off[1];
- for (std::unique_ptr<dex_ir::StringId>& string_id : header_.GetCollections().StringIds()) {
+ for (std::unique_ptr<dex_ir::StringId>& string_id : header_->GetCollections().StringIds()) {
string_data_off[0] = string_id->DataItem()->GetOffset();
Write(string_data_off, string_id->GetSize(), string_id->GetOffset());
}
- for (std::unique_ptr<dex_ir::StringData>& string_data : header_.GetCollections().StringDatas()) {
+ for (auto& string_data_pair : header_->GetCollections().StringDatas()) {
+ std::unique_ptr<dex_ir::StringData>& string_data = string_data_pair.second;
uint32_t offset = string_data->GetOffset();
offset += WriteUleb128(CountModifiedUtf8Chars(string_data->Data()), offset);
Write(string_data->Data(), strlen(string_data->Data()), offset);
@@ -250,7 +253,7 @@
void DexWriter::WriteTypes() {
uint32_t descriptor_idx[1];
- for (std::unique_ptr<dex_ir::TypeId>& type_id : header_.GetCollections().TypeIds()) {
+ for (std::unique_ptr<dex_ir::TypeId>& type_id : header_->GetCollections().TypeIds()) {
descriptor_idx[0] = type_id->GetStringId()->GetIndex();
Write(descriptor_idx, type_id->GetSize(), type_id->GetOffset());
}
@@ -259,7 +262,8 @@
void DexWriter::WriteTypeLists() {
uint32_t size[1];
uint16_t list[1];
- for (std::unique_ptr<dex_ir::TypeList>& type_list : header_.GetCollections().TypeLists()) {
+ for (auto& type_list_pair : header_->GetCollections().TypeLists()) {
+ std::unique_ptr<dex_ir::TypeList>& type_list = type_list_pair.second;
size[0] = type_list->GetTypeList()->size();
uint32_t offset = type_list->GetOffset();
offset += Write(size, sizeof(uint32_t), offset);
@@ -272,7 +276,7 @@
void DexWriter::WriteProtos() {
uint32_t buffer[3];
- for (std::unique_ptr<dex_ir::ProtoId>& proto_id : header_.GetCollections().ProtoIds()) {
+ for (std::unique_ptr<dex_ir::ProtoId>& proto_id : header_->GetCollections().ProtoIds()) {
buffer[0] = proto_id->Shorty()->GetIndex();
buffer[1] = proto_id->ReturnType()->GetIndex();
buffer[2] = proto_id->Parameters() == nullptr ? 0 : proto_id->Parameters()->GetOffset();
@@ -282,7 +286,7 @@
void DexWriter::WriteFields() {
uint16_t buffer[4];
- for (std::unique_ptr<dex_ir::FieldId>& field_id : header_.GetCollections().FieldIds()) {
+ for (std::unique_ptr<dex_ir::FieldId>& field_id : header_->GetCollections().FieldIds()) {
buffer[0] = field_id->Class()->GetIndex();
buffer[1] = field_id->Type()->GetIndex();
buffer[2] = field_id->Name()->GetIndex();
@@ -293,7 +297,7 @@
void DexWriter::WriteMethods() {
uint16_t buffer[4];
- for (std::unique_ptr<dex_ir::MethodId>& method_id : header_.GetCollections().MethodIds()) {
+ for (std::unique_ptr<dex_ir::MethodId>& method_id : header_->GetCollections().MethodIds()) {
buffer[0] = method_id->Class()->GetIndex();
buffer[1] = method_id->Proto()->GetIndex();
buffer[2] = method_id->Name()->GetIndex();
@@ -303,16 +307,16 @@
}
void DexWriter::WriteEncodedArrays() {
- for (std::unique_ptr<dex_ir::EncodedArrayItem>& encoded_array :
- header_.GetCollections().EncodedArrayItems()) {
+ for (auto& encoded_array_pair : header_->GetCollections().EncodedArrayItems()) {
+ std::unique_ptr<dex_ir::EncodedArrayItem>& encoded_array = encoded_array_pair.second;
WriteEncodedArray(encoded_array->GetEncodedValues(), encoded_array->GetOffset());
}
}
void DexWriter::WriteAnnotations() {
uint8_t visibility[1];
- for (std::unique_ptr<dex_ir::AnnotationItem>& annotation :
- header_.GetCollections().AnnotationItems()) {
+ for (auto& annotation_pair : header_->GetCollections().AnnotationItems()) {
+ std::unique_ptr<dex_ir::AnnotationItem>& annotation = annotation_pair.second;
visibility[0] = annotation->GetVisibility();
size_t offset = annotation->GetOffset();
offset += Write(visibility, sizeof(uint8_t), offset);
@@ -323,8 +327,8 @@
void DexWriter::WriteAnnotationSets() {
uint32_t size[1];
uint32_t annotation_off[1];
- for (std::unique_ptr<dex_ir::AnnotationSetItem>& annotation_set :
- header_.GetCollections().AnnotationSetItems()) {
+ for (auto& annotation_set_pair : header_->GetCollections().AnnotationSetItems()) {
+ std::unique_ptr<dex_ir::AnnotationSetItem>& annotation_set = annotation_set_pair.second;
size[0] = annotation_set->GetItems()->size();
size_t offset = annotation_set->GetOffset();
offset += Write(size, sizeof(uint32_t), offset);
@@ -338,8 +342,8 @@
void DexWriter::WriteAnnotationSetRefs() {
uint32_t size[1];
uint32_t annotations_off[1];
- for (std::unique_ptr<dex_ir::AnnotationSetRefList>& annotation_set_ref :
- header_.GetCollections().AnnotationSetRefLists()) {
+ for (auto& anno_set_ref_pair : header_->GetCollections().AnnotationSetRefLists()) {
+ std::unique_ptr<dex_ir::AnnotationSetRefList>& annotation_set_ref = anno_set_ref_pair.second;
size[0] = annotation_set_ref->GetItems()->size();
size_t offset = annotation_set_ref->GetOffset();
offset += Write(size, sizeof(uint32_t), offset);
@@ -353,8 +357,9 @@
void DexWriter::WriteAnnotationsDirectories() {
uint32_t directory_buffer[4];
uint32_t annotation_buffer[2];
- for (std::unique_ptr<dex_ir::AnnotationsDirectoryItem>& annotations_directory :
- header_.GetCollections().AnnotationsDirectoryItems()) {
+ for (auto& annotations_directory_pair : header_->GetCollections().AnnotationsDirectoryItems()) {
+ std::unique_ptr<dex_ir::AnnotationsDirectoryItem>& annotations_directory =
+ annotations_directory_pair.second;
directory_buffer[0] = annotations_directory->GetClassAnnotation() == nullptr ? 0 :
annotations_directory->GetClassAnnotation()->GetOffset();
directory_buffer[1] = annotations_directory->GetFieldAnnotations() == nullptr ? 0 :
@@ -393,15 +398,17 @@
}
void DexWriter::WriteDebugInfoItems() {
- for (std::unique_ptr<dex_ir::DebugInfoItem>& info : header_.GetCollections().DebugInfoItems()) {
- Write(info->GetDebugInfo(), info->GetDebugInfoSize(), info->GetOffset());
+ for (auto& debug_info_pair : header_->GetCollections().DebugInfoItems()) {
+ std::unique_ptr<dex_ir::DebugInfoItem>& debug_info = debug_info_pair.second;
+ Write(debug_info->GetDebugInfo(), debug_info->GetDebugInfoSize(), debug_info->GetOffset());
}
}
void DexWriter::WriteCodeItems() {
uint16_t uint16_buffer[4];
uint32_t uint32_buffer[2];
- for (std::unique_ptr<dex_ir::CodeItem>& code_item : header_.GetCollections().CodeItems()) {
+ for (auto& code_item_pair : header_->GetCollections().CodeItems()) {
+ std::unique_ptr<dex_ir::CodeItem>& code_item = code_item_pair.second;
uint16_buffer[0] = code_item->RegistersSize();
uint16_buffer[1] = code_item->InsSize();
uint16_buffer[2] = code_item->OutsSize();
@@ -446,7 +453,7 @@
void DexWriter::WriteClasses() {
uint32_t class_def_buffer[8];
- for (std::unique_ptr<dex_ir::ClassDef>& class_def : header_.GetCollections().ClassDefs()) {
+ for (std::unique_ptr<dex_ir::ClassDef>& class_def : header_->GetCollections().ClassDefs()) {
class_def_buffer[0] = class_def->ClassType()->GetIndex();
class_def_buffer[1] = class_def->GetAccessFlags();
class_def_buffer[2] = class_def->Superclass() == nullptr ? DexFile::kDexNoIndex :
@@ -464,7 +471,8 @@
Write(class_def_buffer, class_def->GetSize(), offset);
}
- for (std::unique_ptr<dex_ir::ClassData>& class_data : header_.GetCollections().ClassDatas()) {
+ for (auto& class_data_pair : header_->GetCollections().ClassDatas()) {
+ std::unique_ptr<dex_ir::ClassData>& class_data = class_data_pair.second;
size_t offset = class_data->GetOffset();
offset += WriteUleb128(class_data->StaticFields()->size(), offset);
offset += WriteUleb128(class_data->InstanceFields()->size(), offset);
@@ -491,7 +499,7 @@
};
void DexWriter::WriteMapItem() {
- dex_ir::Collections& collection = header_.GetCollections();
+ dex_ir::Collections& collection = header_->GetCollections();
std::priority_queue<MapItemContainer> queue;
// Header and index section.
@@ -522,7 +530,7 @@
}
// Data section.
- queue.push(MapItemContainer(DexFile::kDexTypeMapList, 1, collection.MapItemOffset()));
+ queue.push(MapItemContainer(DexFile::kDexTypeMapList, 1, collection.MapListOffset()));
if (collection.TypeListsSize() != 0) {
queue.push(MapItemContainer(DexFile::kDexTypeTypeList, collection.TypeListsSize(),
collection.TypeListsOffset()));
@@ -564,7 +572,7 @@
collection.AnnotationsDirectoryItemsSize(), collection.AnnotationsDirectoryItemsOffset()));
}
- uint32_t offset = collection.MapItemOffset();
+ uint32_t offset = collection.MapListOffset();
uint16_t uint16_buffer[2];
uint32_t uint32_buffer[2];
uint16_buffer[1] = 0;
@@ -583,19 +591,19 @@
void DexWriter::WriteHeader() {
uint32_t buffer[20];
- dex_ir::Collections& collections = header_.GetCollections();
+ dex_ir::Collections& collections = header_->GetCollections();
size_t offset = 0;
- offset += Write(header_.Magic(), 8 * sizeof(uint8_t), offset);
- buffer[0] = header_.Checksum();
+ offset += Write(header_->Magic(), 8 * sizeof(uint8_t), offset);
+ buffer[0] = header_->Checksum();
offset += Write(buffer, sizeof(uint32_t), offset);
- offset += Write(header_.Signature(), 20 * sizeof(uint8_t), offset);
- uint32_t file_size = header_.FileSize();
+ offset += Write(header_->Signature(), 20 * sizeof(uint8_t), offset);
+ uint32_t file_size = header_->FileSize();
buffer[0] = file_size;
- buffer[1] = header_.GetSize();
- buffer[2] = header_.EndianTag();
- buffer[3] = header_.LinkSize();
- buffer[4] = header_.LinkOffset();
- buffer[5] = collections.MapItemOffset();
+ buffer[1] = header_->GetSize();
+ buffer[2] = header_->EndianTag();
+ buffer[3] = header_->LinkSize();
+ buffer[4] = header_->LinkOffset();
+ buffer[5] = collections.MapListOffset();
buffer[6] = collections.StringIdsSize();
buffer[7] = collections.StringIdsOffset();
buffer[8] = collections.TypeIdsSize();
@@ -617,12 +625,7 @@
Write(buffer, 20 * sizeof(uint32_t), offset);
}
-void DexWriter::WriteFile() {
- if (dex_file_.get() == nullptr) {
- fprintf(stderr, "Can't open output dex file\n");
- return;
- }
-
+void DexWriter::WriteMemMap() {
WriteStrings();
WriteTypes();
WriteTypeLists();
@@ -641,8 +644,9 @@
WriteHeader();
}
-void DexWriter::OutputDexFile(dex_ir::Header& header, const char* file_name) {
- (new DexWriter(header, file_name))->WriteFile();
+void DexWriter::Output(dex_ir::Header* header, MemMap* mem_map) {
+ DexWriter dex_writer(header, mem_map);
+ dex_writer.WriteMemMap();
}
} // namespace art
diff --git a/dexlayout/dex_writer.h b/dexlayout/dex_writer.h
index 9104295..fb76e5c 100644
--- a/dexlayout/dex_writer.h
+++ b/dexlayout/dex_writer.h
@@ -21,19 +21,19 @@
#include "base/unix_file/fd_file.h"
#include "dex_ir.h"
+#include "mem_map.h"
#include "os.h"
namespace art {
class DexWriter {
public:
- DexWriter(dex_ir::Header& header, const char* file_name) : header_(header),
- dex_file_(OS::CreateEmptyFileWriteOnly(file_name)) { }
+ DexWriter(dex_ir::Header* header, MemMap* mem_map) : header_(header), mem_map_(mem_map) { }
- static void OutputDexFile(dex_ir::Header& header, const char* file_name);
+ static void Output(dex_ir::Header* header, MemMap* mem_map);
private:
- void WriteFile();
+ void WriteMemMap();
size_t Write(const void* buffer, size_t length, size_t offset);
size_t WriteSleb128(uint32_t value, size_t offset);
@@ -62,13 +62,12 @@
void WriteMapItem();
void WriteHeader();
- dex_ir::Header& header_;
- std::unique_ptr<File> dex_file_;
+ dex_ir::Header* const header_;
+ MemMap* const mem_map_;
DISALLOW_COPY_AND_ASSIGN(DexWriter);
};
-
} // namespace art
#endif // ART_DEXLAYOUT_DEX_WRITER_H_
diff --git a/dexlayout/dexlayout.cc b/dexlayout/dexlayout.cc
index aa80655..cac6090 100644
--- a/dexlayout/dexlayout.cc
+++ b/dexlayout/dexlayout.cc
@@ -30,32 +30,21 @@
#include <sstream>
#include <vector>
-#include "base/stringprintf.h"
+#include "android-base/stringprintf.h"
+
#include "dex_ir_builder.h"
#include "dex_file-inl.h"
#include "dex_instruction-inl.h"
#include "dex_visualize.h"
#include "dex_writer.h"
#include "jit/offline_profiling_info.h"
+#include "mem_map.h"
#include "os.h"
#include "utils.h"
namespace art {
-/*
- * Options parsed in main driver.
- */
-struct Options options_;
-
-/*
- * Output file. Defaults to stdout.
- */
-FILE* out_file_ = stdout;
-
-/*
- * Profile information file.
- */
-ProfileCompilationInfo* profile_info_ = nullptr;
+using android::base::StringPrintf;
/*
* Flags for use with createAccessFlagStr().
@@ -301,420 +290,65 @@
/*
* Dumps a string value with some escape characters.
*/
-static void DumpEscapedString(const char* p) {
- fputs("\"", out_file_);
+static void DumpEscapedString(const char* p, FILE* out_file) {
+ fputs("\"", out_file);
for (; *p; p++) {
switch (*p) {
case '\\':
- fputs("\\\\", out_file_);
+ fputs("\\\\", out_file);
break;
case '\"':
- fputs("\\\"", out_file_);
+ fputs("\\\"", out_file);
break;
case '\t':
- fputs("\\t", out_file_);
+ fputs("\\t", out_file);
break;
case '\n':
- fputs("\\n", out_file_);
+ fputs("\\n", out_file);
break;
case '\r':
- fputs("\\r", out_file_);
+ fputs("\\r", out_file);
break;
default:
- putc(*p, out_file_);
+ putc(*p, out_file);
} // switch
} // for
- fputs("\"", out_file_);
+ fputs("\"", out_file);
}
/*
* Dumps a string as an XML attribute value.
*/
-static void DumpXmlAttribute(const char* p) {
+static void DumpXmlAttribute(const char* p, FILE* out_file) {
for (; *p; p++) {
switch (*p) {
case '&':
- fputs("&", out_file_);
+ fputs("&", out_file);
break;
case '<':
- fputs("<", out_file_);
+ fputs("<", out_file);
break;
case '>':
- fputs(">", out_file_);
+ fputs(">", out_file);
break;
case '"':
- fputs(""", out_file_);
+ fputs(""", out_file);
break;
case '\t':
- fputs("	", out_file_);
+ fputs("	", out_file);
break;
case '\n':
- fputs("
", out_file_);
+ fputs("
", out_file);
break;
case '\r':
- fputs("
", out_file_);
+ fputs("
", out_file);
break;
default:
- putc(*p, out_file_);
+ putc(*p, out_file);
} // switch
} // for
}
-// Forward declare to resolve circular dependence.
-static void DumpEncodedValue(const dex_ir::EncodedValue* data);
-
-/*
- * Dumps encoded annotation.
- */
-static void DumpEncodedAnnotation(dex_ir::EncodedAnnotation* annotation) {
- fputs(annotation->GetType()->GetStringId()->Data(), out_file_);
- // Display all name=value pairs.
- for (auto& subannotation : *annotation->GetAnnotationElements()) {
- fputc(' ', out_file_);
- fputs(subannotation->GetName()->Data(), out_file_);
- fputc('=', out_file_);
- DumpEncodedValue(subannotation->GetValue());
- }
-}
-/*
- * Dumps encoded value.
- */
-static void DumpEncodedValue(const dex_ir::EncodedValue* data) {
- switch (data->Type()) {
- case DexFile::kDexAnnotationByte:
- fprintf(out_file_, "%" PRId8, data->GetByte());
- break;
- case DexFile::kDexAnnotationShort:
- fprintf(out_file_, "%" PRId16, data->GetShort());
- break;
- case DexFile::kDexAnnotationChar:
- fprintf(out_file_, "%" PRIu16, data->GetChar());
- break;
- case DexFile::kDexAnnotationInt:
- fprintf(out_file_, "%" PRId32, data->GetInt());
- break;
- case DexFile::kDexAnnotationLong:
- fprintf(out_file_, "%" PRId64, data->GetLong());
- break;
- case DexFile::kDexAnnotationFloat: {
- fprintf(out_file_, "%g", data->GetFloat());
- break;
- }
- case DexFile::kDexAnnotationDouble: {
- fprintf(out_file_, "%g", data->GetDouble());
- break;
- }
- case DexFile::kDexAnnotationString: {
- dex_ir::StringId* string_id = data->GetStringId();
- if (options_.output_format_ == kOutputPlain) {
- DumpEscapedString(string_id->Data());
- } else {
- DumpXmlAttribute(string_id->Data());
- }
- break;
- }
- case DexFile::kDexAnnotationType: {
- dex_ir::TypeId* type_id = data->GetTypeId();
- fputs(type_id->GetStringId()->Data(), out_file_);
- break;
- }
- case DexFile::kDexAnnotationField:
- case DexFile::kDexAnnotationEnum: {
- dex_ir::FieldId* field_id = data->GetFieldId();
- fputs(field_id->Name()->Data(), out_file_);
- break;
- }
- case DexFile::kDexAnnotationMethod: {
- dex_ir::MethodId* method_id = data->GetMethodId();
- fputs(method_id->Name()->Data(), out_file_);
- break;
- }
- case DexFile::kDexAnnotationArray: {
- fputc('{', out_file_);
- // Display all elements.
- for (auto& value : *data->GetEncodedArray()->GetEncodedValues()) {
- fputc(' ', out_file_);
- DumpEncodedValue(value.get());
- }
- fputs(" }", out_file_);
- break;
- }
- case DexFile::kDexAnnotationAnnotation: {
- DumpEncodedAnnotation(data->GetEncodedAnnotation());
- break;
- }
- case DexFile::kDexAnnotationNull:
- fputs("null", out_file_);
- break;
- case DexFile::kDexAnnotationBoolean:
- fputs(StrBool(data->GetBoolean()), out_file_);
- break;
- default:
- fputs("????", out_file_);
- break;
- } // switch
-}
-
-/*
- * Dumps the file header.
- */
-static void DumpFileHeader(dex_ir::Header* header) {
- char sanitized[8 * 2 + 1];
- dex_ir::Collections& collections = header->GetCollections();
- fprintf(out_file_, "DEX file header:\n");
- Asciify(sanitized, header->Magic(), 8);
- fprintf(out_file_, "magic : '%s'\n", sanitized);
- fprintf(out_file_, "checksum : %08x\n", header->Checksum());
- fprintf(out_file_, "signature : %02x%02x...%02x%02x\n",
- header->Signature()[0], header->Signature()[1],
- header->Signature()[DexFile::kSha1DigestSize - 2],
- header->Signature()[DexFile::kSha1DigestSize - 1]);
- fprintf(out_file_, "file_size : %d\n", header->FileSize());
- fprintf(out_file_, "header_size : %d\n", header->HeaderSize());
- fprintf(out_file_, "link_size : %d\n", header->LinkSize());
- fprintf(out_file_, "link_off : %d (0x%06x)\n",
- header->LinkOffset(), header->LinkOffset());
- fprintf(out_file_, "string_ids_size : %d\n", collections.StringIdsSize());
- fprintf(out_file_, "string_ids_off : %d (0x%06x)\n",
- collections.StringIdsOffset(), collections.StringIdsOffset());
- fprintf(out_file_, "type_ids_size : %d\n", collections.TypeIdsSize());
- fprintf(out_file_, "type_ids_off : %d (0x%06x)\n",
- collections.TypeIdsOffset(), collections.TypeIdsOffset());
- fprintf(out_file_, "proto_ids_size : %d\n", collections.ProtoIdsSize());
- fprintf(out_file_, "proto_ids_off : %d (0x%06x)\n",
- collections.ProtoIdsOffset(), collections.ProtoIdsOffset());
- fprintf(out_file_, "field_ids_size : %d\n", collections.FieldIdsSize());
- fprintf(out_file_, "field_ids_off : %d (0x%06x)\n",
- collections.FieldIdsOffset(), collections.FieldIdsOffset());
- fprintf(out_file_, "method_ids_size : %d\n", collections.MethodIdsSize());
- fprintf(out_file_, "method_ids_off : %d (0x%06x)\n",
- collections.MethodIdsOffset(), collections.MethodIdsOffset());
- fprintf(out_file_, "class_defs_size : %d\n", collections.ClassDefsSize());
- fprintf(out_file_, "class_defs_off : %d (0x%06x)\n",
- collections.ClassDefsOffset(), collections.ClassDefsOffset());
- fprintf(out_file_, "data_size : %d\n", header->DataSize());
- fprintf(out_file_, "data_off : %d (0x%06x)\n\n",
- header->DataOffset(), header->DataOffset());
-}
-
-/*
- * Dumps a class_def_item.
- */
-static void DumpClassDef(dex_ir::Header* header, int idx) {
- // General class information.
- dex_ir::ClassDef* class_def = header->GetCollections().GetClassDef(idx);
- fprintf(out_file_, "Class #%d header:\n", idx);
- fprintf(out_file_, "class_idx : %d\n", class_def->ClassType()->GetIndex());
- fprintf(out_file_, "access_flags : %d (0x%04x)\n",
- class_def->GetAccessFlags(), class_def->GetAccessFlags());
- uint32_t superclass_idx = class_def->Superclass() == nullptr ?
- DexFile::kDexNoIndex16 : class_def->Superclass()->GetIndex();
- fprintf(out_file_, "superclass_idx : %d\n", superclass_idx);
- fprintf(out_file_, "interfaces_off : %d (0x%06x)\n",
- class_def->InterfacesOffset(), class_def->InterfacesOffset());
- uint32_t source_file_offset = 0xffffffffU;
- if (class_def->SourceFile() != nullptr) {
- source_file_offset = class_def->SourceFile()->GetIndex();
- }
- fprintf(out_file_, "source_file_idx : %d\n", source_file_offset);
- uint32_t annotations_offset = 0;
- if (class_def->Annotations() != nullptr) {
- annotations_offset = class_def->Annotations()->GetOffset();
- }
- fprintf(out_file_, "annotations_off : %d (0x%06x)\n",
- annotations_offset, annotations_offset);
- if (class_def->GetClassData() == nullptr) {
- fprintf(out_file_, "class_data_off : %d (0x%06x)\n", 0, 0);
- } else {
- fprintf(out_file_, "class_data_off : %d (0x%06x)\n",
- class_def->GetClassData()->GetOffset(), class_def->GetClassData()->GetOffset());
- }
-
- // Fields and methods.
- dex_ir::ClassData* class_data = class_def->GetClassData();
- if (class_data != nullptr && class_data->StaticFields() != nullptr) {
- fprintf(out_file_, "static_fields_size : %zu\n", class_data->StaticFields()->size());
- } else {
- fprintf(out_file_, "static_fields_size : 0\n");
- }
- if (class_data != nullptr && class_data->InstanceFields() != nullptr) {
- fprintf(out_file_, "instance_fields_size: %zu\n", class_data->InstanceFields()->size());
- } else {
- fprintf(out_file_, "instance_fields_size: 0\n");
- }
- if (class_data != nullptr && class_data->DirectMethods() != nullptr) {
- fprintf(out_file_, "direct_methods_size : %zu\n", class_data->DirectMethods()->size());
- } else {
- fprintf(out_file_, "direct_methods_size : 0\n");
- }
- if (class_data != nullptr && class_data->VirtualMethods() != nullptr) {
- fprintf(out_file_, "virtual_methods_size: %zu\n", class_data->VirtualMethods()->size());
- } else {
- fprintf(out_file_, "virtual_methods_size: 0\n");
- }
- fprintf(out_file_, "\n");
-}
-
-/**
- * Dumps an annotation set item.
- */
-static void DumpAnnotationSetItem(dex_ir::AnnotationSetItem* set_item) {
- if (set_item == nullptr || set_item->GetItems()->size() == 0) {
- fputs(" empty-annotation-set\n", out_file_);
- return;
- }
- for (dex_ir::AnnotationItem* annotation : *set_item->GetItems()) {
- if (annotation == nullptr) {
- continue;
- }
- fputs(" ", out_file_);
- switch (annotation->GetVisibility()) {
- case DexFile::kDexVisibilityBuild: fputs("VISIBILITY_BUILD ", out_file_); break;
- case DexFile::kDexVisibilityRuntime: fputs("VISIBILITY_RUNTIME ", out_file_); break;
- case DexFile::kDexVisibilitySystem: fputs("VISIBILITY_SYSTEM ", out_file_); break;
- default: fputs("VISIBILITY_UNKNOWN ", out_file_); break;
- } // switch
- DumpEncodedAnnotation(annotation->GetAnnotation());
- fputc('\n', out_file_);
- }
-}
-
-/*
- * Dumps class annotations.
- */
-static void DumpClassAnnotations(dex_ir::Header* header, int idx) {
- dex_ir::ClassDef* class_def = header->GetCollections().GetClassDef(idx);
- dex_ir::AnnotationsDirectoryItem* annotations_directory = class_def->Annotations();
- if (annotations_directory == nullptr) {
- return; // none
- }
-
- fprintf(out_file_, "Class #%d annotations:\n", idx);
-
- dex_ir::AnnotationSetItem* class_set_item = annotations_directory->GetClassAnnotation();
- dex_ir::FieldAnnotationVector* fields = annotations_directory->GetFieldAnnotations();
- dex_ir::MethodAnnotationVector* methods = annotations_directory->GetMethodAnnotations();
- dex_ir::ParameterAnnotationVector* parameters = annotations_directory->GetParameterAnnotations();
-
- // Annotations on the class itself.
- if (class_set_item != nullptr) {
- fprintf(out_file_, "Annotations on class\n");
- DumpAnnotationSetItem(class_set_item);
- }
-
- // Annotations on fields.
- if (fields != nullptr) {
- for (auto& field : *fields) {
- const dex_ir::FieldId* field_id = field->GetFieldId();
- const uint32_t field_idx = field_id->GetIndex();
- const char* field_name = field_id->Name()->Data();
- fprintf(out_file_, "Annotations on field #%u '%s'\n", field_idx, field_name);
- DumpAnnotationSetItem(field->GetAnnotationSetItem());
- }
- }
-
- // Annotations on methods.
- if (methods != nullptr) {
- for (auto& method : *methods) {
- const dex_ir::MethodId* method_id = method->GetMethodId();
- const uint32_t method_idx = method_id->GetIndex();
- const char* method_name = method_id->Name()->Data();
- fprintf(out_file_, "Annotations on method #%u '%s'\n", method_idx, method_name);
- DumpAnnotationSetItem(method->GetAnnotationSetItem());
- }
- }
-
- // Annotations on method parameters.
- if (parameters != nullptr) {
- for (auto& parameter : *parameters) {
- const dex_ir::MethodId* method_id = parameter->GetMethodId();
- const uint32_t method_idx = method_id->GetIndex();
- const char* method_name = method_id->Name()->Data();
- fprintf(out_file_, "Annotations on method #%u '%s' parameters\n", method_idx, method_name);
- uint32_t j = 0;
- for (dex_ir::AnnotationSetItem* annotation : *parameter->GetAnnotations()->GetItems()) {
- fprintf(out_file_, "#%u\n", j);
- DumpAnnotationSetItem(annotation);
- ++j;
- }
- }
- }
-
- fputc('\n', out_file_);
-}
-
-/*
- * Dumps an interface that a class declares to implement.
- */
-static void DumpInterface(const dex_ir::TypeId* type_item, int i) {
- const char* interface_name = type_item->GetStringId()->Data();
- if (options_.output_format_ == kOutputPlain) {
- fprintf(out_file_, " #%d : '%s'\n", i, interface_name);
- } else {
- std::string dot(DescriptorToDotWrapper(interface_name));
- fprintf(out_file_, "<implements name=\"%s\">\n</implements>\n", dot.c_str());
- }
-}
-
-/*
- * Dumps the catches table associated with the code.
- */
-static void DumpCatches(const dex_ir::CodeItem* code) {
- const uint16_t tries_size = code->TriesSize();
-
- // No catch table.
- if (tries_size == 0) {
- fprintf(out_file_, " catches : (none)\n");
- return;
- }
-
- // Dump all table entries.
- fprintf(out_file_, " catches : %d\n", tries_size);
- std::vector<std::unique_ptr<const dex_ir::TryItem>>* tries = code->Tries();
- for (uint32_t i = 0; i < tries_size; i++) {
- const dex_ir::TryItem* try_item = (*tries)[i].get();
- const uint32_t start = try_item->StartAddr();
- const uint32_t end = start + try_item->InsnCount();
- fprintf(out_file_, " 0x%04x - 0x%04x\n", start, end);
- for (auto& handler : *try_item->GetHandlers()->GetHandlers()) {
- const dex_ir::TypeId* type_id = handler->GetTypeId();
- const char* descriptor = (type_id == nullptr) ? "<any>" : type_id->GetStringId()->Data();
- fprintf(out_file_, " %s -> 0x%04x\n", descriptor, handler->GetAddress());
- } // for
- } // for
-}
-
-/*
- * Dumps all positions table entries associated with the code.
- */
-static void DumpPositionInfo(const dex_ir::CodeItem* code) {
- dex_ir::DebugInfoItem* debug_info = code->DebugInfo();
- if (debug_info == nullptr) {
- return;
- }
- std::vector<std::unique_ptr<dex_ir::PositionInfo>>& positions = debug_info->GetPositionInfo();
- for (size_t i = 0; i < positions.size(); ++i) {
- fprintf(out_file_, " 0x%04x line=%d\n", positions[i]->address_, positions[i]->line_);
- }
-}
-
-/*
- * Dumps all locals table entries associated with the code.
- */
-static void DumpLocalInfo(const dex_ir::CodeItem* code) {
- dex_ir::DebugInfoItem* debug_info = code->DebugInfo();
- if (debug_info == nullptr) {
- return;
- }
- std::vector<std::unique_ptr<dex_ir::LocalInfo>>& locals = debug_info->GetLocalInfo();
- for (size_t i = 0; i < locals.size(); ++i) {
- dex_ir::LocalInfo* entry = locals[i].get();
- fprintf(out_file_, " 0x%04x - 0x%04x reg=%d %s %s %s\n",
- entry->start_address_, entry->end_address_, entry->reg_,
- entry->name_.c_str(), entry->descriptor_.c_str(), entry->signature_.c_str());
- }
-}
-
/*
* Helper for dumpInstruction(), which builds the string
* representation for the index in the given instruction.
@@ -723,11 +357,10 @@
static std::unique_ptr<char[]> IndexString(dex_ir::Header* header,
const Instruction* dec_insn,
size_t buf_size) {
- static const uint32_t kInvalidIndex = std::numeric_limits<uint32_t>::max();
std::unique_ptr<char[]> buf(new char[buf_size]);
// Determine index and width of the string.
uint32_t index = 0;
- uint32_t secondary_index = kInvalidIndex;
+ uint32_t secondary_index = DexFile::kDexNoIndex;
uint32_t width = 4;
switch (Instruction::FormatOf(dec_insn->Opcode())) {
// SOME NOT SUPPORTED:
@@ -756,7 +389,6 @@
index = dec_insn->VRegB();
secondary_index = dec_insn->VRegH();
width = 4;
- break;
default:
break;
} // switch
@@ -821,9 +453,6 @@
case Instruction::kIndexFieldOffset:
outSize = snprintf(buf.get(), buf_size, "[obj+%0*x]", width, index);
break;
- // SOME NOT SUPPORTED:
- // case Instruction::kIndexVaries:
- // case Instruction::kIndexInlineMethod:
case Instruction::kIndexMethodAndProtoRef: {
std::string method("<method?>");
std::string proto("<proto?>");
@@ -840,8 +469,11 @@
}
outSize = snprintf(buf.get(), buf_size, "%s, %s // method@%0*x, proto@%0*x",
method.c_str(), proto.c_str(), width, index, width, secondary_index);
- }
- break;
+ }
+ break;
+ // SOME NOT SUPPORTED:
+ // case Instruction::kIndexVaries:
+ // case Instruction::kIndexInlineMethod:
default:
outSize = snprintf(buf.get(), buf_size, "<?>");
break;
@@ -858,11 +490,365 @@
}
/*
+ * Dumps encoded annotation.
+ */
+void DexLayout::DumpEncodedAnnotation(dex_ir::EncodedAnnotation* annotation) {
+ fputs(annotation->GetType()->GetStringId()->Data(), out_file_);
+ // Display all name=value pairs.
+ for (auto& subannotation : *annotation->GetAnnotationElements()) {
+ fputc(' ', out_file_);
+ fputs(subannotation->GetName()->Data(), out_file_);
+ fputc('=', out_file_);
+ DumpEncodedValue(subannotation->GetValue());
+ }
+}
+/*
+ * Dumps encoded value.
+ */
+void DexLayout::DumpEncodedValue(const dex_ir::EncodedValue* data) {
+ switch (data->Type()) {
+ case DexFile::kDexAnnotationByte:
+ fprintf(out_file_, "%" PRId8, data->GetByte());
+ break;
+ case DexFile::kDexAnnotationShort:
+ fprintf(out_file_, "%" PRId16, data->GetShort());
+ break;
+ case DexFile::kDexAnnotationChar:
+ fprintf(out_file_, "%" PRIu16, data->GetChar());
+ break;
+ case DexFile::kDexAnnotationInt:
+ fprintf(out_file_, "%" PRId32, data->GetInt());
+ break;
+ case DexFile::kDexAnnotationLong:
+ fprintf(out_file_, "%" PRId64, data->GetLong());
+ break;
+ case DexFile::kDexAnnotationFloat: {
+ fprintf(out_file_, "%g", data->GetFloat());
+ break;
+ }
+ case DexFile::kDexAnnotationDouble: {
+ fprintf(out_file_, "%g", data->GetDouble());
+ break;
+ }
+ case DexFile::kDexAnnotationString: {
+ dex_ir::StringId* string_id = data->GetStringId();
+ if (options_.output_format_ == kOutputPlain) {
+ DumpEscapedString(string_id->Data(), out_file_);
+ } else {
+ DumpXmlAttribute(string_id->Data(), out_file_);
+ }
+ break;
+ }
+ case DexFile::kDexAnnotationType: {
+ dex_ir::TypeId* type_id = data->GetTypeId();
+ fputs(type_id->GetStringId()->Data(), out_file_);
+ break;
+ }
+ case DexFile::kDexAnnotationField:
+ case DexFile::kDexAnnotationEnum: {
+ dex_ir::FieldId* field_id = data->GetFieldId();
+ fputs(field_id->Name()->Data(), out_file_);
+ break;
+ }
+ case DexFile::kDexAnnotationMethod: {
+ dex_ir::MethodId* method_id = data->GetMethodId();
+ fputs(method_id->Name()->Data(), out_file_);
+ break;
+ }
+ case DexFile::kDexAnnotationArray: {
+ fputc('{', out_file_);
+ // Display all elements.
+ for (auto& value : *data->GetEncodedArray()->GetEncodedValues()) {
+ fputc(' ', out_file_);
+ DumpEncodedValue(value.get());
+ }
+ fputs(" }", out_file_);
+ break;
+ }
+ case DexFile::kDexAnnotationAnnotation: {
+ DumpEncodedAnnotation(data->GetEncodedAnnotation());
+ break;
+ }
+ case DexFile::kDexAnnotationNull:
+ fputs("null", out_file_);
+ break;
+ case DexFile::kDexAnnotationBoolean:
+ fputs(StrBool(data->GetBoolean()), out_file_);
+ break;
+ default:
+ fputs("????", out_file_);
+ break;
+ } // switch
+}
+
+/*
+ * Dumps the file header.
+ */
+void DexLayout::DumpFileHeader() {
+ char sanitized[8 * 2 + 1];
+ dex_ir::Collections& collections = header_->GetCollections();
+ fprintf(out_file_, "DEX file header:\n");
+ Asciify(sanitized, header_->Magic(), 8);
+ fprintf(out_file_, "magic : '%s'\n", sanitized);
+ fprintf(out_file_, "checksum : %08x\n", header_->Checksum());
+ fprintf(out_file_, "signature : %02x%02x...%02x%02x\n",
+ header_->Signature()[0], header_->Signature()[1],
+ header_->Signature()[DexFile::kSha1DigestSize - 2],
+ header_->Signature()[DexFile::kSha1DigestSize - 1]);
+ fprintf(out_file_, "file_size : %d\n", header_->FileSize());
+ fprintf(out_file_, "header_size : %d\n", header_->HeaderSize());
+ fprintf(out_file_, "link_size : %d\n", header_->LinkSize());
+ fprintf(out_file_, "link_off : %d (0x%06x)\n",
+ header_->LinkOffset(), header_->LinkOffset());
+ fprintf(out_file_, "string_ids_size : %d\n", collections.StringIdsSize());
+ fprintf(out_file_, "string_ids_off : %d (0x%06x)\n",
+ collections.StringIdsOffset(), collections.StringIdsOffset());
+ fprintf(out_file_, "type_ids_size : %d\n", collections.TypeIdsSize());
+ fprintf(out_file_, "type_ids_off : %d (0x%06x)\n",
+ collections.TypeIdsOffset(), collections.TypeIdsOffset());
+ fprintf(out_file_, "proto_ids_size : %d\n", collections.ProtoIdsSize());
+ fprintf(out_file_, "proto_ids_off : %d (0x%06x)\n",
+ collections.ProtoIdsOffset(), collections.ProtoIdsOffset());
+ fprintf(out_file_, "field_ids_size : %d\n", collections.FieldIdsSize());
+ fprintf(out_file_, "field_ids_off : %d (0x%06x)\n",
+ collections.FieldIdsOffset(), collections.FieldIdsOffset());
+ fprintf(out_file_, "method_ids_size : %d\n", collections.MethodIdsSize());
+ fprintf(out_file_, "method_ids_off : %d (0x%06x)\n",
+ collections.MethodIdsOffset(), collections.MethodIdsOffset());
+ fprintf(out_file_, "class_defs_size : %d\n", collections.ClassDefsSize());
+ fprintf(out_file_, "class_defs_off : %d (0x%06x)\n",
+ collections.ClassDefsOffset(), collections.ClassDefsOffset());
+ fprintf(out_file_, "data_size : %d\n", header_->DataSize());
+ fprintf(out_file_, "data_off : %d (0x%06x)\n\n",
+ header_->DataOffset(), header_->DataOffset());
+}
+
+/*
+ * Dumps a class_def_item.
+ */
+void DexLayout::DumpClassDef(int idx) {
+ // General class information.
+ dex_ir::ClassDef* class_def = header_->GetCollections().GetClassDef(idx);
+ fprintf(out_file_, "Class #%d header:\n", idx);
+ fprintf(out_file_, "class_idx : %d\n", class_def->ClassType()->GetIndex());
+ fprintf(out_file_, "access_flags : %d (0x%04x)\n",
+ class_def->GetAccessFlags(), class_def->GetAccessFlags());
+ uint32_t superclass_idx = class_def->Superclass() == nullptr ?
+ DexFile::kDexNoIndex16 : class_def->Superclass()->GetIndex();
+ fprintf(out_file_, "superclass_idx : %d\n", superclass_idx);
+ fprintf(out_file_, "interfaces_off : %d (0x%06x)\n",
+ class_def->InterfacesOffset(), class_def->InterfacesOffset());
+ uint32_t source_file_offset = 0xffffffffU;
+ if (class_def->SourceFile() != nullptr) {
+ source_file_offset = class_def->SourceFile()->GetIndex();
+ }
+ fprintf(out_file_, "source_file_idx : %d\n", source_file_offset);
+ uint32_t annotations_offset = 0;
+ if (class_def->Annotations() != nullptr) {
+ annotations_offset = class_def->Annotations()->GetOffset();
+ }
+ fprintf(out_file_, "annotations_off : %d (0x%06x)\n",
+ annotations_offset, annotations_offset);
+ if (class_def->GetClassData() == nullptr) {
+ fprintf(out_file_, "class_data_off : %d (0x%06x)\n", 0, 0);
+ } else {
+ fprintf(out_file_, "class_data_off : %d (0x%06x)\n",
+ class_def->GetClassData()->GetOffset(), class_def->GetClassData()->GetOffset());
+ }
+
+ // Fields and methods.
+ dex_ir::ClassData* class_data = class_def->GetClassData();
+ if (class_data != nullptr && class_data->StaticFields() != nullptr) {
+ fprintf(out_file_, "static_fields_size : %zu\n", class_data->StaticFields()->size());
+ } else {
+ fprintf(out_file_, "static_fields_size : 0\n");
+ }
+ if (class_data != nullptr && class_data->InstanceFields() != nullptr) {
+ fprintf(out_file_, "instance_fields_size: %zu\n", class_data->InstanceFields()->size());
+ } else {
+ fprintf(out_file_, "instance_fields_size: 0\n");
+ }
+ if (class_data != nullptr && class_data->DirectMethods() != nullptr) {
+ fprintf(out_file_, "direct_methods_size : %zu\n", class_data->DirectMethods()->size());
+ } else {
+ fprintf(out_file_, "direct_methods_size : 0\n");
+ }
+ if (class_data != nullptr && class_data->VirtualMethods() != nullptr) {
+ fprintf(out_file_, "virtual_methods_size: %zu\n", class_data->VirtualMethods()->size());
+ } else {
+ fprintf(out_file_, "virtual_methods_size: 0\n");
+ }
+ fprintf(out_file_, "\n");
+}
+
+/**
+ * Dumps an annotation set item.
+ */
+void DexLayout::DumpAnnotationSetItem(dex_ir::AnnotationSetItem* set_item) {
+ if (set_item == nullptr || set_item->GetItems()->size() == 0) {
+ fputs(" empty-annotation-set\n", out_file_);
+ return;
+ }
+ for (dex_ir::AnnotationItem* annotation : *set_item->GetItems()) {
+ if (annotation == nullptr) {
+ continue;
+ }
+ fputs(" ", out_file_);
+ switch (annotation->GetVisibility()) {
+ case DexFile::kDexVisibilityBuild: fputs("VISIBILITY_BUILD ", out_file_); break;
+ case DexFile::kDexVisibilityRuntime: fputs("VISIBILITY_RUNTIME ", out_file_); break;
+ case DexFile::kDexVisibilitySystem: fputs("VISIBILITY_SYSTEM ", out_file_); break;
+ default: fputs("VISIBILITY_UNKNOWN ", out_file_); break;
+ } // switch
+ DumpEncodedAnnotation(annotation->GetAnnotation());
+ fputc('\n', out_file_);
+ }
+}
+
+/*
+ * Dumps class annotations.
+ */
+void DexLayout::DumpClassAnnotations(int idx) {
+ dex_ir::ClassDef* class_def = header_->GetCollections().GetClassDef(idx);
+ dex_ir::AnnotationsDirectoryItem* annotations_directory = class_def->Annotations();
+ if (annotations_directory == nullptr) {
+ return; // none
+ }
+
+ fprintf(out_file_, "Class #%d annotations:\n", idx);
+
+ dex_ir::AnnotationSetItem* class_set_item = annotations_directory->GetClassAnnotation();
+ dex_ir::FieldAnnotationVector* fields = annotations_directory->GetFieldAnnotations();
+ dex_ir::MethodAnnotationVector* methods = annotations_directory->GetMethodAnnotations();
+ dex_ir::ParameterAnnotationVector* parameters = annotations_directory->GetParameterAnnotations();
+
+ // Annotations on the class itself.
+ if (class_set_item != nullptr) {
+ fprintf(out_file_, "Annotations on class\n");
+ DumpAnnotationSetItem(class_set_item);
+ }
+
+ // Annotations on fields.
+ if (fields != nullptr) {
+ for (auto& field : *fields) {
+ const dex_ir::FieldId* field_id = field->GetFieldId();
+ const uint32_t field_idx = field_id->GetIndex();
+ const char* field_name = field_id->Name()->Data();
+ fprintf(out_file_, "Annotations on field #%u '%s'\n", field_idx, field_name);
+ DumpAnnotationSetItem(field->GetAnnotationSetItem());
+ }
+ }
+
+ // Annotations on methods.
+ if (methods != nullptr) {
+ for (auto& method : *methods) {
+ const dex_ir::MethodId* method_id = method->GetMethodId();
+ const uint32_t method_idx = method_id->GetIndex();
+ const char* method_name = method_id->Name()->Data();
+ fprintf(out_file_, "Annotations on method #%u '%s'\n", method_idx, method_name);
+ DumpAnnotationSetItem(method->GetAnnotationSetItem());
+ }
+ }
+
+ // Annotations on method parameters.
+ if (parameters != nullptr) {
+ for (auto& parameter : *parameters) {
+ const dex_ir::MethodId* method_id = parameter->GetMethodId();
+ const uint32_t method_idx = method_id->GetIndex();
+ const char* method_name = method_id->Name()->Data();
+ fprintf(out_file_, "Annotations on method #%u '%s' parameters\n", method_idx, method_name);
+ uint32_t j = 0;
+ for (dex_ir::AnnotationSetItem* annotation : *parameter->GetAnnotations()->GetItems()) {
+ fprintf(out_file_, "#%u\n", j);
+ DumpAnnotationSetItem(annotation);
+ ++j;
+ }
+ }
+ }
+
+ fputc('\n', out_file_);
+}
+
+/*
+ * Dumps an interface that a class declares to implement.
+ */
+void DexLayout::DumpInterface(const dex_ir::TypeId* type_item, int i) {
+ const char* interface_name = type_item->GetStringId()->Data();
+ if (options_.output_format_ == kOutputPlain) {
+ fprintf(out_file_, " #%d : '%s'\n", i, interface_name);
+ } else {
+ std::string dot(DescriptorToDotWrapper(interface_name));
+ fprintf(out_file_, "<implements name=\"%s\">\n</implements>\n", dot.c_str());
+ }
+}
+
+/*
+ * Dumps the catches table associated with the code.
+ */
+void DexLayout::DumpCatches(const dex_ir::CodeItem* code) {
+ const uint16_t tries_size = code->TriesSize();
+
+ // No catch table.
+ if (tries_size == 0) {
+ fprintf(out_file_, " catches : (none)\n");
+ return;
+ }
+
+ // Dump all table entries.
+ fprintf(out_file_, " catches : %d\n", tries_size);
+ std::vector<std::unique_ptr<const dex_ir::TryItem>>* tries = code->Tries();
+ for (uint32_t i = 0; i < tries_size; i++) {
+ const dex_ir::TryItem* try_item = (*tries)[i].get();
+ const uint32_t start = try_item->StartAddr();
+ const uint32_t end = start + try_item->InsnCount();
+ fprintf(out_file_, " 0x%04x - 0x%04x\n", start, end);
+ for (auto& handler : *try_item->GetHandlers()->GetHandlers()) {
+ const dex_ir::TypeId* type_id = handler->GetTypeId();
+ const char* descriptor = (type_id == nullptr) ? "<any>" : type_id->GetStringId()->Data();
+ fprintf(out_file_, " %s -> 0x%04x\n", descriptor, handler->GetAddress());
+ } // for
+ } // for
+}
+
+/*
+ * Dumps all positions table entries associated with the code.
+ */
+void DexLayout::DumpPositionInfo(const dex_ir::CodeItem* code) {
+ dex_ir::DebugInfoItem* debug_info = code->DebugInfo();
+ if (debug_info == nullptr) {
+ return;
+ }
+ std::vector<std::unique_ptr<dex_ir::PositionInfo>>& positions = debug_info->GetPositionInfo();
+ for (size_t i = 0; i < positions.size(); ++i) {
+ fprintf(out_file_, " 0x%04x line=%d\n", positions[i]->address_, positions[i]->line_);
+ }
+}
+
+/*
+ * Dumps all locals table entries associated with the code.
+ */
+void DexLayout::DumpLocalInfo(const dex_ir::CodeItem* code) {
+ dex_ir::DebugInfoItem* debug_info = code->DebugInfo();
+ if (debug_info == nullptr) {
+ return;
+ }
+ std::vector<std::unique_ptr<dex_ir::LocalInfo>>& locals = debug_info->GetLocalInfo();
+ for (size_t i = 0; i < locals.size(); ++i) {
+ dex_ir::LocalInfo* entry = locals[i].get();
+ fprintf(out_file_, " 0x%04x - 0x%04x reg=%d %s %s %s\n",
+ entry->start_address_, entry->end_address_, entry->reg_,
+ entry->name_.c_str(), entry->descriptor_.c_str(), entry->signature_.c_str());
+ }
+}
+
+/*
* Dumps a single instruction.
*/
-static void DumpInstruction(dex_ir::Header* header, const dex_ir::CodeItem* code,
- uint32_t code_offset, uint32_t insn_idx, uint32_t insn_width,
- const Instruction* dec_insn) {
+void DexLayout::DumpInstruction(const dex_ir::CodeItem* code,
+ uint32_t code_offset,
+ uint32_t insn_idx,
+ uint32_t insn_width,
+ const Instruction* dec_insn) {
// Address of instruction (expressed as byte offset).
fprintf(out_file_, "%06x:", code_offset + 0x10 + insn_idx * 2);
@@ -901,7 +887,7 @@
// Set up additional argument.
std::unique_ptr<char[]> index_buf;
if (Instruction::IndexTypeOf(dec_insn->Opcode()) != Instruction::kIndexNone) {
- index_buf = IndexString(header, dec_insn, 200);
+ index_buf = IndexString(header_, dec_insn, 200);
}
// Dump the instruction.
@@ -1073,9 +1059,8 @@
/*
* Dumps a bytecode disassembly.
*/
-static void DumpBytecodes(dex_ir::Header* header, uint32_t idx,
- const dex_ir::CodeItem* code, uint32_t code_offset) {
- dex_ir::MethodId* method_id = header->GetCollections().GetMethodId(idx);
+void DexLayout::DumpBytecodes(uint32_t idx, const dex_ir::CodeItem* code, uint32_t code_offset) {
+ dex_ir::MethodId* method_id = header_->GetCollections().GetMethodId(idx);
const char* name = method_id->Name()->Data();
std::string type_descriptor = GetSignatureForProtoId(method_id->Proto());
const char* back_descriptor = method_id->Class()->GetStringId()->Data();
@@ -1094,7 +1079,7 @@
fprintf(stderr, "GLITCH: zero-width instruction at idx=0x%04x\n", insn_idx);
break;
}
- DumpInstruction(header, code, code_offset, insn_idx, insn_width, instruction);
+ DumpInstruction(code, code_offset, insn_idx, insn_width, instruction);
insn_idx += insn_width;
} // for
}
@@ -1102,8 +1087,7 @@
/*
* Dumps code of a method.
*/
-static void DumpCode(dex_ir::Header* header, uint32_t idx, const dex_ir::CodeItem* code,
- uint32_t code_offset) {
+void DexLayout::DumpCode(uint32_t idx, const dex_ir::CodeItem* code, uint32_t code_offset) {
fprintf(out_file_, " registers : %d\n", code->RegistersSize());
fprintf(out_file_, " ins : %d\n", code->InsSize());
fprintf(out_file_, " outs : %d\n", code->OutsSize());
@@ -1112,7 +1096,7 @@
// Bytecode disassembly, if requested.
if (options_.disassemble_) {
- DumpBytecodes(header, idx, code, code_offset);
+ DumpBytecodes(idx, code, code_offset);
}
// Try-catch blocks.
@@ -1128,14 +1112,13 @@
/*
* Dumps a method.
*/
-static void DumpMethod(dex_ir::Header* header, uint32_t idx, uint32_t flags,
- const dex_ir::CodeItem* code, int i) {
+void DexLayout::DumpMethod(uint32_t idx, uint32_t flags, const dex_ir::CodeItem* code, int i) {
// Bail for anything private if export only requested.
if (options_.exports_only_ && (flags & (kAccPublic | kAccProtected)) == 0) {
return;
}
- dex_ir::MethodId* method_id = header->GetCollections().GetMethodId(idx);
+ dex_ir::MethodId* method_id = header_->GetCollections().GetMethodId(idx);
const char* name = method_id->Name()->Data();
char* type_descriptor = strdup(GetSignatureForProtoId(method_id->Proto()).c_str());
const char* back_descriptor = method_id->Class()->GetStringId()->Data();
@@ -1150,7 +1133,7 @@
fprintf(out_file_, " code : (none)\n");
} else {
fprintf(out_file_, " code -\n");
- DumpCode(header, idx, code, code->GetOffset());
+ DumpCode(idx, code, code->GetOffset());
}
if (options_.disassemble_) {
fputc('\n', out_file_);
@@ -1233,14 +1216,13 @@
/*
* Dumps a static (class) field.
*/
-static void DumpSField(dex_ir::Header* header, uint32_t idx, uint32_t flags,
- int i, dex_ir::EncodedValue* init) {
+void DexLayout::DumpSField(uint32_t idx, uint32_t flags, int i, dex_ir::EncodedValue* init) {
// Bail for anything private if export only requested.
if (options_.exports_only_ && (flags & (kAccPublic | kAccProtected)) == 0) {
return;
}
- dex_ir::FieldId* field_id = header->GetCollections().GetFieldId(idx);
+ dex_ir::FieldId* field_id = header_->GetCollections().GetFieldId(idx);
const char* name = field_id->Name()->Data();
const char* type_descriptor = field_id->Type()->GetStringId()->Data();
const char* back_descriptor = field_id->Class()->GetStringId()->Data();
@@ -1281,8 +1263,8 @@
/*
* Dumps an instance field.
*/
-static void DumpIField(dex_ir::Header* header, uint32_t idx, uint32_t flags, int i) {
- DumpSField(header, idx, flags, i, nullptr);
+void DexLayout::DumpIField(uint32_t idx, uint32_t flags, int i) {
+ DumpSField(idx, flags, i, nullptr);
}
/*
@@ -1293,19 +1275,19 @@
* If "*last_package" is nullptr or does not match the current class' package,
* the value will be replaced with a newly-allocated string.
*/
-static void DumpClass(dex_ir::Header* header, int idx, char** last_package) {
- dex_ir::ClassDef* class_def = header->GetCollections().GetClassDef(idx);
+void DexLayout::DumpClass(int idx, char** last_package) {
+ dex_ir::ClassDef* class_def = header_->GetCollections().GetClassDef(idx);
// Omitting non-public class.
if (options_.exports_only_ && (class_def->GetAccessFlags() & kAccPublic) == 0) {
return;
}
if (options_.show_section_headers_) {
- DumpClassDef(header, idx);
+ DumpClassDef(idx);
}
if (options_.show_annotations_) {
- DumpClassAnnotations(header, idx);
+ DumpClassAnnotations(idx);
}
// For the XML output, show the package name. Ideally we'd gather
@@ -1313,7 +1295,7 @@
// package name wouldn't jump around, but that's not a great plan
// for something that needs to run on the device.
const char* class_descriptor =
- header->GetCollections().GetClassDef(idx)->ClassType()->GetStringId()->Data();
+ header_->GetCollections().GetClassDef(idx)->ClassType()->GetStringId()->Data();
if (!(class_descriptor[0] == 'L' &&
class_descriptor[strlen(class_descriptor)-1] == ';')) {
// Arrays and primitives should not be defined explicitly. Keep going?
@@ -1406,8 +1388,7 @@
dex_ir::FieldItemVector* static_fields = class_data->StaticFields();
if (static_fields != nullptr) {
for (uint32_t i = 0; i < static_fields->size(); i++) {
- DumpSField(header,
- (*static_fields)[i]->GetFieldId()->GetIndex(),
+ DumpSField((*static_fields)[i]->GetFieldId()->GetIndex(),
(*static_fields)[i]->GetAccessFlags(),
i,
i < encoded_values_size ? (*encoded_values)[i].get() : nullptr);
@@ -1423,8 +1404,7 @@
dex_ir::FieldItemVector* instance_fields = class_data->InstanceFields();
if (instance_fields != nullptr) {
for (uint32_t i = 0; i < instance_fields->size(); i++) {
- DumpIField(header,
- (*instance_fields)[i]->GetFieldId()->GetIndex(),
+ DumpIField((*instance_fields)[i]->GetFieldId()->GetIndex(),
(*instance_fields)[i]->GetAccessFlags(),
i);
} // for
@@ -1439,8 +1419,7 @@
dex_ir::MethodItemVector* direct_methods = class_data->DirectMethods();
if (direct_methods != nullptr) {
for (uint32_t i = 0; i < direct_methods->size(); i++) {
- DumpMethod(header,
- (*direct_methods)[i]->GetMethodId()->GetIndex(),
+ DumpMethod((*direct_methods)[i]->GetMethodId()->GetIndex(),
(*direct_methods)[i]->GetAccessFlags(),
(*direct_methods)[i]->GetCodeItem(),
i);
@@ -1456,8 +1435,7 @@
dex_ir::MethodItemVector* virtual_methods = class_data->VirtualMethods();
if (virtual_methods != nullptr) {
for (uint32_t i = 0; i < virtual_methods->size(); i++) {
- DumpMethod(header,
- (*virtual_methods)[i]->GetMethodId()->GetIndex(),
+ DumpMethod((*virtual_methods)[i]->GetMethodId()->GetIndex(),
(*virtual_methods)[i]->GetAccessFlags(),
(*virtual_methods)[i]->GetCodeItem(),
i);
@@ -1481,24 +1459,10 @@
free(access_str);
}
-/*
- * Dumps the requested sections of the file.
- */
-static void ProcessDexFile(const char* file_name, const DexFile* dex_file, size_t dex_file_index) {
- if (options_.verbose_) {
- fprintf(out_file_, "Opened '%s', DEX version '%.3s'\n",
- file_name, dex_file->GetHeader().magic_ + 4);
- }
- std::unique_ptr<dex_ir::Header> header(dex_ir::DexIrBuilder(*dex_file));
-
- if (options_.visualize_pattern_) {
- VisualizeDexLayout(header.get(), dex_file, dex_file_index);
- return;
- }
-
+void DexLayout::DumpDexFile() {
// Headers.
if (options_.show_file_headers_) {
- DumpFileHeader(header.get());
+ DumpFileHeader();
}
// Open XML context.
@@ -1508,9 +1472,9 @@
// Iterate over all classes.
char* package = nullptr;
- const uint32_t class_defs_size = header->GetCollections().ClassDefsSize();
+ const uint32_t class_defs_size = header_->GetCollections().ClassDefsSize();
for (uint32_t i = 0; i < class_defs_size; i++) {
- DumpClass(header.get(), i, &package);
+ DumpClass(i, &package);
} // for
// Free the last package allocated.
@@ -1523,20 +1487,227 @@
if (options_.output_format_ == kOutputXml) {
fprintf(out_file_, "</api>\n");
}
+}
- // Output dex file.
- if (options_.output_dex_directory_ != nullptr) {
+std::vector<dex_ir::ClassDef*> DexLayout::LayoutClassDefsAndClassData(const DexFile* dex_file) {
+ std::vector<dex_ir::ClassDef*> new_class_def_order;
+ for (std::unique_ptr<dex_ir::ClassDef>& class_def : header_->GetCollections().ClassDefs()) {
+ dex::TypeIndex type_idx(class_def->ClassType()->GetIndex());
+ if (info_->ContainsClass(*dex_file, type_idx)) {
+ new_class_def_order.push_back(class_def.get());
+ }
+ }
+ for (std::unique_ptr<dex_ir::ClassDef>& class_def : header_->GetCollections().ClassDefs()) {
+ dex::TypeIndex type_idx(class_def->ClassType()->GetIndex());
+ if (!info_->ContainsClass(*dex_file, type_idx)) {
+ new_class_def_order.push_back(class_def.get());
+ }
+ }
+ uint32_t class_defs_offset = header_->GetCollections().ClassDefsOffset();
+ uint32_t class_data_offset = header_->GetCollections().ClassDatasOffset();
+ for (uint32_t i = 0; i < new_class_def_order.size(); ++i) {
+ dex_ir::ClassDef* class_def = new_class_def_order[i];
+ class_def->SetIndex(i);
+ class_def->SetOffset(class_defs_offset);
+ class_defs_offset += dex_ir::ClassDef::ItemSize();
+ if (class_def->GetClassData() != nullptr) {
+ class_def->GetClassData()->SetOffset(class_data_offset);
+ class_data_offset += class_def->GetClassData()->GetSize();
+ }
+ }
+ return new_class_def_order;
+}
+
+int32_t DexLayout::LayoutCodeItems(std::vector<dex_ir::ClassDef*> new_class_def_order) {
+ int32_t diff = 0;
+ uint32_t offset = header_->GetCollections().CodeItemsOffset();
+ for (dex_ir::ClassDef* class_def : new_class_def_order) {
+ dex_ir::ClassData* class_data = class_def->GetClassData();
+ if (class_data != nullptr) {
+ class_data->SetOffset(class_data->GetOffset() + diff);
+ for (auto& method : *class_data->DirectMethods()) {
+ dex_ir::CodeItem* code_item = method->GetCodeItem();
+ if (code_item != nullptr) {
+ diff += UnsignedLeb128Size(offset) - UnsignedLeb128Size(code_item->GetOffset());
+ code_item->SetOffset(offset);
+ offset += RoundUp(code_item->GetSize(), 4);
+ }
+ }
+ for (auto& method : *class_data->VirtualMethods()) {
+ dex_ir::CodeItem* code_item = method->GetCodeItem();
+ if (code_item != nullptr) {
+ diff += UnsignedLeb128Size(offset) - UnsignedLeb128Size(code_item->GetOffset());
+ code_item->SetOffset(offset);
+ offset += RoundUp(code_item->GetSize(), 4);
+ }
+ }
+ }
+ }
+
+ return diff;
+}
+
+// Adjust offsets of every item in the specified section by diff bytes.
+template<class T> void DexLayout::FixupSection(std::map<uint32_t, std::unique_ptr<T>>& map,
+ uint32_t diff) {
+ for (auto& pair : map) {
+ std::unique_ptr<T>& item = pair.second;
+ item->SetOffset(item->GetOffset() + diff);
+ }
+}
+
+// Adjust offsets of all sections with an address after the specified offset by diff bytes.
+void DexLayout::FixupSections(uint32_t offset, uint32_t diff) {
+ dex_ir::Collections& collections = header_->GetCollections();
+ uint32_t map_list_offset = collections.MapListOffset();
+ if (map_list_offset > offset) {
+ collections.SetMapListOffset(map_list_offset + diff);
+ }
+
+ uint32_t type_lists_offset = collections.TypeListsOffset();
+ if (type_lists_offset > offset) {
+ collections.SetTypeListsOffset(type_lists_offset + diff);
+ FixupSection(collections.TypeLists(), diff);
+ }
+
+ uint32_t annotation_set_ref_lists_offset = collections.AnnotationSetRefListsOffset();
+ if (annotation_set_ref_lists_offset > offset) {
+ collections.SetAnnotationSetRefListsOffset(annotation_set_ref_lists_offset + diff);
+ FixupSection(collections.AnnotationSetRefLists(), diff);
+ }
+
+ uint32_t annotation_set_items_offset = collections.AnnotationSetItemsOffset();
+ if (annotation_set_items_offset > offset) {
+ collections.SetAnnotationSetItemsOffset(annotation_set_items_offset + diff);
+ FixupSection(collections.AnnotationSetItems(), diff);
+ }
+
+ uint32_t class_datas_offset = collections.ClassDatasOffset();
+ if (class_datas_offset > offset) {
+ collections.SetClassDatasOffset(class_datas_offset + diff);
+ FixupSection(collections.ClassDatas(), diff);
+ }
+
+ uint32_t code_items_offset = collections.CodeItemsOffset();
+ if (code_items_offset > offset) {
+ collections.SetCodeItemsOffset(code_items_offset + diff);
+ FixupSection(collections.CodeItems(), diff);
+ }
+
+ uint32_t string_datas_offset = collections.StringDatasOffset();
+ if (string_datas_offset > offset) {
+ collections.SetStringDatasOffset(string_datas_offset + diff);
+ FixupSection(collections.StringDatas(), diff);
+ }
+
+ uint32_t debug_info_items_offset = collections.DebugInfoItemsOffset();
+ if (debug_info_items_offset > offset) {
+ collections.SetDebugInfoItemsOffset(debug_info_items_offset + diff);
+ FixupSection(collections.DebugInfoItems(), diff);
+ }
+
+ uint32_t annotation_items_offset = collections.AnnotationItemsOffset();
+ if (annotation_items_offset > offset) {
+ collections.SetAnnotationItemsOffset(annotation_items_offset + diff);
+ FixupSection(collections.AnnotationItems(), diff);
+ }
+
+ uint32_t encoded_array_items_offset = collections.EncodedArrayItemsOffset();
+ if (encoded_array_items_offset > offset) {
+ collections.SetEncodedArrayItemsOffset(encoded_array_items_offset + diff);
+ FixupSection(collections.EncodedArrayItems(), diff);
+ }
+
+ uint32_t annotations_directory_items_offset = collections.AnnotationsDirectoryItemsOffset();
+ if (annotations_directory_items_offset > offset) {
+ collections.SetAnnotationsDirectoryItemsOffset(annotations_directory_items_offset + diff);
+ FixupSection(collections.AnnotationsDirectoryItems(), diff);
+ }
+}
+
+void DexLayout::LayoutOutputFile(const DexFile* dex_file) {
+ std::vector<dex_ir::ClassDef*> new_class_def_order = LayoutClassDefsAndClassData(dex_file);
+ int32_t diff = LayoutCodeItems(new_class_def_order);
+ // Adjust diff to be 4-byte aligned.
+ diff = RoundUp(diff, 4);
+ // Move sections after ClassData by diff bytes.
+ FixupSections(header_->GetCollections().ClassDatasOffset(), diff);
+ // Update file size.
+ header_->SetFileSize(header_->FileSize() + diff);
+}
+
+void DexLayout::OutputDexFile(const std::string& dex_file_location) {
+ std::string error_msg;
+ std::unique_ptr<File> new_file;
+ if (!options_.output_to_memmap_) {
std::string output_location(options_.output_dex_directory_);
- size_t last_slash = dex_file->GetLocation().rfind('/');
- output_location.append(dex_file->GetLocation().substr(last_slash));
- DexWriter::OutputDexFile(*header, output_location.c_str());
+ size_t last_slash = dex_file_location.rfind("/");
+ std::string dex_file_directory = dex_file_location.substr(0, last_slash + 1);
+ if (output_location == dex_file_directory) {
+ output_location = dex_file_location + ".new";
+ } else if (last_slash != std::string::npos) {
+ output_location += dex_file_location.substr(last_slash);
+ } else {
+ output_location += "/" + dex_file_location + ".new";
+ }
+ new_file.reset(OS::CreateEmptyFile(output_location.c_str()));
+ ftruncate(new_file->Fd(), header_->FileSize());
+ mem_map_.reset(MemMap::MapFile(header_->FileSize(), PROT_READ | PROT_WRITE, MAP_SHARED,
+ new_file->Fd(), 0, /*low_4gb*/ false, output_location.c_str(), &error_msg));
+ } else {
+ mem_map_.reset(MemMap::MapAnonymous("layout dex", nullptr, header_->FileSize(),
+ PROT_READ | PROT_WRITE, /* low_4gb */ false, /* reuse */ false, &error_msg));
+ }
+ if (mem_map_ == nullptr) {
+ LOG(ERROR) << "Could not create mem map for dex writer output: " << error_msg;
+ if (new_file.get() != nullptr) {
+ new_file->Erase();
+ }
+ return;
+ }
+ DexWriter::Output(header_, mem_map_.get());
+ if (new_file != nullptr) {
+ UNUSED(new_file->FlushCloseOrErase());
+ }
+}
+
+/*
+ * Dumps the requested sections of the file.
+ */
+void DexLayout::ProcessDexFile(const char* file_name,
+ const DexFile* dex_file,
+ size_t dex_file_index) {
+ std::unique_ptr<dex_ir::Header> header(dex_ir::DexIrBuilder(*dex_file));
+ SetHeader(header.get());
+
+ if (options_.verbose_) {
+ fprintf(out_file_, "Opened '%s', DEX version '%.3s'\n",
+ file_name, dex_file->GetHeader().magic_ + 4);
+ }
+
+ if (options_.visualize_pattern_) {
+ VisualizeDexLayout(header_, dex_file, dex_file_index, info_);
+ return;
+ }
+
+ // Dump dex file.
+ if (options_.dump_) {
+ DumpDexFile();
+ }
+
+ // Output dex file as file or memmap.
+ if (options_.output_dex_directory_ != nullptr || options_.output_to_memmap_) {
+ if (info_ != nullptr) {
+ LayoutOutputFile(dex_file);
+ }
+ OutputDexFile(dex_file->GetLocation());
}
}
/*
* Processes a single file (either direct .dex or indirect .zip/.jar/.apk).
*/
-int ProcessFile(const char* file_name) {
+int DexLayout::ProcessFile(const char* file_name) {
if (options_.verbose_) {
fprintf(out_file_, "Processing '%s'...\n", file_name);
}
diff --git a/dexlayout/dexlayout.h b/dexlayout/dexlayout.h
index a5bd992..ac1a4a6 100644
--- a/dexlayout/dexlayout.h
+++ b/dexlayout/dexlayout.h
@@ -26,8 +26,13 @@
#include <stdint.h>
#include <stdio.h>
+#include "dex_ir.h"
+#include "mem_map.h"
+
namespace art {
+class DexFile;
+class Instruction;
class ProfileCompilationInfo;
/* Supported output formats. */
@@ -37,28 +42,90 @@
};
/* Command-line options. */
-struct Options {
- bool build_dex_ir_;
- bool checksum_only_;
- bool disassemble_;
- bool exports_only_;
- bool ignore_bad_checksum_;
- bool show_annotations_;
- bool show_file_headers_;
- bool show_section_headers_;
- bool verbose_;
- bool visualize_pattern_;
- OutputFormat output_format_;
- const char* output_dex_directory_;
- const char* output_file_name_;
- const char* profile_file_name_;
+class Options {
+ public:
+ Options() = default;
+
+ bool dump_ = false;
+ bool build_dex_ir_ = false;
+ bool checksum_only_ = false;
+ bool disassemble_ = false;
+ bool exports_only_ = false;
+ bool ignore_bad_checksum_ = false;
+ bool output_to_memmap_ = false;
+ bool show_annotations_ = false;
+ bool show_file_headers_ = false;
+ bool show_section_headers_ = false;
+ bool verbose_ = false;
+ bool visualize_pattern_ = false;
+ OutputFormat output_format_ = kOutputPlain;
+ const char* output_dex_directory_ = nullptr;
+ const char* output_file_name_ = nullptr;
+ const char* profile_file_name_ = nullptr;
};
-/* Prototypes. */
-extern struct Options options_;
-extern FILE* out_file_;
-extern ProfileCompilationInfo* profile_info_;
-int ProcessFile(const char* file_name);
+class DexLayout {
+ public:
+ DexLayout(Options& options,
+ ProfileCompilationInfo* info,
+ FILE* out_file,
+ dex_ir::Header*
+ header = nullptr)
+ : options_(options), info_(info), out_file_(out_file), header_(header) { }
+
+ int ProcessFile(const char* file_name);
+ void ProcessDexFile(const char* file_name, const DexFile* dex_file, size_t dex_file_index);
+
+ dex_ir::Header* GetHeader() const { return header_; }
+ void SetHeader(dex_ir::Header* header) { header_ = header; }
+
+ MemMap* GetAndReleaseMemMap() { return mem_map_.release(); }
+
+ private:
+ void DumpAnnotationSetItem(dex_ir::AnnotationSetItem* set_item);
+ void DumpBytecodes(uint32_t idx, const dex_ir::CodeItem* code, uint32_t code_offset);
+ void DumpCatches(const dex_ir::CodeItem* code);
+ void DumpClass(int idx, char** last_package);
+ void DumpClassAnnotations(int idx);
+ void DumpClassDef(int idx);
+ void DumpCode(uint32_t idx, const dex_ir::CodeItem* code, uint32_t code_offset);
+ void DumpEncodedAnnotation(dex_ir::EncodedAnnotation* annotation);
+ void DumpEncodedValue(const dex_ir::EncodedValue* data);
+ void DumpFileHeader();
+ void DumpIField(uint32_t idx, uint32_t flags, int i);
+ void DumpInstruction(const dex_ir::CodeItem* code,
+ uint32_t code_offset,
+ uint32_t insn_idx,
+ uint32_t insn_width,
+ const Instruction* dec_insn);
+ void DumpInterface(const dex_ir::TypeId* type_item, int i);
+ void DumpLocalInfo(const dex_ir::CodeItem* code);
+ void DumpMethod(uint32_t idx, uint32_t flags, const dex_ir::CodeItem* code, int i);
+ void DumpPositionInfo(const dex_ir::CodeItem* code);
+ void DumpSField(uint32_t idx, uint32_t flags, int i, dex_ir::EncodedValue* init);
+ void DumpDexFile();
+
+ std::vector<dex_ir::ClassDef*> LayoutClassDefsAndClassData(const DexFile* dex_file);
+ int32_t LayoutCodeItems(std::vector<dex_ir::ClassDef*> new_class_def_order);
+ template<class T> void FixupSection(std::map<uint32_t, std::unique_ptr<T>>& map, uint32_t diff);
+ void FixupSections(uint32_t offset, uint32_t diff);
+
+ // Creates a new layout for the dex file based on profile info.
+ // Currently reorders ClassDefs, ClassDataItems, and CodeItems.
+ void LayoutOutputFile(const DexFile* dex_file);
+ void OutputDexFile(const std::string& dex_file_location);
+
+ void DumpCFG(const DexFile* dex_file, int idx);
+ void DumpCFG(const DexFile* dex_file, uint32_t dex_method_idx, const DexFile::CodeItem* code);
+
+ Options& options_;
+ ProfileCompilationInfo* info_;
+ FILE* out_file_;
+ dex_ir::Header* header_;
+ std::unique_ptr<MemMap> mem_map_;
+
+ DISALLOW_COPY_AND_ASSIGN(DexLayout);
+};
} // namespace art
diff --git a/dexlayout/dexlayout_main.cc b/dexlayout/dexlayout_main.cc
index 825dd50..5f8a118 100644
--- a/dexlayout/dexlayout_main.cc
+++ b/dexlayout/dexlayout_main.cc
@@ -68,64 +68,67 @@
InitLogging(argv, Runtime::Aborter);
MemMap::Init();
- // Reset options.
+ Options options;
+ options.dump_ = true;
+ options.verbose_ = true;
bool want_usage = false;
- memset(&options_, 0, sizeof(options_));
- options_.verbose_ = true;
// Parse all arguments.
while (1) {
- const int ic = getopt(argc, argv, "abcdefghil:o:p:sw:");
+ const int ic = getopt(argc, argv, "abcdefghil:mo:p:sw:");
if (ic < 0) {
break; // done
}
switch (ic) {
case 'a': // display annotations
- options_.show_annotations_ = true;
+ options.show_annotations_ = true;
break;
case 'b': // build dex_ir
- options_.build_dex_ir_ = true;
+ options.build_dex_ir_ = true;
break;
case 'c': // verify the checksum then exit
- options_.checksum_only_ = true;
+ options.checksum_only_ = true;
break;
case 'd': // disassemble Dalvik instructions
- options_.disassemble_ = true;
+ options.disassemble_ = true;
break;
case 'e': // exported items only
- options_.exports_only_ = true;
+ options.exports_only_ = true;
break;
case 'f': // display outer file header
- options_.show_file_headers_ = true;
+ options.show_file_headers_ = true;
break;
case 'h': // display section headers, i.e. all meta-data
- options_.show_section_headers_ = true;
+ options.show_section_headers_ = true;
break;
case 'i': // continue even if checksum is bad
- options_.ignore_bad_checksum_ = true;
+ options.ignore_bad_checksum_ = true;
break;
case 'l': // layout
if (strcmp(optarg, "plain") == 0) {
- options_.output_format_ = kOutputPlain;
+ options.output_format_ = kOutputPlain;
} else if (strcmp(optarg, "xml") == 0) {
- options_.output_format_ = kOutputXml;
- options_.verbose_ = false;
+ options.output_format_ = kOutputXml;
+ options.verbose_ = false;
} else {
want_usage = true;
}
break;
+ case 'm': // output dex files to a memmap
+ options.output_to_memmap_ = true;
+ break;
case 'o': // output file
- options_.output_file_name_ = optarg;
+ options.output_file_name_ = optarg;
break;
case 'p': // profile file
- options_.profile_file_name_ = optarg;
+ options.profile_file_name_ = optarg;
break;
case 's': // visualize access pattern
- options_.visualize_pattern_ = true;
- options_.verbose_ = false;
+ options.visualize_pattern_ = true;
+ options.verbose_ = false;
break;
case 'w': // output dex files directory
- options_.output_dex_directory_ = optarg;
+ options.output_dex_directory_ = optarg;
break;
default:
want_usage = true;
@@ -138,7 +141,7 @@
fprintf(stderr, "%s: no file specified\n", kProgramName);
want_usage = true;
}
- if (options_.checksum_only_ && options_.ignore_bad_checksum_) {
+ if (options.checksum_only_ && options.ignore_bad_checksum_) {
fprintf(stderr, "Can't specify both -c and -i\n");
want_usage = true;
}
@@ -148,32 +151,37 @@
}
// Open alternative output file.
- if (options_.output_file_name_) {
- out_file_ = fopen(options_.output_file_name_, "w");
- if (!out_file_) {
- fprintf(stderr, "Can't open %s\n", options_.output_file_name_);
+ FILE* out_file = stdout;
+ if (options.output_file_name_) {
+ out_file = fopen(options.output_file_name_, "w");
+ if (!out_file) {
+ fprintf(stderr, "Can't open %s\n", options.output_file_name_);
return 1;
}
}
// Open profile file.
- if (options_.profile_file_name_) {
- int profile_fd = open(options_.profile_file_name_, O_RDONLY);
+ ProfileCompilationInfo* profile_info = nullptr;
+ if (options.profile_file_name_) {
+ int profile_fd = open(options.profile_file_name_, O_RDONLY);
if (profile_fd < 0) {
- fprintf(stderr, "Can't open %s\n", options_.profile_file_name_);
+ fprintf(stderr, "Can't open %s\n", options.profile_file_name_);
return 1;
}
- profile_info_ = new ProfileCompilationInfo();
- if (!profile_info_->Load(profile_fd)) {
- fprintf(stderr, "Can't read profile info from %s\n", options_.profile_file_name_);
+ profile_info = new ProfileCompilationInfo();
+ if (!profile_info->Load(profile_fd)) {
+ fprintf(stderr, "Can't read profile info from %s\n", options.profile_file_name_);
return 1;
}
}
+ // Create DexLayout instance.
+ DexLayout dex_layout(options, profile_info, out_file);
+
// Process all files supplied on command line.
int result = 0;
while (optind < argc) {
- result |= ProcessFile(argv[optind++]);
+ result |= dex_layout.ProcessFile(argv[optind++]);
} // while
return result != 0;
}
diff --git a/dexlayout/dexlayout_test.cc b/dexlayout/dexlayout_test.cc
index c7f36be..46a1c43 100644
--- a/dexlayout/dexlayout_test.cc
+++ b/dexlayout/dexlayout_test.cc
@@ -21,12 +21,57 @@
#include <sys/types.h>
#include <unistd.h>
-#include "base/stringprintf.h"
+#include "base/unix_file/fd_file.h"
#include "common_runtime_test.h"
#include "utils.h"
namespace art {
+static const char kDexFileLayoutInputDex[] =
+ "ZGV4CjAzNQD1KW3+B8NAB0f2A/ZVIBJ0aHrGIqcpVTAUAgAAcAAAAHhWNBIAAAAAAAAAAIwBAAAH"
+ "AAAAcAAAAAQAAACMAAAAAQAAAJwAAAAAAAAAAAAAAAMAAACoAAAAAgAAAMAAAAAUAQAAAAEAADAB"
+ "AAA4AQAAQAEAAEgBAABNAQAAUgEAAGYBAAADAAAABAAAAAUAAAAGAAAABgAAAAMAAAAAAAAAAAAA"
+ "AAAAAAABAAAAAAAAAAIAAAAAAAAAAAAAAAAAAAACAAAAAAAAAAEAAAAAAAAAdQEAAAAAAAABAAAA"
+ "AAAAAAIAAAAAAAAAAgAAAAAAAAB/AQAAAAAAAAEAAQABAAAAaQEAAAQAAABwEAIAAAAOAAEAAQAB"
+ "AAAAbwEAAAQAAABwEAIAAAAOAAY8aW5pdD4ABkEuamF2YQAGQi5qYXZhAANMQTsAA0xCOwASTGph"
+ "dmEvbGFuZy9PYmplY3Q7AAFWAAQABw48AAQABw48AAAAAQAAgIAEgAIAAAEAAYCABJgCAAAACwAA"
+ "AAAAAAABAAAAAAAAAAEAAAAHAAAAcAAAAAIAAAAEAAAAjAAAAAMAAAABAAAAnAAAAAUAAAADAAAA"
+ "qAAAAAYAAAACAAAAwAAAAAEgAAACAAAAAAEAAAIgAAAHAAAAMAEAAAMgAAACAAAAaQEAAAAgAAAC"
+ "AAAAdQEAAAAQAAABAAAAjAEAAA==";
+
+static const char kDexFileLayoutInputProfile[] =
+ "cHJvADAwMgABAAsAAAABAPUpbf5jbGFzc2VzLmRleAEA";
+
+static const char kDexFileLayoutExpectedOutputDex[] =
+ "ZGV4CjAzNQD1KW3+B8NAB0f2A/ZVIBJ0aHrGIqcpVTAUAgAAcAAAAHhWNBIAAAAAAAAAAIwBAAAH"
+ "AAAAcAAAAAQAAACMAAAAAQAAAJwAAAAAAAAAAAAAAAMAAACoAAAAAgAAAMAAAAAUAQAAAAEAADAB"
+ "AAA4AQAAQAEAAEgBAABNAQAAUgEAAGYBAAADAAAABAAAAAUAAAAGAAAABgAAAAMAAAAAAAAAAAAA"
+ "AAAAAAABAAAAAAAAAAIAAAAAAAAAAQAAAAAAAAACAAAAAAAAAAIAAAAAAAAAdQEAAAAAAAAAAAAA"
+ "AAAAAAIAAAAAAAAAAQAAAAAAAAB/AQAAAAAAAAEAAQABAAAAbwEAAAQAAABwEAIAAAAOAAEAAQAB"
+ "AAAAaQEAAAQAAABwEAIAAAAOAAY8aW5pdD4ABkEuamF2YQAGQi5qYXZhAANMQTsAA0xCOwASTGph"
+ "dmEvbGFuZy9PYmplY3Q7AAFWAAQABw48AAQABw48AAAAAQABgIAEgAIAAAEAAICABJgCAAAACwAA"
+ "AAAAAAABAAAAAAAAAAEAAAAHAAAAcAAAAAIAAAAEAAAAjAAAAAMAAAABAAAAnAAAAAUAAAADAAAA"
+ "qAAAAAYAAAACAAAAwAAAAAEgAAACAAAAAAEAAAIgAAAHAAAAMAEAAAMgAAACAAAAaQEAAAAgAAAC"
+ "AAAAdQEAAAAQAAABAAAAjAEAAA==";
+
+static void WriteFileBase64(const char* base64, const char* location) {
+ // Decode base64.
+ CHECK(base64 != nullptr);
+ size_t length;
+ std::unique_ptr<uint8_t[]> bytes(DecodeBase64(base64, &length));
+ CHECK(bytes.get() != nullptr);
+
+ // Write to provided file.
+ std::unique_ptr<File> file(OS::CreateEmptyFile(location));
+ CHECK(file.get() != nullptr);
+ if (!file->WriteFully(bytes.get(), length)) {
+ PLOG(FATAL) << "Failed to write base64 as file";
+ }
+ if (file->FlushCloseOrErase() != 0) {
+ PLOG(FATAL) << "Could not flush and close test file.";
+ }
+}
+
class DexLayoutTest : public CommonRuntimeTest {
protected:
virtual void SetUp() {
@@ -51,7 +96,6 @@
{ dexdump, "-d", "-f", "-h", "-l", "plain", "-o", dexdump_filename, dex_file };
std::vector<std::string> dexlayout_exec_argv =
{ dexlayout, "-d", "-f", "-h", "-l", "plain", "-o", dexlayout_filename, dex_file };
-
if (!::art::Exec(dexdump_exec_argv, error_msg)) {
return false;
}
@@ -78,13 +122,11 @@
for (const std::string &dex_file : GetLibCoreDexFileNames()) {
std::vector<std::string> dexlayout_exec_argv =
- { dexlayout, "-d", "-f", "-h", "-l", "plain", "-w", tmp_dir, "-o", tmp_name, dex_file };
-
+ { dexlayout, "-w", tmp_dir, "-o", tmp_name, dex_file };
if (!::art::Exec(dexlayout_exec_argv, error_msg)) {
return false;
}
-
- size_t dex_file_last_slash = dex_file.rfind('/');
+ size_t dex_file_last_slash = dex_file.rfind("/");
std::string dex_file_name = dex_file.substr(dex_file_last_slash + 1);
std::vector<std::string> unzip_exec_argv =
{ "/usr/bin/unzip", dex_file, "classes.dex", "-d", tmp_dir};
@@ -105,7 +147,44 @@
return false;
}
}
+ return true;
+ }
+ // Runs DexFileOutput test.
+ bool DexFileLayoutExec(std::string* error_msg) {
+ ScratchFile tmp_file;
+ std::string tmp_name = tmp_file.GetFilename();
+ size_t tmp_last_slash = tmp_name.rfind("/");
+ std::string tmp_dir = tmp_name.substr(0, tmp_last_slash + 1);
+
+ // Write inputs and expected outputs.
+ std::string dex_file = tmp_dir + "classes.dex";
+ WriteFileBase64(kDexFileLayoutInputDex, dex_file.c_str());
+ std::string profile_file = tmp_dir + "primary.prof";
+ WriteFileBase64(kDexFileLayoutInputProfile, profile_file.c_str());
+ std::string expected_output = tmp_dir + "expected.dex";
+ WriteFileBase64(kDexFileLayoutExpectedOutputDex, expected_output.c_str());
+ std::string output_dex = tmp_dir + "classes.dex.new";
+
+ std::string dexlayout = GetTestAndroidRoot() + "/bin/dexlayout";
+ EXPECT_TRUE(OS::FileExists(dexlayout.c_str())) << dexlayout << " should be a valid file path";
+
+ std::vector<std::string> dexlayout_exec_argv =
+ { dexlayout, "-w", tmp_dir, "-o", tmp_name, "-p", profile_file, dex_file };
+ if (!::art::Exec(dexlayout_exec_argv, error_msg)) {
+ return false;
+ }
+ std::vector<std::string> diff_exec_argv =
+ { "/usr/bin/diff", expected_output, output_dex };
+ if (!::art::Exec(diff_exec_argv, error_msg)) {
+ return false;
+ }
+
+ std::vector<std::string> rm_exec_argv =
+ { "/bin/rm", dex_file, profile_file, expected_output, output_dex };
+ if (!::art::Exec(rm_exec_argv, error_msg)) {
+ return false;
+ }
return true;
}
};
@@ -125,4 +204,11 @@
ASSERT_TRUE(DexFileOutputExec(&error_msg)) << error_msg;
}
+TEST_F(DexLayoutTest, DexFileLayout) {
+ // Disable test on target.
+ TEST_DISABLED_FOR_TARGET();
+ std::string error_msg;
+ ASSERT_TRUE(DexFileLayoutExec(&error_msg)) << error_msg;
+}
+
} // namespace art
diff --git a/dexlist/dexlist.cc b/dexlist/dexlist.cc
index 68473c4..efe1aad 100644
--- a/dexlist/dexlist.cc
+++ b/dexlist/dexlist.cc
@@ -140,7 +140,7 @@
const DexFile::ClassDef& pClassDef = pDexFile->GetClassDef(idx);
const char* fileName;
- if (pClassDef.source_file_idx_ == DexFile::kDexNoIndex) {
+ if (!pClassDef.source_file_idx_.IsValid()) {
fileName = nullptr;
} else {
fileName = pDexFile->StringDataByIdx(pClassDef.source_file_idx_);
diff --git a/dexlist/dexlist_test.cc b/dexlist/dexlist_test.cc
index da1dd7f..1320942 100644
--- a/dexlist/dexlist_test.cc
+++ b/dexlist/dexlist_test.cc
@@ -21,7 +21,6 @@
#include <sys/types.h>
#include <unistd.h>
-#include "base/stringprintf.h"
#include "common_runtime_test.h"
#include "runtime/arch/instruction_set.h"
#include "runtime/gc/heap.h"
diff --git a/disassembler/disassembler_arm.cc b/disassembler/disassembler_arm.cc
index 30b708c..3347dac 100644
--- a/disassembler/disassembler_arm.cc
+++ b/disassembler/disassembler_arm.cc
@@ -63,9 +63,7 @@
case kVld2Location:
case kVld3Location:
case kVld4Location: {
- const uintptr_t pc_delta = disasm_->IsT32()
- ? vixl::aarch32::kT32PcDelta
- : vixl::aarch32::kA32PcDelta;
+ const uintptr_t pc_delta = label.GetLabel()->GetPcOffset();
const int32_t offset = label.GetLabel()->GetLocation();
os() << "[pc, #" << offset - pc_delta << "]";
@@ -77,7 +75,7 @@
}
}
- DisassemblerStream& operator<<(const vixl::aarch32::Register reg) OVERRIDE {
+ DisassemblerStream& operator<<(vixl::aarch32::Register reg) OVERRIDE {
if (reg.Is(tr)) {
os() << "tr";
return *this;
@@ -118,20 +116,11 @@
CustomDisassembler(std::ostream& os, const DisassemblerOptions* options)
: PrintDisassembler(&disassembler_stream_), disassembler_stream_(os, this, options) {}
- void PrintPc(uint32_t prog_ctr) OVERRIDE {
+ void PrintCodeAddress(uint32_t prog_ctr) OVERRIDE {
os() << "0x" << std::hex << std::setw(8) << std::setfill('0') << prog_ctr << ": ";
}
- bool IsT32() const {
- return is_t32_;
- }
-
- void SetT32(bool is_t32) {
- is_t32_ = is_t32;
- }
-
private:
- bool is_t32_;
CustomDisassemblerStream disassembler_stream_;
};
@@ -152,7 +141,7 @@
sizeof(unaligned_float), sizeof(unaligned_double)};
const uintptr_t begin = reinterpret_cast<uintptr_t>(options_->base_address_);
const uintptr_t end = reinterpret_cast<uintptr_t>(options_->end_address_);
- uintptr_t literal_addr = RoundDown(disasm_->GetPc(), vixl::aarch32::kRegSizeInBytes) + offset;
+ uintptr_t literal_addr = RoundDown(disasm_->GetCodeAddress(), vixl::aarch32::kRegSizeInBytes) + offset;
if (!options_->absolute_addresses_) {
literal_addr += begin;
@@ -208,12 +197,14 @@
// Remove the Thumb specifier bit; no effect if begin does not point to T32 code.
const uintptr_t instr_ptr = reinterpret_cast<uintptr_t>(begin) & ~1;
- disasm_->SetT32((reinterpret_cast<uintptr_t>(begin) & 1) != 0);
- disasm_->JumpToPc(GetPc(instr_ptr));
+ const bool is_t32 = (reinterpret_cast<uintptr_t>(begin) & 1) != 0;
+ disasm_->SetCodeAddress(GetPc(instr_ptr));
- if (disasm_->IsT32()) {
+ if (is_t32) {
const uint16_t* const ip = reinterpret_cast<const uint16_t*>(instr_ptr);
- next = reinterpret_cast<uintptr_t>(disasm_->DecodeT32At(ip));
+ const uint16_t* const end_address = reinterpret_cast<const uint16_t*>(
+ GetDisassemblerOptions()->end_address_);
+ next = reinterpret_cast<uintptr_t>(disasm_->DecodeT32At(ip, end_address));
} else {
const uint32_t* const ip = reinterpret_cast<const uint32_t*>(instr_ptr);
next = reinterpret_cast<uintptr_t>(disasm_->DecodeA32At(ip));
@@ -230,10 +221,10 @@
// Remove the Thumb specifier bit; no effect if begin does not point to T32 code.
const uintptr_t base = reinterpret_cast<uintptr_t>(begin) & ~1;
- disasm_->SetT32((reinterpret_cast<uintptr_t>(begin) & 1) != 0);
- disasm_->JumpToPc(GetPc(base));
+ const bool is_t32 = (reinterpret_cast<uintptr_t>(begin) & 1) != 0;
+ disasm_->SetCodeAddress(GetPc(base));
- if (disasm_->IsT32()) {
+ if (is_t32) {
// The Thumb specifier bits cancel each other.
disasm_->DisassembleT32Buffer(reinterpret_cast<const uint16_t*>(base), end - begin);
} else {
diff --git a/disassembler/disassembler_mips.cc b/disassembler/disassembler_mips.cc
index 4787395..c82600b 100644
--- a/disassembler/disassembler_mips.cc
+++ b/disassembler/disassembler_mips.cc
@@ -22,6 +22,8 @@
#include "android-base/logging.h"
#include "android-base/stringprintf.h"
+#include "base/bit_utils.h"
+
using android::base::StringPrintf;
namespace art {
@@ -154,6 +156,7 @@
{ kSpecial3Mask | 0x3f, (31 << kOpcodeShift), "ext", "TSAZ", },
{ kSpecial3Mask | 0x3f, (31 << kOpcodeShift) | 3, "dext", "TSAZ", },
{ kSpecial3Mask | 0x3f, (31 << kOpcodeShift) | 4, "ins", "TSAz", },
+ { kSpecial3Mask | 0x3f, (31 << kOpcodeShift) | 6, "dinsu", "TSFz", },
{ kSpecial3Mask | (0x1f << 21) | (0x1f << 6) | 0x3f,
(31 << kOpcodeShift) | (16 << 6) | 32,
"seb",
@@ -218,8 +221,8 @@
{ kITypeMask, 12 << kOpcodeShift, "andi", "TSi", },
{ kITypeMask, 13 << kOpcodeShift, "ori", "TSi", },
{ kITypeMask, 14 << kOpcodeShift, "xori", "TSi", },
- { kITypeMask | (0x1f << 21), 15 << kOpcodeShift, "lui", "TI", },
- { kITypeMask, 15 << kOpcodeShift, "aui", "TSI", },
+ { kITypeMask | (0x1f << 21), 15 << kOpcodeShift, "lui", "Ti", },
+ { kITypeMask, 15 << kOpcodeShift, "aui", "TSi", },
{ kITypeMask | (0x3e3 << 16), (17 << kOpcodeShift) | (8 << 21), "bc1f", "cB" },
{ kITypeMask | (0x3e3 << 16), (17 << kOpcodeShift) | (8 << 21) | (1 << 16), "bc1t", "cB" },
@@ -335,6 +338,8 @@
{ kITypeMask | (0x1f << 16), (59u << kOpcodeShift) | (30 << 16), "auipc", "Si" },
{ kITypeMask | (0x3 << 19), (59u << kOpcodeShift) | (0 << 19), "addiupc", "Sp" },
{ kITypeMask | (0x3 << 19), (59u << kOpcodeShift) | (1 << 19), "lwpc", "So" },
+ { kITypeMask | (0x3 << 19), (59u << kOpcodeShift) | (2 << 19), "lwupc", "So" },
+ { kITypeMask | (0x7 << 18), (59u << kOpcodeShift) | (6 << 18), "ldpc", "S0" },
{ kITypeMask, 61u << kOpcodeShift, "sdc1", "tO", },
{ kITypeMask | (0x1f << 21), 62u << kOpcodeShift, "jialc", "Ti" },
{ kITypeMask | (1 << 21), (62u << kOpcodeShift) | (1 << 21), "bnezc", "Sb" }, // TODO: de-dup?
@@ -468,6 +473,7 @@
case 'D': args << 'r' << rd; break;
case 'd': args << 'f' << rd; break;
case 'a': args << 'f' << sa; break;
+ case 'F': args << (sa + 32); break; // dinsu position.
case 'f': // Floating point "fmt".
{
size_t fmt = (instruction >> 21) & 0x7; // TODO: other fmts?
@@ -481,9 +487,6 @@
}
continue; // No ", ".
}
- case 'I': // Upper 16-bit immediate.
- args << reinterpret_cast<void*>((instruction & 0xffff) << 16);
- break;
case 'i': // Sign-extended lower 16-bit immediate.
args << static_cast<int16_t>(instruction & 0xffff);
break;
@@ -512,7 +515,7 @@
}
}
break;
- case 'o': // 19-bit offset in lwpc.
+ case 'o': // 19-bit offset in lwpc and lwupc.
{
int32_t offset = (instruction & 0x7ffff) - ((instruction & 0x40000) << 1);
offset <<= 2;
@@ -520,6 +523,15 @@
args << StringPrintf(" ; %+d", offset);
}
break;
+ case '0': // 18-bit offset in ldpc.
+ {
+ int32_t offset = (instruction & 0x3ffff) - ((instruction & 0x20000) << 1);
+ offset <<= 3;
+ uintptr_t ptr = RoundDown(reinterpret_cast<uintptr_t>(instr_ptr), 8);
+ args << FormatInstructionPointer(reinterpret_cast<const uint8_t*>(ptr + offset));
+ args << StringPrintf(" ; %+d", offset);
+ }
+ break;
case 'P': // 26-bit offset in bc and balc.
{
int32_t offset = (instruction & 0x3ffffff) - ((instruction & 0x2000000) << 1);
@@ -541,7 +553,7 @@
case 'T': args << 'r' << rt; break;
case 't': args << 'f' << rt; break;
case 'Z': args << (rd + 1); break; // sz ([d]ext size).
- case 'z': args << (rd - sa + 1); break; // sz ([d]ins size).
+ case 'z': args << (rd - sa + 1); break; // sz ([d]ins, dinsu size).
}
if (*(args_fmt + 1)) {
args << ", ";
@@ -551,17 +563,14 @@
}
}
- // TODO: Simplify this once these sequences are simplified in the compiler.
// Special cases for sequences of:
// pc-relative +/- 2GB branch:
// auipc reg, imm
// jic reg, imm
// pc-relative +/- 2GB branch and link:
// auipc reg, imm
- // daddiu reg, reg, imm
- // jialc reg, 0
- if (((op == 0x36 && rs == 0 && rt != 0) || // jic
- (op == 0x19 && rs == rt && rt != 0)) && // daddiu
+ // jialc reg, imm
+ if (((op == 0x36 || op == 0x3E) && rs == 0 && rt != 0) && // ji[al]c
last_ptr_ && (intptr_t)instr_ptr - (intptr_t)last_ptr_ == 4 &&
(last_instr_ & 0xFC1F0000) == 0xEC1E0000 && // auipc
((last_instr_ >> 21) & 0x1F) == rt) {
@@ -569,9 +578,9 @@
offset -= (offset & 0x8000) << 1;
offset -= 4;
if (op == 0x36) {
- args << " ; b ";
+ args << " ; bc ";
} else {
- args << " ; move r" << rt << ", ";
+ args << " ; balc ";
}
args << FormatInstructionPointer(instr_ptr + (int32_t)offset);
args << StringPrintf(" ; %+d", (int32_t)offset);
diff --git a/imgdiag/imgdiag.cc b/imgdiag/imgdiag.cc
index a374686..f307cbc 100644
--- a/imgdiag/imgdiag.cc
+++ b/imgdiag/imgdiag.cc
@@ -26,9 +26,10 @@
#include <map>
#include <unordered_set>
+#include "android-base/stringprintf.h"
+
#include "art_method-inl.h"
#include "base/unix_file/fd_file.h"
-#include "base/stringprintf.h"
#include "gc/space/image_space.h"
#include "gc/heap.h"
#include "mirror/class-inl.h"
@@ -46,6 +47,8 @@
namespace art {
+using android::base::StringPrintf;
+
class ImgDiagDumper {
public:
explicit ImgDiagDumper(std::ostream* os,
diff --git a/imgdiag/imgdiag_test.cc b/imgdiag/imgdiag_test.cc
index 9f771ba..3f2afc0 100644
--- a/imgdiag/imgdiag_test.cc
+++ b/imgdiag/imgdiag_test.cc
@@ -20,12 +20,13 @@
#include "common_runtime_test.h"
+#include "android-base/stringprintf.h"
+
#include "runtime/os.h"
#include "runtime/arch/instruction_set.h"
#include "runtime/utils.h"
#include "runtime/gc/space/image_space.h"
#include "runtime/gc/heap.h"
-#include "base/stringprintf.h"
#include <sys/types.h>
#include <unistd.h>
@@ -57,7 +58,7 @@
virtual void SetUpRuntimeOptions(RuntimeOptions* options) OVERRIDE {
// Needs to live until CommonRuntimeTest::SetUp finishes, since we pass it a cstring.
- runtime_args_image_ = StringPrintf("-Ximage:%s", GetCoreArtLocation().c_str());
+ runtime_args_image_ = android::base::StringPrintf("-Ximage:%s", GetCoreArtLocation().c_str());
options->push_back(std::make_pair(runtime_args_image_, nullptr));
}
diff --git a/oatdump/Android.bp b/oatdump/Android.bp
index bbe6cc1..f1fcf3d 100644
--- a/oatdump/Android.bp
+++ b/oatdump/Android.bp
@@ -54,13 +54,22 @@
art_cc_binary {
name: "oatdumps",
- defaults: ["oatdump-defaults"],
device_supported: false,
+ static_executable: true,
+ defaults: ["oatdump-defaults"],
target: {
darwin: {
enabled: false,
},
},
+ ldflags: [
+ // We need this because GC stress mode makes use of
+ // _Unwind_GetIP and _Unwind_Backtrace and the symbols are also
+ // defined in libgcc_eh.a(unwind-dw2.o)
+ // TODO: Having this is not ideal as it might obscure errors.
+ // Try to get rid of it.
+ "-z muldefs",
+ ],
static_libs: [
"libart",
"libart-compiler",
@@ -72,16 +81,25 @@
art_cc_binary {
name: "oatdumpds",
+ device_supported: false,
+ static_executable: true,
defaults: [
"art_debug_defaults",
"oatdump-defaults",
],
- device_supported: false,
target: {
darwin: {
enabled: false,
},
},
+ ldflags: [
+ // We need this because GC stress mode makes use of
+ // _Unwind_GetIP and _Unwind_Backtrace and the symbols are also
+ // defined in libgcc_eh.a(unwind-dw2.o)
+ // TODO: Having this is not ideal as it might obscure errors.
+ // Try to get rid of it.
+ "-z muldefs",
+ ],
static_libs: [
"libartd",
"libartd-compiler",
diff --git a/oatdump/oatdump.cc b/oatdump/oatdump.cc
index 4c01c14..148ee88 100644
--- a/oatdump/oatdump.cc
+++ b/oatdump/oatdump.cc
@@ -26,6 +26,9 @@
#include <unordered_set>
#include <vector>
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
#include "arch/instruction_set_features.h"
#include "art_field-inl.h"
#include "art_method-inl.h"
@@ -74,6 +77,8 @@
namespace art {
+using android::base::StringPrintf;
+
const char* image_methods_descriptions_[] = {
"kResolutionMethod",
"kImtConflictMethod",
@@ -87,6 +92,7 @@
const char* image_roots_descriptions_[] = {
"kDexCaches",
"kClassRoots",
+ "kClassLoader",
};
// Map is so that we don't allocate multiple dex files for the same OatDexFile.
@@ -668,6 +674,12 @@
}
private:
+ // All of the elements from one container to another.
+ template <typename Dest, typename Src>
+ static void AddAll(Dest& dest, const Src& src) {
+ dest.insert(src.begin(), src.end());
+ }
+
void WalkClass(const DexFile& dex_file, const DexFile::ClassDef& class_def) {
const uint8_t* class_data = dex_file.GetClassData(class_def);
if (class_data == nullptr) { // empty class such as a marker interface?
@@ -703,13 +715,13 @@
const Instruction* inst = Instruction::At(code_ptr);
switch (inst->Opcode()) {
case Instruction::CONST_STRING: {
- const uint32_t string_index = inst->VRegB_21c();
+ const dex::StringIndex string_index(inst->VRegB_21c());
unique_string_ids_from_code_.insert(StringReference(&dex_file, string_index));
++num_string_ids_from_code_;
break;
}
case Instruction::CONST_STRING_JUMBO: {
- const uint32_t string_index = inst->VRegB_31c();
+ const dex::StringIndex string_index(inst->VRegB_31c());
unique_string_ids_from_code_.insert(StringReference(&dex_file, string_index));
++num_string_ids_from_code_;
break;
@@ -794,7 +806,7 @@
uint32_t oat_class_offset = oat_dex_file.GetOatClassOffset(class_def_index);
const OatFile::OatClass oat_class = oat_dex_file.GetOatClass(class_def_index);
os << StringPrintf("%zd: %s (offset=0x%08x) (type_idx=%d)",
- class_def_index, descriptor, oat_class_offset, class_def.class_idx_)
+ class_def_index, descriptor, oat_class_offset, class_def.class_idx_.index_)
<< " (" << oat_class.GetStatus() << ")"
<< " (" << oat_class.GetType() << ")\n";
// TODO: include bitmap here if type is kOatClassSomeCompiled?
@@ -1053,7 +1065,8 @@
if (options_.absolute_addresses_) {
vios->Stream() << StringPrintf("%p ", oat_method.GetVmapTable());
}
- uint32_t vmap_table_offset = method_header == nullptr ? 0 : method_header->vmap_table_offset_;
+ uint32_t vmap_table_offset = method_header ==
+ nullptr ? 0 : method_header->GetVmapTableOffset();
vios->Stream() << StringPrintf("(offset=0x%08x)\n", vmap_table_offset);
size_t vmap_table_offset_limit =
@@ -1497,12 +1510,13 @@
os << "ROOTS: " << reinterpret_cast<void*>(image_header_.GetImageRoots()) << "\n";
static_assert(arraysize(image_roots_descriptions_) ==
static_cast<size_t>(ImageHeader::kImageRootsMax), "sizes must match");
- for (int i = 0; i < ImageHeader::kImageRootsMax; i++) {
+ DCHECK_LE(image_header_.GetImageRoots()->GetLength(), ImageHeader::kImageRootsMax);
+ for (int32_t i = 0, size = image_header_.GetImageRoots()->GetLength(); i != size; ++i) {
ImageHeader::ImageRoot image_root = static_cast<ImageHeader::ImageRoot>(i);
const char* image_root_description = image_roots_descriptions_[i];
mirror::Object* image_root_object = image_header_.GetImageRoot(image_root);
indent_os << StringPrintf("%s: %p\n", image_root_description, image_root_object);
- if (image_root_object->IsObjectArray()) {
+ if (image_root_object != nullptr && image_root_object->IsObjectArray()) {
mirror::ObjectArray<mirror::Object>* image_root_object_array
= image_root_object->AsObjectArray<mirror::Object>();
ScopedIndentation indent2(&vios_);
@@ -1603,7 +1617,7 @@
// Mark dex caches.
dex_caches_.clear();
{
- ReaderMutexLock mu(self, *class_linker->DexLock());
+ ReaderMutexLock mu(self, *Locks::dex_lock_);
for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) {
ObjPtr<mirror::DexCache> dex_cache =
ObjPtr<mirror::DexCache>::DownCast(self->DecodeJObject(data.weak_root));
@@ -2951,7 +2965,7 @@
table_index++;
std::string p_name = ptr2->PrettyMethod(true);
- if (StartsWith(p_name, method.c_str())) {
+ if (android::base::StartsWith(p_name, method.c_str())) {
std::cerr << " Slot "
<< index
<< " ("
@@ -2964,7 +2978,7 @@
}
} else {
std::string p_name = ptr->PrettyMethod(true);
- if (StartsWith(p_name, method.c_str())) {
+ if (android::base::StartsWith(p_name, method.c_str())) {
std::cerr << " Slot " << index << " (1)" << std::endl;
std::cerr << " " << p_name << std::endl;
} else {
@@ -2977,7 +2991,7 @@
for (ArtMethod& iface_method : iface->GetMethods(pointer_size)) {
if (ImTable::GetImtIndex(&iface_method) == index) {
std::string i_name = iface_method.PrettyMethod(true);
- if (StartsWith(i_name, method.c_str())) {
+ if (android::base::StartsWith(i_name, method.c_str())) {
std::cerr << " Slot " << index << " (1)" << std::endl;
std::cerr << " " << p_name << " (" << i_name << ")" << std::endl;
}
@@ -2996,7 +3010,7 @@
while (in_stream.good()) {
std::string dot;
std::getline(in_stream, dot);
- if (StartsWith(dot, "#") || dot.empty()) {
+ if (android::base::StartsWith(dot, "#") || dot.empty()) {
continue;
}
output.push_back(dot);
diff --git a/oatdump/oatdump_test.cc b/oatdump/oatdump_test.cc
index 22db818..e77d03b 100644
--- a/oatdump/oatdump_test.cc
+++ b/oatdump/oatdump_test.cc
@@ -18,9 +18,10 @@
#include <string>
#include <vector>
+#include "android-base/strings.h"
+
#include "common_runtime_test.h"
-#include "base/stringprintf.h"
#include "base/unix_file/fd_file.h"
#include "runtime/arch/instruction_set.h"
#include "runtime/gc/heap.h"
@@ -143,7 +144,7 @@
}
argv.push_back(nullptr);
UNUSED(execv(argv[0], &argv[0]));
- const std::string command_line(Join(exec_argv, ' '));
+ const std::string command_line(android::base::Join(exec_argv, ' '));
PLOG(ERROR) << "Failed to execv(" << command_line << ")";
// _exit to avoid atexit handlers in child.
_exit(1);
diff --git a/patchoat/patchoat.cc b/patchoat/patchoat.cc
index db28a3f..7ae13a5 100644
--- a/patchoat/patchoat.cc
+++ b/patchoat/patchoat.cc
@@ -24,12 +24,14 @@
#include <string>
#include <vector>
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
#include "art_field-inl.h"
#include "art_method-inl.h"
#include "base/dumpable.h"
#include "base/scoped_flock.h"
#include "base/stringpiece.h"
-#include "base/stringprintf.h"
#include "base/unix_file/fd_file.h"
#include "base/unix_file/random_access_file_utils.h"
#include "elf_utils.h"
@@ -286,8 +288,8 @@
std::string converted_image_filename = space->GetImageLocation();
std::replace(converted_image_filename.begin() + 1, converted_image_filename.end(), '/', '@');
std::string output_image_filename = output_directory +
- (StartsWith(converted_image_filename, "/") ? "" : "/") +
- converted_image_filename;
+ (android::base::StartsWith(converted_image_filename, "/") ? "" : "/") +
+ converted_image_filename;
std::string output_vdex_filename =
ImageHeader::GetVdexLocationFromImageLocation(output_image_filename);
std::string output_oat_filename =
@@ -343,8 +345,8 @@
std::string converted_image_filename = space->GetImageLocation();
std::replace(converted_image_filename.begin() + 1, converted_image_filename.end(), '/', '@');
std::string output_image_filename = output_directory +
- (StartsWith(converted_image_filename, "/") ? "" : "/") +
- converted_image_filename;
+ (android::base::StartsWith(converted_image_filename, "/") ? "" : "/") +
+ converted_image_filename;
bool new_oat_out;
std::unique_ptr<File>
output_image_file(CreateOrOpen(output_image_filename.c_str(), &new_oat_out));
@@ -605,8 +607,7 @@
ClassTable temp_table;
temp_table.ReadFromMemory(image_->Begin() + section.Offset());
FixupRootVisitor visitor(this);
- BufferedRootVisitor<kDefaultBufferedRootCount> buffered_visitor(&visitor, RootInfo(kRootUnknown));
- temp_table.VisitRoots(buffered_visitor);
+ temp_table.VisitRoots(UnbufferedRootVisitor(&visitor, RootInfo(kRootUnknown)));
}
@@ -933,12 +934,12 @@
for (int i = 0; i < orig_argc; ++i) {
command.push_back(orig_argv[i]);
}
- return Join(command, ' ');
+ return android::base::Join(command, ' ');
}
static void UsageErrorV(const char* fmt, va_list ap) {
std::string error;
- StringAppendV(&error, fmt, ap);
+ android::base::StringAppendV(&error, fmt, ap);
LOG(ERROR) << error;
}
diff --git a/profman/profile_assistant_test.cc b/profman/profile_assistant_test.cc
index cd0aa6f..776c31a 100644
--- a/profman/profile_assistant_test.cc
+++ b/profman/profile_assistant_test.cc
@@ -42,7 +42,7 @@
ASSERT_TRUE(info->AddMethodIndex(dex_location2, dex_location_checksum2, i));
}
for (uint16_t i = 0; i < number_of_classes; i++) {
- ASSERT_TRUE(info->AddClassIndex(dex_location1, dex_location_checksum1, i));
+ ASSERT_TRUE(info->AddClassIndex(dex_location1, dex_location_checksum1, dex::TypeIndex(i)));
}
ASSERT_TRUE(info->Save(GetFd(profile)));
diff --git a/profman/profman.cc b/profman/profman.cc
index bfef834..e538407 100644
--- a/profman/profman.cc
+++ b/profman/profman.cc
@@ -25,10 +25,12 @@
#include <string>
#include <vector>
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
#include "base/dumpable.h"
#include "base/scoped_flock.h"
#include "base/stringpiece.h"
-#include "base/stringprintf.h"
#include "base/time_utils.h"
#include "base/unix_file/fd_file.h"
#include "dex_file.h"
@@ -48,7 +50,7 @@
for (int i = 0; i < original_argc; ++i) {
command.push_back(original_argv[i]);
}
- return Join(command, ' ');
+ return android::base::Join(command, ' ');
}
static constexpr int kInvalidFd = -1;
@@ -59,7 +61,7 @@
static void UsageErrorV(const char* fmt, va_list ap) {
std::string error;
- StringAppendV(&error, fmt, ap);
+ android::base::StringAppendV(&error, fmt, ap);
LOG(ERROR) << error;
}
diff --git a/runtime/Android.bp b/runtime/Android.bp
index c6f479f..86019bf 100644
--- a/runtime/Android.bp
+++ b/runtime/Android.bp
@@ -40,11 +40,11 @@
"base/scoped_arena_allocator.cc",
"base/scoped_flock.cc",
"base/stringpiece.cc",
- "base/stringprintf.cc",
"base/time_utils.cc",
"base/timing_logger.cc",
"base/unix_file/fd_file.cc",
"base/unix_file/random_access_file_utils.cc",
+ "cha.cc",
"check_jni.cc",
"class_linker.cc",
"class_table.cc",
@@ -507,14 +507,15 @@
"base/histogram_test.cc",
"base/mutex_test.cc",
"base/scoped_flock_test.cc",
- "base/stringprintf_test.cc",
"base/time_utils_test.cc",
"base/timing_logger_test.cc",
"base/transform_array_ref_test.cc",
"base/transform_iterator_test.cc",
"base/variant_map_test.cc",
"base/unix_file/fd_file_test.cc",
+ "cha_test.cc",
"class_linker_test.cc",
+ "class_table_test.cc",
"compiler_filter_test.cc",
"dex_file_test.cc",
"dex_file_verifier_test.cc",
diff --git a/runtime/arch/arm/instruction_set_features_arm.cc b/runtime/arch/arm/instruction_set_features_arm.cc
index c81a93c..181b2ed 100644
--- a/runtime/arch/arm/instruction_set_features_arm.cc
+++ b/runtime/arch/arm/instruction_set_features_arm.cc
@@ -24,8 +24,10 @@
#include "signal.h"
#include <fstream>
-#include "base/stringprintf.h"
-#include "utils.h" // For Trim.
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
+#include "base/logging.h"
#if defined(__arm__)
extern "C" bool artCheckForArmSdivInstruction();
@@ -33,6 +35,8 @@
namespace art {
+using android::base::StringPrintf;
+
ArmFeaturesUniquePtr ArmInstructionSetFeatures::FromVariant(
const std::string& variant, std::string* error_msg) {
// Assume all ARM processors are SMP.
@@ -271,7 +275,7 @@
bool has_atomic_ldrd_strd = has_atomic_ldrd_strd_;
bool has_div = has_div_;
for (auto i = features.begin(); i != features.end(); i++) {
- std::string feature = Trim(*i);
+ std::string feature = android::base::Trim(*i);
if (feature == "div") {
has_div = true;
} else if (feature == "-div") {
diff --git a/runtime/arch/arm/quick_entrypoints_arm.S b/runtime/arch/arm/quick_entrypoints_arm.S
index 3a83eaf..a71ab4b 100644
--- a/runtime/arch/arm/quick_entrypoints_arm.S
+++ b/runtime/arch/arm/quick_entrypoints_arm.S
@@ -1109,62 +1109,7 @@
*/
ENTRY art_quick_resolve_string
- push {r10-r12, lr}
- .cfi_adjust_cfa_offset 16
- .cfi_rel_offset r10, 0
- .cfi_rel_offset r11, 4
- .cfi_rel_offset ip, 8
- .cfi_rel_offset lr, 12
- ldr r10, [sp, #16] @ load referrer
- ldr r10, [r10, #ART_METHOD_DECLARING_CLASS_OFFSET] @ load declaring class
- ldr r10, [r10, #DECLARING_CLASS_DEX_CACHE_STRINGS_OFFSET] @ load string dex cache
- ubfx r11, r0, #0, #STRING_DEX_CACHE_HASH_BITS
- add r10, r10, r11, LSL #STRING_DEX_CACHE_ELEMENT_SIZE_SHIFT
- ldrd r10, r11, [r10] @ load index into r11 and pointer into r10
- cmp r0, r11
- bne .Lart_quick_resolve_string_slow_path
-#ifdef USE_READ_BARRIER
- ldr r0, [rSELF, #THREAD_IS_GC_MARKING_OFFSET]
- cbnz r0, .Lart_quick_resolve_string_marking
-.Lart_quick_resolve_string_no_rb:
-#endif
- mov r0, r10
- pop {r10-r12, pc}
-
-#ifdef USE_READ_BARRIER
-// GC is marking case, need to check the mark bit.
-.Lart_quick_resolve_string_marking:
- ldr r0, [r10, MIRROR_OBJECT_LOCK_WORD_OFFSET]
- lsrs r0, #(LOCK_WORD_MARK_BIT_SHIFT + 1)
- bcs .Lart_quick_resolve_string_no_rb
- mov r0, r10
- .cfi_remember_state
- pop {r10-r12, lr}
- .cfi_adjust_cfa_offset -16
- .cfi_restore r10
- .cfi_restore r11
- .cfi_restore r12
- .cfi_restore lr
- // Note: art_quick_read_barrier_mark_reg00 clobbers IP but the .Lslow_rb_* does not.
- b .Lslow_rb_art_quick_read_barrier_mark_reg00 @ Get the marked string back.
- .cfi_restore_state
-#endif
-
-// Slow path case, the index did not match
-.Lart_quick_resolve_string_slow_path:
- push {r0-r9} @ 10 words of callee saves and args; {r10-r12, lr} already saved.
- .cfi_adjust_cfa_offset 40
- .cfi_rel_offset r0, 0
- .cfi_rel_offset r1, 4
- .cfi_rel_offset r2, 8
- .cfi_rel_offset r3, 12
- .cfi_rel_offset r4, 16
- .cfi_rel_offset r5, 20
- .cfi_rel_offset r6, 24
- .cfi_rel_offset r7, 28
- .cfi_rel_offset r8, 32
- .cfi_rel_offset r9, 36
- SETUP_SAVE_EVERYTHING_FRAME_CORE_REGS_SAVED r1 @ save callee saves in case of GC
+ SETUP_SAVE_EVERYTHING_FRAME r1 @ save everything in case of GC
mov r1, r9 @ pass Thread::Current
bl artResolveStringFromCode @ (uint32_t type_idx, Thread*)
cbz r0, 1f @ If result is null, deliver the OOME.
diff --git a/runtime/arch/arm64/instruction_set_features_arm64.cc b/runtime/arch/arm64/instruction_set_features_arm64.cc
index 4e7dea3..52d8b3e 100644
--- a/runtime/arch/arm64/instruction_set_features_arm64.cc
+++ b/runtime/arch/arm64/instruction_set_features_arm64.cc
@@ -19,12 +19,16 @@
#include <fstream>
#include <sstream>
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
+#include "base/logging.h"
#include "base/stl_util.h"
-#include "base/stringprintf.h"
-#include "utils.h" // For Trim.
namespace art {
+using android::base::StringPrintf;
+
Arm64FeaturesUniquePtr Arm64InstructionSetFeatures::FromVariant(
const std::string& variant, std::string* error_msg) {
const bool smp = true; // Conservative default.
@@ -137,7 +141,7 @@
const bool smp, const std::vector<std::string>& features, std::string* error_msg) const {
bool is_a53 = fix_cortex_a53_835769_;
for (auto i = features.begin(); i != features.end(); i++) {
- std::string feature = Trim(*i);
+ std::string feature = android::base::Trim(*i);
if (feature == "a53") {
is_a53 = true;
} else if (feature == "-a53") {
diff --git a/runtime/arch/arm64/quick_entrypoints_arm64.S b/runtime/arch/arm64/quick_entrypoints_arm64.S
index 73bca03..b88515f 100644
--- a/runtime/arch/arm64/quick_entrypoints_arm64.S
+++ b/runtime/arch/arm64/quick_entrypoints_arm64.S
@@ -1317,6 +1317,7 @@
RESTORE_TWO_REGS_DECREASE_FRAME x0, x1, 32
ret
.cfi_restore_state // Reset unwind info so following code unwinds.
+ .cfi_def_cfa_offset 32 // workaround for clang bug: 31975598
.Lthrow_class_cast_exception:
// Restore
@@ -1484,6 +1485,7 @@
strb w3, [x3, x0]
ret
.cfi_restore_state // Reset unwind info so following code unwinds.
+ .cfi_def_cfa_offset 32 // workaround for clang bug: 31975598
.Lthrow_array_store_exception:
RESTORE_TWO_REGS x2, xLR, 16
RESTORE_TWO_REGS_DECREASE_FRAME x0, x1, 32
@@ -1651,44 +1653,7 @@
*/
ENTRY art_quick_resolve_string
- SAVE_TWO_REGS_INCREASE_FRAME x29, xLR, 2 * __SIZEOF_POINTER__
- ldr x29, [sp, #(2 * __SIZEOF_POINTER__)] // load referrer
- ldr w29, [x29, #ART_METHOD_DECLARING_CLASS_OFFSET] // load declaring class
- ldr x29, [x29, #DECLARING_CLASS_DEX_CACHE_STRINGS_OFFSET] // load string dex cache
- ubfx lr, x0, #0, #STRING_DEX_CACHE_HASH_BITS // get masked string index into LR
- ldr x29, [x29, lr, lsl #STRING_DEX_CACHE_ELEMENT_SIZE_SHIFT] // load dex cache pair into x29
- cmp x0, x29, lsr #32 // compare against upper 32 bits
- bne .Lart_quick_resolve_string_slow_path
- ubfx x0, x29, #0, #32 // extract lower 32 bits into x0
-#ifdef USE_READ_BARRIER
- // Most common case: GC is not marking.
- ldr w29, [xSELF, #THREAD_IS_GC_MARKING_OFFSET]
- cbnz x29, .Lart_quick_resolve_string_marking
-.Lart_quick_resolve_string_no_rb:
-#endif
- .cfi_remember_state
- RESTORE_TWO_REGS_DECREASE_FRAME x29, xLR, 2 * __SIZEOF_POINTER__
- ret
- .cfi_restore_state
- .cfi_def_cfa_offset 16 // workaround for clang bug: 31975598
-
-#ifdef USE_READ_BARRIER
-// GC is marking case, need to check the mark bit.
-.Lart_quick_resolve_string_marking:
- ldr x29, [x0, #MIRROR_OBJECT_LOCK_WORD_OFFSET]
- tbnz x29, #LOCK_WORD_MARK_BIT_SHIFT, .Lart_quick_resolve_string_no_rb
- .cfi_remember_state
- RESTORE_TWO_REGS_DECREASE_FRAME x29, xLR, 2 * __SIZEOF_POINTER__
- // Note: art_quick_read_barrier_mark_reg00 clobbers IP0 but the .Lslow_rb_* does not.
- b .Lslow_rb_art_quick_read_barrier_mark_reg00 // Get the marked string back.
- .cfi_restore_state
- .cfi_def_cfa_offset 16 // workaround for clang bug: 31975598
-#endif
-
-// Slow path case, the index did not match.
-.Lart_quick_resolve_string_slow_path:
- INCREASE_FRAME (FRAME_SIZE_SAVE_EVERYTHING - 2 * __SIZEOF_POINTER__)
- SETUP_SAVE_EVERYTHING_FRAME_DECREMENTED_SP_SKIP_X29_LR // save callee saves in case of GC
+ SETUP_SAVE_EVERYTHING_FRAME // save everything for stack crawl
mov x1, xSELF // pass Thread::Current
bl artResolveStringFromCode // (int32_t string_idx, Thread* self)
cbz w0, 1f // If result is null, deliver the OOME.
diff --git a/runtime/arch/instruction_set_features.cc b/runtime/arch/instruction_set_features.cc
index b32391f..db004e7 100644
--- a/runtime/arch/instruction_set_features.cc
+++ b/runtime/arch/instruction_set_features.cc
@@ -16,6 +16,8 @@
#include "instruction_set_features.h"
+#include "android-base/strings.h"
+
#include "base/casts.h"
#include "utils.h"
@@ -224,7 +226,7 @@
*error_msg = "Unexpected instruction set features after 'default'";
return std::unique_ptr<const InstructionSetFeatures>();
}
- std::string feature = Trim(*it);
+ std::string feature = android::base::Trim(*it);
bool erase = false;
if (feature == "default") {
if (!first) {
diff --git a/runtime/arch/instruction_set_features_test.cc b/runtime/arch/instruction_set_features_test.cc
index 0b8e531..d489392 100644
--- a/runtime/arch/instruction_set_features_test.cc
+++ b/runtime/arch/instruction_set_features_test.cc
@@ -22,11 +22,14 @@
#include "android-base/properties.h"
#endif
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
-#include "base/stringprintf.h"
namespace art {
+using android::base::StringPrintf;
+
#ifdef ART_TARGET_ANDROID
#if defined(__aarch64__)
TEST(InstructionSetFeaturesTest, DISABLED_FeaturesFromSystemPropertyVariant) {
diff --git a/runtime/arch/instruction_set_test.cc b/runtime/arch/instruction_set_test.cc
index 5dfc4b4..5aae93a 100644
--- a/runtime/arch/instruction_set_test.cc
+++ b/runtime/arch/instruction_set_test.cc
@@ -19,7 +19,6 @@
#include <gtest/gtest.h>
#include "base/enums.h"
-#include "base/stringprintf.h"
namespace art {
diff --git a/runtime/arch/mips/asm_support_mips.h b/runtime/arch/mips/asm_support_mips.h
index 135b074..7437774 100644
--- a/runtime/arch/mips/asm_support_mips.h
+++ b/runtime/arch/mips/asm_support_mips.h
@@ -21,7 +21,7 @@
#define FRAME_SIZE_SAVE_ALL_CALLEE_SAVES 96
#define FRAME_SIZE_SAVE_REFS_ONLY 48
-#define FRAME_SIZE_SAVE_REFS_AND_ARGS 80
+#define FRAME_SIZE_SAVE_REFS_AND_ARGS 112
#define FRAME_SIZE_SAVE_EVERYTHING 256
#endif // ART_RUNTIME_ARCH_MIPS_ASM_SUPPORT_MIPS_H_
diff --git a/runtime/arch/mips/context_mips.cc b/runtime/arch/mips/context_mips.cc
index 375a03a..98ed5e6 100644
--- a/runtime/arch/mips/context_mips.cc
+++ b/runtime/arch/mips/context_mips.cc
@@ -75,11 +75,21 @@
gprs_[A1] = nullptr;
gprs_[A2] = nullptr;
gprs_[A3] = nullptr;
+ gprs_[T0] = nullptr;
+ gprs_[T1] = nullptr;
+ fprs_[F8] = nullptr;
+ fprs_[F9] = nullptr;
+ fprs_[F10] = nullptr;
+ fprs_[F11] = nullptr;
fprs_[F12] = nullptr;
fprs_[F13] = nullptr;
fprs_[F14] = nullptr;
fprs_[F15] = nullptr;
+ fprs_[F16] = nullptr;
+ fprs_[F17] = nullptr;
+ fprs_[F18] = nullptr;
+ fprs_[F19] = nullptr;
}
extern "C" NO_RETURN void art_quick_do_long_jump(uint32_t*, uint32_t*);
diff --git a/runtime/arch/mips/entrypoints_init_mips.cc b/runtime/arch/mips/entrypoints_init_mips.cc
index 6a442a5..5c56923 100644
--- a/runtime/arch/mips/entrypoints_init_mips.cc
+++ b/runtime/arch/mips/entrypoints_init_mips.cc
@@ -71,7 +71,7 @@
jpoints->pDlsymLookup = art_jni_dlsym_lookup_stub;
// Alloc
- ResetQuickAllocEntryPoints(qpoints);
+ ResetQuickAllocEntryPoints(qpoints, /*is_marking*/ false);
// Cast
qpoints->pInstanceofNonTrivial = artInstanceOfFromCode;
diff --git a/runtime/arch/mips/instruction_set_features_mips.cc b/runtime/arch/mips/instruction_set_features_mips.cc
index a95b6f6..5b50573 100644
--- a/runtime/arch/mips/instruction_set_features_mips.cc
+++ b/runtime/arch/mips/instruction_set_features_mips.cc
@@ -19,12 +19,16 @@
#include <fstream>
#include <sstream>
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
+#include "base/logging.h"
#include "base/stl_util.h"
-#include "base/stringprintf.h"
-#include "utils.h" // For Trim.
namespace art {
+using android::base::StringPrintf;
+
// An enum for the Mips revision.
enum class MipsLevel {
kBase,
@@ -210,7 +214,7 @@
bool mips_isa_gte2 = mips_isa_gte2_;
bool r6 = r6_;
for (auto i = features.begin(); i != features.end(); i++) {
- std::string feature = Trim(*i);
+ std::string feature = android::base::Trim(*i);
if (feature == "fpu32") {
fpu_32bit = true;
} else if (feature == "-fpu32") {
diff --git a/runtime/arch/mips/quick_entrypoints_mips.S b/runtime/arch/mips/quick_entrypoints_mips.S
index 34e34b4..3e8cdc9 100644
--- a/runtime/arch/mips/quick_entrypoints_mips.S
+++ b/runtime/arch/mips/quick_entrypoints_mips.S
@@ -167,50 +167,60 @@
/*
* Macro that sets up the callee save frame to conform with
* Runtime::CreateCalleeSaveMethod(kSaveRefsAndArgs).
- * callee-save: $a1-$a3, $s2-$s8 + $gp + $ra, 12 total + 3 words padding + method*
+ * callee-save: $a1-$a3, $t0-$t1, $s2-$s8, $gp, $ra, $f8-$f19
+ * (26 total + 1 word padding + method*)
*/
.macro SETUP_SAVE_REFS_AND_ARGS_FRAME_REGISTERS_ONLY
- addiu $sp, $sp, -80
- .cfi_adjust_cfa_offset 80
+ addiu $sp, $sp, -112
+ .cfi_adjust_cfa_offset 112
// Ugly compile-time check, but we only have the preprocessor.
-#if (FRAME_SIZE_SAVE_REFS_AND_ARGS != 80)
+#if (FRAME_SIZE_SAVE_REFS_AND_ARGS != 112)
#error "FRAME_SIZE_SAVE_REFS_AND_ARGS(MIPS) size not as expected."
#endif
- sw $ra, 76($sp)
- .cfi_rel_offset 31, 76
- sw $s8, 72($sp)
- .cfi_rel_offset 30, 72
- sw $gp, 68($sp)
- .cfi_rel_offset 28, 68
- sw $s7, 64($sp)
- .cfi_rel_offset 23, 64
- sw $s6, 60($sp)
- .cfi_rel_offset 22, 60
- sw $s5, 56($sp)
- .cfi_rel_offset 21, 56
- sw $s4, 52($sp)
- .cfi_rel_offset 20, 52
- sw $s3, 48($sp)
- .cfi_rel_offset 19, 48
- sw $s2, 44($sp)
- .cfi_rel_offset 18, 44
- sw $a3, 40($sp)
- .cfi_rel_offset 7, 40
- sw $a2, 36($sp)
- .cfi_rel_offset 6, 36
- sw $a1, 32($sp)
- .cfi_rel_offset 5, 32
- SDu $f14, $f15, 24, $sp, $t0
- SDu $f12, $f13, 16, $sp, $t0
+ sw $ra, 108($sp)
+ .cfi_rel_offset 31, 108
+ sw $s8, 104($sp)
+ .cfi_rel_offset 30, 104
+ sw $gp, 100($sp)
+ .cfi_rel_offset 28, 100
+ sw $s7, 96($sp)
+ .cfi_rel_offset 23, 96
+ sw $s6, 92($sp)
+ .cfi_rel_offset 22, 92
+ sw $s5, 88($sp)
+ .cfi_rel_offset 21, 88
+ sw $s4, 84($sp)
+ .cfi_rel_offset 20, 84
+ sw $s3, 80($sp)
+ .cfi_rel_offset 19, 80
+ sw $s2, 76($sp)
+ .cfi_rel_offset 18, 76
+ sw $t1, 72($sp)
+ .cfi_rel_offset 9, 72
+ sw $t0, 68($sp)
+ .cfi_rel_offset 8, 68
+ sw $a3, 64($sp)
+ .cfi_rel_offset 7, 64
+ sw $a2, 60($sp)
+ .cfi_rel_offset 6, 60
+ sw $a1, 56($sp)
+ .cfi_rel_offset 5, 56
+ SDu $f18, $f19, 48, $sp, $t8
+ SDu $f16, $f17, 40, $sp, $t8
+ SDu $f14, $f15, 32, $sp, $t8
+ SDu $f12, $f13, 24, $sp, $t8
+ SDu $f10, $f11, 16, $sp, $t8
+ SDu $f8, $f9, 8, $sp, $t8
# bottom will hold Method*
.endm
/*
* Macro that sets up the callee save frame to conform with
* Runtime::CreateCalleeSaveMethod(kSaveRefsAndArgs). Restoration assumes non-moving GC.
- * callee-save: $a1-$a3, $f12-$f15, $s2-$s8 + $gp + $ra, 12 total + 3 words padding + method*
+ * callee-save: $a1-$a3, $t0-$t1, $s2-$s8, $gp, $ra, $f8-$f19
+ * (26 total + 1 word padding + method*)
* Clobbers $t0 and $sp
* Allocates ARG_SLOT_SIZE bytes at the bottom of the stack for arg slots.
* Reserves FRAME_SIZE_SAVE_REFS_AND_ARGS + ARG_SLOT_SIZE bytes on the stack
@@ -229,7 +239,8 @@
/*
* Macro that sets up the callee save frame to conform with
* Runtime::CreateCalleeSaveMethod(kSaveRefsAndArgs). Restoration assumes non-moving GC.
- * callee-save: $a1-$a3, $f12-$f15, $s2-$s8 + $gp + $ra, 12 total + 3 words padding + method*
+ * callee-save: $a1-$a3, $t0-$t1, $s2-$s8, $gp, $ra, $f8-$f19
+ * (26 total + 1 word padding + method*)
* Clobbers $sp
* Use $a0 as the Method* and loads it into bottom of stack.
* Allocates ARG_SLOT_SIZE bytes at the bottom of the stack for arg slots.
@@ -246,34 +257,42 @@
.macro RESTORE_SAVE_REFS_AND_ARGS_FRAME
addiu $sp, $sp, ARG_SLOT_SIZE # remove argument slots on the stack
.cfi_adjust_cfa_offset -ARG_SLOT_SIZE
- lw $ra, 76($sp)
+ lw $ra, 108($sp)
.cfi_restore 31
- lw $s8, 72($sp)
+ lw $s8, 104($sp)
.cfi_restore 30
- lw $gp, 68($sp)
+ lw $gp, 100($sp)
.cfi_restore 28
- lw $s7, 64($sp)
+ lw $s7, 96($sp)
.cfi_restore 23
- lw $s6, 60($sp)
+ lw $s6, 92($sp)
.cfi_restore 22
- lw $s5, 56($sp)
+ lw $s5, 88($sp)
.cfi_restore 21
- lw $s4, 52($sp)
+ lw $s4, 84($sp)
.cfi_restore 20
- lw $s3, 48($sp)
+ lw $s3, 80($sp)
.cfi_restore 19
- lw $s2, 44($sp)
+ lw $s2, 76($sp)
.cfi_restore 18
- lw $a3, 40($sp)
+ lw $t1, 72($sp)
+ .cfi_restore 9
+ lw $t0, 68($sp)
+ .cfi_restore 8
+ lw $a3, 64($sp)
.cfi_restore 7
- lw $a2, 36($sp)
+ lw $a2, 60($sp)
.cfi_restore 6
- lw $a1, 32($sp)
+ lw $a1, 56($sp)
.cfi_restore 5
- LDu $f14, $f15, 24, $sp, $t1
- LDu $f12, $f13, 16, $sp, $t1
- addiu $sp, $sp, 80 # pop frame
- .cfi_adjust_cfa_offset -80
+ LDu $f18, $f19, 48, $sp, $t8
+ LDu $f16, $f17, 40, $sp, $t8
+ LDu $f14, $f15, 32, $sp, $t8
+ LDu $f12, $f13, 24, $sp, $t8
+ LDu $f10, $f11, 16, $sp, $t8
+ LDu $f8, $f9, 8, $sp, $t8
+ addiu $sp, $sp, 112 # pop frame
+ .cfi_adjust_cfa_offset -112
.endm
/*
@@ -824,30 +843,56 @@
INVOKE_TRAMPOLINE art_quick_invoke_super_trampoline_with_access_check, artInvokeSuperTrampolineWithAccessCheck
INVOKE_TRAMPOLINE art_quick_invoke_virtual_trampoline_with_access_check, artInvokeVirtualTrampolineWithAccessCheck
-.macro LOAD_WORD_TO_REG reg, next_arg, index, label
+// Each of the following macros expands into four instructions or 16 bytes.
+// They are used to build indexable "tables" of code.
+
+.macro LOAD_WORD_TO_REG reg, next_arg, index_reg, label
lw $\reg, -4($\next_arg) # next_arg points to argument after the current one (offset is 4)
b \label
- addiu $\index, 1
+ addiu $\index_reg, 16
+ .balign 16
.endm
-.macro LOAD_LONG_TO_REG reg1, reg2, next_arg, index, label
+.macro LOAD_LONG_TO_REG reg1, reg2, next_arg, index_reg, next_index, label
lw $\reg1, -8($\next_arg) # next_arg points to argument after the current one (offset is 8)
lw $\reg2, -4($\next_arg)
b \label
- li $\index, 4 # long can be loaded only to a2_a3 pair so index will be always 4
+ li $\index_reg, \next_index
+ .balign 16
.endm
-.macro LOAD_FLOAT_TO_REG reg, next_arg, index, label
+.macro LOAD_FLOAT_TO_REG reg, next_arg, index_reg, label
lwc1 $\reg, -4($\next_arg) # next_arg points to argument after the current one (offset is 4)
b \label
- addiu $\index, 1
+ addiu $\index_reg, 16
+ .balign 16
.endm
-.macro LOAD_DOUBLE_TO_REG reg1, reg2, next_arg, index, tmp, label
+#if defined(__mips_isa_rev) && __mips_isa_rev > 2
+// LDu expands into 3 instructions for 64-bit FPU, so index_reg cannot be updated here.
+.macro LOAD_DOUBLE_TO_REG reg1, reg2, next_arg, index_reg, tmp, label
+ .set reorder # force use of the branch delay slot
LDu $\reg1, $\reg2, -8, $\next_arg, $\tmp # next_arg points to argument after the current one
# (offset is 8)
b \label
- addiu $\index, 1
+ .set noreorder
+ .balign 16
+.endm
+#else
+// LDu expands into 2 instructions for 32-bit FPU, so index_reg is updated here.
+.macro LOAD_DOUBLE_TO_REG reg1, reg2, next_arg, index_reg, tmp, label
+ LDu $\reg1, $\reg2, -8, $\next_arg, $\tmp # next_arg points to argument after the current one
+ # (offset is 8)
+ b \label
+ addiu $\index_reg, 16
+ .balign 16
+.endm
+#endif
+
+.macro LOAD_END index_reg, next_index, label
+ b \label
+ li $\index_reg, \next_index
+ .balign 16
.endm
#define SPILL_SIZE 32
@@ -891,61 +936,63 @@
lw $gp, 16($fp) # restore $gp
lw $a0, SPILL_SIZE($fp) # restore ArtMethod*
lw $a1, 4($sp) # a1 = this*
- addiu $t0, $sp, 8 # t0 = pointer to the current argument (skip ArtMethod* and this*)
- li $t3, 2 # t3 = gpr_index = 2 (skip A0 and A1)
- move $t4, $zero # t4 = fp_index = 0
- lw $t1, 20 + SPILL_SIZE($fp) # get shorty (20 is offset from the $sp on entry + SPILL_SIZE
+ addiu $t8, $sp, 8 # t8 = pointer to the current argument (skip ArtMethod* and this*)
+ li $t6, 0 # t6 = gpr_index = 0 (corresponds to A2; A0 and A1 are skipped)
+ li $t7, 0 # t7 = fp_index = 0
+ lw $t9, 20 + SPILL_SIZE($fp) # get shorty (20 is offset from the $sp on entry + SPILL_SIZE
# as the $fp is SPILL_SIZE bytes below the $sp on entry)
- addiu $t1, 1 # t1 = shorty + 1 (skip 1 for return type)
+ addiu $t9, 1 # t9 = shorty + 1 (skip 1 for return type)
+
+ // Load the base addresses of tabInt ... tabDouble.
+ // We will use the register indices (gpr_index, fp_index) to branch.
+ // Note that the indices are scaled by 16, so they can be added to the bases directly.
+#if defined(__mips_isa_rev) && __mips_isa_rev >= 6
+ lapc $t2, tabInt
+ lapc $t3, tabLong
+ lapc $t4, tabSingle
+ lapc $t5, tabDouble
+#else
+ bltzal $zero, tabBase # nal
+ addiu $t2, $ra, %lo(tabInt - tabBase)
+tabBase:
+ addiu $t3, $ra, %lo(tabLong - tabBase)
+ addiu $t4, $ra, %lo(tabSingle - tabBase)
+ addiu $t5, $ra, %lo(tabDouble - tabBase)
+#endif
+
loop:
- lbu $t2, 0($t1) # t2 = shorty[i]
- beqz $t2, loopEnd # finish getting args when shorty[i] == '\0'
- addiu $t1, 1
+ lbu $ra, 0($t9) # ra = shorty[i]
+ beqz $ra, loopEnd # finish getting args when shorty[i] == '\0'
+ addiu $t9, 1
- li $t9, 'J' # put char 'J' into t9
- beq $t9, $t2, isLong # branch if result type char == 'J'
- li $t9, 'D' # put char 'D' into t9
- beq $t9, $t2, isDouble # branch if result type char == 'D'
- li $t9, 'F' # put char 'F' into t9
- beq $t9, $t2, isSingle # branch if result type char == 'F'
- addiu $t0, 4 # next_arg = curr_arg + 4 (in branch delay slot,
- # for both, int and single)
+ addiu $ra, -'J'
+ beqz $ra, isLong # branch if result type char == 'J'
+ addiu $ra, 'J' - 'D'
+ beqz $ra, isDouble # branch if result type char == 'D'
+ addiu $ra, 'D' - 'F'
+ beqz $ra, isSingle # branch if result type char == 'F'
- li $t5, 2 # skip a0 and a1 (ArtMethod* and this*)
- bne $t5, $t3, 1f # if (gpr_index == 2)
- addiu $t5, 1
- LOAD_WORD_TO_REG a2, t0, t3, loop # a2 = current argument, gpr_index++
-1: bne $t5, $t3, loop # else if (gpr_index == 3)
- nop
- LOAD_WORD_TO_REG a3, t0, t3, loop # a3 = current argument, gpr_index++
+ addu $ra, $t2, $t6
+ jalr $zero, $ra
+ addiu $t8, 4 # next_arg = curr_arg + 4
isLong:
- addiu $t0, 8 # next_arg = curr_arg + 8
- slti $t5, $t3, 3
- beqz $t5, 2f # if (gpr_index < 3)
- nop
- LOAD_LONG_TO_REG a2, a3, t0, t3, loop # a2_a3 = curr_arg, gpr_index = 4
-2: b loop # else
- li $t3, 4 # gpr_index = 4
-
-isDouble:
- addiu $t0, 8 # next_arg = curr_arg + 8
- li $t5, 0
- bne $t5, $t4, 3f # if (fp_index == 0)
- addiu $t5, 1
- LOAD_DOUBLE_TO_REG f12, f13, t0, t4, t9, loop # f12_f13 = curr_arg, fp_index++
-3: bne $t5, $t4, loop # else if (fp_index == 1)
- nop
- LOAD_DOUBLE_TO_REG f14, f15, t0, t4, t9, loop # f14_f15 = curr_arg, fp_index++
+ addu $ra, $t3, $t6
+ jalr $zero, $ra
+ addiu $t8, 8 # next_arg = curr_arg + 8
isSingle:
- li $t5, 0
- bne $t5, $t4, 4f # if (fp_index == 0)
- addiu $t5, 1
- LOAD_FLOAT_TO_REG f12, t0, t4, loop # f12 = curr_arg, fp_index++
-4: bne $t5, $t4, loop # else if (fp_index == 1)
- nop
- LOAD_FLOAT_TO_REG f14, t0, t4, loop # f14 = curr_arg, fp_index++
+ addu $ra, $t4, $t7
+ jalr $zero, $ra
+ addiu $t8, 4 # next_arg = curr_arg + 4
+
+isDouble:
+ addu $ra, $t5, $t7
+#if defined(__mips_isa_rev) && __mips_isa_rev > 2
+ addiu $t7, 16 # fp_index += 16 didn't fit into LOAD_DOUBLE_TO_REG
+#endif
+ jalr $zero, $ra
+ addiu $t8, 8 # next_arg = curr_arg + 8
loopEnd:
lw $t9, ART_METHOD_QUICK_CODE_OFFSET_32($a0) # get pointer to the code
@@ -976,6 +1023,38 @@
SDu $f0, $f1, 0, $t0, $t1 # store floating point result
jalr $zero, $ra
nop
+
+ // Note that gpr_index is kept within the range of tabInt and tabLong
+ // and fp_index is kept within the range of tabSingle and tabDouble.
+ .balign 16
+tabInt:
+ LOAD_WORD_TO_REG a2, t8, t6, loop # a2 = current argument, gpr_index += 16
+ LOAD_WORD_TO_REG a3, t8, t6, loop # a3 = current argument, gpr_index += 16
+ LOAD_WORD_TO_REG t0, t8, t6, loop # t0 = current argument, gpr_index += 16
+ LOAD_WORD_TO_REG t1, t8, t6, loop # t1 = current argument, gpr_index += 16
+ LOAD_END t6, 4*16, loop # no more GPR args, gpr_index = 4*16
+tabLong:
+ LOAD_LONG_TO_REG a2, a3, t8, t6, 2*16, loop # a2_a3 = curr_arg, gpr_index = 2*16
+ LOAD_LONG_TO_REG t0, t1, t8, t6, 4*16, loop # t0_t1 = curr_arg, gpr_index = 4*16
+ LOAD_LONG_TO_REG t0, t1, t8, t6, 4*16, loop # t0_t1 = curr_arg, gpr_index = 4*16
+ LOAD_END t6, 4*16, loop # no more GPR args, gpr_index = 4*16
+ LOAD_END t6, 4*16, loop # no more GPR args, gpr_index = 4*16
+tabSingle:
+ LOAD_FLOAT_TO_REG f8, t8, t7, loop # f8 = curr_arg, fp_index += 16
+ LOAD_FLOAT_TO_REG f10, t8, t7, loop # f10 = curr_arg, fp_index += 16
+ LOAD_FLOAT_TO_REG f12, t8, t7, loop # f12 = curr_arg, fp_index += 16
+ LOAD_FLOAT_TO_REG f14, t8, t7, loop # f14 = curr_arg, fp_index += 16
+ LOAD_FLOAT_TO_REG f16, t8, t7, loop # f16 = curr_arg, fp_index += 16
+ LOAD_FLOAT_TO_REG f18, t8, t7, loop # f18 = curr_arg, fp_index += 16
+ LOAD_END t7, 6*16, loop # no more FPR args, fp_index = 6*16
+tabDouble:
+ LOAD_DOUBLE_TO_REG f8, f9, t8, t7, ra, loop # f8_f9 = curr_arg; if FPU32, fp_index += 16
+ LOAD_DOUBLE_TO_REG f10, f11, t8, t7, ra, loop # f10_f11 = curr_arg; if FPU32, fp_index += 16
+ LOAD_DOUBLE_TO_REG f12, f13, t8, t7, ra, loop # f12_f13 = curr_arg; if FPU32, fp_index += 16
+ LOAD_DOUBLE_TO_REG f14, f15, t8, t7, ra, loop # f14_f15 = curr_arg; if FPU32, fp_index += 16
+ LOAD_DOUBLE_TO_REG f16, f17, t8, t7, ra, loop # f16_f17 = curr_arg; if FPU32, fp_index += 16
+ LOAD_DOUBLE_TO_REG f18, f19, t8, t7, ra, loop # f18_f19 = curr_arg; if FPU32, fp_index += 16
+ LOAD_END t7, 6*16, loop # no more FPR args, fp_index = 6*16
END art_quick_invoke_stub
/*
@@ -1016,64 +1095,63 @@
addiu $sp, $sp, 16 # restore stack after memcpy
lw $gp, 16($fp) # restore $gp
lw $a0, SPILL_SIZE($fp) # restore ArtMethod*
- addiu $t0, $sp, 4 # t0 = pointer to the current argument (skip ArtMethod*)
- li $t3, 1 # t3 = gpr_index = 1 (skip A0)
- move $t4, $zero # t4 = fp_index = 0
- lw $t1, 20 + SPILL_SIZE($fp) # get shorty (20 is offset from the $sp on entry + SPILL_SIZE
+ addiu $t8, $sp, 4 # t8 = pointer to the current argument (skip ArtMethod*)
+ li $t6, 0 # t6 = gpr_index = 0 (corresponds to A1; A0 is skipped)
+ li $t7, 0 # t7 = fp_index = 0
+ lw $t9, 20 + SPILL_SIZE($fp) # get shorty (20 is offset from the $sp on entry + SPILL_SIZE
# as the $fp is SPILL_SIZE bytes below the $sp on entry)
- addiu $t1, 1 # t1 = shorty + 1 (skip 1 for return type)
+ addiu $t9, 1 # t9 = shorty + 1 (skip 1 for return type)
+
+ // Load the base addresses of tabIntS ... tabDoubleS.
+ // We will use the register indices (gpr_index, fp_index) to branch.
+ // Note that the indices are scaled by 16, so they can be added to the bases directly.
+#if defined(__mips_isa_rev) && __mips_isa_rev >= 6
+ lapc $t2, tabIntS
+ lapc $t3, tabLongS
+ lapc $t4, tabSingleS
+ lapc $t5, tabDoubleS
+#else
+ bltzal $zero, tabBaseS # nal
+ addiu $t2, $ra, %lo(tabIntS - tabBaseS)
+tabBaseS:
+ addiu $t3, $ra, %lo(tabLongS - tabBaseS)
+ addiu $t4, $ra, %lo(tabSingleS - tabBaseS)
+ addiu $t5, $ra, %lo(tabDoubleS - tabBaseS)
+#endif
+
loopS:
- lbu $t2, 0($t1) # t2 = shorty[i]
- beqz $t2, loopEndS # finish getting args when shorty[i] == '\0'
- addiu $t1, 1
+ lbu $ra, 0($t9) # ra = shorty[i]
+ beqz $ra, loopEndS # finish getting args when shorty[i] == '\0'
+ addiu $t9, 1
- li $t9, 'J' # put char 'J' into t9
- beq $t9, $t2, isLongS # branch if result type char == 'J'
- li $t9, 'D' # put char 'D' into t9
- beq $t9, $t2, isDoubleS # branch if result type char == 'D'
- li $t9, 'F' # put char 'F' into t9
- beq $t9, $t2, isSingleS # branch if result type char == 'F'
- addiu $t0, 4 # next_arg = curr_arg + 4 (in branch delay slot,
- # for both, int and single)
+ addiu $ra, -'J'
+ beqz $ra, isLongS # branch if result type char == 'J'
+ addiu $ra, 'J' - 'D'
+ beqz $ra, isDoubleS # branch if result type char == 'D'
+ addiu $ra, 'D' - 'F'
+ beqz $ra, isSingleS # branch if result type char == 'F'
- li $t5, 1 # skip a0 (ArtMethod*)
- bne $t5, $t3, 1f # if (gpr_index == 1)
- addiu $t5, 1
- LOAD_WORD_TO_REG a1, t0, t3, loopS # a1 = current argument, gpr_index++
-1: bne $t5, $t3, 2f # else if (gpr_index == 2)
- addiu $t5, 1
- LOAD_WORD_TO_REG a2, t0, t3, loopS # a2 = current argument, gpr_index++
-2: bne $t5, $t3, loopS # else if (gpr_index == 3)
- nop
- LOAD_WORD_TO_REG a3, t0, t3, loopS # a3 = current argument, gpr_index++
+ addu $ra, $t2, $t6
+ jalr $zero, $ra
+ addiu $t8, 4 # next_arg = curr_arg + 4
isLongS:
- addiu $t0, 8 # next_arg = curr_arg + 8
- slti $t5, $t3, 3
- beqz $t5, 3f # if (gpr_index < 3)
- nop
- LOAD_LONG_TO_REG a2, a3, t0, t3, loopS # a2_a3 = curr_arg, gpr_index = 4
-3: b loopS # else
- li $t3, 4 # gpr_index = 4
-
-isDoubleS:
- addiu $t0, 8 # next_arg = curr_arg + 8
- li $t5, 0
- bne $t5, $t4, 4f # if (fp_index == 0)
- addiu $t5, 1
- LOAD_DOUBLE_TO_REG f12, f13, t0, t4, t9, loopS # f12_f13 = curr_arg, fp_index++
-4: bne $t5, $t4, loopS # else if (fp_index == 1)
- nop
- LOAD_DOUBLE_TO_REG f14, f15, t0, t4, t9, loopS # f14_f15 = curr_arg, fp_index++
+ addu $ra, $t3, $t6
+ jalr $zero, $ra
+ addiu $t8, 8 # next_arg = curr_arg + 8
isSingleS:
- li $t5, 0
- bne $t5, $t4, 5f # if (fp_index == 0)
- addiu $t5, 1
- LOAD_FLOAT_TO_REG f12, t0, t4, loopS # f12 = curr_arg, fp_index++
-5: bne $t5, $t4, loopS # else if (fp_index == 1)
- nop
- LOAD_FLOAT_TO_REG f14, t0, t4, loopS # f14 = curr_arg, fp_index++
+ addu $ra, $t4, $t7
+ jalr $zero, $ra
+ addiu $t8, 4 # next_arg = curr_arg + 4
+
+isDoubleS:
+ addu $ra, $t5, $t7
+#if defined(__mips_isa_rev) && __mips_isa_rev > 2
+ addiu $t7, 16 # fp_index += 16 didn't fit into LOAD_DOUBLE_TO_REG
+#endif
+ jalr $zero, $ra
+ addiu $t8, 8 # next_arg = curr_arg + 8
loopEndS:
lw $t9, ART_METHOD_QUICK_CODE_OFFSET_32($a0) # get pointer to the code
@@ -1104,6 +1182,40 @@
SDu $f0, $f1, 0, $t0, $t1 # store floating point result
jalr $zero, $ra
nop
+
+ // Note that gpr_index is kept within the range of tabIntS and tabLongS
+ // and fp_index is kept within the range of tabSingleS and tabDoubleS.
+ .balign 16
+tabIntS:
+ LOAD_WORD_TO_REG a1, t8, t6, loopS # a1 = current argument, gpr_index += 16
+ LOAD_WORD_TO_REG a2, t8, t6, loopS # a2 = current argument, gpr_index += 16
+ LOAD_WORD_TO_REG a3, t8, t6, loopS # a3 = current argument, gpr_index += 16
+ LOAD_WORD_TO_REG t0, t8, t6, loopS # t0 = current argument, gpr_index += 16
+ LOAD_WORD_TO_REG t1, t8, t6, loopS # t1 = current argument, gpr_index += 16
+ LOAD_END t6, 5*16, loopS # no more GPR args, gpr_index = 5*16
+tabLongS:
+ LOAD_LONG_TO_REG a2, a3, t8, t6, 3*16, loopS # a2_a3 = curr_arg, gpr_index = 3*16
+ LOAD_LONG_TO_REG a2, a3, t8, t6, 3*16, loopS # a2_a3 = curr_arg, gpr_index = 3*16
+ LOAD_LONG_TO_REG t0, t1, t8, t6, 5*16, loopS # t0_t1 = curr_arg, gpr_index = 5*16
+ LOAD_LONG_TO_REG t0, t1, t8, t6, 5*16, loopS # t0_t1 = curr_arg, gpr_index = 5*16
+ LOAD_END t6, 5*16, loopS # no more GPR args, gpr_index = 5*16
+ LOAD_END t6, 5*16, loopS # no more GPR args, gpr_index = 5*16
+tabSingleS:
+ LOAD_FLOAT_TO_REG f8, t8, t7, loopS # f8 = curr_arg, fp_index += 16
+ LOAD_FLOAT_TO_REG f10, t8, t7, loopS # f10 = curr_arg, fp_index += 16
+ LOAD_FLOAT_TO_REG f12, t8, t7, loopS # f12 = curr_arg, fp_index += 16
+ LOAD_FLOAT_TO_REG f14, t8, t7, loopS # f14 = curr_arg, fp_index += 16
+ LOAD_FLOAT_TO_REG f16, t8, t7, loopS # f16 = curr_arg, fp_index += 16
+ LOAD_FLOAT_TO_REG f18, t8, t7, loopS # f18 = curr_arg, fp_index += 16
+ LOAD_END t7, 6*16, loopS # no more FPR args, fp_index = 6*16
+tabDoubleS:
+ LOAD_DOUBLE_TO_REG f8, f9, t8, t7, ra, loopS # f8_f9 = curr_arg; if FPU32, fp_index += 16
+ LOAD_DOUBLE_TO_REG f10, f11, t8, t7, ra, loopS # f10_f11 = curr_arg; if FPU32, fp_index += 16
+ LOAD_DOUBLE_TO_REG f12, f13, t8, t7, ra, loopS # f12_f13 = curr_arg; if FPU32, fp_index += 16
+ LOAD_DOUBLE_TO_REG f14, f15, t8, t7, ra, loopS # f14_f15 = curr_arg; if FPU32, fp_index += 16
+ LOAD_DOUBLE_TO_REG f16, f17, t8, t7, ra, loopS # f16_f17 = curr_arg; if FPU32, fp_index += 16
+ LOAD_DOUBLE_TO_REG f18, f19, t8, t7, ra, loopS # f18_f19 = curr_arg; if FPU32, fp_index += 16
+ LOAD_END t7, 6*16, loopS # no more FPR args, fp_index = 6*16
END art_quick_invoke_static_stub
#undef SPILL_SIZE
@@ -1886,9 +1998,9 @@
la $t9, artQuickProxyInvokeHandler
jalr $t9 # (Method* proxy method, receiver, Thread*, SP)
addiu $a3, $sp, ARG_SLOT_SIZE # pass $sp (remove arg slots)
- lw $t0, THREAD_EXCEPTION_OFFSET(rSELF) # load Thread::Current()->exception_
+ lw $t7, THREAD_EXCEPTION_OFFSET(rSELF) # load Thread::Current()->exception_
RESTORE_SAVE_REFS_AND_ARGS_FRAME
- bnez $t0, 1f
+ bnez $t7, 1f
# don't care if $v0 and/or $v1 are modified, when exception branch taken
MTD $v0, $v1, $f0, $f1 # move float value to return value
jalr $zero, $ra
@@ -1900,25 +2012,25 @@
/*
* Called to resolve an imt conflict.
* a0 is the conflict ArtMethod.
- * t0 is a hidden argument that holds the target interface method's dex method index.
+ * t7 is a hidden argument that holds the target interface method's dex method index.
*
- * Note that this stub writes to a0, t0 and t1.
+ * Note that this stub writes to a0, t7 and t8.
*/
ENTRY art_quick_imt_conflict_trampoline
- lw $t1, 0($sp) # Load referrer.
- lw $t1, ART_METHOD_DEX_CACHE_METHODS_OFFSET_32($t1) # Load dex cache methods array.
- sll $t0, $t0, POINTER_SIZE_SHIFT # Calculate offset.
- addu $t0, $t1, $t0 # Add offset to base.
- lw $t0, 0($t0) # Load interface method.
+ lw $t8, 0($sp) # Load referrer.
+ lw $t8, ART_METHOD_DEX_CACHE_METHODS_OFFSET_32($t8) # Load dex cache methods array.
+ sll $t7, $t7, POINTER_SIZE_SHIFT # Calculate offset.
+ addu $t7, $t8, $t7 # Add offset to base.
+ lw $t7, 0($t7) # Load interface method.
lw $a0, ART_METHOD_JNI_OFFSET_32($a0) # Load ImtConflictTable.
.Limt_table_iterate:
- lw $t1, 0($a0) # Load next entry in ImtConflictTable.
+ lw $t8, 0($a0) # Load next entry in ImtConflictTable.
# Branch if found.
- beq $t1, $t0, .Limt_table_found
+ beq $t8, $t7, .Limt_table_found
nop
# If the entry is null, the interface method is not in the ImtConflictTable.
- beqz $t1, .Lconflict_trampoline
+ beqz $t8, .Lconflict_trampoline
nop
# Iterate over the entries of the ImtConflictTable.
b .Limt_table_iterate
@@ -1928,7 +2040,7 @@
# We successfully hit an entry in the table. Load the target method and jump to it.
lw $a0, __SIZEOF_POINTER__($a0)
lw $t9, ART_METHOD_QUICK_CODE_OFFSET_32($a0)
- jr $t9
+ jalr $zero, $t9
nop
.Lconflict_trampoline:
@@ -1972,7 +2084,7 @@
# The result of the call is:
# v0: ptr to native code, 0 on error.
# v1: ptr to the bottom of the used area of the alloca, can restore stack till here.
- beq $v0, $zero, 1f # check entry error
+ beq $v0, $zero, 2f # check entry error
move $t9, $v0 # save the code ptr
move $sp, $v1 # release part of the alloca
@@ -1980,10 +2092,22 @@
lw $a0, 0($sp)
lw $a1, 4($sp)
lw $a2, 8($sp)
-
- # Load FPRs the same as GPRs. Look at BuildNativeCallFrameStateMachine.
- jalr $t9 # native call
lw $a3, 12($sp)
+
+ # artQuickGenericJniTrampoline sets bit 0 of the native code address to 1
+ # when the first two arguments are both single precision floats. This lets
+ # us extract them properly from the stack and load into floating point
+ # registers.
+ MTD $a0, $a1, $f12, $f13
+ andi $t0, $t9, 1
+ xor $t9, $t9, $t0
+ bnez $t0, 1f
+ mtc1 $a1, $f14
+ MTD $a2, $a3, $f14, $f15
+
+1:
+ jalr $t9 # native call
+ nop
addiu $sp, $sp, 16 # remove arg slots
move $gp, $s3 # restore $gp from $s3
@@ -1999,18 +2123,18 @@
s.d $f0, 16($sp) # pass result_f
lw $t0, THREAD_EXCEPTION_OFFSET(rSELF) # load Thread::Current()->exception_
- bne $t0, $zero, 1f # check for pending exceptions
+ bne $t0, $zero, 2f # check for pending exceptions
move $sp, $s8 # tear down the alloca
- # tear dpown the callee-save frame
+ # tear down the callee-save frame
RESTORE_SAVE_REFS_AND_ARGS_FRAME
MTD $v0, $v1, $f0, $f1 # move float value to return value
jalr $zero, $ra
nop
-1:
+2:
lw $sp, THREAD_TOP_QUICK_FRAME_OFFSET(rSELF)
# This will create a new save-all frame, required by the runtime.
DELIVER_PENDING_EXCEPTION
@@ -2023,9 +2147,9 @@
la $t9, artQuickToInterpreterBridge
jalr $t9 # (Method* method, Thread*, SP)
addiu $a2, $sp, ARG_SLOT_SIZE # pass $sp (remove arg slots)
- lw $t0, THREAD_EXCEPTION_OFFSET(rSELF) # load Thread::Current()->exception_
+ lw $t7, THREAD_EXCEPTION_OFFSET(rSELF) # load Thread::Current()->exception_
RESTORE_SAVE_REFS_AND_ARGS_FRAME
- bnez $t0, 1f
+ bnez $t7, 1f
# don't care if $v0 and/or $v1 are modified, when exception branch taken
MTD $v0, $v1, $f0, $f1 # move float value to return value
jalr $zero, $ra
diff --git a/runtime/arch/mips/quick_method_frame_info_mips.h b/runtime/arch/mips/quick_method_frame_info_mips.h
index 90e7b20..6f16352 100644
--- a/runtime/arch/mips/quick_method_frame_info_mips.h
+++ b/runtime/arch/mips/quick_method_frame_info_mips.h
@@ -26,12 +26,13 @@
namespace mips {
static constexpr uint32_t kMipsCalleeSaveAlwaysSpills =
- (1 << art::mips::RA);
+ (1u << art::mips::RA);
static constexpr uint32_t kMipsCalleeSaveRefSpills =
(1 << art::mips::S2) | (1 << art::mips::S3) | (1 << art::mips::S4) | (1 << art::mips::S5) |
(1 << art::mips::S6) | (1 << art::mips::S7) | (1 << art::mips::GP) | (1 << art::mips::FP);
static constexpr uint32_t kMipsCalleeSaveArgSpills =
- (1 << art::mips::A1) | (1 << art::mips::A2) | (1 << art::mips::A3);
+ (1 << art::mips::A1) | (1 << art::mips::A2) | (1 << art::mips::A3) | (1 << art::mips::T0) |
+ (1 << art::mips::T1);
static constexpr uint32_t kMipsCalleeSaveAllSpills =
(1 << art::mips::S0) | (1 << art::mips::S1);
static constexpr uint32_t kMipsCalleeSaveEverythingSpills =
@@ -44,11 +45,13 @@
static constexpr uint32_t kMipsCalleeSaveFpAlwaysSpills = 0;
static constexpr uint32_t kMipsCalleeSaveFpRefSpills = 0;
static constexpr uint32_t kMipsCalleeSaveFpArgSpills =
- (1 << art::mips::F12) | (1 << art::mips::F13) | (1 << art::mips::F14) | (1 << art::mips::F15);
+ (1 << art::mips::F8) | (1 << art::mips::F9) | (1 << art::mips::F10) | (1 << art::mips::F11) |
+ (1 << art::mips::F12) | (1 << art::mips::F13) | (1 << art::mips::F14) | (1 << art::mips::F15) |
+ (1 << art::mips::F16) | (1 << art::mips::F17) | (1 << art::mips::F18) | (1 << art::mips::F19);
static constexpr uint32_t kMipsCalleeSaveAllFPSpills =
(1 << art::mips::F20) | (1 << art::mips::F21) | (1 << art::mips::F22) | (1 << art::mips::F23) |
(1 << art::mips::F24) | (1 << art::mips::F25) | (1 << art::mips::F26) | (1 << art::mips::F27) |
- (1 << art::mips::F28) | (1 << art::mips::F29) | (1 << art::mips::F30) | (1 << art::mips::F31);
+ (1 << art::mips::F28) | (1 << art::mips::F29) | (1 << art::mips::F30) | (1u << art::mips::F31);
static constexpr uint32_t kMipsCalleeSaveFpEverythingSpills =
(1 << art::mips::F0) | (1 << art::mips::F1) | (1 << art::mips::F2) | (1 << art::mips::F3) |
(1 << art::mips::F4) | (1 << art::mips::F5) | (1 << art::mips::F6) | (1 << art::mips::F7) |
@@ -57,7 +60,7 @@
(1 << art::mips::F16) | (1 << art::mips::F17) | (1 << art::mips::F18) | (1 << art::mips::F19) |
(1 << art::mips::F20) | (1 << art::mips::F21) | (1 << art::mips::F22) | (1 << art::mips::F23) |
(1 << art::mips::F24) | (1 << art::mips::F25) | (1 << art::mips::F26) | (1 << art::mips::F27) |
- (1 << art::mips::F28) | (1 << art::mips::F29) | (1 << art::mips::F30) | (1 << art::mips::F31);
+ (1 << art::mips::F28) | (1 << art::mips::F29) | (1 << art::mips::F30) | (1u << art::mips::F31);
constexpr uint32_t MipsCalleeSaveCoreSpills(Runtime::CalleeSaveType type) {
return kMipsCalleeSaveAlwaysSpills | kMipsCalleeSaveRefSpills |
diff --git a/runtime/arch/mips/registers_mips.h b/runtime/arch/mips/registers_mips.h
index ae01bd5..555f3f0 100644
--- a/runtime/arch/mips/registers_mips.h
+++ b/runtime/arch/mips/registers_mips.h
@@ -35,9 +35,9 @@
A1 = 5,
A2 = 6,
A3 = 7,
- T0 = 8, // Temporaries.
+ T0 = 8, // Two extra arguments / temporaries.
T1 = 9,
- T2 = 10,
+ T2 = 10, // Temporaries.
T3 = 11,
T4 = 12,
T5 = 13,
@@ -100,7 +100,7 @@
F29 = 29,
F30 = 30,
F31 = 31,
- FTMP = F8, // scratch register
+ FTMP = F6, // scratch register
kNumberOfFRegisters = 32,
kNoFRegister = -1,
};
diff --git a/runtime/arch/mips64/instruction_set_features_mips64.cc b/runtime/arch/mips64/instruction_set_features_mips64.cc
index 490a8d2..92c44e8 100644
--- a/runtime/arch/mips64/instruction_set_features_mips64.cc
+++ b/runtime/arch/mips64/instruction_set_features_mips64.cc
@@ -19,11 +19,15 @@
#include <fstream>
#include <sstream>
-#include "base/stringprintf.h"
-#include "utils.h" // For Trim.
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
+#include "base/logging.h"
namespace art {
+using android::base::StringPrintf;
+
Mips64FeaturesUniquePtr Mips64InstructionSetFeatures::FromVariant(
const std::string& variant, std::string* error_msg ATTRIBUTE_UNUSED) {
if (variant != "default" && variant != "mips64r6") {
@@ -105,7 +109,7 @@
auto i = features.begin();
if (i != features.end()) {
// We don't have any features.
- std::string feature = Trim(*i);
+ std::string feature = android::base::Trim(*i);
*error_msg = StringPrintf("Unknown instruction set feature: '%s'", feature.c_str());
return nullptr;
}
diff --git a/runtime/arch/quick_alloc_entrypoints.S b/runtime/arch/quick_alloc_entrypoints.S
index fa86bf4..db2fdca 100644
--- a/runtime/arch/quick_alloc_entrypoints.S
+++ b/runtime/arch/quick_alloc_entrypoints.S
@@ -107,7 +107,28 @@
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab, RegionTLAB)
.endm
+.macro GENERATE_ALLOC_ENTRYPOINTS_FOR_TLAB_ALLOCATOR
+// This is to be separately defined for each architecture to allow a hand-written assembly fast path.
+// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_tlab, TLAB)
+.endm
+
.macro GENERATE_ALLOC_ENTRYPOINTS_FOR_NON_REGION_TLAB_ALLOCATORS
+GENERATE_ALLOC_ENTRYPOINTS_FOR_NON_TLAB_ALLOCATORS
+GENERATE_ALLOC_ENTRYPOINTS_FOR_TLAB_ALLOCATOR
+.endm
+
+.macro GENERATE_ALLOC_ENTRYPOINTS_FOR_NON_TLAB_ALLOCATORS
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT(_dlmalloc, DlMalloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_dlmalloc, DlMalloc)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_dlmalloc, DlMalloc)
@@ -187,20 +208,6 @@
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_bump_pointer_instrumented, BumpPointerInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_bump_pointer_instrumented, BumpPointerInstrumented)
-// This is to be separately defined for each architecture to allow a hand-written assembly fast path.
-// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_tlab, TLAB)
-
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT(_tlab_instrumented, TLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_tlab_instrumented, TLABInstrumented)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_tlab_instrumented, TLABInstrumented)
diff --git a/runtime/arch/stub_test.cc b/runtime/arch/stub_test.cc
index bbf9a8b..9e385f8 100644
--- a/runtime/arch/stub_test.cc
+++ b/runtime/arch/stub_test.cc
@@ -355,7 +355,7 @@
"lw $a2, 8($sp)\n\t"
"lw $t9, 12($sp)\n\t"
"lw $s1, 16($sp)\n\t"
- "lw $t0, 20($sp)\n\t"
+ "lw $t7, 20($sp)\n\t"
"addiu $sp, $sp, 24\n\t"
"jalr $t9\n\t" // Call the stub.
@@ -1063,7 +1063,7 @@
EXPECT_FALSE(self->IsExceptionPending());
{
// Use an arbitrary method from c to use as referrer
- size_t result = Invoke3(static_cast<size_t>(c->GetDexTypeIndex()), // type_idx
+ size_t result = Invoke3(static_cast<size_t>(c->GetDexTypeIndex().index_), // type_idx
// arbitrary
reinterpret_cast<size_t>(c->GetVirtualMethod(0, kRuntimePointerSize)),
0U,
@@ -1197,7 +1197,7 @@
if ((false)) {
// Use an arbitrary method from c to use as referrer
size_t result = Invoke3(
- static_cast<size_t>(c->GetDexTypeIndex()), // type_idx
+ static_cast<size_t>(c->GetDexTypeIndex().index_), // type_idx
10U,
// arbitrary
reinterpret_cast<size_t>(c_obj->GetVirtualMethod(0, kRuntimePointerSize)),
diff --git a/runtime/arch/x86/instruction_set_features_x86.cc b/runtime/arch/x86/instruction_set_features_x86.cc
index 90b55a9..c520d63 100644
--- a/runtime/arch/x86/instruction_set_features_x86.cc
+++ b/runtime/arch/x86/instruction_set_features_x86.cc
@@ -19,12 +19,16 @@
#include <fstream>
#include <sstream>
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
#include "arch/x86_64/instruction_set_features_x86_64.h"
-#include "base/stringprintf.h"
-#include "utils.h" // For Trim.
+#include "base/logging.h"
namespace art {
+using android::base::StringPrintf;
+
// Feature-support arrays.
static constexpr const char* x86_known_variants[] = {
@@ -293,7 +297,7 @@
bool has_AVX2 = has_AVX2_;
bool has_POPCNT = has_POPCNT_;
for (auto i = features.begin(); i != features.end(); i++) {
- std::string feature = Trim(*i);
+ std::string feature = android::base::Trim(*i);
if (feature == "ssse3") {
has_SSSE3 = true;
} else if (feature == "-ssse3") {
diff --git a/runtime/arch/x86/quick_entrypoints_x86.S b/runtime/arch/x86/quick_entrypoints_x86.S
index fb405fa..c6f4c03 100644
--- a/runtime/arch/x86/quick_entrypoints_x86.S
+++ b/runtime/arch/x86/quick_entrypoints_x86.S
@@ -1085,15 +1085,12 @@
RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER // return or deliver exception
END_MACRO
-// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT(_tlab, TLAB).
+// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT(_tlab, TLAB). May be called
+// for CC if the GC is not marking.
DEFINE_FUNCTION art_quick_alloc_object_tlab
// Fast path tlab allocation.
// EAX: uint32_t type_idx/return value, ECX: ArtMethod*.
// EBX, EDX: free.
-#if defined(USE_READ_BARRIER)
- int3
- int3
-#endif
PUSH esi
PUSH edi
movl ART_METHOD_DEX_CACHE_TYPES_OFFSET_32(%ecx), %edx // Load dex cache resolved types array
@@ -1151,51 +1148,17 @@
END_FUNCTION art_quick_alloc_object_region_tlab
DEFINE_FUNCTION art_quick_resolve_string
- PUSH edi
- PUSH esi
- // Save xmm0 at an aligned address on the stack.
- subl MACRO_LITERAL(12), %esp
- CFI_ADJUST_CFA_OFFSET(12)
- movsd %xmm0, 0(%esp)
- movl 24(%esp), %edi // get referrer
- movl ART_METHOD_DECLARING_CLASS_OFFSET(%edi), %edi // get declaring class
- movl DECLARING_CLASS_DEX_CACHE_STRINGS_OFFSET(%edi), %edi // get string dex cache
- movl LITERAL(STRING_DEX_CACHE_SIZE_MINUS_ONE), %esi
- andl %eax, %esi
- movlps (%edi, %esi, STRING_DEX_CACHE_ELEMENT_SIZE), %xmm0 // load string idx and ptr to xmm0
- movd %xmm0, %edi // extract pointer
- pshufd LITERAL(0x55), %xmm0, %xmm0 // shuffle index into lowest bits
- movd %xmm0, %esi // extract index
- // Restore xmm0 and remove it together with padding from the stack.
- movsd 0(%esp), %xmm0
- addl MACRO_LITERAL(12), %esp
- CFI_ADJUST_CFA_OFFSET(-12)
- cmp %esi, %eax
- jne .Lart_quick_resolve_string_slow_path
- movl %edi, %eax
- CFI_REMEMBER_STATE
- POP esi
- POP edi
-#ifdef USE_READ_BARRIER
- cmpl LITERAL(0), %fs:THREAD_IS_GC_MARKING_OFFSET
- jne .Lnot_null_art_quick_read_barrier_mark_reg00
-#endif
- ret
- CFI_RESTORE_STATE
- CFI_DEF_CFA(esp, 24) // workaround for clang bug: 31975598
-
-.Lart_quick_resolve_string_slow_path:
+ SETUP_SAVE_EVERYTHING_FRAME ebx, ebx
// Outgoing argument set up
- SETUP_SAVE_EVERYTHING_FRAME_EDI_ESI_SAVED ebx, ebx
- subl LITERAL(8), %esp // push padding
+ subl LITERAL(8), %esp // push padding
CFI_ADJUST_CFA_OFFSET(8)
- pushl %fs:THREAD_SELF_OFFSET // pass Thread::Current()
+ pushl %fs:THREAD_SELF_OFFSET // pass Thread::Current()
CFI_ADJUST_CFA_OFFSET(4)
- PUSH eax // pass arg1
+ PUSH eax // pass arg1
call SYMBOL(artResolveStringFromCode)
- addl LITERAL(16), %esp // pop arguments
+ addl LITERAL(16), %esp // pop arguments
CFI_ADJUST_CFA_OFFSET(-16)
- testl %eax, %eax // If result is null, deliver the OOME.
+ testl %eax, %eax // If result is null, deliver the OOME.
jz 1f
CFI_REMEMBER_STATE
RESTORE_SAVE_EVERYTHING_FRAME_KEEP_EAX
diff --git a/runtime/arch/x86_64/quick_entrypoints_x86_64.S b/runtime/arch/x86_64/quick_entrypoints_x86_64.S
index 860b77e..4c46b08 100644
--- a/runtime/arch/x86_64/quick_entrypoints_x86_64.S
+++ b/runtime/arch/x86_64/quick_entrypoints_x86_64.S
@@ -18,6 +18,13 @@
#include "arch/quick_alloc_entrypoints.S"
+MACRO0(ASSERT_USE_READ_BARRIER)
+#if !defined(USE_READ_BARRIER)
+ int3
+ int3
+#endif
+END_MACRO
+
MACRO0(SETUP_FP_CALLEE_SAVE_FRAME)
// Create space for ART FP callee-saved registers
subq MACRO_LITERAL(4 * 8), %rsp
@@ -972,8 +979,10 @@
END_MACRO
// Generate the allocation entrypoints for each allocator.
-GENERATE_ALLOC_ENTRYPOINTS_FOR_NON_REGION_TLAB_ALLOCATORS
+GENERATE_ALLOC_ENTRYPOINTS_FOR_NON_TLAB_ALLOCATORS
+
// Comment out allocators that have x86_64 specific asm.
+// Region TLAB:
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT(_region_tlab, RegionTLAB)
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region_tlab, RegionTLAB)
// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region_tlab, RegionTLAB)
@@ -986,6 +995,19 @@
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region_tlab, RegionTLAB)
GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab, RegionTLAB)
+// Normal TLAB:
+// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT(_tlab, TLAB)
+// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_tlab, TLAB)
+// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_tlab, TLAB)
+// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_tlab, TLAB)
+// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_tlab, TLAB)
+GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_tlab, TLAB)
// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT(_rosalloc, RosAlloc).
DEFINE_FUNCTION art_quick_alloc_object_rosalloc
@@ -1162,16 +1184,11 @@
RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER // return or deliver exception
END_MACRO
-// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT(_tlab, TLAB).
+// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT(_tlab, TLAB). May be
+// called with CC if the GC is not active.
DEFINE_FUNCTION art_quick_alloc_object_tlab
- // Fast path tlab allocation.
// RDI: uint32_t type_idx, RSI: ArtMethod*
// RDX, RCX, R8, R9: free. RAX: return val.
-#if defined(USE_READ_BARRIER)
- int3
- int3
-#endif
- // Might need a special macro since rsi and edx is 32b/64b mismatched.
movq ART_METHOD_DEX_CACHE_TYPES_OFFSET_64(%rsi), %rdx // Load dex cache resolved types array
// Might need to break down into multiple instructions to get the base address in a register.
// Load the class
@@ -1181,29 +1198,69 @@
ALLOC_OBJECT_TLAB_SLOW_PATH artAllocObjectFromCodeTLAB
END_FUNCTION art_quick_alloc_object_tlab
+// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_tlab, TLAB). May be
+// called with CC if the GC is not active.
+DEFINE_FUNCTION art_quick_alloc_object_resolved_tlab
+ // RDI: mirror::Class* klass, RSI: ArtMethod*
+ // RDX, RCX, R8, R9: free. RAX: return val.
+ movq %rdi, %rdx
+ ALLOC_OBJECT_RESOLVED_TLAB_FAST_PATH .Lart_quick_alloc_object_resolved_tlab_slow_path
+.Lart_quick_alloc_object_resolved_tlab_slow_path:
+ ALLOC_OBJECT_TLAB_SLOW_PATH artAllocObjectFromCodeResolvedTLAB
+END_FUNCTION art_quick_alloc_object_resolved_tlab
+
+// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_tlab, TLAB).
+// May be called with CC if the GC is not active.
+DEFINE_FUNCTION art_quick_alloc_object_initialized_tlab
+ // RDI: mirror::Class* klass, RSI: ArtMethod*
+ // RDX, RCX, R8, R9: free. RAX: return val.
+ movq %rdi, %rdx
+ ALLOC_OBJECT_INITIALIZED_TLAB_FAST_PATH .Lart_quick_alloc_object_initialized_tlab_slow_path
+.Lart_quick_alloc_object_initialized_tlab_slow_path:
+ ALLOC_OBJECT_TLAB_SLOW_PATH artAllocObjectFromCodeInitializedTLAB
+END_FUNCTION art_quick_alloc_object_initialized_tlab
+
+// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_tlab, TLAB).
+DEFINE_FUNCTION art_quick_alloc_array_tlab
+ // RDI: uint32_t type_idx, RSI: int32_t component_count, RDX: ArtMethod*
+ // RCX: klass, R8, R9: free. RAX: return val.
+ movq ART_METHOD_DEX_CACHE_TYPES_OFFSET_64(%rdx), %rcx // Load dex cache resolved types array
+ movl 0(%rcx, %rdi, COMPRESSED_REFERENCE_SIZE), %ecx // Load the class
+ testl %ecx, %ecx
+ jz .Lart_quick_alloc_array_tlab_slow_path
+ ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_tlab_slow_path
+.Lart_quick_alloc_array_tlab_slow_path:
+ ALLOC_ARRAY_TLAB_SLOW_PATH artAllocArrayFromCodeTLAB
+END_FUNCTION art_quick_alloc_array_tlab
+
+// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab, TLAB).
+DEFINE_FUNCTION art_quick_alloc_array_resolved_tlab
+ // RDI: mirror::Class* klass, RSI: int32_t component_count, RDX: ArtMethod*
+ // RCX: mirror::Class* klass, R8, R9: free. RAX: return val.
+ movq %rdi, %rcx
+ // Already resolved, no null check.
+ ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_resolved_tlab_slow_path
+.Lart_quick_alloc_array_resolved_tlab_slow_path:
+ ALLOC_ARRAY_TLAB_SLOW_PATH artAllocArrayFromCodeResolvedTLAB
+END_FUNCTION art_quick_alloc_array_resolved_tlab
+
// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_tlab, RegionTLAB).
DEFINE_FUNCTION art_quick_alloc_array_region_tlab
// Fast path region tlab allocation.
// RDI: uint32_t type_idx, RSI: int32_t component_count, RDX: ArtMethod*
// RCX: klass, R8, R9: free. RAX: return val.
-#if !defined(USE_READ_BARRIER)
- int3
- int3
-#endif
+ ASSERT_USE_READ_BARRIER
movq ART_METHOD_DEX_CACHE_TYPES_OFFSET_64(%rdx), %rcx // Load dex cache resolved types array
movl 0(%rcx, %rdi, COMPRESSED_REFERENCE_SIZE), %ecx // Load the class
// Null check so that we can load the lock word.
testl %ecx, %ecx
jz .Lart_quick_alloc_array_region_tlab_slow_path
-
- cmpl LITERAL(0), %gs:THREAD_IS_GC_MARKING_OFFSET
- jne .Lart_quick_alloc_array_region_tlab_class_load_read_barrier_marking
+ // Since we have allocation entrypoint switching, we know the GC is marking.
+ // Check the mark bit, if it is 0, do the read barrier mark.
+ testl LITERAL(LOCK_WORD_MARK_BIT_MASK_SHIFTED), MIRROR_OBJECT_LOCK_WORD_OFFSET(%ecx)
+ jz .Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path
.Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path_exit:
ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_region_tlab_slow_path
-.Lart_quick_alloc_array_region_tlab_class_load_read_barrier_marking:
- // Check the mark bit, if it is 1 return.
- testl LITERAL(LOCK_WORD_MARK_BIT_MASK_SHIFTED), MIRROR_OBJECT_LOCK_WORD_OFFSET(%ecx)
- jnz .Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path_exit
.Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path:
// The read barrier slow path. Mark the class.
PUSH rdi
@@ -1226,33 +1283,11 @@
// Fast path region tlab allocation.
// RDI: mirror::Class* klass, RSI: int32_t component_count, RDX: ArtMethod*
// RCX: mirror::Class* klass, R8, R9: free. RAX: return val.
-#if !defined(USE_READ_BARRIER)
- int3
- int3
-#endif
+ ASSERT_USE_READ_BARRIER
movq %rdi, %rcx
+ // Caller is responsible for read barrier.
// Already resolved, no null check.
- cmpl LITERAL(0), %gs:THREAD_IS_GC_MARKING_OFFSET
- jne .Lart_quick_alloc_array_resolved_region_tlab_class_load_read_barrier_marking
-.Lart_quick_alloc_array_resolved_region_tlab_class_load_read_barrier_slow_path_exit:
ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_resolved_region_tlab_slow_path
-.Lart_quick_alloc_array_resolved_region_tlab_class_load_read_barrier_marking:
- // Check the mark bit, if it is 1 return.
- testl LITERAL(LOCK_WORD_MARK_BIT_MASK_SHIFTED), MIRROR_OBJECT_LOCK_WORD_OFFSET(%ecx)
- jnz .Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path_exit
-.Lart_quick_alloc_array_resolved_region_tlab_class_load_read_barrier_slow_path:
- // The read barrier slow path. Mark the class.
- PUSH rdi
- PUSH rsi
- PUSH rdx
- // Outgoing argument set up
- movq %rcx, %rdi // Pass the class as the first param.
- call SYMBOL(artReadBarrierMark) // cxx_name(mirror::Object* obj)
- movq %rax, %rcx
- POP rdx
- POP rsi
- POP rdi
- jmp .Lart_quick_alloc_array_resolved_region_tlab_class_load_read_barrier_slow_path_exit
.Lart_quick_alloc_array_resolved_region_tlab_slow_path:
ALLOC_ARRAY_TLAB_SLOW_PATH artAllocArrayFromCodeResolvedRegionTLAB
END_FUNCTION art_quick_alloc_array_resolved_region_tlab
@@ -1262,24 +1297,19 @@
// Fast path region tlab allocation.
// RDI: uint32_t type_idx, RSI: ArtMethod*
// RDX, RCX, R8, R9: free. RAX: return val.
-#if !defined(USE_READ_BARRIER)
- int3
- int3
-#endif
+ ASSERT_USE_READ_BARRIER
movq ART_METHOD_DEX_CACHE_TYPES_OFFSET_64(%rsi), %rdx // Load dex cache resolved types array
movl 0(%rdx, %rdi, COMPRESSED_REFERENCE_SIZE), %edx // Load the class
// Null check so that we can load the lock word.
testl %edx, %edx
jz .Lart_quick_alloc_object_region_tlab_slow_path
- // Test if the GC is marking.
- cmpl LITERAL(0), %gs:THREAD_IS_GC_MARKING_OFFSET
- jne .Lart_quick_alloc_object_region_tlab_class_load_read_barrier_marking
-.Lart_quick_alloc_object_region_tlab_class_load_read_barrier_slow_path_exit:
- ALLOC_OBJECT_TLAB_FAST_PATH .Lart_quick_alloc_object_region_tlab_slow_path
-.Lart_quick_alloc_object_region_tlab_class_load_read_barrier_marking:
- // Check the mark bit, if it is 1 avoid the read barrier.
+ // Since we have allocation entrypoint switching, we know the GC is marking.
+ // Check the mark bit, if it is 0, do the read barrier mark.
testl LITERAL(LOCK_WORD_MARK_BIT_MASK_SHIFTED), MIRROR_OBJECT_LOCK_WORD_OFFSET(%edx)
- jnz .Lart_quick_alloc_object_region_tlab_class_load_read_barrier_slow_path_exit
+ jz .Lart_quick_alloc_object_region_tlab_class_load_read_barrier_slow_path
+.Lart_quick_alloc_object_region_tlab_class_load_read_barrier_slow_path_exit:
+ // Use resolved one since we already did the null check.
+ ALLOC_OBJECT_RESOLVED_TLAB_FAST_PATH .Lart_quick_alloc_object_region_tlab_slow_path
.Lart_quick_alloc_object_region_tlab_class_load_read_barrier_slow_path:
// The read barrier slow path. Mark the class.
PUSH rdi
@@ -1302,10 +1332,7 @@
// Fast path region tlab allocation.
// RDI: mirror::Class* klass, RSI: ArtMethod*
// RDX, RCX, R8, R9: free. RAX: return val.
-#if !defined(USE_READ_BARRIER)
- int3
- int3
-#endif
+ ASSERT_USE_READ_BARRIER
// No read barrier since the caller is responsible for that.
movq %rdi, %rdx
ALLOC_OBJECT_RESOLVED_TLAB_FAST_PATH .Lart_quick_alloc_object_resolved_region_tlab_slow_path
@@ -1318,10 +1345,7 @@
// Fast path region tlab allocation.
// RDI: mirror::Class* klass, RSI: ArtMethod*
// RDX, RCX, R8, R9: free. RAX: return val.
-#if !defined(USE_READ_BARRIER)
- int3
- int3
-#endif
+ ASSERT_USE_READ_BARRIER
movq %rdi, %rdx
// No read barrier since the caller is responsible for that.
ALLOC_OBJECT_INITIALIZED_TLAB_FAST_PATH .Lart_quick_alloc_object_initialized_region_tlab_slow_path
@@ -1330,34 +1354,7 @@
END_FUNCTION art_quick_alloc_object_initialized_region_tlab
DEFINE_FUNCTION art_quick_resolve_string
- // Custom calling convention: RAX serves as both input and output.
- PUSH r15
- PUSH r14
- movq 24(%rsp), %r15 // get referrer
- movl ART_METHOD_DECLARING_CLASS_OFFSET(%r15), %r15d // get declaring class
- movq DECLARING_CLASS_DEX_CACHE_STRINGS_OFFSET(%r15d), %r15 // get string dex cache
- movl LITERAL(STRING_DEX_CACHE_SIZE_MINUS_ONE), %r14d
- andl %eax, %r14d
- movq (%r15, %r14, STRING_DEX_CACHE_ELEMENT_SIZE), %r14
- movl %r14d, %r15d
- shrq LITERAL(32), %r14
- cmpl %r14d, %eax
- jne .Lart_quick_resolve_string_slow_path
- movl %r15d, %eax
- CFI_REMEMBER_STATE
- POP r14
- POP r15
-#ifdef USE_READ_BARRIER
- cmpl LITERAL(0), %gs:THREAD_IS_GC_MARKING_OFFSET
- jne .Lnot_null_art_quick_read_barrier_mark_reg00
-#endif
- ret
- CFI_RESTORE_STATE
- CFI_DEF_CFA(rsp, 24) // workaround for clang bug: 31975598
-
-// Slow path, the index did not match.
-.Lart_quick_resolve_string_slow_path:
- SETUP_SAVE_EVERYTHING_FRAME_R14_R15_SAVED
+ SETUP_SAVE_EVERYTHING_FRAME
// Outgoing argument set up
movl %eax, %edi // pass string index
movq %gs:THREAD_SELF_OFFSET, %rsi // pass Thread::Current()
diff --git a/runtime/art_field.cc b/runtime/art_field.cc
index b46b058..a4a6e5a 100644
--- a/runtime/art_field.cc
+++ b/runtime/art_field.cc
@@ -48,13 +48,13 @@
return Runtime::Current()->GetClassLinker()->FindSystemClass(Thread::Current(), descriptor);
}
-ObjPtr<mirror::Class> ArtField::ResolveGetType(uint32_t type_idx) {
+ObjPtr<mirror::Class> ArtField::ResolveGetType(dex::TypeIndex type_idx) {
return Runtime::Current()->GetClassLinker()->ResolveType(type_idx, this);
}
ObjPtr<mirror::String> ArtField::ResolveGetStringName(Thread* self,
const DexFile& dex_file,
- uint32_t string_idx,
+ dex::StringIndex string_idx,
ObjPtr<mirror::DexCache> dex_cache) {
StackHandleScope<1> hs(self);
return Runtime::Current()->GetClassLinker()->ResolveString(dex_file,
diff --git a/runtime/art_field.h b/runtime/art_field.h
index 7c2f490..427e103 100644
--- a/runtime/art_field.h
+++ b/runtime/art_field.h
@@ -19,6 +19,7 @@
#include <jni.h>
+#include "dex_file_types.h"
#include "gc_root.h"
#include "modifiers.h"
#include "obj_ptr.h"
@@ -216,10 +217,11 @@
private:
ObjPtr<mirror::Class> ProxyFindSystemClass(const char* descriptor)
REQUIRES_SHARED(Locks::mutator_lock_);
- ObjPtr<mirror::Class> ResolveGetType(uint32_t type_idx) REQUIRES_SHARED(Locks::mutator_lock_);
+ ObjPtr<mirror::Class> ResolveGetType(dex::TypeIndex type_idx)
+ REQUIRES_SHARED(Locks::mutator_lock_);
ObjPtr<mirror::String> ResolveGetStringName(Thread* self,
const DexFile& dex_file,
- uint32_t string_idx,
+ dex::StringIndex string_idx,
ObjPtr<mirror::DexCache> dex_cache)
REQUIRES_SHARED(Locks::mutator_lock_);
diff --git a/runtime/art_method-inl.h b/runtime/art_method-inl.h
index a652178..ef03bb3 100644
--- a/runtime/art_method-inl.h
+++ b/runtime/art_method-inl.h
@@ -105,7 +105,7 @@
DoGetAccessFlagsHelper<kReadBarrierOption>(this);
}
}
- return access_flags_;
+ return access_flags_.load(std::memory_order_relaxed);
}
inline uint16_t ArtMethod::GetMethodIndex() {
@@ -183,17 +183,17 @@
}
template <bool kWithCheck>
-inline mirror::Class* ArtMethod::GetDexCacheResolvedType(uint32_t type_index,
+inline mirror::Class* ArtMethod::GetDexCacheResolvedType(dex::TypeIndex type_index,
PointerSize pointer_size) {
if (kWithCheck) {
mirror::DexCache* dex_cache =
GetInterfaceMethodIfProxy(pointer_size)->GetDeclaringClass()->GetDexCache();
- if (UNLIKELY(type_index >= dex_cache->NumResolvedTypes())) {
- ThrowArrayIndexOutOfBoundsException(type_index, dex_cache->NumResolvedTypes());
+ if (UNLIKELY(type_index.index_ >= dex_cache->NumResolvedTypes())) {
+ ThrowArrayIndexOutOfBoundsException(type_index.index_, dex_cache->NumResolvedTypes());
return nullptr;
}
}
- mirror::Class* klass = GetDexCacheResolvedTypes(pointer_size)[type_index].Read();
+ mirror::Class* klass = GetDexCacheResolvedTypes(pointer_size)[type_index.index_].Read();
return (klass != nullptr && !klass->IsErroneous()) ? klass : nullptr;
}
@@ -210,7 +210,7 @@
return GetDexCacheResolvedTypes(pointer_size) == other->GetDexCacheResolvedTypes(pointer_size);
}
-inline mirror::Class* ArtMethod::GetClassFromTypeIndex(uint16_t type_idx,
+inline mirror::Class* ArtMethod::GetClassFromTypeIndex(dex::TypeIndex type_idx,
bool resolve,
PointerSize pointer_size) {
mirror::Class* type = GetDexCacheResolvedType(type_idx, pointer_size);
@@ -336,7 +336,7 @@
return GetDeclaringClass()->GetDexFile().GetCodeItem(GetCodeItemOffset());
}
-inline bool ArtMethod::IsResolvedTypeIdx(uint16_t type_idx, PointerSize pointer_size) {
+inline bool ArtMethod::IsResolvedTypeIdx(dex::TypeIndex type_idx, PointerSize pointer_size) {
DCHECK(!IsProxyMethod());
return GetDexCacheResolvedType(type_idx, pointer_size) != nullptr;
}
@@ -383,11 +383,10 @@
const DexFile* dex_file = GetDexFile();
const DexFile::MethodId& method_id = dex_file->GetMethodId(GetDexMethodIndex());
const DexFile::ProtoId& proto_id = dex_file->GetMethodPrototype(method_id);
- uint16_t return_type_idx = proto_id.return_type_idx_;
- return dex_file->GetTypeDescriptor(dex_file->GetTypeId(return_type_idx));
+ return dex_file->GetTypeDescriptor(dex_file->GetTypeId(proto_id.return_type_idx_));
}
-inline const char* ArtMethod::GetTypeDescriptorFromTypeIdx(uint16_t type_idx) {
+inline const char* ArtMethod::GetTypeDescriptorFromTypeIdx(dex::TypeIndex type_idx) {
DCHECK(!IsProxyMethod());
const DexFile* dex_file = GetDexFile();
return dex_file->GetTypeDescriptor(dex_file->GetTypeId(type_idx));
@@ -400,7 +399,11 @@
inline mirror::DexCache* ArtMethod::GetDexCache() {
DCHECK(!IsProxyMethod());
- return GetDeclaringClass()->GetDexCache();
+ if (UNLIKELY(IsObsolete())) {
+ return GetObsoleteDexCache();
+ } else {
+ return GetDeclaringClass()->GetDexCache();
+ }
}
template<ReadBarrierOption kReadBarrierOption>
@@ -440,7 +443,7 @@
const DexFile* dex_file = GetDexFile();
const DexFile::MethodId& method_id = dex_file->GetMethodId(GetDexMethodIndex());
const DexFile::ProtoId& proto_id = dex_file->GetMethodPrototype(method_id);
- uint16_t return_type_idx = proto_id.return_type_idx_;
+ dex::TypeIndex return_type_idx = proto_id.return_type_idx_;
mirror::Class* type = GetDexCacheResolvedType(return_type_idx, pointer_size);
if (type == nullptr && resolve) {
type = Runtime::Current()->GetClassLinker()->ResolveType(return_type_idx, this);
@@ -449,6 +452,53 @@
return type;
}
+inline bool ArtMethod::HasSingleImplementation() {
+ if (IsFinal() || GetDeclaringClass()->IsFinal()) {
+ // We don't set kAccSingleImplementation for these cases since intrinsic
+ // can use the flag also.
+ return true;
+ }
+ return (GetAccessFlags() & kAccSingleImplementation) != 0;
+}
+
+inline void ArtMethod::SetIntrinsic(uint32_t intrinsic) {
+ DCHECK(IsUint<8>(intrinsic));
+ // Currently we only do intrinsics for static/final methods or methods of final
+ // classes. We don't set kHasSingleImplementation for those methods.
+ DCHECK(IsStatic() || IsFinal() || GetDeclaringClass()->IsFinal()) <<
+ "Potential conflict with kAccSingleImplementation";
+ uint32_t new_value = (GetAccessFlags() & kAccFlagsNotUsedByIntrinsic) |
+ kAccIntrinsic |
+ (intrinsic << POPCOUNT(kAccFlagsNotUsedByIntrinsic));
+ if (kIsDebugBuild) {
+ uint32_t java_flags = (GetAccessFlags() & kAccJavaFlagsMask);
+ bool is_constructor = IsConstructor();
+ bool is_synchronized = IsSynchronized();
+ bool skip_access_checks = SkipAccessChecks();
+ bool is_fast_native = IsFastNative();
+ bool is_copied = IsCopied();
+ bool is_miranda = IsMiranda();
+ bool is_default = IsDefault();
+ bool is_default_conflict = IsDefaultConflicting();
+ bool is_compilable = IsCompilable();
+ bool must_count_locks = MustCountLocks();
+ SetAccessFlags(new_value);
+ DCHECK_EQ(java_flags, (GetAccessFlags() & kAccJavaFlagsMask));
+ DCHECK_EQ(is_constructor, IsConstructor());
+ DCHECK_EQ(is_synchronized, IsSynchronized());
+ DCHECK_EQ(skip_access_checks, SkipAccessChecks());
+ DCHECK_EQ(is_fast_native, IsFastNative());
+ DCHECK_EQ(is_copied, IsCopied());
+ DCHECK_EQ(is_miranda, IsMiranda());
+ DCHECK_EQ(is_default, IsDefault());
+ DCHECK_EQ(is_default_conflict, IsDefaultConflicting());
+ DCHECK_EQ(is_compilable, IsCompilable());
+ DCHECK_EQ(must_count_locks, MustCountLocks());
+ } else {
+ SetAccessFlags(new_value);
+ }
+}
+
template<ReadBarrierOption kReadBarrierOption, typename RootVisitorType>
void ArtMethod::VisitRoots(RootVisitorType& visitor, PointerSize pointer_size) {
if (LIKELY(!declaring_class_.IsNull())) {
@@ -467,20 +517,6 @@
klass, this));
interface_method->VisitRoots(visitor, pointer_size);
}
- // We know we don't have profiling information if the class hasn't been verified. Note
- // that this check also ensures the IsNative call can be made, as IsNative expects a fully
- // created class (and not a retired one).
- if (klass->IsVerified()) {
- // Runtime methods and native methods use the same field as the profiling info for
- // storing their own data (jni entrypoint for native methods, and ImtConflictTable for
- // some runtime methods).
- if (!IsNative<kReadBarrierOption>() && !IsRuntimeMethod()) {
- ProfilingInfo* profiling_info = GetProfilingInfo(pointer_size);
- if (profiling_info != nullptr) {
- profiling_info->VisitRoots(visitor);
- }
- }
- }
}
}
diff --git a/runtime/art_method.cc b/runtime/art_method.cc
index c550a1b..dfc7837 100644
--- a/runtime/art_method.cc
+++ b/runtime/art_method.cc
@@ -18,6 +18,8 @@
#include <cstddef>
+#include "android-base/stringprintf.h"
+
#include "arch/context.h"
#include "art_field-inl.h"
#include "art_method-inl.h"
@@ -35,6 +37,7 @@
#include "jit/profiling_info.h"
#include "jni_internal.h"
#include "mirror/class-inl.h"
+#include "mirror/class_ext.h"
#include "mirror/executable.h"
#include "mirror/object_array-inl.h"
#include "mirror/object-inl.h"
@@ -45,11 +48,24 @@
namespace art {
+using android::base::StringPrintf;
+
extern "C" void art_quick_invoke_stub(ArtMethod*, uint32_t*, uint32_t, Thread*, JValue*,
const char*);
extern "C" void art_quick_invoke_static_stub(ArtMethod*, uint32_t*, uint32_t, Thread*, JValue*,
const char*);
+ArtMethod* ArtMethod::GetSingleImplementation() {
+ DCHECK(!IsNative());
+ if (!IsAbstract()) {
+ // A non-abstract's single implementation is itself.
+ return this;
+ }
+ // TODO: add single-implementation logic for abstract method by storing it
+ // in ptr_sized_fields_.
+ return nullptr;
+}
+
ArtMethod* ArtMethod::FromReflectedMethod(const ScopedObjectAccessAlreadyRunnable& soa,
jobject jlr_method) {
ObjPtr<mirror::Executable> executable = soa.Decode<mirror::Executable>(jlr_method);
@@ -57,6 +73,29 @@
return executable->GetArtMethod();
}
+mirror::DexCache* ArtMethod::GetObsoleteDexCache() {
+ DCHECK(!Runtime::Current()->IsAotCompiler()) << PrettyMethod();
+ DCHECK(IsObsolete());
+ ObjPtr<mirror::ClassExt> ext(GetDeclaringClass()->GetExtData());
+ CHECK(!ext.IsNull());
+ ObjPtr<mirror::PointerArray> obsolete_methods(ext->GetObsoleteMethods());
+ CHECK(!obsolete_methods.IsNull());
+ DCHECK(ext->GetObsoleteDexCaches() != nullptr);
+ int32_t len = obsolete_methods->GetLength();
+ DCHECK_EQ(len, ext->GetObsoleteDexCaches()->GetLength());
+ // Using kRuntimePointerSize (instead of using the image's pointer size) is fine since images
+ // should never have obsolete methods in them so they should always be the same.
+ PointerSize pointer_size = kRuntimePointerSize;
+ DCHECK_EQ(kRuntimePointerSize, Runtime::Current()->GetClassLinker()->GetImagePointerSize());
+ for (int32_t i = 0; i < len; i++) {
+ if (this == obsolete_methods->GetElementPtrSize<ArtMethod*>(i, pointer_size)) {
+ return ext->GetObsoleteDexCaches()->Get(i);
+ }
+ }
+ LOG(FATAL) << "This method does not appear in the obsolete map of its class!";
+ UNREACHABLE();
+}
+
mirror::String* ArtMethod::GetNameAsString(Thread* self) {
CHECK(!IsProxyMethod());
StackHandleScope<1> hs(self);
@@ -199,9 +238,9 @@
// Iterate over the catch handlers associated with dex_pc.
PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
for (CatchHandlerIterator it(*code_item, dex_pc); it.HasNext(); it.Next()) {
- uint16_t iter_type_idx = it.GetHandlerTypeIndex();
+ dex::TypeIndex iter_type_idx = it.GetHandlerTypeIndex();
// Catch all case
- if (iter_type_idx == DexFile::kDexNoIndex16) {
+ if (!iter_type_idx.IsValid()) {
found_dex_pc = it.GetHandlerAddress();
break;
}
@@ -322,7 +361,7 @@
CHECK(!IsFastNative()) << PrettyMethod();
CHECK(native_method != nullptr) << PrettyMethod();
if (is_fast) {
- SetAccessFlags(GetAccessFlags() | kAccFastNative);
+ AddAccessFlags(kAccFastNative);
}
SetEntryPointFromJni(native_method);
}
@@ -476,7 +515,11 @@
}
// The table is in the .vdex file.
const OatFile::OatDexFile* oat_dex_file = GetDexCache()->GetDexFile()->GetOatDexFile();
- return oat_dex_file->GetOatFile()->DexBegin() + header->vmap_table_offset_;
+ const OatFile* oat_file = oat_dex_file->GetOatFile();
+ if (oat_file == nullptr) {
+ return nullptr;
+ }
+ return oat_file->DexBegin() + header->GetVmapTableOffset();
} else {
return oat_method.GetVmapTable();
}
@@ -574,7 +617,7 @@
DCHECK(method_header->Contains(pc))
<< PrettyMethod()
<< " " << std::hex << pc << " " << oat_entry_point
- << " " << (uintptr_t)(method_header->code_ + method_header->code_size_);
+ << " " << (uintptr_t)(method_header->GetCode() + method_header->GetCodeSize());
return method_header;
}
diff --git a/runtime/art_method.h b/runtime/art_method.h
index b31999f..3bc6f5d 100644
--- a/runtime/art_method.h
+++ b/runtime/art_method.h
@@ -85,9 +85,29 @@
template <ReadBarrierOption kReadBarrierOption = kWithReadBarrier>
ALWAYS_INLINE uint32_t GetAccessFlags();
+ // This version should only be called when it's certain there is no
+ // concurrency so there is no need to guarantee atomicity. For example,
+ // before the method is linked.
void SetAccessFlags(uint32_t new_access_flags) {
- // Not called within a transaction.
- access_flags_ = new_access_flags;
+ access_flags_.store(new_access_flags, std::memory_order_relaxed);
+ }
+
+ // This setter guarantees atomicity.
+ void AddAccessFlags(uint32_t flag) {
+ uint32_t old_access_flags = access_flags_.load(std::memory_order_relaxed);
+ uint32_t new_access_flags;
+ do {
+ new_access_flags = old_access_flags | flag;
+ } while (!access_flags_.compare_exchange_weak(old_access_flags, new_access_flags));
+ }
+
+ // This setter guarantees atomicity.
+ void ClearAccessFlags(uint32_t flag) {
+ uint32_t old_access_flags = access_flags_.load(std::memory_order_relaxed);
+ uint32_t new_access_flags;
+ do {
+ new_access_flags = old_access_flags & ~flag;
+ } while (!access_flags_.compare_exchange_weak(old_access_flags, new_access_flags));
}
// Approximate what kind of method call would be used for this method.
@@ -142,39 +162,7 @@
return (GetAccessFlags() & kAccIntrinsic) != 0;
}
- void SetIntrinsic(uint32_t intrinsic) {
- DCHECK(IsUint<8>(intrinsic));
- uint32_t new_value = (GetAccessFlags() & kAccFlagsNotUsedByIntrinsic) |
- kAccIntrinsic |
- (intrinsic << POPCOUNT(kAccFlagsNotUsedByIntrinsic));
- if (kIsDebugBuild) {
- uint32_t java_flags = (GetAccessFlags() & kAccJavaFlagsMask);
- bool is_constructor = IsConstructor();
- bool is_synchronized = IsSynchronized();
- bool skip_access_checks = SkipAccessChecks();
- bool is_fast_native = IsFastNative();
- bool is_copied = IsCopied();
- bool is_miranda = IsMiranda();
- bool is_default = IsDefault();
- bool is_default_conflict = IsDefaultConflicting();
- bool is_compilable = IsCompilable();
- bool must_count_locks = MustCountLocks();
- SetAccessFlags(new_value);
- DCHECK_EQ(java_flags, (GetAccessFlags() & kAccJavaFlagsMask));
- DCHECK_EQ(is_constructor, IsConstructor());
- DCHECK_EQ(is_synchronized, IsSynchronized());
- DCHECK_EQ(skip_access_checks, SkipAccessChecks());
- DCHECK_EQ(is_fast_native, IsFastNative());
- DCHECK_EQ(is_copied, IsCopied());
- DCHECK_EQ(is_miranda, IsMiranda());
- DCHECK_EQ(is_default, IsDefault());
- DCHECK_EQ(is_default_conflict, IsDefaultConflicting());
- DCHECK_EQ(is_compilable, IsCompilable());
- DCHECK_EQ(must_count_locks, MustCountLocks());
- } else {
- SetAccessFlags(new_value);
- }
- }
+ ALWAYS_INLINE void SetIntrinsic(uint32_t intrinsic) REQUIRES_SHARED(Locks::mutator_lock_);
uint32_t GetIntrinsic() {
DCHECK(IsIntrinsic());
@@ -227,6 +215,11 @@
return (GetAccessFlags() & kAccDefault) != 0;
}
+ bool IsObsolete() {
+ // TODO Should maybe make this IsIntrinsic check not needed
+ return !IsIntrinsic() && (GetAccessFlags() & kAccObsoleteMethod) != 0;
+ }
+
template <ReadBarrierOption kReadBarrierOption = kWithReadBarrier>
bool IsNative() {
return (GetAccessFlags<kReadBarrierOption>() & kAccNative) != 0;
@@ -245,6 +238,10 @@
return (GetAccessFlags() & kAccSynthetic) != 0;
}
+ bool IsVarargs() {
+ return (GetAccessFlags() & kAccVarargs) != 0;
+ }
+
template<ReadBarrierOption kReadBarrierOption = kWithReadBarrier>
bool IsProxyMethod() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -254,7 +251,7 @@
void SetSkipAccessChecks() {
DCHECK(!SkipAccessChecks());
- SetAccessFlags(GetAccessFlags() | kAccSkipAccessChecks);
+ AddAccessFlags(kAccSkipAccessChecks);
}
// Should this method be run in the interpreter and count locks (e.g., failed structured-
@@ -343,7 +340,7 @@
REQUIRES_SHARED(Locks::mutator_lock_);
template <bool kWithCheck = true>
- mirror::Class* GetDexCacheResolvedType(uint32_t type_idx, PointerSize pointer_size)
+ mirror::Class* GetDexCacheResolvedType(dex::TypeIndex type_idx, PointerSize pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_);
void SetDexCacheResolvedTypes(GcRoot<mirror::Class>* new_dex_cache_types,
PointerSize pointer_size)
@@ -355,7 +352,9 @@
REQUIRES_SHARED(Locks::mutator_lock_);
// Get the Class* from the type index into this method's dex cache.
- mirror::Class* GetClassFromTypeIndex(uint16_t type_idx, bool resolve, PointerSize pointer_size)
+ mirror::Class* GetClassFromTypeIndex(dex::TypeIndex type_idx,
+ bool resolve,
+ PointerSize pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_);
// Returns true if this method has the same name and signature of the other method.
@@ -454,6 +453,26 @@
return DataOffset(kRuntimePointerSize);
}
+ ALWAYS_INLINE bool HasSingleImplementation() REQUIRES_SHARED(Locks::mutator_lock_);
+
+ ALWAYS_INLINE void SetHasSingleImplementation(bool single_impl) {
+ DCHECK(!IsIntrinsic()) << "conflict with intrinsic bits";
+ if (single_impl) {
+ AddAccessFlags(kAccSingleImplementation);
+ } else {
+ ClearAccessFlags(kAccSingleImplementation);
+ }
+ }
+
+ ArtMethod* GetSingleImplementation()
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ ALWAYS_INLINE void SetSingleImplementation(ArtMethod* method, PointerSize pointer_size) {
+ DCHECK(!IsNative());
+ DCHECK(IsAbstract()); // Non-abstract method's single implementation is just itself.
+ SetDataPtrSize(method, pointer_size);
+ }
+
void* GetEntryPointFromJni() {
DCHECK(IsNative());
return GetEntryPointFromJniPtrSize(kRuntimePointerSize);
@@ -527,7 +546,7 @@
const DexFile::CodeItem* GetCodeItem() REQUIRES_SHARED(Locks::mutator_lock_);
- bool IsResolvedTypeIdx(uint16_t type_idx, PointerSize pointer_size)
+ bool IsResolvedTypeIdx(dex::TypeIndex type_idx, PointerSize pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_);
int32_t GetLineNumFromDexPC(uint32_t dex_pc) REQUIRES_SHARED(Locks::mutator_lock_);
@@ -544,7 +563,7 @@
const char* GetReturnTypeDescriptor() REQUIRES_SHARED(Locks::mutator_lock_);
- const char* GetTypeDescriptorFromTypeIdx(uint16_t type_idx)
+ const char* GetTypeDescriptorFromTypeIdx(dex::TypeIndex type_idx)
REQUIRES_SHARED(Locks::mutator_lock_);
// May cause thread suspension due to GetClassFromTypeIdx calling ResolveType this caused a large
@@ -555,6 +574,7 @@
mirror::ClassLoader* GetClassLoader() REQUIRES_SHARED(Locks::mutator_lock_);
mirror::DexCache* GetDexCache() REQUIRES_SHARED(Locks::mutator_lock_);
+ mirror::DexCache* GetObsoleteDexCache() REQUIRES_SHARED(Locks::mutator_lock_);
ALWAYS_INLINE ArtMethod* GetInterfaceMethodIfProxy(PointerSize pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -647,7 +667,10 @@
GcRoot<mirror::Class> declaring_class_;
// Access flags; low 16 bits are defined by spec.
- uint32_t access_flags_;
+ // Getting and setting this flag needs to be atomic when concurrency is
+ // possible, e.g. after this method's class is linked. Such as when setting
+ // verifier flags and single-implementation flag.
+ std::atomic<std::uint32_t> access_flags_;
/* Dex file fields. The defining dex file is available via declaring_class_->dex_cache_ */
diff --git a/runtime/asm_support.h b/runtime/asm_support.h
index 5ef1f06..e4972da 100644
--- a/runtime/asm_support.h
+++ b/runtime/asm_support.h
@@ -175,19 +175,19 @@
#define MIRROR_CLASS_IF_TABLE_OFFSET (16 + MIRROR_OBJECT_HEADER_SIZE)
ADD_TEST_EQ(MIRROR_CLASS_IF_TABLE_OFFSET,
art::mirror::Class::IfTableOffset().Int32Value())
-#define MIRROR_CLASS_ACCESS_FLAGS_OFFSET (64 + MIRROR_OBJECT_HEADER_SIZE)
+#define MIRROR_CLASS_ACCESS_FLAGS_OFFSET (56 + MIRROR_OBJECT_HEADER_SIZE)
ADD_TEST_EQ(MIRROR_CLASS_ACCESS_FLAGS_OFFSET,
art::mirror::Class::AccessFlagsOffset().Int32Value())
-#define MIRROR_CLASS_OBJECT_SIZE_OFFSET (96 + MIRROR_OBJECT_HEADER_SIZE)
+#define MIRROR_CLASS_OBJECT_SIZE_OFFSET (88 + MIRROR_OBJECT_HEADER_SIZE)
ADD_TEST_EQ(MIRROR_CLASS_OBJECT_SIZE_OFFSET,
art::mirror::Class::ObjectSizeOffset().Int32Value())
-#define MIRROR_CLASS_OBJECT_SIZE_ALLOC_FAST_PATH_OFFSET (100 + MIRROR_OBJECT_HEADER_SIZE)
+#define MIRROR_CLASS_OBJECT_SIZE_ALLOC_FAST_PATH_OFFSET (92 + MIRROR_OBJECT_HEADER_SIZE)
ADD_TEST_EQ(MIRROR_CLASS_OBJECT_SIZE_ALLOC_FAST_PATH_OFFSET,
art::mirror::Class::ObjectSizeAllocFastPathOffset().Int32Value())
-#define MIRROR_CLASS_OBJECT_PRIMITIVE_TYPE_OFFSET (104 + MIRROR_OBJECT_HEADER_SIZE)
+#define MIRROR_CLASS_OBJECT_PRIMITIVE_TYPE_OFFSET (96 + MIRROR_OBJECT_HEADER_SIZE)
ADD_TEST_EQ(MIRROR_CLASS_OBJECT_PRIMITIVE_TYPE_OFFSET,
art::mirror::Class::PrimitiveTypeOffset().Int32Value())
-#define MIRROR_CLASS_STATUS_OFFSET (112 + MIRROR_OBJECT_HEADER_SIZE)
+#define MIRROR_CLASS_STATUS_OFFSET (104 + MIRROR_OBJECT_HEADER_SIZE)
ADD_TEST_EQ(MIRROR_CLASS_STATUS_OFFSET,
art::mirror::Class::StatusOffset().Int32Value())
diff --git a/runtime/barrier.cc b/runtime/barrier.cc
index 0d842cc..9bcda35 100644
--- a/runtime/barrier.cc
+++ b/runtime/barrier.cc
@@ -80,6 +80,11 @@
return timed_out;
}
+int Barrier::GetCount(Thread* self) {
+ MutexLock mu(self, lock_);
+ return count_;
+}
+
void Barrier::SetCountLocked(Thread* self, int count) {
count_ = count;
if (count == 0) {
diff --git a/runtime/barrier.h b/runtime/barrier.h
index 94977fb..d7c4661 100644
--- a/runtime/barrier.h
+++ b/runtime/barrier.h
@@ -61,6 +61,8 @@
// another thread is still in Wait(). See above.
void Init(Thread* self, int count) REQUIRES(!lock_);
+ int GetCount(Thread* self) REQUIRES(!lock_);
+
private:
void SetCountLocked(Thread* self, int count) REQUIRES(lock_);
diff --git a/runtime/base/arena_allocator.h b/runtime/base/arena_allocator.h
index 62cd2a7..2feb28a 100644
--- a/runtime/base/arena_allocator.h
+++ b/runtime/base/arena_allocator.h
@@ -94,6 +94,7 @@
kArenaAllocGraphChecker,
kArenaAllocVerifier,
kArenaAllocCallingConvention,
+ kArenaAllocCHA,
kNumArenaAllocKinds
};
diff --git a/runtime/base/file_magic.cc b/runtime/base/file_magic.cc
index de6f423..568a7ae 100644
--- a/runtime/base/file_magic.cc
+++ b/runtime/base/file_magic.cc
@@ -20,13 +20,16 @@
#include <sys/stat.h>
#include <sys/types.h>
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
#include "base/unix_file/fd_file.h"
#include "dex_file.h"
-#include "stringprintf.h"
namespace art {
+using android::base::StringPrintf;
+
File OpenAndReadMagic(const char* filename, uint32_t* magic, std::string* error_msg) {
CHECK(magic != nullptr);
File fd(filename, O_RDONLY, /* check_usage */ false);
diff --git a/runtime/base/logging.cc b/runtime/base/logging.cc
index 6b21a56..1dca428 100644
--- a/runtime/base/logging.cc
+++ b/runtime/base/logging.cc
@@ -80,7 +80,7 @@
gCmdLine.reset(new std::string("<unset>"));
}
-#ifdef __ANDROID__
+#ifdef ART_TARGET_ANDROID
#define INIT_LOGGING_DEFAULT_LOGGER android::base::LogdLogger()
#else
#define INIT_LOGGING_DEFAULT_LOGGER android::base::StderrLogger
diff --git a/runtime/base/mutex-inl.h b/runtime/base/mutex-inl.h
index 92b7c65..44a84c8 100644
--- a/runtime/base/mutex-inl.h
+++ b/runtime/base/mutex-inl.h
@@ -21,7 +21,6 @@
#include "mutex.h"
-#include "base/stringprintf.h"
#include "base/value_object.h"
#include "thread.h"
#include "utils.h"
diff --git a/runtime/base/mutex.cc b/runtime/base/mutex.cc
index 5d92298..9116097 100644
--- a/runtime/base/mutex.cc
+++ b/runtime/base/mutex.cc
@@ -19,6 +19,8 @@
#include <errno.h>
#include <sys/time.h>
+#include "android-base/stringprintf.h"
+
#include "atomic.h"
#include "base/logging.h"
#include "base/time_utils.h"
@@ -30,6 +32,8 @@
namespace art {
+using android::base::StringPrintf;
+
static Atomic<Locks::ClientCallback*> safe_to_call_abort_callback(nullptr);
Mutex* Locks::abort_lock_ = nullptr;
@@ -48,7 +52,7 @@
Mutex* Locks::modify_ldt_lock_ = nullptr;
MutatorMutex* Locks::mutator_lock_ = nullptr;
Mutex* Locks::profiler_lock_ = nullptr;
-Mutex* Locks::verifier_deps_lock_ = nullptr;
+ReaderWriterMutex* Locks::verifier_deps_lock_ = nullptr;
ReaderWriterMutex* Locks::oat_file_manager_lock_ = nullptr;
Mutex* Locks::host_dlopen_handles_lock_ = nullptr;
Mutex* Locks::reference_processor_lock_ = nullptr;
@@ -58,6 +62,7 @@
Mutex* Locks::reference_queue_soft_references_lock_ = nullptr;
Mutex* Locks::reference_queue_weak_references_lock_ = nullptr;
Mutex* Locks::runtime_shutdown_lock_ = nullptr;
+Mutex* Locks::cha_lock_ = nullptr;
Mutex* Locks::thread_list_lock_ = nullptr;
ConditionVariable* Locks::thread_exit_cond_ = nullptr;
Mutex* Locks::thread_suspend_count_lock_ = nullptr;
@@ -66,6 +71,7 @@
Uninterruptible Roles::uninterruptible_;
ReaderWriterMutex* Locks::jni_globals_lock_ = nullptr;
Mutex* Locks::jni_weak_globals_lock_ = nullptr;
+ReaderWriterMutex* Locks::dex_lock_ = nullptr;
struct AllMutexData {
// A guard for all_mutexes_ that's not a mutex (Mutexes must CAS to acquire and busy wait).
@@ -672,7 +678,7 @@
ScopedContentionRecorder scr(this, GetExclusiveOwnerTid(), SafeGetTid(self));
++num_pending_readers_;
if (futex(state_.Address(), FUTEX_WAIT, cur_state, nullptr, nullptr, 0) != 0) {
- if (errno != EAGAIN) {
+ if (errno != EAGAIN && errno != EINTR) {
PLOG(FATAL) << "futex wait failed for " << name_;
}
}
@@ -796,7 +802,7 @@
reinterpret_cast<const timespec*>(std::numeric_limits<int32_t>::max()),
guard_.state_.Address(), cur_sequence) != -1;
if (!done) {
- if (errno != EAGAIN) {
+ if (errno != EAGAIN && errno != EINTR) {
PLOG(FATAL) << "futex cmp requeue failed for " << name_;
}
}
@@ -955,10 +961,12 @@
DCHECK(logging_lock_ != nullptr);
DCHECK(mutator_lock_ != nullptr);
DCHECK(profiler_lock_ != nullptr);
+ DCHECK(cha_lock_ != nullptr);
DCHECK(thread_list_lock_ != nullptr);
DCHECK(thread_suspend_count_lock_ != nullptr);
DCHECK(trace_lock_ != nullptr);
DCHECK(unexpected_signal_lock_ != nullptr);
+ DCHECK(dex_lock_ != nullptr);
} else {
// Create global locks in level order from highest lock level to lowest.
LockLevel current_lock_level = kInstrumentEntrypointsLock;
@@ -1014,6 +1022,10 @@
DCHECK(breakpoint_lock_ == nullptr);
breakpoint_lock_ = new ReaderWriterMutex("breakpoint lock", current_lock_level);
+ UPDATE_CURRENT_LOCK_LEVEL(kCHALock);
+ DCHECK(cha_lock_ == nullptr);
+ cha_lock_ = new Mutex("CHA lock", current_lock_level);
+
UPDATE_CURRENT_LOCK_LEVEL(kClassLinkerClassesLock);
DCHECK(classlinker_classes_lock_ == nullptr);
classlinker_classes_lock_ = new ReaderWriterMutex("ClassLinker classes lock",
@@ -1033,13 +1045,17 @@
modify_ldt_lock_ = new Mutex("modify_ldt lock", current_lock_level);
}
+ UPDATE_CURRENT_LOCK_LEVEL(kDexLock);
+ DCHECK(dex_lock_ == nullptr);
+ dex_lock_ = new ReaderWriterMutex("ClassLinker dex lock", current_lock_level);
+
UPDATE_CURRENT_LOCK_LEVEL(kOatFileManagerLock);
DCHECK(oat_file_manager_lock_ == nullptr);
oat_file_manager_lock_ = new ReaderWriterMutex("OatFile manager lock", current_lock_level);
UPDATE_CURRENT_LOCK_LEVEL(kVerifierDepsLock);
DCHECK(verifier_deps_lock_ == nullptr);
- verifier_deps_lock_ = new Mutex("verifier deps lock", current_lock_level);
+ verifier_deps_lock_ = new ReaderWriterMutex("verifier deps lock", current_lock_level);
UPDATE_CURRENT_LOCK_LEVEL(kHostDlOpenHandlesLock);
DCHECK(host_dlopen_handles_lock_ == nullptr);
diff --git a/runtime/base/mutex.h b/runtime/base/mutex.h
index 74b786c..255ad71 100644
--- a/runtime/base/mutex.h
+++ b/runtime/base/mutex.h
@@ -97,6 +97,7 @@
kMonitorPoolLock,
kClassLinkerClassesLock, // TODO rename.
kJitCodeCacheLock,
+ kCHALock,
kBreakpointLock,
kMonitorLock,
kMonitorListLock,
@@ -627,9 +628,12 @@
// TODO: improve name, perhaps instrumentation_update_lock_.
static Mutex* deoptimization_lock_ ACQUIRED_AFTER(alloc_tracker_lock_);
+ // Guards Class Hierarchy Analysis (CHA).
+ static Mutex* cha_lock_ ACQUIRED_AFTER(deoptimization_lock_);
+
// The thread_list_lock_ guards ThreadList::list_. It is also commonly held to stop threads
// attaching and detaching.
- static Mutex* thread_list_lock_ ACQUIRED_AFTER(deoptimization_lock_);
+ static Mutex* thread_list_lock_ ACQUIRED_AFTER(cha_lock_);
// Signaled when threads terminate. Used to determine when all non-daemons have terminated.
static ConditionVariable* thread_exit_cond_ GUARDED_BY(Locks::thread_list_lock_);
@@ -655,11 +659,13 @@
// Guards modification of the LDT on x86.
static Mutex* modify_ldt_lock_ ACQUIRED_AFTER(allocated_thread_ids_lock_);
- // Guards opened oat files in OatFileManager.
- static ReaderWriterMutex* oat_file_manager_lock_ ACQUIRED_AFTER(modify_ldt_lock_);
+ static ReaderWriterMutex* dex_lock_ ACQUIRED_AFTER(modify_ldt_lock_);
- // Guards verifier dependency collection in VerifierDeps.
- static Mutex* verifier_deps_lock_ ACQUIRED_AFTER(oat_file_manager_lock_);
+ // Guards opened oat files in OatFileManager.
+ static ReaderWriterMutex* oat_file_manager_lock_ ACQUIRED_AFTER(dex_lock_);
+
+ // Guards extra string entries for VerifierDeps.
+ static ReaderWriterMutex* verifier_deps_lock_ ACQUIRED_AFTER(oat_file_manager_lock_);
// Guards dlopen_handles_ in DlOpenOatFile.
static Mutex* host_dlopen_handles_lock_ ACQUIRED_AFTER(verifier_deps_lock_);
diff --git a/runtime/base/scoped_flock.cc b/runtime/base/scoped_flock.cc
index 0e8031f..d4bb56b 100644
--- a/runtime/base/scoped_flock.cc
+++ b/runtime/base/scoped_flock.cc
@@ -19,12 +19,15 @@
#include <sys/file.h>
#include <sys/stat.h>
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
-#include "base/stringprintf.h"
#include "base/unix_file/fd_file.h"
namespace art {
+using android::base::StringPrintf;
+
bool ScopedFlock::Init(const char* filename, std::string* error_msg) {
return Init(filename, O_CREAT | O_RDWR, true, error_msg);
}
diff --git a/runtime/base/stl_util.h b/runtime/base/stl_util.h
index a53dcea..d5f375a 100644
--- a/runtime/base/stl_util.h
+++ b/runtime/base/stl_util.h
@@ -18,6 +18,7 @@
#define ART_RUNTIME_BASE_STL_UTIL_H_
#include <algorithm>
+#include <set>
#include <sstream>
#include "base/logging.h"
@@ -187,6 +188,12 @@
using type = T;
};
+// Merge `other` entries into `to_update`.
+template <typename T>
+static inline void MergeSets(std::set<T>& to_update, const std::set<T>& other) {
+ to_update.insert(other.begin(), other.end());
+}
+
} // namespace art
#endif // ART_RUNTIME_BASE_STL_UTIL_H_
diff --git a/runtime/base/stringprintf.cc b/runtime/base/stringprintf.cc
deleted file mode 100644
index 8fd9257..0000000
--- a/runtime/base/stringprintf.cc
+++ /dev/null
@@ -1,81 +0,0 @@
-/*
- * Copyright (C) 2011 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#include "stringprintf.h"
-
-#include <stdio.h>
-
-namespace art {
-
-void StringAppendV(std::string* dst, const char* format, va_list ap) {
- // First try with a small fixed size buffer
- char space[1024];
-
- // It's possible for methods that use a va_list to invalidate
- // the data in it upon use. The fix is to make a copy
- // of the structure before using it and use that copy instead.
- va_list backup_ap;
- va_copy(backup_ap, ap);
- int result = vsnprintf(space, sizeof(space), format, backup_ap);
- va_end(backup_ap);
-
- if (result < static_cast<int>(sizeof(space))) {
- if (result >= 0) {
- // Normal case -- everything fit.
- dst->append(space, result);
- return;
- }
-
- if (result < 0) {
- // Just an error.
- return;
- }
- }
-
- // Increase the buffer size to the size requested by vsnprintf,
- // plus one for the closing \0.
- int length = result+1;
- char* buf = new char[length];
-
- // Restore the va_list before we use it again
- va_copy(backup_ap, ap);
- result = vsnprintf(buf, length, format, backup_ap);
- va_end(backup_ap);
-
- if (result >= 0 && result < length) {
- // It fit
- dst->append(buf, result);
- }
- delete[] buf;
-}
-
-std::string StringPrintf(const char* fmt, ...) {
- va_list ap;
- va_start(ap, fmt);
- std::string result;
- StringAppendV(&result, fmt, ap);
- va_end(ap);
- return result;
-}
-
-void StringAppendF(std::string* dst, const char* format, ...) {
- va_list ap;
- va_start(ap, format);
- StringAppendV(dst, format, ap);
- va_end(ap);
-}
-
-} // namespace art
diff --git a/runtime/base/stringprintf.h b/runtime/base/stringprintf.h
deleted file mode 100644
index 4767a75..0000000
--- a/runtime/base/stringprintf.h
+++ /dev/null
@@ -1,38 +0,0 @@
-/*
- * Copyright (C) 2011 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#ifndef ART_RUNTIME_BASE_STRINGPRINTF_H_
-#define ART_RUNTIME_BASE_STRINGPRINTF_H_
-
-#include <stdarg.h>
-#include <string>
-
-namespace art {
-
-// Returns a string corresponding to printf-like formatting of the arguments.
-std::string StringPrintf(const char* fmt, ...)
- __attribute__((__format__(__printf__, 1, 2)));
-
-// Appends a printf-like formatting of the arguments to 'dst'.
-void StringAppendF(std::string* dst, const char* fmt, ...)
- __attribute__((__format__(__printf__, 2, 3)));
-
-// Appends a printf-like formatting of the arguments to 'dst'.
-void StringAppendV(std::string* dst, const char* format, va_list ap);
-
-} // namespace art
-
-#endif // ART_RUNTIME_BASE_STRINGPRINTF_H_
diff --git a/runtime/base/time_utils.cc b/runtime/base/time_utils.cc
index 3e5bac8..3c09d5a 100644
--- a/runtime/base/time_utils.cc
+++ b/runtime/base/time_utils.cc
@@ -20,8 +20,9 @@
#include "time_utils.h"
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
-#include "base/stringprintf.h"
#if defined(__APPLE__)
#include <sys/time.h>
@@ -29,6 +30,8 @@
namespace art {
+using android::base::StringPrintf;
+
std::string PrettyDuration(uint64_t nano_duration, size_t max_fraction_digits) {
if (nano_duration == 0) {
return "0";
@@ -167,6 +170,17 @@
#endif
}
+uint64_t ProcessCpuNanoTime() {
+#if defined(__linux__)
+ timespec now;
+ clock_gettime(CLOCK_PROCESS_CPUTIME_ID, &now);
+ return static_cast<uint64_t>(now.tv_sec) * UINT64_C(1000000000) + now.tv_nsec;
+#else
+ UNIMPLEMENTED(WARNING);
+ return -1;
+#endif
+}
+
void NanoSleep(uint64_t ns) {
timespec tm;
tm.tv_sec = ns / MsToNs(1000);
diff --git a/runtime/base/time_utils.h b/runtime/base/time_utils.h
index 383b52f..dbb8bcd 100644
--- a/runtime/base/time_utils.h
+++ b/runtime/base/time_utils.h
@@ -62,6 +62,9 @@
// Returns the thread-specific CPU-time clock in nanoseconds or -1 if unavailable.
uint64_t ThreadCpuNanoTime();
+// Returns the process CPU-time clock in nanoseconds or -1 if unavailable.
+uint64_t ProcessCpuNanoTime();
+
// Converts the given number of nanoseconds to milliseconds.
static constexpr inline uint64_t NsToMs(uint64_t ns) {
return ns / 1000 / 1000;
diff --git a/runtime/cha.cc b/runtime/cha.cc
new file mode 100644
index 0000000..d94b091
--- /dev/null
+++ b/runtime/cha.cc
@@ -0,0 +1,361 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "cha.h"
+
+#include "jit/jit.h"
+#include "jit/jit_code_cache.h"
+#include "runtime.h"
+#include "scoped_thread_state_change-inl.h"
+#include "stack.h"
+#include "thread.h"
+#include "thread_list.h"
+#include "thread_pool.h"
+
+namespace art {
+
+void ClassHierarchyAnalysis::AddDependency(ArtMethod* method,
+ ArtMethod* dependent_method,
+ OatQuickMethodHeader* dependent_header) {
+ auto it = cha_dependency_map_.find(method);
+ if (it == cha_dependency_map_.end()) {
+ cha_dependency_map_[method] =
+ new std::vector<std::pair<art::ArtMethod*, art::OatQuickMethodHeader*>>();
+ it = cha_dependency_map_.find(method);
+ } else {
+ DCHECK(it->second != nullptr);
+ }
+ it->second->push_back(std::make_pair(dependent_method, dependent_header));
+}
+
+std::vector<std::pair<ArtMethod*, OatQuickMethodHeader*>>*
+ ClassHierarchyAnalysis::GetDependents(ArtMethod* method) {
+ auto it = cha_dependency_map_.find(method);
+ if (it != cha_dependency_map_.end()) {
+ DCHECK(it->second != nullptr);
+ return it->second;
+ }
+ return nullptr;
+}
+
+void ClassHierarchyAnalysis::RemoveDependencyFor(ArtMethod* method) {
+ auto it = cha_dependency_map_.find(method);
+ if (it != cha_dependency_map_.end()) {
+ auto dependents = it->second;
+ cha_dependency_map_.erase(it);
+ delete dependents;
+ }
+}
+
+void ClassHierarchyAnalysis::RemoveDependentsWithMethodHeaders(
+ const std::unordered_set<OatQuickMethodHeader*>& method_headers) {
+ // Iterate through all entries in the dependency map and remove any entry that
+ // contains one of those in method_headers.
+ for (auto map_it = cha_dependency_map_.begin(); map_it != cha_dependency_map_.end(); ) {
+ auto dependents = map_it->second;
+ for (auto vec_it = dependents->begin(); vec_it != dependents->end(); ) {
+ OatQuickMethodHeader* method_header = vec_it->second;
+ auto it = std::find(method_headers.begin(), method_headers.end(), method_header);
+ if (it != method_headers.end()) {
+ vec_it = dependents->erase(vec_it);
+ } else {
+ vec_it++;
+ }
+ }
+ // Remove the map entry if there are no more dependents.
+ if (dependents->empty()) {
+ map_it = cha_dependency_map_.erase(map_it);
+ delete dependents;
+ } else {
+ map_it++;
+ }
+ }
+}
+
+// This stack visitor walks the stack and for compiled code with certain method
+// headers, sets the should_deoptimize flag on stack to 1.
+// TODO: also set the register value to 1 when should_deoptimize is allocated in
+// a register.
+class CHAStackVisitor FINAL : public StackVisitor {
+ public:
+ CHAStackVisitor(Thread* thread_in,
+ Context* context,
+ const std::unordered_set<OatQuickMethodHeader*>& method_headers)
+ : StackVisitor(thread_in, context, StackVisitor::StackWalkKind::kSkipInlinedFrames),
+ method_headers_(method_headers) {
+ }
+
+ bool VisitFrame() OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+ ArtMethod* method = GetMethod();
+ // Avoid types of methods that do not have an oat quick method header.
+ if (method == nullptr ||
+ method->IsRuntimeMethod() ||
+ method->IsNative() ||
+ method->IsProxyMethod()) {
+ return true;
+ }
+ if (GetCurrentQuickFrame() == nullptr) {
+ // Not compiled code.
+ return true;
+ }
+ // Method may have multiple versions of compiled code. Check
+ // the method header to see if it has should_deoptimize flag.
+ const OatQuickMethodHeader* method_header = GetCurrentOatQuickMethodHeader();
+ DCHECK(method_header != nullptr);
+ if (!method_header->HasShouldDeoptimizeFlag()) {
+ // This compiled version doesn't have should_deoptimize flag. Skip.
+ return true;
+ }
+ auto it = std::find(method_headers_.begin(), method_headers_.end(), method_header);
+ if (it == method_headers_.end()) {
+ // Not in the list of method headers that should be deoptimized.
+ return true;
+ }
+
+ // The compiled code on stack is not valid anymore. Need to deoptimize.
+ SetShouldDeoptimizeFlag();
+
+ return true;
+ }
+
+ private:
+ void SetShouldDeoptimizeFlag() REQUIRES_SHARED(Locks::mutator_lock_) {
+ QuickMethodFrameInfo frame_info = GetCurrentQuickFrameInfo();
+ size_t frame_size = frame_info.FrameSizeInBytes();
+ uint8_t* sp = reinterpret_cast<uint8_t*>(GetCurrentQuickFrame());
+ size_t core_spill_size = POPCOUNT(frame_info.CoreSpillMask()) *
+ GetBytesPerGprSpillLocation(kRuntimeISA);
+ size_t fpu_spill_size = POPCOUNT(frame_info.FpSpillMask()) *
+ GetBytesPerFprSpillLocation(kRuntimeISA);
+ size_t offset = frame_size - core_spill_size - fpu_spill_size - kShouldDeoptimizeFlagSize;
+ uint8_t* should_deoptimize_addr = sp + offset;
+ // Set deoptimization flag to 1.
+ DCHECK(*should_deoptimize_addr == 0 || *should_deoptimize_addr == 1);
+ *should_deoptimize_addr = 1;
+ }
+
+ // Set of method headers for compiled code that should be deoptimized.
+ const std::unordered_set<OatQuickMethodHeader*>& method_headers_;
+
+ DISALLOW_COPY_AND_ASSIGN(CHAStackVisitor);
+};
+
+class CHACheckpoint FINAL : public Closure {
+ public:
+ explicit CHACheckpoint(const std::unordered_set<OatQuickMethodHeader*>& method_headers)
+ : barrier_(0),
+ method_headers_(method_headers) {}
+
+ void Run(Thread* thread) OVERRIDE {
+ // Note thread and self may not be equal if thread was already suspended at
+ // the point of the request.
+ Thread* self = Thread::Current();
+ ScopedObjectAccess soa(self);
+ CHAStackVisitor visitor(thread, nullptr, method_headers_);
+ visitor.WalkStack();
+ barrier_.Pass(self);
+ }
+
+ void WaitForThreadsToRunThroughCheckpoint(size_t threads_running_checkpoint) {
+ Thread* self = Thread::Current();
+ ScopedThreadStateChange tsc(self, kWaitingForCheckPointsToRun);
+ barrier_.Increment(self, threads_running_checkpoint);
+ }
+
+ private:
+ // The barrier to be passed through and for the requestor to wait upon.
+ Barrier barrier_;
+ // List of method headers for invalidated compiled code.
+ const std::unordered_set<OatQuickMethodHeader*>& method_headers_;
+
+ DISALLOW_COPY_AND_ASSIGN(CHACheckpoint);
+};
+
+void ClassHierarchyAnalysis::VerifyNonSingleImplementation(mirror::Class* verify_class,
+ uint16_t verify_index) {
+ // Grab cha_lock_ to make sure all single-implementation updates are seen.
+ PointerSize image_pointer_size =
+ Runtime::Current()->GetClassLinker()->GetImagePointerSize();
+ MutexLock cha_mu(Thread::Current(), *Locks::cha_lock_);
+ while (verify_class != nullptr) {
+ if (verify_index >= verify_class->GetVTableLength()) {
+ return;
+ }
+ ArtMethod* verify_method = verify_class->GetVTableEntry(verify_index, image_pointer_size);
+ DCHECK(!verify_method->HasSingleImplementation())
+ << "class: " << verify_class->PrettyClass()
+ << " verify_method: " << verify_method->PrettyMethod(true);
+ verify_class = verify_class->GetSuperClass();
+ }
+}
+
+void ClassHierarchyAnalysis::CheckSingleImplementationInfo(
+ Handle<mirror::Class> klass,
+ ArtMethod* virtual_method,
+ ArtMethod* method_in_super,
+ std::unordered_set<ArtMethod*>& invalidated_single_impl_methods) {
+ // TODO: if klass is not instantiable, virtual_method isn't invocable yet so
+ // even if it overrides, it doesn't invalidate single-implementation
+ // assumption.
+
+ DCHECK_NE(virtual_method, method_in_super);
+ DCHECK(method_in_super->GetDeclaringClass()->IsResolved()) << "class isn't resolved";
+ // If virtual_method doesn't come from a default interface method, it should
+ // be supplied by klass.
+ DCHECK(virtual_method->IsCopied() ||
+ virtual_method->GetDeclaringClass() == klass.Get());
+
+ // A new virtual_method should set method_in_super to
+ // non-single-implementation (if not set already).
+ // We don't grab cha_lock_. Single-implementation flag won't be set to true
+ // again once it's set to false.
+ if (!method_in_super->HasSingleImplementation()) {
+ // method_in_super already has multiple implementations. All methods in the
+ // same vtable slots in its super classes should have
+ // non-single-implementation already.
+ if (kIsDebugBuild) {
+ VerifyNonSingleImplementation(klass->GetSuperClass()->GetSuperClass(),
+ method_in_super->GetMethodIndex());
+ }
+ return;
+ }
+
+ // Native methods don't have single-implementation flag set.
+ DCHECK(!method_in_super->IsNative());
+ // Invalidate method_in_super's single-implementation status.
+ invalidated_single_impl_methods.insert(method_in_super);
+}
+
+void ClassHierarchyAnalysis::InitSingleImplementationFlag(Handle<mirror::Class> klass,
+ ArtMethod* method) {
+ DCHECK(method->IsCopied() || method->GetDeclaringClass() == klass.Get());
+ if (klass->IsFinal() || method->IsFinal()) {
+ // Final classes or methods do not need CHA for devirtualization.
+ // This frees up modifier bits for intrinsics which currently are only
+ // used for static methods or methods of final classes.
+ return;
+ }
+ if (method->IsNative()) {
+ // Native method's invocation overhead is already high and it
+ // cannot be inlined. It's not worthwhile to devirtualize the
+ // call which can add a deoptimization point.
+ DCHECK(!method->HasSingleImplementation());
+ } else {
+ method->SetHasSingleImplementation(true);
+ if (method->IsAbstract()) {
+ // There is no real implementation yet.
+ // TODO: implement single-implementation logic for abstract methods.
+ DCHECK(method->GetSingleImplementation() == nullptr);
+ } else {
+ // Single implementation of non-abstract method is itself.
+ DCHECK_EQ(method->GetSingleImplementation(), method);
+ }
+ }
+}
+
+void ClassHierarchyAnalysis::UpdateAfterLoadingOf(Handle<mirror::Class> klass) {
+ if (klass->IsInterface()) {
+ return;
+ }
+ mirror::Class* super_class = klass->GetSuperClass();
+ if (super_class == nullptr) {
+ return;
+ }
+
+ // Keeps track of all methods whose single-implementation assumption
+ // is invalidated by linking `klass`.
+ std::unordered_set<ArtMethod*> invalidated_single_impl_methods;
+
+ PointerSize image_pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
+ // Do an entry-by-entry comparison of vtable contents with super's vtable.
+ for (int32_t i = 0; i < super_class->GetVTableLength(); ++i) {
+ ArtMethod* method = klass->GetVTableEntry(i, image_pointer_size);
+ ArtMethod* method_in_super = super_class->GetVTableEntry(i, image_pointer_size);
+ if (method == method_in_super) {
+ // vtable slot entry is inherited from super class.
+ continue;
+ }
+ InitSingleImplementationFlag(klass, method);
+ CheckSingleImplementationInfo(klass,
+ method,
+ method_in_super,
+ invalidated_single_impl_methods);
+ }
+
+ // For new virtual methods that don't override.
+ for (int32_t i = super_class->GetVTableLength(); i < klass->GetVTableLength(); ++i) {
+ ArtMethod* method = klass->GetVTableEntry(i, image_pointer_size);
+ InitSingleImplementationFlag(klass, method);
+ }
+
+ Runtime* const runtime = Runtime::Current();
+ if (!invalidated_single_impl_methods.empty()) {
+ Thread *self = Thread::Current();
+ // Method headers for compiled code to be invalidated.
+ std::unordered_set<OatQuickMethodHeader*> dependent_method_headers;
+
+ {
+ // We do this under cha_lock_. Committing code also grabs this lock to
+ // make sure the code is only committed when all single-implementation
+ // assumptions are still true.
+ MutexLock cha_mu(self, *Locks::cha_lock_);
+ // Invalidate compiled methods that assume some virtual calls have only
+ // single implementations.
+ for (ArtMethod* invalidated : invalidated_single_impl_methods) {
+ if (!invalidated->HasSingleImplementation()) {
+ // It might have been invalidated already when other class linking is
+ // going on.
+ continue;
+ }
+ invalidated->SetHasSingleImplementation(false);
+
+ if (runtime->IsAotCompiler()) {
+ // No need to invalidate any compiled code as the AotCompiler doesn't
+ // run any code.
+ continue;
+ }
+
+ // Invalidate all dependents.
+ auto dependents = GetDependents(invalidated);
+ if (dependents == nullptr) {
+ continue;
+ }
+ for (const auto& dependent : *dependents) {
+ ArtMethod* method = dependent.first;;
+ OatQuickMethodHeader* method_header = dependent.second;
+ VLOG(class_linker) << "CHA invalidated compiled code for " << method->PrettyMethod();
+ DCHECK(runtime->UseJitCompilation());
+ runtime->GetJit()->GetCodeCache()->InvalidateCompiledCodeFor(
+ method, method_header);
+ dependent_method_headers.insert(method_header);
+ }
+ RemoveDependencyFor(invalidated);
+ }
+ }
+
+ if (dependent_method_headers.empty()) {
+ return;
+ }
+ // Deoptimze compiled code on stack that should have been invalidated.
+ CHACheckpoint checkpoint(dependent_method_headers);
+ size_t threads_running_checkpoint = runtime->GetThreadList()->RunCheckpoint(&checkpoint);
+ if (threads_running_checkpoint != 0) {
+ checkpoint.WaitForThreadsToRunThroughCheckpoint(threads_running_checkpoint);
+ }
+ }
+}
+
+} // namespace art
diff --git a/runtime/cha.h b/runtime/cha.h
new file mode 100644
index 0000000..ada5c89
--- /dev/null
+++ b/runtime/cha.h
@@ -0,0 +1,144 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_RUNTIME_CHA_H_
+#define ART_RUNTIME_CHA_H_
+
+#include "art_method.h"
+#include "base/enums.h"
+#include "base/mutex.h"
+#include "handle.h"
+#include "mirror/class.h"
+#include "oat_quick_method_header.h"
+#include <unordered_map>
+#include <unordered_set>
+
+namespace art {
+
+/**
+ * Class Hierarchy Analysis (CHA) tries to devirtualize virtual calls into
+ * direct calls based on the info generated by analyzing class hierarchies.
+ * If a class is not subclassed, or even if it's subclassed but one of its
+ * virtual methods isn't overridden, a virtual call for that method can be
+ * changed into a direct call.
+ *
+ * Each virtual method carries a single-implementation status. The status is
+ * incrementally maintained at the end of class linking time when method
+ * overriding takes effect.
+ *
+ * Compiler takes advantage of the single-implementation info of a
+ * method. If a method A has the single-implementation flag set, the compiler
+ * devirtualizes the virtual call for method A into a direct call, and
+ * further try to inline the direct call as a result. The compiler will
+ * also register a dependency that the compiled code depends on the
+ * assumption that method A has single-implementation status.
+ *
+ * When single-implementation info is updated at the end of class linking,
+ * and if method A's single-implementation status is invalidated, all compiled
+ * code that depends on the assumption that method A has single-implementation
+ * status need to be invalidated. Method entrypoints that have this dependency
+ * will be updated as a result. Method A can later be recompiled with less
+ * aggressive assumptions.
+ *
+ * For live compiled code that's on stack, deoptmization will be initiated
+ * to force the invalidated compiled code into interpreter mode to guarantee
+ * correctness. The deoptimization mechanism used is a hybrid of
+ * synchronous and asynchronous deoptimization. The synchronous deoptimization
+ * part checks a hidden local variable flag for the method, and if true,
+ * initiates deoptimization. The asynchronous deoptimization part issues a
+ * checkpoint that walks the stack and for any compiled code on the stack
+ * that should be deoptimized, set the hidden local variable value to be true.
+ *
+ * A cha_lock_ needs to be held for updating single-implementation status,
+ * and registering/unregistering CHA dependencies. Registering CHA dependency
+ * and making compiled code visible also need to be atomic. Otherwise, we
+ * may miss invalidating CHA dependents or making compiled code visible even
+ * after it is invalidated. Care needs to be taken between cha_lock_ and
+ * JitCodeCache::lock_ to guarantee the atomicity.
+ *
+ * We base our CHA on dynamically linked class profiles instead of doing static
+ * analysis. Static analysis can be too aggressive due to dynamic class loading
+ * at runtime, and too conservative since some classes may not be really loaded
+ * at runtime.
+ */
+class ClassHierarchyAnalysis {
+ public:
+ // Types for recording CHA dependencies.
+ // For invalidating CHA dependency, we need to know both the ArtMethod and
+ // the method header. If the ArtMethod has compiled code with the method header
+ // as the entrypoint, we update the entrypoint to the interpreter bridge.
+ // We will also deoptimize frames that are currently executing the code of
+ // the method header.
+ typedef std::pair<ArtMethod*, OatQuickMethodHeader*> MethodAndMethodHeaderPair;
+ typedef std::vector<MethodAndMethodHeaderPair> ListOfDependentPairs;
+
+ ClassHierarchyAnalysis() {}
+
+ // Add a dependency that compiled code with `dependent_header` for `dependent_method`
+ // assumes that virtual `method` has single-implementation.
+ void AddDependency(ArtMethod* method,
+ ArtMethod* dependent_method,
+ OatQuickMethodHeader* dependent_header) REQUIRES(Locks::cha_lock_);
+
+ // Return compiled code that assumes that `method` has single-implementation.
+ std::vector<MethodAndMethodHeaderPair>* GetDependents(ArtMethod* method)
+ REQUIRES(Locks::cha_lock_);
+
+ // Remove dependency tracking for compiled code that assumes that
+ // `method` has single-implementation.
+ void RemoveDependencyFor(ArtMethod* method) REQUIRES(Locks::cha_lock_);
+
+ // Remove from cha_dependency_map_ all entries that contain OatQuickMethodHeader from
+ // the given `method_headers` set.
+ // This is used when some compiled code is freed.
+ void RemoveDependentsWithMethodHeaders(
+ const std::unordered_set<OatQuickMethodHeader*>& method_headers)
+ REQUIRES(Locks::cha_lock_);
+
+ // Update CHA info for methods that `klass` overrides, after loading `klass`.
+ void UpdateAfterLoadingOf(Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_);
+
+ private:
+ void InitSingleImplementationFlag(Handle<mirror::Class> klass, ArtMethod* method)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // `virtual_method` in `klass` overrides `method_in_super`.
+ // This will invalidate some assumptions on single-implementation.
+ // Append methods that should have their single-implementation flag invalidated
+ // to `invalidated_single_impl_methods`.
+ void CheckSingleImplementationInfo(
+ Handle<mirror::Class> klass,
+ ArtMethod* virtual_method,
+ ArtMethod* method_in_super,
+ std::unordered_set<ArtMethod*>& invalidated_single_impl_methods)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // Verify all methods in the same vtable slot from verify_class and its supers
+ // don't have single-implementation.
+ void VerifyNonSingleImplementation(mirror::Class* verify_class, uint16_t verify_index)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // A map that maps a method to a set of compiled code that assumes that method has a
+ // single implementation, which is used to do CHA-based devirtualization.
+ std::unordered_map<ArtMethod*, ListOfDependentPairs*> cha_dependency_map_
+ GUARDED_BY(Locks::cha_lock_);
+
+ DISALLOW_COPY_AND_ASSIGN(ClassHierarchyAnalysis);
+};
+
+} // namespace art
+
+#endif // ART_RUNTIME_CHA_H_
diff --git a/runtime/cha_test.cc b/runtime/cha_test.cc
new file mode 100644
index 0000000..d2f335e
--- /dev/null
+++ b/runtime/cha_test.cc
@@ -0,0 +1,93 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "cha.h"
+
+#include "common_runtime_test.h"
+
+namespace art {
+
+class CHATest : public CommonRuntimeTest {};
+
+// Mocks some methods.
+#define METHOD1 (reinterpret_cast<ArtMethod*>(8u))
+#define METHOD2 (reinterpret_cast<ArtMethod*>(16u))
+#define METHOD3 (reinterpret_cast<ArtMethod*>(24u))
+
+// Mocks some method headers.
+#define METHOD_HEADER1 (reinterpret_cast<OatQuickMethodHeader*>(128u))
+#define METHOD_HEADER2 (reinterpret_cast<OatQuickMethodHeader*>(136u))
+#define METHOD_HEADER3 (reinterpret_cast<OatQuickMethodHeader*>(144u))
+
+TEST_F(CHATest, CHACheckDependency) {
+ ClassHierarchyAnalysis cha;
+ MutexLock cha_mu(Thread::Current(), *Locks::cha_lock_);
+
+ ASSERT_EQ(cha.GetDependents(METHOD1), nullptr);
+ ASSERT_EQ(cha.GetDependents(METHOD2), nullptr);
+ ASSERT_EQ(cha.GetDependents(METHOD3), nullptr);
+
+ cha.AddDependency(METHOD1, METHOD2, METHOD_HEADER2);
+ ASSERT_EQ(cha.GetDependents(METHOD2), nullptr);
+ ASSERT_EQ(cha.GetDependents(METHOD3), nullptr);
+ auto dependents = cha.GetDependents(METHOD1);
+ ASSERT_EQ(dependents->size(), 1u);
+ ASSERT_EQ(dependents->at(0).first, METHOD2);
+ ASSERT_EQ(dependents->at(0).second, METHOD_HEADER2);
+
+ cha.AddDependency(METHOD1, METHOD3, METHOD_HEADER3);
+ ASSERT_EQ(cha.GetDependents(METHOD2), nullptr);
+ ASSERT_EQ(cha.GetDependents(METHOD3), nullptr);
+ dependents = cha.GetDependents(METHOD1);
+ ASSERT_EQ(dependents->size(), 2u);
+ ASSERT_EQ(dependents->at(0).first, METHOD2);
+ ASSERT_EQ(dependents->at(0).second, METHOD_HEADER2);
+ ASSERT_EQ(dependents->at(1).first, METHOD3);
+ ASSERT_EQ(dependents->at(1).second, METHOD_HEADER3);
+
+ std::unordered_set<OatQuickMethodHeader*> headers;
+ headers.insert(METHOD_HEADER2);
+ cha.RemoveDependentsWithMethodHeaders(headers);
+ ASSERT_EQ(cha.GetDependents(METHOD2), nullptr);
+ ASSERT_EQ(cha.GetDependents(METHOD3), nullptr);
+ dependents = cha.GetDependents(METHOD1);
+ ASSERT_EQ(dependents->size(), 1u);
+ ASSERT_EQ(dependents->at(0).first, METHOD3);
+ ASSERT_EQ(dependents->at(0).second, METHOD_HEADER3);
+
+ cha.AddDependency(METHOD2, METHOD1, METHOD_HEADER1);
+ ASSERT_EQ(cha.GetDependents(METHOD3), nullptr);
+ dependents = cha.GetDependents(METHOD1);
+ ASSERT_EQ(dependents->size(), 1u);
+ dependents = cha.GetDependents(METHOD2);
+ ASSERT_EQ(dependents->size(), 1u);
+
+ headers.insert(METHOD_HEADER3);
+ cha.RemoveDependentsWithMethodHeaders(headers);
+ ASSERT_EQ(cha.GetDependents(METHOD1), nullptr);
+ ASSERT_EQ(cha.GetDependents(METHOD3), nullptr);
+ dependents = cha.GetDependents(METHOD2);
+ ASSERT_EQ(dependents->size(), 1u);
+ ASSERT_EQ(dependents->at(0).first, METHOD1);
+ ASSERT_EQ(dependents->at(0).second, METHOD_HEADER1);
+
+ cha.RemoveDependencyFor(METHOD2);
+ ASSERT_EQ(cha.GetDependents(METHOD1), nullptr);
+ ASSERT_EQ(cha.GetDependents(METHOD2), nullptr);
+ ASSERT_EQ(cha.GetDependents(METHOD3), nullptr);
+}
+
+} // namespace art
diff --git a/runtime/check_jni.cc b/runtime/check_jni.cc
index 6c27bc6..1c3328e 100644
--- a/runtime/check_jni.cc
+++ b/runtime/check_jni.cc
@@ -20,6 +20,8 @@
#include <sys/mman.h>
#include <zlib.h>
+#include "android-base/stringprintf.h"
+
#include "art_field-inl.h"
#include "art_method-inl.h"
#include "base/logging.h"
@@ -42,6 +44,9 @@
namespace art {
+using android::base::StringAppendF;
+using android::base::StringPrintf;
+
/*
* ===========================================================================
* JNI function helpers
diff --git a/runtime/class_linker-inl.h b/runtime/class_linker-inl.h
index 7359243..a11257f 100644
--- a/runtime/class_linker-inl.h
+++ b/runtime/class_linker-inl.h
@@ -25,6 +25,7 @@
#include "mirror/class_loader.h"
#include "mirror/dex_cache-inl.h"
#include "mirror/iftable.h"
+#include "mirror/throwable.h"
#include "mirror/object_array.h"
#include "handle_scope-inl.h"
#include "scoped_thread_state_change-inl.h"
@@ -65,14 +66,15 @@
return array_class.Ptr();
}
-inline mirror::String* ClassLinker::ResolveString(uint32_t string_idx, ArtMethod* referrer) {
+inline mirror::String* ClassLinker::ResolveString(dex::StringIndex string_idx,
+ ArtMethod* referrer) {
Thread::PoisonObjectPointersIfDebug();
ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass();
// MethodVerifier refuses methods with string_idx out of bounds.
- DCHECK_LT(string_idx, declaring_class->GetDexFile().NumStringIds());
+ DCHECK_LT(string_idx.index_, declaring_class->GetDexFile().NumStringIds());
ObjPtr<mirror::String> string =
- mirror::StringDexCachePair::Lookup(declaring_class->GetDexCacheStrings(),
- string_idx,
+ mirror::StringDexCachePair::Lookup(declaring_class->GetDexCache()->GetStrings(),
+ string_idx.index_,
mirror::DexCache::kDexCacheStringCacheSize).Read();
if (UNLIKELY(string == nullptr)) {
StackHandleScope<1> hs(Thread::Current());
@@ -86,24 +88,35 @@
return string.Ptr();
}
-inline mirror::Class* ClassLinker::ResolveType(uint16_t type_idx, ArtMethod* referrer) {
+inline mirror::Class* ClassLinker::ResolveType(dex::TypeIndex type_idx, ArtMethod* referrer) {
Thread::PoisonObjectPointersIfDebug();
+ if (kIsDebugBuild) {
+ Thread::Current()->AssertNoPendingException();
+ }
ObjPtr<mirror::Class> resolved_type =
referrer->GetDexCacheResolvedType(type_idx, image_pointer_size_);
if (UNLIKELY(resolved_type == nullptr)) {
- ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass();
StackHandleScope<2> hs(Thread::Current());
- Handle<mirror::DexCache> dex_cache(hs.NewHandle(declaring_class->GetDexCache()));
- Handle<mirror::ClassLoader> class_loader(hs.NewHandle(declaring_class->GetClassLoader()));
- const DexFile& dex_file = *dex_cache->GetDexFile();
- resolved_type = ResolveType(dex_file, type_idx, dex_cache, class_loader);
- // Note: We cannot check here to see whether we added the type to the cache. The type
- // might be an erroneous class, which results in it being hidden from us.
+ // There could be an out of bounds exception from GetDexCacheResolvedType, don't call
+ // ResolveType for this case.
+ if (LIKELY(!hs.Self()->IsExceptionPending())) {
+ ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass();
+ Handle<mirror::DexCache> dex_cache(hs.NewHandle(declaring_class->GetDexCache()));
+ Handle<mirror::ClassLoader> class_loader(hs.NewHandle(declaring_class->GetClassLoader()));
+ const DexFile& dex_file = *dex_cache->GetDexFile();
+ resolved_type = ResolveType(dex_file, type_idx, dex_cache, class_loader);
+ // Note: We cannot check here to see whether we added the type to the cache. The type
+ // might be an erroneous class, which results in it being hidden from us.
+ } else {
+ // Make sure its an array out of bounds exception.
+ DCHECK(hs.Self()->GetException()->GetClass()->DescriptorEquals(
+ "Ljava/lang/ArrayIndexOutOfBoundsException;"));
+ }
}
return resolved_type.Ptr();
}
-inline mirror::Class* ClassLinker::ResolveType(uint16_t type_idx, ArtField* referrer) {
+inline mirror::Class* ClassLinker::ResolveType(dex::TypeIndex type_idx, ArtField* referrer) {
Thread::PoisonObjectPointersIfDebug();
ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass();
ObjPtr<mirror::DexCache> dex_cache_ptr = declaring_class->GetDexCache();
@@ -247,7 +260,7 @@
DCHECK(proxy_method->IsProxyMethod<kReadBarrierOption>());
{
Thread* const self = Thread::Current();
- ReaderMutexLock mu(self, dex_lock_);
+ ReaderMutexLock mu(self, *Locks::dex_lock_);
// Locate the dex cache of the original interface/Object
for (const DexCacheData& data : dex_caches_) {
if (!self->IsJWeakCleared(data.weak_root) &&
diff --git a/runtime/class_linker.cc b/runtime/class_linker.cc
index 4905514..5b8d4e4 100644
--- a/runtime/class_linker.cc
+++ b/runtime/class_linker.cc
@@ -28,6 +28,8 @@
#include <utility>
#include <vector>
+#include "android-base/stringprintf.h"
+
#include "art_field-inl.h"
#include "art_method-inl.h"
#include "base/arena_allocator.h"
@@ -40,6 +42,7 @@
#include "base/time_utils.h"
#include "base/unix_file/fd_file.h"
#include "base/value_object.h"
+#include "cha.h"
#include "class_linker-inl.h"
#include "class_table-inl.h"
#include "compiler_callbacks.h"
@@ -96,6 +99,7 @@
#include "ScopedLocalRef.h"
#include "scoped_thread_state_change-inl.h"
#include "thread-inl.h"
+#include "thread_list.h"
#include "trace.h"
#include "utils.h"
#include "utils/dex_cache_arrays_layout-inl.h"
@@ -104,6 +108,8 @@
namespace art {
+using android::base::StringPrintf;
+
static constexpr bool kSanityCheckObjects = kIsDebugBuild;
static constexpr bool kVerifyArtMethodDeclaringClasses = kIsDebugBuild;
@@ -240,6 +246,13 @@
ScopedLocalRef<jthrowable> cause(env, env->ExceptionOccurred());
CHECK(cause.get() != nullptr);
+ // Boot classpath classes should not fail initialization. This is a sanity debug check. This
+ // cannot in general be guaranteed, but in all likelihood leads to breakage down the line.
+ if (klass->GetClassLoader() == nullptr && !Runtime::Current()->IsAotCompiler()) {
+ std::string tmp;
+ LOG(kIsDebugBuild ? FATAL : WARNING) << klass->GetDescriptor(&tmp) << " failed initialization";
+ }
+
env->ExceptionClear();
bool is_error = env->IsInstanceOf(cause.get(), WellKnownClasses::java_lang_Error);
env->Throw(cause.get());
@@ -333,9 +346,7 @@
}
ClassLinker::ClassLinker(InternTable* intern_table)
- // dex_lock_ is recursive as it may be used in stack dumping.
- : dex_lock_("ClassLinker dex lock", kDexLock),
- failed_dex_cache_class_lookups_(0),
+ : failed_dex_cache_class_lookups_(0),
class_roots_(nullptr),
array_iftable_(nullptr),
find_array_class_cache_next_victim_(0),
@@ -622,13 +633,13 @@
// Sanity check Class[] and Object[]'s interfaces. GetDirectInterface may cause thread
// suspension.
CHECK_EQ(java_lang_Cloneable.Get(),
- mirror::Class::GetDirectInterface(self, class_array_class, 0));
+ mirror::Class::GetDirectInterface(self, class_array_class.Get(), 0));
CHECK_EQ(java_io_Serializable.Get(),
- mirror::Class::GetDirectInterface(self, class_array_class, 1));
+ mirror::Class::GetDirectInterface(self, class_array_class.Get(), 1));
CHECK_EQ(java_lang_Cloneable.Get(),
- mirror::Class::GetDirectInterface(self, object_array_class, 0));
+ mirror::Class::GetDirectInterface(self, object_array_class.Get(), 0));
CHECK_EQ(java_io_Serializable.Get(),
- mirror::Class::GetDirectInterface(self, object_array_class, 1));
+ mirror::Class::GetDirectInterface(self, object_array_class.Get(), 1));
CHECK_EQ(object_array_string.Get(),
FindSystemClass(self, GetClassRootDescriptor(kJavaLangStringArrayClass)));
@@ -730,10 +741,12 @@
const DexFile& dex_file = java_lang_Object->GetDexFile();
const DexFile::TypeId* void_type_id = dex_file.FindTypeId("V");
CHECK(void_type_id != nullptr);
- uint16_t void_type_idx = dex_file.GetIndexForTypeId(*void_type_id);
+ dex::TypeIndex void_type_idx = dex_file.GetIndexForTypeId(*void_type_id);
// Now we resolve void type so the dex cache contains it. We use java.lang.Object class
// as referrer so the used dex cache is core's one.
- ObjPtr<mirror::Class> resolved_type = ResolveType(dex_file, void_type_idx, java_lang_Object.Get());
+ ObjPtr<mirror::Class> resolved_type = ResolveType(dex_file,
+ void_type_idx,
+ java_lang_Object.Get());
CHECK_EQ(resolved_type, GetClassRoot(kPrimitiveVoid));
self->AssertNoPendingException();
}
@@ -812,123 +825,6 @@
}
}
-static void SanityCheckArtMethod(ArtMethod* m,
- ObjPtr<mirror::Class> expected_class,
- const std::vector<gc::space::ImageSpace*>& spaces)
- REQUIRES_SHARED(Locks::mutator_lock_) {
- if (m->IsRuntimeMethod()) {
- ObjPtr<mirror::Class> declaring_class = m->GetDeclaringClassUnchecked();
- CHECK(declaring_class == nullptr) << declaring_class << " " << m->PrettyMethod();
- } else if (m->IsCopied()) {
- CHECK(m->GetDeclaringClass() != nullptr) << m->PrettyMethod();
- } else if (expected_class != nullptr) {
- CHECK_EQ(m->GetDeclaringClassUnchecked(), expected_class) << m->PrettyMethod();
- }
- if (!spaces.empty()) {
- bool contains = false;
- for (gc::space::ImageSpace* space : spaces) {
- auto& header = space->GetImageHeader();
- size_t offset = reinterpret_cast<uint8_t*>(m) - space->Begin();
-
- const ImageSection& methods = header.GetMethodsSection();
- contains = contains || methods.Contains(offset);
-
- const ImageSection& runtime_methods = header.GetRuntimeMethodsSection();
- contains = contains || runtime_methods.Contains(offset);
- }
- CHECK(contains) << m << " not found";
- }
-}
-
-static void SanityCheckArtMethodPointerArray(ObjPtr<mirror::PointerArray> arr,
- ObjPtr<mirror::Class> expected_class,
- PointerSize pointer_size,
- const std::vector<gc::space::ImageSpace*>& spaces)
- REQUIRES_SHARED(Locks::mutator_lock_) {
- CHECK(arr != nullptr);
- for (int32_t j = 0; j < arr->GetLength(); ++j) {
- auto* method = arr->GetElementPtrSize<ArtMethod*>(j, pointer_size);
- // expected_class == null means we are a dex cache.
- if (expected_class != nullptr) {
- CHECK(method != nullptr);
- }
- if (method != nullptr) {
- SanityCheckArtMethod(method, expected_class, spaces);
- }
- }
-}
-
-static void SanityCheckArtMethodPointerArray(ArtMethod** arr,
- size_t size,
- PointerSize pointer_size,
- const std::vector<gc::space::ImageSpace*>& spaces)
- REQUIRES_SHARED(Locks::mutator_lock_) {
- CHECK_EQ(arr != nullptr, size != 0u);
- if (arr != nullptr) {
- bool contains = false;
- for (auto space : spaces) {
- auto offset = reinterpret_cast<uint8_t*>(arr) - space->Begin();
- if (space->GetImageHeader().GetImageSection(
- ImageHeader::kSectionDexCacheArrays).Contains(offset)) {
- contains = true;
- break;
- }
- }
- CHECK(contains);
- }
- for (size_t j = 0; j < size; ++j) {
- ArtMethod* method = mirror::DexCache::GetElementPtrSize(arr, j, pointer_size);
- // expected_class == null means we are a dex cache.
- if (method != nullptr) {
- SanityCheckArtMethod(method, nullptr, spaces);
- }
- }
-}
-
-static void SanityCheckObjectsCallback(mirror::Object* obj, void* arg ATTRIBUTE_UNUSED)
- REQUIRES_SHARED(Locks::mutator_lock_) {
- DCHECK(obj != nullptr);
- CHECK(obj->GetClass() != nullptr) << "Null class in object " << obj;
- CHECK(obj->GetClass()->GetClass() != nullptr) << "Null class class " << obj;
- if (obj->IsClass()) {
- auto klass = obj->AsClass();
- for (ArtField& field : klass->GetIFields()) {
- CHECK_EQ(field.GetDeclaringClass(), klass);
- }
- for (ArtField& field : klass->GetSFields()) {
- CHECK_EQ(field.GetDeclaringClass(), klass);
- }
- auto* runtime = Runtime::Current();
- auto image_spaces = runtime->GetHeap()->GetBootImageSpaces();
- auto pointer_size = runtime->GetClassLinker()->GetImagePointerSize();
- for (auto& m : klass->GetMethods(pointer_size)) {
- SanityCheckArtMethod(&m, klass, image_spaces);
- }
- auto* vtable = klass->GetVTable();
- if (vtable != nullptr) {
- SanityCheckArtMethodPointerArray(vtable, nullptr, pointer_size, image_spaces);
- }
- if (klass->ShouldHaveImt()) {
- ImTable* imt = klass->GetImt(pointer_size);
- for (size_t i = 0; i < ImTable::kSize; ++i) {
- SanityCheckArtMethod(imt->Get(i, pointer_size), nullptr, image_spaces);
- }
- }
- if (klass->ShouldHaveEmbeddedVTable()) {
- for (int32_t i = 0; i < klass->GetEmbeddedVTableLength(); ++i) {
- SanityCheckArtMethod(klass->GetEmbeddedVTableEntry(i, pointer_size), nullptr, image_spaces);
- }
- }
- mirror::IfTable* iftable = klass->GetIfTable();
- for (int32_t i = 0; i < klass->GetIfTableCount(); ++i) {
- if (iftable->GetMethodArrayCount(i) > 0) {
- SanityCheckArtMethodPointerArray(
- iftable->GetMethodArray(i), nullptr, pointer_size, image_spaces);
- }
- }
- }
-}
-
// Set image methods' entry point to interpreter.
class SetInterpreterEntrypointArtMethodVisitor : public ArtMethodVisitor {
public:
@@ -1436,7 +1332,7 @@
}
}
{
- WriterMutexLock mu2(self, dex_lock_);
+ WriterMutexLock mu2(self, *Locks::dex_lock_);
// Make sure to do this after we update the arrays since we store the resolved types array
// in DexCacheData in RegisterDexFileLocked. We need the array pointer to be the one in the
// BSS.
@@ -1460,12 +1356,12 @@
ObjPtr<mirror::Class> klass = types[j].Read();
if (space->HasAddress(klass.Ptr())) {
DCHECK_NE(klass->GetStatus(), mirror::Class::kStatusError);
- auto it = new_class_set->Find(GcRoot<mirror::Class>(klass));
+ auto it = new_class_set->Find(ClassTable::TableSlot(klass));
DCHECK(it != new_class_set->end());
DCHECK_EQ(it->Read(), klass);
ObjPtr<mirror::Class> super_class = klass->GetSuperClass();
if (super_class != nullptr && !heap->ObjectIsInBootImageSpace(super_class)) {
- auto it2 = new_class_set->Find(GcRoot<mirror::Class>(super_class));
+ auto it2 = new_class_set->Find(ClassTable::TableSlot(super_class));
DCHECK(it2 != new_class_set->end());
DCHECK_EQ(it2->Read(), super_class);
}
@@ -1509,39 +1405,20 @@
return true;
}
-// Update the class loader and resolved string dex cache array of classes. Should only be used on
-// classes in the image space.
-class UpdateClassLoaderAndResolvedStringsVisitor {
+// Update the class loader. Should only be used on classes in the image space.
+class UpdateClassLoaderVisitor {
public:
- UpdateClassLoaderAndResolvedStringsVisitor(gc::space::ImageSpace* space,
- ObjPtr<mirror::ClassLoader> class_loader,
- bool forward_strings)
+ UpdateClassLoaderVisitor(gc::space::ImageSpace* space, ObjPtr<mirror::ClassLoader> class_loader)
: space_(space),
- class_loader_(class_loader),
- forward_strings_(forward_strings) {}
+ class_loader_(class_loader) {}
bool operator()(ObjPtr<mirror::Class> klass) const REQUIRES_SHARED(Locks::mutator_lock_) {
- if (forward_strings_) {
- mirror::StringDexCacheType* strings = klass->GetDexCacheStrings();
- if (strings != nullptr) {
- DCHECK(
- space_->GetImageHeader().GetImageSection(ImageHeader::kSectionDexCacheArrays).Contains(
- reinterpret_cast<uint8_t*>(strings) - space_->Begin()))
- << "String dex cache array for " << klass->PrettyClass() << " is not in app image";
- // Dex caches have already been updated, so take the strings pointer from there.
- mirror::StringDexCacheType* new_strings = klass->GetDexCache()->GetStrings();
- DCHECK_NE(strings, new_strings);
- klass->SetDexCacheStrings(new_strings);
- }
- }
- // Finally, update class loader.
klass->SetClassLoader(class_loader_);
return true;
}
gc::space::ImageSpace* const space_;
ObjPtr<mirror::ClassLoader> const class_loader_;
- const bool forward_strings_;
};
static std::unique_ptr<const DexFile> OpenOatDexFile(const OatFile* oat_file,
@@ -1599,6 +1476,153 @@
return true;
}
+// Helper class for ArtMethod checks when adding an image. Keeps all required functionality
+// together and caches some intermediate results.
+class ImageSanityChecks FINAL {
+ public:
+ static void CheckObjects(gc::Heap* heap, ClassLinker* class_linker)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ ImageSanityChecks isc(heap, class_linker);
+ heap->VisitObjects(ImageSanityChecks::SanityCheckObjectsCallback, &isc);
+ }
+
+ static void CheckPointerArray(gc::Heap* heap,
+ ClassLinker* class_linker,
+ ArtMethod** arr,
+ size_t size)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ ImageSanityChecks isc(heap, class_linker);
+ isc.SanityCheckArtMethodPointerArray(arr, size);
+ }
+
+ static void SanityCheckObjectsCallback(mirror::Object* obj, void* arg)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ DCHECK(obj != nullptr);
+ CHECK(obj->GetClass() != nullptr) << "Null class in object " << obj;
+ CHECK(obj->GetClass()->GetClass() != nullptr) << "Null class class " << obj;
+ if (obj->IsClass()) {
+ ImageSanityChecks* isc = reinterpret_cast<ImageSanityChecks*>(arg);
+
+ auto klass = obj->AsClass();
+ for (ArtField& field : klass->GetIFields()) {
+ CHECK_EQ(field.GetDeclaringClass(), klass);
+ }
+ for (ArtField& field : klass->GetSFields()) {
+ CHECK_EQ(field.GetDeclaringClass(), klass);
+ }
+ const auto pointer_size = isc->pointer_size_;
+ for (auto& m : klass->GetMethods(pointer_size)) {
+ isc->SanityCheckArtMethod(&m, klass);
+ }
+ auto* vtable = klass->GetVTable();
+ if (vtable != nullptr) {
+ isc->SanityCheckArtMethodPointerArray(vtable, nullptr);
+ }
+ if (klass->ShouldHaveImt()) {
+ ImTable* imt = klass->GetImt(pointer_size);
+ for (size_t i = 0; i < ImTable::kSize; ++i) {
+ isc->SanityCheckArtMethod(imt->Get(i, pointer_size), nullptr);
+ }
+ }
+ if (klass->ShouldHaveEmbeddedVTable()) {
+ for (int32_t i = 0; i < klass->GetEmbeddedVTableLength(); ++i) {
+ isc->SanityCheckArtMethod(klass->GetEmbeddedVTableEntry(i, pointer_size), nullptr);
+ }
+ }
+ mirror::IfTable* iftable = klass->GetIfTable();
+ for (int32_t i = 0; i < klass->GetIfTableCount(); ++i) {
+ if (iftable->GetMethodArrayCount(i) > 0) {
+ isc->SanityCheckArtMethodPointerArray(iftable->GetMethodArray(i), nullptr);
+ }
+ }
+ }
+ }
+
+ private:
+ ImageSanityChecks(gc::Heap* heap, ClassLinker* class_linker)
+ : spaces_(heap->GetBootImageSpaces()),
+ pointer_size_(class_linker->GetImagePointerSize()) {
+ space_begin_.reserve(spaces_.size());
+ method_sections_.reserve(spaces_.size());
+ runtime_method_sections_.reserve(spaces_.size());
+ for (gc::space::ImageSpace* space : spaces_) {
+ space_begin_.push_back(space->Begin());
+ auto& header = space->GetImageHeader();
+ method_sections_.push_back(&header.GetMethodsSection());
+ runtime_method_sections_.push_back(&header.GetRuntimeMethodsSection());
+ }
+ }
+
+ void SanityCheckArtMethod(ArtMethod* m, ObjPtr<mirror::Class> expected_class)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ if (m->IsRuntimeMethod()) {
+ ObjPtr<mirror::Class> declaring_class = m->GetDeclaringClassUnchecked();
+ CHECK(declaring_class == nullptr) << declaring_class << " " << m->PrettyMethod();
+ } else if (m->IsCopied()) {
+ CHECK(m->GetDeclaringClass() != nullptr) << m->PrettyMethod();
+ } else if (expected_class != nullptr) {
+ CHECK_EQ(m->GetDeclaringClassUnchecked(), expected_class) << m->PrettyMethod();
+ }
+ if (!spaces_.empty()) {
+ bool contains = false;
+ for (size_t i = 0; !contains && i != space_begin_.size(); ++i) {
+ const size_t offset = reinterpret_cast<uint8_t*>(m) - space_begin_[i];
+ contains = method_sections_[i]->Contains(offset) ||
+ runtime_method_sections_[i]->Contains(offset);
+ }
+ CHECK(contains) << m << " not found";
+ }
+ }
+
+ void SanityCheckArtMethodPointerArray(ObjPtr<mirror::PointerArray> arr,
+ ObjPtr<mirror::Class> expected_class)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ CHECK(arr != nullptr);
+ for (int32_t j = 0; j < arr->GetLength(); ++j) {
+ auto* method = arr->GetElementPtrSize<ArtMethod*>(j, pointer_size_);
+ // expected_class == null means we are a dex cache.
+ if (expected_class != nullptr) {
+ CHECK(method != nullptr);
+ }
+ if (method != nullptr) {
+ SanityCheckArtMethod(method, expected_class);
+ }
+ }
+ }
+
+ void SanityCheckArtMethodPointerArray(ArtMethod** arr, size_t size)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ CHECK_EQ(arr != nullptr, size != 0u);
+ if (arr != nullptr) {
+ bool contains = false;
+ for (auto space : spaces_) {
+ auto offset = reinterpret_cast<uint8_t*>(arr) - space->Begin();
+ if (space->GetImageHeader().GetImageSection(
+ ImageHeader::kSectionDexCacheArrays).Contains(offset)) {
+ contains = true;
+ break;
+ }
+ }
+ CHECK(contains);
+ }
+ for (size_t j = 0; j < size; ++j) {
+ ArtMethod* method = mirror::DexCache::GetElementPtrSize(arr, j, pointer_size_);
+ // expected_class == null means we are a dex cache.
+ if (method != nullptr) {
+ SanityCheckArtMethod(method, nullptr);
+ }
+ }
+ }
+
+ const std::vector<gc::space::ImageSpace*>& spaces_;
+ const PointerSize pointer_size_;
+
+ // Cached sections from the spaces.
+ std::vector<const uint8_t*> space_begin_;
+ std::vector<const ImageSection*> method_sections_;
+ std::vector<const ImageSection*> runtime_method_sections_;
+};
+
bool ClassLinker::AddImageSpace(
gc::space::ImageSpace* space,
Handle<mirror::ClassLoader> class_loader,
@@ -1616,13 +1640,6 @@
Runtime* const runtime = Runtime::Current();
gc::Heap* const heap = runtime->GetHeap();
Thread* const self = Thread::Current();
- StackHandleScope<2> hs(self);
- Handle<mirror::ObjectArray<mirror::DexCache>> dex_caches(
- hs.NewHandle(dex_caches_object->AsObjectArray<mirror::DexCache>()));
- Handle<mirror::ObjectArray<mirror::Class>> class_roots(hs.NewHandle(
- header.GetImageRoot(ImageHeader::kClassRoots)->AsObjectArray<mirror::Class>()));
- const OatFile* oat_file = space->GetOatFile();
- std::unordered_set<mirror::ClassLoader*> image_class_loaders;
// Check that the image is what we are expecting.
if (image_pointer_size_ != space->GetImageHeader().GetPointerSize()) {
*error_msg = StringPrintf("Application image pointer size does not match runtime: %zu vs %zu",
@@ -1630,6 +1647,22 @@
image_pointer_size_);
return false;
}
+ size_t expected_image_roots = ImageHeader::NumberOfImageRoots(app_image);
+ if (static_cast<size_t>(header.GetImageRoots()->GetLength()) != expected_image_roots) {
+ *error_msg = StringPrintf("Expected %zu image roots but got %d",
+ expected_image_roots,
+ header.GetImageRoots()->GetLength());
+ return false;
+ }
+ StackHandleScope<3> hs(self);
+ Handle<mirror::ObjectArray<mirror::DexCache>> dex_caches(
+ hs.NewHandle(dex_caches_object->AsObjectArray<mirror::DexCache>()));
+ Handle<mirror::ObjectArray<mirror::Class>> class_roots(hs.NewHandle(
+ header.GetImageRoot(ImageHeader::kClassRoots)->AsObjectArray<mirror::Class>()));
+ static_assert(ImageHeader::kClassLoader + 1u == ImageHeader::kImageRootsMax,
+ "Class loader should be the last image root.");
+ MutableHandle<mirror::ClassLoader> image_class_loader(hs.NewHandle(
+ app_image ? header.GetImageRoot(ImageHeader::kClassLoader)->AsClassLoader() : nullptr));
DCHECK(class_roots.Get() != nullptr);
if (class_roots->GetLength() != static_cast<int32_t>(kClassRootsMax)) {
*error_msg = StringPrintf("Expected %d class roots but got %d",
@@ -1644,6 +1677,7 @@
return false;
}
}
+ const OatFile* oat_file = space->GetOatFile();
if (oat_file->GetOatHeader().GetDexFileCount() !=
static_cast<uint32_t>(dex_caches->GetLength())) {
*error_msg = "Dex cache count and dex file count mismatch while trying to initialize from "
@@ -1676,23 +1710,19 @@
// The current dex file field is bogus, overwrite it so that we can get the dex file in the
// loop below.
h_dex_cache->SetDexFile(dex_file.get());
- // Check that each class loader resolved the same way.
- // TODO: Store image class loaders as image roots.
GcRoot<mirror::Class>* const types = h_dex_cache->GetResolvedTypes();
for (int32_t j = 0, num_types = h_dex_cache->NumResolvedTypes(); j < num_types; j++) {
ObjPtr<mirror::Class> klass = types[j].Read();
if (klass != nullptr) {
DCHECK_NE(klass->GetStatus(), mirror::Class::kStatusError);
- ObjPtr<mirror::ClassLoader> image_class_loader = klass->GetClassLoader();
- image_class_loaders.insert(image_class_loader.Ptr());
}
}
} else {
if (kSanityCheckObjects) {
- SanityCheckArtMethodPointerArray(h_dex_cache->GetResolvedMethods(),
- h_dex_cache->NumResolvedMethods(),
- image_pointer_size_,
- heap->GetBootImageSpaces());
+ ImageSanityChecks::CheckPointerArray(heap,
+ this,
+ h_dex_cache->GetResolvedMethods(),
+ h_dex_cache->NumResolvedMethods());
}
// Register dex files, keep track of existing ones that are conflicts.
AppendToBootClassPath(*dex_file.get(), h_dex_cache);
@@ -1710,59 +1740,57 @@
// for PathClassLoader does this by looping through the array of dex files. To ensure they
// resolve the same way, simply flatten the hierarchy in the way the resolution order would be,
// and check that the dex file names are the same.
- for (ObjPtr<mirror::ClassLoader> image_class_loader : image_class_loaders) {
- if (IsBootClassLoader(soa, image_class_loader)) {
- // The dex cache can reference types from the boot class loader.
- continue;
+ if (IsBootClassLoader(soa, image_class_loader.Get())) {
+ *error_msg = "Unexpected BootClassLoader in app image";
+ return false;
+ }
+ std::list<mirror::String*> image_dex_file_names;
+ std::string temp_error_msg;
+ if (!FlattenPathClassLoader(image_class_loader.Get(), &image_dex_file_names, &temp_error_msg)) {
+ *error_msg = StringPrintf("Failed to flatten image class loader hierarchy '%s'",
+ temp_error_msg.c_str());
+ return false;
+ }
+ std::list<mirror::String*> loader_dex_file_names;
+ if (!FlattenPathClassLoader(class_loader.Get(), &loader_dex_file_names, &temp_error_msg)) {
+ *error_msg = StringPrintf("Failed to flatten class loader hierarchy '%s'",
+ temp_error_msg.c_str());
+ return false;
+ }
+ // Add the temporary dex path list elements at the end.
+ auto elements = soa.Decode<mirror::ObjectArray<mirror::Object>>(dex_elements);
+ for (size_t i = 0, num_elems = elements->GetLength(); i < num_elems; ++i) {
+ ObjPtr<mirror::Object> element = elements->GetWithoutChecks(i);
+ if (element != nullptr) {
+ // If we are somewhere in the middle of the array, there may be nulls at the end.
+ loader_dex_file_names.push_back(GetDexPathListElementName(element));
}
- std::list<mirror::String*> image_dex_file_names;
- std::string temp_error_msg;
- if (!FlattenPathClassLoader(image_class_loader, &image_dex_file_names, &temp_error_msg)) {
- *error_msg = StringPrintf("Failed to flatten image class loader hierarchy '%s'",
- temp_error_msg.c_str());
- return false;
+ }
+ // Ignore the number of image dex files since we are adding those to the class loader anyways.
+ CHECK_GE(static_cast<size_t>(image_dex_file_names.size()),
+ static_cast<size_t>(dex_caches->GetLength()));
+ size_t image_count = image_dex_file_names.size() - dex_caches->GetLength();
+ // Check that the dex file names match.
+ bool equal = image_count == loader_dex_file_names.size();
+ if (equal) {
+ auto it1 = image_dex_file_names.begin();
+ auto it2 = loader_dex_file_names.begin();
+ for (size_t i = 0; equal && i < image_count; ++i, ++it1, ++it2) {
+ equal = equal && (*it1)->Equals(*it2);
}
- std::list<mirror::String*> loader_dex_file_names;
- if (!FlattenPathClassLoader(class_loader.Get(), &loader_dex_file_names, &temp_error_msg)) {
- *error_msg = StringPrintf("Failed to flatten class loader hierarchy '%s'",
- temp_error_msg.c_str());
- return false;
+ }
+ if (!equal) {
+ VLOG(image) << "Image dex files " << image_dex_file_names.size();
+ for (ObjPtr<mirror::String> name : image_dex_file_names) {
+ VLOG(image) << name->ToModifiedUtf8();
}
- // Add the temporary dex path list elements at the end.
- auto elements = soa.Decode<mirror::ObjectArray<mirror::Object>>(dex_elements);
- for (size_t i = 0, num_elems = elements->GetLength(); i < num_elems; ++i) {
- ObjPtr<mirror::Object> element = elements->GetWithoutChecks(i);
- if (element != nullptr) {
- // If we are somewhere in the middle of the array, there may be nulls at the end.
- loader_dex_file_names.push_back(GetDexPathListElementName(element));
- }
+ VLOG(image) << "Loader dex files " << loader_dex_file_names.size();
+ for (ObjPtr<mirror::String> name : loader_dex_file_names) {
+ VLOG(image) << name->ToModifiedUtf8();
}
- // Ignore the number of image dex files since we are adding those to the class loader anyways.
- CHECK_GE(static_cast<size_t>(image_dex_file_names.size()),
- static_cast<size_t>(dex_caches->GetLength()));
- size_t image_count = image_dex_file_names.size() - dex_caches->GetLength();
- // Check that the dex file names match.
- bool equal = image_count == loader_dex_file_names.size();
- if (equal) {
- auto it1 = image_dex_file_names.begin();
- auto it2 = loader_dex_file_names.begin();
- for (size_t i = 0; equal && i < image_count; ++i, ++it1, ++it2) {
- equal = equal && (*it1)->Equals(*it2);
- }
- }
- if (!equal) {
- VLOG(image) << "Image dex files " << image_dex_file_names.size();
- for (ObjPtr<mirror::String> name : image_dex_file_names) {
- VLOG(image) << name->ToModifiedUtf8();
- }
- VLOG(image) << "Loader dex files " << loader_dex_file_names.size();
- for (ObjPtr<mirror::String> name : loader_dex_file_names) {
- VLOG(image) << name->ToModifiedUtf8();
- }
- *error_msg = "Rejecting application image due to class loader mismatch";
- // Ignore class loader mismatch for now since these would just use possibly incorrect
- // oat code anyways. The structural class check should be done in the parent.
- }
+ *error_msg = "Rejecting application image due to class loader mismatch";
+ // Ignore class loader mismatch for now since these would just use possibly incorrect
+ // oat code anyways. The structural class check should be done in the parent.
}
}
@@ -1777,7 +1805,7 @@
}
}
if (!app_image) {
- heap->VisitObjects(SanityCheckObjectsCallback, nullptr);
+ ImageSanityChecks::CheckObjects(heap, this);
}
}
@@ -1817,10 +1845,8 @@
}
// Update class loader and resolved strings. If added_class_table is false, the resolved
// strings were forwarded UpdateAppImageClassLoadersAndDexCaches.
- UpdateClassLoaderAndResolvedStringsVisitor visitor(space,
- class_loader.Get(),
- forward_dex_cache_arrays);
- for (GcRoot<mirror::Class>& root : temp_set) {
+ UpdateClassLoaderVisitor visitor(space, class_loader.Get());
+ for (const ClassTable::TableSlot& root : temp_set) {
visitor(root.Read());
}
// forward_dex_cache_arrays is true iff we copied all of the dex cache arrays into the .bss.
@@ -1871,8 +1897,6 @@
const bool tracing_enabled = Trace::IsTracingEnabled();
Thread* const self = Thread::Current();
WriterMutexLock mu(self, *Locks::classlinker_classes_lock_);
- BufferedRootVisitor<kDefaultBufferedRootCount> buffered_visitor(
- visitor, RootInfo(kRootStickyClass));
if ((flags & kVisitRootFlagAllRoots) != 0) {
// Argument for how root visiting deals with ArtField and ArtMethod roots.
// There is 3 GC cases to handle:
@@ -1889,8 +1913,12 @@
// Moving concurrent:
// Need to make sure to not copy ArtMethods without doing read barriers since the roots are
// marked concurrently and we don't hold the classlinker_classes_lock_ when we do the copy.
- boot_class_table_.VisitRoots(buffered_visitor);
-
+ //
+ // Use an unbuffered visitor since the class table uses a temporary GcRoot for holding decoded
+ // ClassTable::TableSlot. The buffered root visiting would access a stale stack location for
+ // these objects.
+ UnbufferedRootVisitor root_visitor(visitor, RootInfo(kRootStickyClass));
+ boot_class_table_.VisitRoots(root_visitor);
// If tracing is enabled, then mark all the class loaders to prevent unloading.
if ((flags & kVisitRootFlagClassLoader) != 0 || tracing_enabled) {
for (const ClassLoaderData& data : class_loaders_) {
@@ -1907,7 +1935,6 @@
CHECK_EQ(new_ref, old_ref);
}
}
- buffered_visitor.Flush(); // Flush before clearing new_class_roots_.
if ((flags & kVisitRootFlagClearRootLog) != 0) {
new_class_roots_.clear();
}
@@ -1941,13 +1968,36 @@
void Visit(ObjPtr<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::classlinker_classes_lock_, Locks::mutator_lock_) OVERRIDE {
ClassTable* const class_table = class_loader->GetClassTable();
- if (!done_ && class_table != nullptr && !class_table->Visit(*visitor_)) {
- // If the visitor ClassTable returns false it means that we don't need to continue.
- done_ = true;
+ if (!done_ && class_table != nullptr) {
+ DefiningClassLoaderFilterVisitor visitor(class_loader, visitor_);
+ if (!class_table->Visit(visitor)) {
+ // If the visitor ClassTable returns false it means that we don't need to continue.
+ done_ = true;
+ }
}
}
private:
+ // Class visitor that limits the class visits from a ClassTable to the classes with
+ // the provided defining class loader. This filter is used to avoid multiple visits
+ // of the same class which can be recorded for multiple initiating class loaders.
+ class DefiningClassLoaderFilterVisitor : public ClassVisitor {
+ public:
+ DefiningClassLoaderFilterVisitor(ObjPtr<mirror::ClassLoader> defining_class_loader,
+ ClassVisitor* visitor)
+ : defining_class_loader_(defining_class_loader), visitor_(visitor) { }
+
+ bool operator()(ObjPtr<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+ if (klass->GetClassLoader() != defining_class_loader_) {
+ return true;
+ }
+ return (*visitor_)(klass);
+ }
+
+ ObjPtr<mirror::ClassLoader> const defining_class_loader_;
+ ClassVisitor* const visitor_;
+ };
+
ClassVisitor* const visitor_;
// If done is true then we don't need to do any more visiting.
bool done_;
@@ -2104,109 +2154,6 @@
: static_cast<mirror::Array*>(mirror::IntArray::Alloc(self, length)));
}
-void ClassLinker::InitializeDexCache(Thread* self,
- ObjPtr<mirror::DexCache> dex_cache,
- ObjPtr<mirror::String> location,
- const DexFile& dex_file,
- LinearAlloc* linear_alloc) {
- ScopedAssertNoThreadSuspension sants(__FUNCTION__);
- DexCacheArraysLayout layout(image_pointer_size_, &dex_file);
- uint8_t* raw_arrays = nullptr;
-
- const OatDexFile* const oat_dex = dex_file.GetOatDexFile();
- if (oat_dex != nullptr && oat_dex->GetDexCacheArrays() != nullptr) {
- raw_arrays = oat_dex->GetDexCacheArrays();
- } else if (dex_file.NumStringIds() != 0u ||
- dex_file.NumTypeIds() != 0u ||
- dex_file.NumMethodIds() != 0u ||
- dex_file.NumFieldIds() != 0u) {
- // Zero-initialized.
- raw_arrays = reinterpret_cast<uint8_t*>(linear_alloc->Alloc(self, layout.Size()));
- }
-
- mirror::StringDexCacheType* strings = (dex_file.NumStringIds() == 0u) ? nullptr :
- reinterpret_cast<mirror::StringDexCacheType*>(raw_arrays + layout.StringsOffset());
- GcRoot<mirror::Class>* types = (dex_file.NumTypeIds() == 0u) ? nullptr :
- reinterpret_cast<GcRoot<mirror::Class>*>(raw_arrays + layout.TypesOffset());
- ArtMethod** methods = (dex_file.NumMethodIds() == 0u) ? nullptr :
- reinterpret_cast<ArtMethod**>(raw_arrays + layout.MethodsOffset());
- ArtField** fields = (dex_file.NumFieldIds() == 0u) ? nullptr :
- reinterpret_cast<ArtField**>(raw_arrays + layout.FieldsOffset());
-
- size_t num_strings = mirror::DexCache::kDexCacheStringCacheSize;
- if (dex_file.NumStringIds() < num_strings) {
- num_strings = dex_file.NumStringIds();
- }
-
- // Note that we allocate the method type dex caches regardless of this flag,
- // and we make sure here that they're not used by the runtime. This is in the
- // interest of simplicity and to avoid extensive compiler and layout class changes.
- //
- // If this needs to be mitigated in a production system running this code,
- // DexCache::kDexCacheMethodTypeCacheSize can be set to zero.
- mirror::MethodTypeDexCacheType* method_types = nullptr;
- size_t num_method_types = 0;
-
- if (dex_file.NumProtoIds() < mirror::DexCache::kDexCacheMethodTypeCacheSize) {
- num_method_types = dex_file.NumProtoIds();
- } else {
- num_method_types = mirror::DexCache::kDexCacheMethodTypeCacheSize;
- }
-
- if (num_method_types > 0) {
- method_types = reinterpret_cast<mirror::MethodTypeDexCacheType*>(
- raw_arrays + layout.MethodTypesOffset());
- }
-
- DCHECK_ALIGNED(raw_arrays, alignof(mirror::StringDexCacheType)) <<
- "Expected raw_arrays to align to StringDexCacheType.";
- DCHECK_ALIGNED(layout.StringsOffset(), alignof(mirror::StringDexCacheType)) <<
- "Expected StringsOffset() to align to StringDexCacheType.";
- DCHECK_ALIGNED(strings, alignof(mirror::StringDexCacheType)) <<
- "Expected strings to align to StringDexCacheType.";
- static_assert(alignof(mirror::StringDexCacheType) == 8u,
- "Expected StringDexCacheType to have align of 8.");
- if (kIsDebugBuild) {
- // Sanity check to make sure all the dex cache arrays are empty. b/28992179
- for (size_t i = 0; i < num_strings; ++i) {
- CHECK_EQ(strings[i].load(std::memory_order_relaxed).index, 0u);
- CHECK(strings[i].load(std::memory_order_relaxed).object.IsNull());
- }
- for (size_t i = 0; i < dex_file.NumTypeIds(); ++i) {
- CHECK(types[i].IsNull());
- }
- for (size_t i = 0; i < dex_file.NumMethodIds(); ++i) {
- CHECK(mirror::DexCache::GetElementPtrSize(methods, i, image_pointer_size_) == nullptr);
- }
- for (size_t i = 0; i < dex_file.NumFieldIds(); ++i) {
- CHECK(mirror::DexCache::GetElementPtrSize(fields, i, image_pointer_size_) == nullptr);
- }
- for (size_t i = 0; i < num_method_types; ++i) {
- CHECK_EQ(method_types[i].load(std::memory_order_relaxed).index, 0u);
- CHECK(method_types[i].load(std::memory_order_relaxed).object.IsNull());
- }
- }
- if (strings != nullptr) {
- mirror::StringDexCachePair::Initialize(strings);
- }
- if (method_types != nullptr) {
- mirror::MethodTypeDexCachePair::Initialize(method_types);
- }
- dex_cache->Init(&dex_file,
- location,
- strings,
- num_strings,
- types,
- dex_file.NumTypeIds(),
- methods,
- dex_file.NumMethodIds(),
- fields,
- dex_file.NumFieldIds(),
- method_types,
- num_method_types,
- image_pointer_size_);
-}
-
mirror::DexCache* ClassLinker::AllocDexCache(ObjPtr<mirror::String>* out_location,
Thread* self,
const DexFile& dex_file) {
@@ -2233,9 +2180,14 @@
ObjPtr<mirror::String> location = nullptr;
ObjPtr<mirror::DexCache> dex_cache = AllocDexCache(&location, self, dex_file);
if (dex_cache != nullptr) {
- WriterMutexLock mu(self, dex_lock_);
+ WriterMutexLock mu(self, *Locks::dex_lock_);
DCHECK(location != nullptr);
- InitializeDexCache(self, dex_cache, location, dex_file, linear_alloc);
+ mirror::DexCache::InitializeDexCache(self,
+ dex_cache,
+ location,
+ &dex_file,
+ linear_alloc,
+ image_pointer_size_);
}
return dex_cache.Ptr();
}
@@ -2532,56 +2484,110 @@
}
} else {
ScopedObjectAccessUnchecked soa(self);
- ObjPtr<mirror::Class> cp_klass;
- if (FindClassInBaseDexClassLoader(soa, self, descriptor, hash, class_loader, &cp_klass)) {
- // The chain was understood. So the value in cp_klass is either the class we were looking
- // for, or not found.
- if (cp_klass != nullptr) {
- return cp_klass.Ptr();
- }
- // TODO: We handle the boot classpath loader in FindClassInBaseDexClassLoader. Try to unify
- // this and the branch above. TODO: throw the right exception here.
+ ObjPtr<mirror::Class> result_ptr;
+ bool descriptor_equals;
+ bool known_hierarchy =
+ FindClassInBaseDexClassLoader(soa, self, descriptor, hash, class_loader, &result_ptr);
+ if (result_ptr != nullptr) {
+ // The chain was understood and we found the class. We still need to add the class to
+ // the class table to protect from racy programs that can try and redefine the path list
+ // which would change the Class<?> returned for subsequent evaluation of const-class.
+ DCHECK(known_hierarchy);
+ DCHECK(result_ptr->DescriptorEquals(descriptor));
+ descriptor_equals = true;
+ } else {
+ // Either the chain wasn't understood or the class wasn't found.
+ //
+ // If the chain was understood but we did not find the class, let the Java-side
+ // rediscover all this and throw the exception with the right stack trace. Note that
+ // the Java-side could still succeed for racy programs if another thread is actively
+ // modifying the class loader's path list.
- // We'll let the Java-side rediscover all this and throw the exception with the right stack
- // trace.
- }
-
- if (Runtime::Current()->IsAotCompiler()) {
- // Oops, compile-time, can't run actual class-loader code.
- ObjPtr<mirror::Throwable> pre_allocated = Runtime::Current()->GetPreAllocatedNoClassDefFoundError();
- self->SetException(pre_allocated);
- return nullptr;
- }
-
- ScopedLocalRef<jobject> class_loader_object(soa.Env(),
- soa.AddLocalReference<jobject>(class_loader.Get()));
- std::string class_name_string(DescriptorToDot(descriptor));
- ScopedLocalRef<jobject> result(soa.Env(), nullptr);
- {
- ScopedThreadStateChange tsc(self, kNative);
- ScopedLocalRef<jobject> class_name_object(soa.Env(),
- soa.Env()->NewStringUTF(class_name_string.c_str()));
- if (class_name_object.get() == nullptr) {
- DCHECK(self->IsExceptionPending()); // OOME.
+ if (!self->CanCallIntoJava()) {
+ // Oops, we can't call into java so we can't run actual class-loader code.
+ // This is true for e.g. for the compiler (jit or aot).
+ ObjPtr<mirror::Throwable> pre_allocated =
+ Runtime::Current()->GetPreAllocatedNoClassDefFoundError();
+ self->SetException(pre_allocated);
return nullptr;
}
- CHECK(class_loader_object.get() != nullptr);
- result.reset(soa.Env()->CallObjectMethod(class_loader_object.get(),
- WellKnownClasses::java_lang_ClassLoader_loadClass,
- class_name_object.get()));
+
+ ScopedLocalRef<jobject> class_loader_object(
+ soa.Env(), soa.AddLocalReference<jobject>(class_loader.Get()));
+ std::string class_name_string(DescriptorToDot(descriptor));
+ ScopedLocalRef<jobject> result(soa.Env(), nullptr);
+ {
+ ScopedThreadStateChange tsc(self, kNative);
+ ScopedLocalRef<jobject> class_name_object(
+ soa.Env(), soa.Env()->NewStringUTF(class_name_string.c_str()));
+ if (class_name_object.get() == nullptr) {
+ DCHECK(self->IsExceptionPending()); // OOME.
+ return nullptr;
+ }
+ CHECK(class_loader_object.get() != nullptr);
+ result.reset(soa.Env()->CallObjectMethod(class_loader_object.get(),
+ WellKnownClasses::java_lang_ClassLoader_loadClass,
+ class_name_object.get()));
+ }
+ if (self->IsExceptionPending()) {
+ // If the ClassLoader threw, pass that exception up.
+ // However, to comply with the RI behavior, first check if another thread succeeded.
+ result_ptr = LookupClass(self, descriptor, hash, class_loader.Get());
+ if (result_ptr != nullptr && !result_ptr->IsErroneous()) {
+ self->ClearException();
+ return EnsureResolved(self, descriptor, result_ptr);
+ }
+ return nullptr;
+ } else if (result.get() == nullptr) {
+ // broken loader - throw NPE to be compatible with Dalvik
+ ThrowNullPointerException(StringPrintf("ClassLoader.loadClass returned null for %s",
+ class_name_string.c_str()).c_str());
+ return nullptr;
+ }
+ result_ptr = soa.Decode<mirror::Class>(result.get());
+ // Check the name of the returned class.
+ descriptor_equals = result_ptr->DescriptorEquals(descriptor);
}
- if (self->IsExceptionPending()) {
- // If the ClassLoader threw, pass that exception up.
- return nullptr;
- } else if (result.get() == nullptr) {
- // broken loader - throw NPE to be compatible with Dalvik
- ThrowNullPointerException(StringPrintf("ClassLoader.loadClass returned null for %s",
- class_name_string.c_str()).c_str());
- return nullptr;
- } else {
- // success, return mirror::Class*
- return soa.Decode<mirror::Class>(result.get()).Ptr();
+
+ // Try to insert the class to the class table, checking for mismatch.
+ ObjPtr<mirror::Class> old;
+ {
+ WriterMutexLock mu(self, *Locks::classlinker_classes_lock_);
+ ClassTable* const class_table = InsertClassTableForClassLoader(class_loader.Get());
+ old = class_table->Lookup(descriptor, hash);
+ if (old == nullptr) {
+ old = result_ptr; // For the comparison below, after releasing the lock.
+ if (descriptor_equals) {
+ class_table->InsertWithHash(result_ptr.Ptr(), hash);
+ Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader.Get());
+ } // else throw below, after releasing the lock.
+ }
}
+ if (UNLIKELY(old != result_ptr)) {
+ // Return `old` (even if `!descriptor_equals`) to mimic the RI behavior for parallel
+ // capable class loaders. (All class loaders are considered parallel capable on Android.)
+ mirror::Class* loader_class = class_loader->GetClass();
+ const char* loader_class_name =
+ loader_class->GetDexFile().StringByTypeIdx(loader_class->GetDexTypeIndex());
+ LOG(WARNING) << "Initiating class loader of type " << DescriptorToDot(loader_class_name)
+ << " is not well-behaved; it returned a different Class for racing loadClass(\""
+ << DescriptorToDot(descriptor) << "\").";
+ return EnsureResolved(self, descriptor, old);
+ }
+ if (UNLIKELY(!descriptor_equals)) {
+ std::string result_storage;
+ const char* result_name = result_ptr->GetDescriptor(&result_storage);
+ std::string loader_storage;
+ const char* loader_class_name = class_loader->GetClass()->GetDescriptor(&loader_storage);
+ ThrowNoClassDefFoundError(
+ "Initiating class loader of type %s returned class %s instead of %s.",
+ DescriptorToDot(loader_class_name).c_str(),
+ DescriptorToDot(result_name).c_str(),
+ DescriptorToDot(descriptor).c_str());
+ return nullptr;
+ }
+ // success, return mirror::Class*
+ return result_ptr.Ptr();
}
UNREACHABLE();
}
@@ -2641,6 +2647,8 @@
ObjectLock<mirror::Class> lock(self, klass);
klass->SetClinitThreadId(self->GetTid());
+ // Make sure we have a valid empty iftable even if there are errors.
+ klass->SetIfTable(GetClassRoot(kJavaLangObject)->GetIfTable());
// Add the newly loaded class to the loaded classes table.
ObjPtr<mirror::Class> existing = InsertClass(descriptor, klass.Get(), hash);
@@ -2992,7 +3000,6 @@
klass->SetDexClassDefIndex(dex_file.GetIndexForClassDef(dex_class_def));
klass->SetDexTypeIndex(dex_class_def.class_idx_);
- CHECK(klass->GetDexCacheStrings() != nullptr);
}
void ClassLinker::LoadClass(Thread* self,
@@ -3255,7 +3262,7 @@
void ClassLinker::RegisterDexFileLocked(const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache) {
Thread* const self = Thread::Current();
- dex_lock_.AssertExclusiveHeld(self);
+ Locks::dex_lock_->AssertExclusiveHeld(self);
CHECK(dex_cache.Get() != nullptr) << dex_file.GetLocation();
// For app images, the dex cache location may be a suffix of the dex file location since the
// dex file location is an absolute path.
@@ -3297,7 +3304,7 @@
ObjPtr<mirror::ClassLoader> class_loader) {
Thread* self = Thread::Current();
{
- ReaderMutexLock mu(self, dex_lock_);
+ ReaderMutexLock mu(self, *Locks::dex_lock_);
ObjPtr<mirror::DexCache> dex_cache = FindDexCacheLocked(self, dex_file, true);
if (dex_cache != nullptr) {
return dex_cache.Ptr();
@@ -3320,7 +3327,7 @@
dex_file)));
Handle<mirror::String> h_location(hs.NewHandle(location));
{
- WriterMutexLock mu(self, dex_lock_);
+ WriterMutexLock mu(self, *Locks::dex_lock_);
ObjPtr<mirror::DexCache> dex_cache = FindDexCacheLocked(self, dex_file, true);
if (dex_cache != nullptr) {
// Another thread managed to initialize the dex cache faster, so use that DexCache.
@@ -3336,7 +3343,12 @@
// Do InitializeDexCache while holding dex lock to make sure two threads don't call it at the
// same time with the same dex cache. Since the .bss is shared this can cause failing DCHECK
// that the arrays are null.
- InitializeDexCache(self, h_dex_cache.Get(), h_location.Get(), dex_file, linear_alloc);
+ mirror::DexCache::InitializeDexCache(self,
+ h_dex_cache.Get(),
+ h_location.Get(),
+ &dex_file,
+ linear_alloc,
+ image_pointer_size_);
RegisterDexFileLocked(dex_file, h_dex_cache);
}
table->InsertStrongRoot(h_dex_cache.Get());
@@ -3345,14 +3357,14 @@
void ClassLinker::RegisterDexFile(const DexFile& dex_file,
Handle<mirror::DexCache> dex_cache) {
- WriterMutexLock mu(Thread::Current(), dex_lock_);
+ WriterMutexLock mu(Thread::Current(), *Locks::dex_lock_);
RegisterDexFileLocked(dex_file, dex_cache);
}
mirror::DexCache* ClassLinker::FindDexCache(Thread* self,
const DexFile& dex_file,
bool allow_failure) {
- ReaderMutexLock mu(self, dex_lock_);
+ ReaderMutexLock mu(self, *Locks::dex_lock_);
return FindDexCacheLocked(self, dex_file, allow_failure);
}
@@ -3389,7 +3401,7 @@
void ClassLinker::FixupDexCaches(ArtMethod* resolution_method) {
Thread* const self = Thread::Current();
- ReaderMutexLock mu(self, dex_lock_);
+ ReaderMutexLock mu(self, *Locks::dex_lock_);
for (const DexCacheData& data : dex_caches_) {
if (!self->IsJWeakCleared(data.weak_root)) {
ObjPtr<mirror::DexCache> dex_cache = ObjPtr<mirror::DexCache>::DownCast(
@@ -3662,12 +3674,6 @@
Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(klass);
}
-bool ClassLinker::RemoveClass(const char* descriptor, ObjPtr<mirror::ClassLoader> class_loader) {
- WriterMutexLock mu(Thread::Current(), *Locks::classlinker_classes_lock_);
- ClassTable* const class_table = ClassTableForClassLoader(class_loader);
- return class_table != nullptr && class_table->Remove(descriptor);
-}
-
mirror::Class* ClassLinker::LookupClass(Thread* self,
const char* descriptor,
size_t hash,
@@ -3718,7 +3724,8 @@
REQUIRES_SHARED(Locks::classlinker_classes_lock_, Locks::mutator_lock_) OVERRIDE {
ClassTable* const class_table = class_loader->GetClassTable();
ObjPtr<mirror::Class> klass = class_table->Lookup(descriptor_, hash_);
- if (klass != nullptr) {
+ // Add `klass` only if `class_loader` is its defining (not just initiating) class loader.
+ if (klass != nullptr && klass->GetClassLoader() == class_loader) {
result_->push_back(klass);
}
}
@@ -3737,6 +3744,7 @@
const size_t hash = ComputeModifiedUtf8Hash(descriptor);
ObjPtr<mirror::Class> klass = boot_class_table_.Lookup(descriptor, hash);
if (klass != nullptr) {
+ DCHECK(klass->GetClassLoader() == nullptr);
result.push_back(klass);
}
LookupClassesVisitor visitor(descriptor, hash, &result);
@@ -3784,6 +3792,17 @@
return false;
}
+// Ensures that methods have the kAccSkipAccessChecks bit set. We use the
+// kAccVerificationAttempted bit on the class access flags to determine whether this has been done
+// before.
+static void EnsureSkipAccessChecksMethods(Handle<mirror::Class> klass, PointerSize pointer_size)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ if (!klass->WasVerificationAttempted()) {
+ klass->SetSkipAccessChecksFlagOnAllMethods(pointer_size);
+ klass->SetVerificationAttempted();
+ }
+}
+
verifier::MethodVerifier::FailureKind ClassLinker::VerifyClass(
Thread* self, Handle<mirror::Class> klass, verifier::HardFailLogMode log_level) {
{
@@ -3811,7 +3830,7 @@
// Don't attempt to re-verify if already sufficiently verified.
if (klass->IsVerified()) {
- EnsureSkipAccessChecksMethods(klass);
+ EnsureSkipAccessChecksMethods(klass, image_pointer_size_);
return verifier::MethodVerifier::kNoFailure;
}
if (klass->IsCompileTimeVerified() && Runtime::Current()->IsAotCompiler()) {
@@ -3830,7 +3849,7 @@
// Skip verification if disabled.
if (!Runtime::Current()->IsVerificationEnabled()) {
mirror::Class::SetStatus(klass, mirror::Class::kStatusVerified, self);
- EnsureSkipAccessChecksMethods(klass);
+ EnsureSkipAccessChecksMethods(klass, image_pointer_size_);
return verifier::MethodVerifier::kNoFailure;
}
}
@@ -3965,19 +3984,12 @@
// Mark the class as having a verification attempt to avoid re-running the verifier.
klass->SetVerificationAttempted();
} else {
- EnsureSkipAccessChecksMethods(klass);
+ EnsureSkipAccessChecksMethods(klass, image_pointer_size_);
}
}
return verifier_failure;
}
-void ClassLinker::EnsureSkipAccessChecksMethods(Handle<mirror::Class> klass) {
- if (!klass->WasVerificationAttempted()) {
- klass->SetSkipAccessChecksFlagOnAllMethods(image_pointer_size_);
- klass->SetVerificationAttempted();
- }
-}
-
bool ClassLinker::VerifyClassUsingOatFile(const DexFile& dex_file,
ObjPtr<mirror::Class> klass,
mirror::Class::Status& oat_file_class_status) {
@@ -4000,7 +4012,7 @@
const OatFile::OatDexFile* oat_dex_file = dex_file.GetOatDexFile();
// In case we run without an image there won't be a backing oat file.
- if (oat_dex_file == nullptr) {
+ if (oat_dex_file == nullptr || oat_dex_file->GetOatFile() == nullptr) {
return false;
}
@@ -4090,7 +4102,7 @@
for (; iterator.HasNext(); iterator.Next()) {
// Ensure exception types are resolved so that they don't need resolution to be delivered,
// unresolved exception types will be ignored by exception delivery
- if (iterator.GetHandlerTypeIndex() != DexFile::kDexNoIndex16) {
+ if (iterator.GetHandlerTypeIndex().IsValid()) {
ObjPtr<mirror::Class> exception_type = ResolveType(iterator.GetHandlerTypeIndex(), method);
if (exception_type == nullptr) {
DCHECK(Thread::Current()->IsExceptionPending());
@@ -4535,7 +4547,7 @@
StackHandleScope<1> hs_iface(self);
MutableHandle<mirror::Class> handle_scope_iface(hs_iface.NewHandle<mirror::Class>(nullptr));
for (size_t i = 0; i < num_direct_interfaces; i++) {
- handle_scope_iface.Assign(mirror::Class::GetDirectInterface(self, klass, i));
+ handle_scope_iface.Assign(mirror::Class::GetDirectInterface(self, klass.Get(), i));
CHECK(handle_scope_iface.Get() != nullptr);
CHECK(handle_scope_iface->IsInterface());
if (handle_scope_iface->HasBeenRecursivelyInitialized()) {
@@ -4671,7 +4683,8 @@
MutableHandle<mirror::Class> handle_super_iface(hs.NewHandle<mirror::Class>(nullptr));
// First we initialize all of iface's super-interfaces recursively.
for (size_t i = 0; i < num_direct_ifaces; i++) {
- ObjPtr<mirror::Class> super_iface = mirror::Class::GetDirectInterface(self, iface, i);
+ ObjPtr<mirror::Class> super_iface = mirror::Class::GetDirectInterface(self, iface.Get(), i);
+ DCHECK(super_iface != nullptr);
if (!super_iface->HasBeenRecursivelyInitialized()) {
// Recursive step
handle_super_iface.Assign(super_iface);
@@ -4756,7 +4769,7 @@
const DexFile* dex_file = m->GetDexFile();
const DexFile::MethodId& method_id = dex_file->GetMethodId(m->GetDexMethodIndex());
const DexFile::ProtoId& proto_id = dex_file->GetMethodPrototype(method_id);
- uint16_t return_type_idx = proto_id.return_type_idx_;
+ dex::TypeIndex return_type_idx = proto_id.return_type_idx_;
std::string return_type = dex_file->PrettyType(return_type_idx);
std::string class_loader = mirror::Object::PrettyTypeOf(m->GetDeclaringClass()->GetClassLoader());
ThrowWrappedLinkageError(klass.Get(),
@@ -4774,7 +4787,7 @@
ArtMethod* method,
ArtMethod* m,
uint32_t index,
- uint32_t arg_type_idx)
+ dex::TypeIndex arg_type_idx)
REQUIRES_SHARED(Locks::mutator_lock_) {
DCHECK(Thread::Current()->IsExceptionPending());
DCHECK(!m->IsProxyMethod());
@@ -4864,7 +4877,7 @@
}
for (uint32_t i = 0; i < num_types; ++i) {
StackHandleScope<1> hs(self);
- uint32_t param_type_idx = types1->GetTypeItem(i).type_idx_;
+ dex::TypeIndex param_type_idx = types1->GetTypeItem(i).type_idx_;
Handle<mirror::Class> param_type(hs.NewHandle(
method1->GetClassFromTypeIndex(param_type_idx, true /* resolve */, pointer_size)));
if (UNLIKELY(param_type.Get() == nullptr)) {
@@ -4872,7 +4885,7 @@
method1, i, param_type_idx);
return false;
}
- uint32_t other_param_type_idx = types2->GetTypeItem(i).type_idx_;
+ dex::TypeIndex other_param_type_idx = types2->GetTypeItem(i).type_idx_;
ObjPtr<mirror::Class> other_param_type =
method2->GetClassFromTypeIndex(other_param_type_idx, true /* resolve */, pointer_size);
if (UNLIKELY(other_param_type == nullptr)) {
@@ -4947,7 +4960,7 @@
bool can_init_parents) {
DCHECK(c.Get() != nullptr);
if (c->IsInitialized()) {
- EnsureSkipAccessChecksMethods(c);
+ EnsureSkipAccessChecksMethods(c, image_pointer_size_);
self->AssertNoPendingException();
return true;
}
@@ -5103,6 +5116,12 @@
if (klass->ShouldHaveImt()) {
klass->SetImt(imt, image_pointer_size_);
}
+
+ // Update CHA info based on whether we override methods.
+ // Have to do this before setting the class as resolved which allows
+ // instantiation of klass.
+ Runtime::Current()->GetClassHierarchyAnalysis()->UpdateAfterLoadingOf(klass);
+
// This will notify waiters on klass that saw the not yet resolved
// class in the class_table_ during EnsureResolved.
mirror::Class::SetStatus(klass, mirror::Class::kStatusResolved, self);
@@ -5146,6 +5165,11 @@
}
}
+ // Update CHA info based on whether we override methods.
+ // Have to do this before setting the class as resolved which allows
+ // instantiation of klass.
+ Runtime::Current()->GetClassHierarchyAnalysis()->UpdateAfterLoadingOf(h_new_class);
+
// This will notify waiters on temp class that saw the not yet resolved class in the
// class_table_ during EnsureResolved.
mirror::Class::SetStatus(klass, mirror::Class::kStatusRetired, self);
@@ -5356,8 +5380,8 @@
bool ClassLinker::LoadSuperAndInterfaces(Handle<mirror::Class> klass, const DexFile& dex_file) {
CHECK_EQ(mirror::Class::kStatusIdx, klass->GetStatus());
const DexFile::ClassDef& class_def = dex_file.GetClassDef(klass->GetDexClassDefIndex());
- uint16_t super_class_idx = class_def.superclass_idx_;
- if (super_class_idx != DexFile::kDexNoIndex16) {
+ dex::TypeIndex super_class_idx = class_def.superclass_idx_;
+ if (super_class_idx.IsValid()) {
// Check that a class does not inherit from itself directly.
//
// TODO: This is a cheap check to detect the straightforward case
@@ -5394,7 +5418,7 @@
const DexFile::TypeList* interfaces = dex_file.GetInterfacesList(class_def);
if (interfaces != nullptr) {
for (size_t i = 0; i < interfaces->Size(); i++) {
- uint16_t idx = interfaces->GetTypeItem(i).type_idx_;
+ dex::TypeIndex idx = interfaces->GetTypeItem(i).type_idx_;
ObjPtr<mirror::Class> interface = ResolveType(dex_file, idx, klass.Get());
if (interface == nullptr) {
DCHECK(Thread::Current()->IsExceptionPending());
@@ -6421,7 +6445,7 @@
for (size_t i = 0; i < num_interfaces; i++) {
ObjPtr<mirror::Class> interface = have_interfaces
? interfaces->GetWithoutChecks(i)
- : mirror::Class::GetDirectInterface(self, klass, i);
+ : mirror::Class::GetDirectInterface(self, klass.Get(), i);
DCHECK(interface != nullptr);
if (UNLIKELY(!interface->IsInterface())) {
std::string temp;
@@ -6459,7 +6483,7 @@
std::vector<mirror::Class*> to_add;
for (size_t i = 0; i < num_interfaces; i++) {
ObjPtr<mirror::Class> interface = have_interfaces ? interfaces->Get(i) :
- mirror::Class::GetDirectInterface(self, klass, i);
+ mirror::Class::GetDirectInterface(self, klass.Get(), i);
to_add.push_back(interface.Ptr());
}
@@ -7477,7 +7501,7 @@
}
mirror::String* ClassLinker::ResolveString(const DexFile& dex_file,
- uint32_t string_idx,
+ dex::StringIndex string_idx,
Handle<mirror::DexCache> dex_cache) {
DCHECK(dex_cache.Get() != nullptr);
Thread::PoisonObjectPointersIfDebug();
@@ -7493,7 +7517,7 @@
}
mirror::String* ClassLinker::LookupString(const DexFile& dex_file,
- uint32_t string_idx,
+ dex::StringIndex string_idx,
Handle<mirror::DexCache> dex_cache) {
DCHECK(dex_cache.Get() != nullptr);
ObjPtr<mirror::String> resolved = dex_cache->GetResolvedString(string_idx);
@@ -7502,7 +7526,8 @@
}
uint32_t utf16_length;
const char* utf8_data = dex_file.StringDataAndUtf16LengthByIdx(string_idx, &utf16_length);
- ObjPtr<mirror::String> string = intern_table_->LookupStrong(Thread::Current(), utf16_length, utf8_data);
+ ObjPtr<mirror::String> string =
+ intern_table_->LookupStrong(Thread::Current(), utf16_length, utf8_data);
if (string != nullptr) {
dex_cache->SetResolvedString(string_idx, string);
}
@@ -7510,7 +7535,7 @@
}
ObjPtr<mirror::Class> ClassLinker::LookupResolvedType(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
ObjPtr<mirror::DexCache> dex_cache,
ObjPtr<mirror::ClassLoader> class_loader) {
ObjPtr<mirror::Class> type = dex_cache->GetResolvedType(type_idx);
@@ -7536,7 +7561,7 @@
}
mirror::Class* ClassLinker::ResolveType(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
ObjPtr<mirror::Class> referrer) {
StackHandleScope<2> hs(Thread::Current());
Handle<mirror::DexCache> dex_cache(hs.NewHandle(referrer->GetDexCache()));
@@ -7545,7 +7570,7 @@
}
mirror::Class* ClassLinker::ResolveType(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader) {
DCHECK(dex_cache.Get() != nullptr);
@@ -7833,16 +7858,14 @@
}
const DexFile::FieldId& field_id = dex_file.GetFieldId(field_idx);
Thread* const self = Thread::Current();
- StackHandleScope<1> hs(self);
- Handle<mirror::Class> klass(
- hs.NewHandle(ResolveType(dex_file, field_id.class_idx_, dex_cache, class_loader)));
- if (klass.Get() == nullptr) {
+ ObjPtr<mirror::Class> klass = ResolveType(dex_file, field_id.class_idx_, dex_cache, class_loader);
+ if (klass == nullptr) {
DCHECK(Thread::Current()->IsExceptionPending());
return nullptr;
}
if (is_static) {
- resolved = mirror::Class::FindStaticField(self, klass.Get(), dex_cache.Get(), field_idx);
+ resolved = mirror::Class::FindStaticField(self, klass, dex_cache.Get(), field_idx);
} else {
resolved = klass->FindInstanceField(dex_cache.Get(), field_idx);
}
@@ -7856,7 +7879,7 @@
resolved = klass->FindInstanceField(name, type);
}
if (resolved == nullptr) {
- ThrowNoSuchFieldError(is_static ? "static " : "instance ", klass.Get(), type, name);
+ ThrowNoSuchFieldError(is_static ? "static " : "instance ", klass, type, name);
return nullptr;
}
}
@@ -7876,10 +7899,8 @@
}
const DexFile::FieldId& field_id = dex_file.GetFieldId(field_idx);
Thread* self = Thread::Current();
- StackHandleScope<1> hs(self);
- Handle<mirror::Class> klass(
- hs.NewHandle(ResolveType(dex_file, field_id.class_idx_, dex_cache, class_loader)));
- if (klass.Get() == nullptr) {
+ ObjPtr<mirror::Class> klass(ResolveType(dex_file, field_id.class_idx_, dex_cache, class_loader));
+ if (klass == nullptr) {
DCHECK(Thread::Current()->IsExceptionPending());
return nullptr;
}
@@ -7891,7 +7912,7 @@
if (resolved != nullptr) {
dex_cache->SetResolvedField(field_idx, resolved, image_pointer_size_);
} else {
- ThrowNoSuchFieldError("", klass.Get(), type, name);
+ ThrowNoSuchFieldError("", klass, type, name);
}
return resolved;
}
@@ -7939,7 +7960,7 @@
int32_t i = 0;
MutableHandle<mirror::Class> param_class = hs.NewHandle<mirror::Class>(nullptr);
for (; it.HasNext(); it.Next()) {
- const uint16_t type_idx = it.GetTypeIdx();
+ const dex::TypeIndex type_idx = it.GetTypeIdx();
param_class.Assign(ResolveType(dex_file, type_idx, dex_cache, class_loader));
if (param_class.Get() == nullptr) {
DCHECK(self->IsExceptionPending());
@@ -7958,42 +7979,6 @@
return type.Get();
}
-const char* ClassLinker::MethodShorty(uint32_t method_idx,
- ArtMethod* referrer,
- uint32_t* length) {
- ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass();
- ObjPtr<mirror::DexCache> dex_cache = declaring_class->GetDexCache();
- const DexFile& dex_file = *dex_cache->GetDexFile();
- const DexFile::MethodId& method_id = dex_file.GetMethodId(method_idx);
- return dex_file.GetMethodShorty(method_id, length);
-}
-
-class DumpClassVisitor : public ClassVisitor {
- public:
- explicit DumpClassVisitor(int flags) : flags_(flags) {}
-
- bool operator()(ObjPtr<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
- klass->DumpClass(LOG_STREAM(ERROR), flags_);
- return true;
- }
-
- private:
- const int flags_;
-};
-
-void ClassLinker::DumpAllClasses(int flags) {
- DumpClassVisitor visitor(flags);
- VisitClasses(&visitor);
-}
-
-static OatFile::OatMethod CreateOatMethod(const void* code) {
- CHECK(code != nullptr);
- const uint8_t* base = reinterpret_cast<const uint8_t*>(code); // Base of data points at code.
- base -= sizeof(void*); // Move backward so that code_offset != 0.
- const uint32_t code_offset = sizeof(void*);
- return OatFile::OatMethod(base, code_offset);
-}
-
bool ClassLinker::IsQuickResolutionStub(const void* entry_point) const {
return (entry_point == GetQuickResolutionStub()) ||
(quick_resolution_trampoline_ == entry_point);
@@ -8013,9 +7998,12 @@
return GetQuickGenericJniStub();
}
-void ClassLinker::SetEntryPointsToCompiledCode(ArtMethod* method,
- const void* method_code) const {
- OatFile::OatMethod oat_method = CreateOatMethod(method_code);
+void ClassLinker::SetEntryPointsToCompiledCode(ArtMethod* method, const void* code) const {
+ CHECK(code != nullptr);
+ const uint8_t* base = reinterpret_cast<const uint8_t*>(code); // Base of data points at code.
+ base -= sizeof(void*); // Move backward so that code_offset != 0.
+ const uint32_t code_offset = sizeof(void*);
+ OatFile::OatMethod oat_method(base, code_offset);
oat_method.LinkMethod(method);
}
@@ -8023,9 +8011,7 @@
if (!method->IsNative()) {
method->SetEntryPointFromQuickCompiledCode(GetQuickToInterpreterBridge());
} else {
- const void* quick_method_code = GetQuickGenericJniStub();
- OatFile::OatMethod oat_method = CreateOatMethod(quick_method_code);
- oat_method.LinkMethod(method);
+ SetEntryPointsToCompiledCode(method, GetQuickGenericJniStub());
}
}
@@ -8044,8 +8030,8 @@
REQUIRES_SHARED(Locks::classlinker_classes_lock_, Locks::mutator_lock_) OVERRIDE {
ClassTable* const class_table = class_loader->GetClassTable();
if (class_table != nullptr) {
- num_zygote_classes += class_table->NumZygoteClasses();
- num_non_zygote_classes += class_table->NumNonZygoteClasses();
+ num_zygote_classes += class_table->NumZygoteClasses(class_loader);
+ num_non_zygote_classes += class_table->NumNonZygoteClasses(class_loader);
}
}
@@ -8056,13 +8042,13 @@
size_t ClassLinker::NumZygoteClasses() const {
CountClassesVisitor visitor;
VisitClassLoaders(&visitor);
- return visitor.num_zygote_classes + boot_class_table_.NumZygoteClasses();
+ return visitor.num_zygote_classes + boot_class_table_.NumZygoteClasses(nullptr);
}
size_t ClassLinker::NumNonZygoteClasses() const {
CountClassesVisitor visitor;
VisitClassLoaders(&visitor);
- return visitor.num_non_zygote_classes + boot_class_table_.NumNonZygoteClasses();
+ return visitor.num_non_zygote_classes + boot_class_table_.NumNonZygoteClasses(nullptr);
}
size_t ClassLinker::NumLoadedClasses() {
@@ -8076,7 +8062,7 @@
}
pid_t ClassLinker::GetDexLockOwner() {
- return dex_lock_.GetExclusiveOwnerTid();
+ return Locks::dex_lock_->GetExclusiveOwnerTid();
}
void ClassLinker::SetClassRoot(ClassRoot class_root, ObjPtr<mirror::Class> klass) {
@@ -8150,7 +8136,7 @@
ScopedObjectAccessUnchecked soa(self);
// For now, create a libcore-level DexFile for each ART DexFile. This "explodes" multidex.
- StackHandleScope<11> hs(self);
+ StackHandleScope<6> hs(self);
ArtField* dex_elements_field =
jni::DecodeArtField(WellKnownClasses::dalvik_system_DexPathList_dexElements);
@@ -8229,7 +8215,9 @@
// Make a pretend boot-classpath.
// TODO: Should we scan the image?
ArtField* const parent_field =
- mirror::Class::FindField(self, hs.NewHandle(h_path_class_loader->GetClass()), "parent",
+ mirror::Class::FindField(self,
+ h_path_class_loader->GetClass(),
+ "parent",
"Ljava/lang/ClassLoader;");
DCHECK(parent_field != nullptr);
ObjPtr<mirror::Object> boot_cl =
@@ -8242,20 +8230,6 @@
return soa.Env()->NewGlobalRef(local_ref.get());
}
-ArtMethod* ClassLinker::CreateRuntimeMethod(LinearAlloc* linear_alloc) {
- const size_t method_alignment = ArtMethod::Alignment(image_pointer_size_);
- const size_t method_size = ArtMethod::Size(image_pointer_size_);
- LengthPrefixedArray<ArtMethod>* method_array = AllocArtMethodArray(
- Thread::Current(),
- linear_alloc,
- 1);
- ArtMethod* method = &method_array->At(0, method_size, method_alignment);
- CHECK(method != nullptr);
- method->SetDexMethodIndex(DexFile::kDexNoIndex);
- CHECK(method->IsRuntimeMethod());
- return method;
-}
-
void ClassLinker::DropFindArrayClassCache() {
std::fill_n(find_array_class_cache_, kFindArrayCacheSize, GcRoot<mirror::Class>(nullptr));
find_array_class_cache_next_victim_ = 0;
@@ -8329,7 +8303,7 @@
std::set<DexCacheResolvedClasses> ret;
VLOG(class_linker) << "Collecting resolved classes";
const uint64_t start_time = NanoTime();
- ReaderMutexLock mu(soa.Self(), *DexLock());
+ ReaderMutexLock mu(soa.Self(), *Locks::dex_lock_);
// Loop through all the dex caches and inspect resolved classes.
for (const ClassLinker::DexCacheData& data : GetDexCachesData()) {
if (soa.Self()->IsJWeakCleared(data.weak_root)) {
@@ -8350,10 +8324,10 @@
dex_file->GetBaseLocation(),
dex_file->GetLocationChecksum());
size_t num_resolved = 0;
- std::unordered_set<uint16_t> class_set;
+ std::unordered_set<dex::TypeIndex> class_set;
CHECK_EQ(num_types, dex_cache->NumResolvedTypes());
for (size_t i = 0; i < num_types; ++i) {
- ObjPtr<mirror::Class> klass = dex_cache->GetResolvedType(i);
+ ObjPtr<mirror::Class> klass = dex_cache->GetResolvedType(dex::TypeIndex(i));
// Filter out null class loader since that is the boot class loader.
if (klass == nullptr || (ignore_boot_classes && klass->GetClassLoader() == nullptr)) {
continue;
@@ -8398,7 +8372,7 @@
std::unordered_map<std::string, const DexFile*> location_to_dex_file;
ScopedObjectAccess soa(self);
ScopedAssertNoThreadSuspension ants(__FUNCTION__);
- ReaderMutexLock mu(self, *DexLock());
+ ReaderMutexLock mu(self, *Locks::dex_lock_);
for (const ClassLinker::DexCacheData& data : GetDexCachesData()) {
if (!self->IsJWeakCleared(data.weak_root)) {
ObjPtr<mirror::DexCache> dex_cache = soa.Decode<mirror::DexCache>(data.weak_root);
@@ -8418,7 +8392,7 @@
VLOG(profiler) << "Found opened dex file for " << dex_file->GetLocation() << " with "
<< info.GetClasses().size() << " classes";
DCHECK_EQ(dex_file->GetLocationChecksum(), info.GetLocationChecksum());
- for (uint16_t type_idx : info.GetClasses()) {
+ for (dex::TypeIndex type_idx : info.GetClasses()) {
const DexFile::TypeId& type_id = dex_file->GetTypeId(type_idx);
const char* descriptor = dex_file->GetTypeDescriptor(type_id);
ret.insert(descriptor);
diff --git a/runtime/class_linker.h b/runtime/class_linker.h
index 1d29e31..9b25303 100644
--- a/runtime/class_linker.h
+++ b/runtime/class_linker.h
@@ -32,6 +32,7 @@
#include "class_table.h"
#include "dex_cache_resolved_classes.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "gc_root.h"
#include "jni.h"
#include "mirror/class.h"
@@ -139,12 +140,12 @@
bool InitWithoutImage(std::vector<std::unique_ptr<const DexFile>> boot_class_path,
std::string* error_msg)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
// Initialize class linker from one or more boot images.
bool InitFromBootImage(std::string* error_msg)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
// Add an image space to the class linker, may fix up classloader fields and dex cache fields.
// The dex files that were newly opened for the space are placed in the out argument
@@ -157,13 +158,13 @@
const char* dex_location,
std::vector<std::unique_ptr<const DexFile>>* out_dex_files,
std::string* error_msg)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
bool OpenImageDexFiles(gc::space::ImageSpace* space,
std::vector<std::unique_ptr<const DexFile>>* out_dex_files,
std::string* error_msg)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
// Finds a class by its descriptor, loading it if necessary.
@@ -172,18 +173,18 @@
const char* descriptor,
Handle<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
// Finds a class by its descriptor using the "system" class loader, ie by searching the
// boot_class_path_.
mirror::Class* FindSystemClass(Thread* self, const char* descriptor)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
// Finds the array class given for the element class.
mirror::Class* FindArrayClass(Thread* self, ObjPtr<mirror::Class>* element_class)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
// Returns true if the class linker is initialized.
bool IsInitialized() const {
@@ -198,7 +199,7 @@
const DexFile& dex_file,
const DexFile::ClassDef& dex_class_def)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
// Finds a class by its descriptor, returning null if it isn't wasn't loaded
// by the given 'class_loader'.
@@ -217,16 +218,6 @@
mirror::Class* FindPrimitiveClass(char type) REQUIRES_SHARED(Locks::mutator_lock_);
- // General class unloading is not supported, this is used to prune
- // unwanted classes during image writing.
- bool RemoveClass(const char* descriptor, ObjPtr<mirror::ClassLoader> class_loader)
- REQUIRES(!Locks::classlinker_classes_lock_)
- REQUIRES_SHARED(Locks::mutator_lock_);
-
- void DumpAllClasses(int flags)
- REQUIRES(!Locks::classlinker_classes_lock_)
- REQUIRES_SHARED(Locks::mutator_lock_);
-
void DumpForSigQuit(std::ostream& os) REQUIRES(!Locks::classlinker_classes_lock_);
size_t NumLoadedClasses()
@@ -236,18 +227,20 @@
// Resolve a String with the given index from the DexFile, storing the
// result in the DexCache. The referrer is used to identify the
// target DexCache and ClassLoader to use for resolution.
- mirror::String* ResolveString(uint32_t string_idx, ArtMethod* referrer)
+ mirror::String* ResolveString(dex::StringIndex string_idx, ArtMethod* referrer)
REQUIRES_SHARED(Locks::mutator_lock_);
// Resolve a String with the given index from the DexFile, storing the
// result in the DexCache.
- mirror::String* ResolveString(const DexFile& dex_file, uint32_t string_idx,
+ mirror::String* ResolveString(const DexFile& dex_file,
+ dex::StringIndex string_idx,
Handle<mirror::DexCache> dex_cache)
REQUIRES_SHARED(Locks::mutator_lock_);
// Find a String with the given index from the DexFile, storing the
// result in the DexCache if found. Return null if not found.
- mirror::String* LookupString(const DexFile& dex_file, uint32_t string_idx,
+ mirror::String* LookupString(const DexFile& dex_file,
+ dex::StringIndex string_idx,
Handle<mirror::DexCache> dex_cache)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -255,26 +248,26 @@
// result in the DexCache. The referrer is used to identify the
// target DexCache and ClassLoader to use for resolution.
mirror::Class* ResolveType(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
ObjPtr<mirror::Class> referrer)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
// Resolve a Type with the given index from the DexFile, storing the
// result in the DexCache. The referrer is used to identify the
// target DexCache and ClassLoader to use for resolution.
- mirror::Class* ResolveType(uint16_t type_idx, ArtMethod* referrer)
+ mirror::Class* ResolveType(dex::TypeIndex type_idx, ArtMethod* referrer)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
- mirror::Class* ResolveType(uint16_t type_idx, ArtField* referrer)
+ mirror::Class* ResolveType(dex::TypeIndex type_idx, ArtField* referrer)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
// Look up a resolved type with the given ID from the DexFile. The ClassLoader is used to search
// for the type, since it may be referenced from but not contained within the given DexFile.
ObjPtr<mirror::Class> LookupResolvedType(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
ObjPtr<mirror::DexCache> dex_cache,
ObjPtr<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -284,11 +277,11 @@
// type, since it may be referenced from but not contained within
// the given DexFile.
mirror::Class* ResolveType(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
// Determine whether a dex cache result should be trusted, or an IncompatibleClassChangeError
// check should be performed even after a hit.
@@ -310,7 +303,7 @@
ArtMethod* referrer,
InvokeType type)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
ArtMethod* GetResolvedMethod(uint32_t method_idx, ArtMethod* referrer)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -322,17 +315,17 @@
Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
template <ResolveMode kResolveMode>
ArtMethod* ResolveMethod(Thread* self, uint32_t method_idx, ArtMethod* referrer, InvokeType type)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
ArtMethod* ResolveMethodWithoutInvokeType(const DexFile& dex_file,
uint32_t method_idx,
Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
ArtField* GetResolvedField(uint32_t field_idx, ObjPtr<mirror::Class> field_declaring_class)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -340,7 +333,7 @@
REQUIRES_SHARED(Locks::mutator_lock_);
ArtField* ResolveField(uint32_t field_idx, ArtMethod* referrer, bool is_static)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
// Resolve a field with a given ID from the DexFile, storing the
// result in DexCache. The ClassLinker and ClassLoader are used as
@@ -351,7 +344,7 @@
Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader, bool is_static)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
// Resolve a field with a given ID from the DexFile, storing the
// result in DexCache. The ClassLinker and ClassLoader are used as
@@ -362,7 +355,7 @@
Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
// Resolve a method type with a given ID from the DexFile, storing
// the result in the DexCache.
@@ -371,11 +364,7 @@
Handle<mirror::DexCache> dex_cache,
Handle<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
-
- // Get shorty from method index without resolution. Used to do handlerization.
- const char* MethodShorty(uint32_t method_idx, ArtMethod* referrer, uint32_t* length)
- REQUIRES_SHARED(Locks::mutator_lock_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
// Returns true on success, false if there's an exception pending.
// can_run_clinit=false allows the compiler to attempt to init a class,
@@ -385,20 +374,20 @@
bool can_init_fields,
bool can_init_parents)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
// Initializes classes that have instances in the image but that have
// <clinit> methods so they could not be initialized by the compiler.
void RunRootClinits()
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
mirror::DexCache* RegisterDexFile(const DexFile& dex_file,
ObjPtr<mirror::ClassLoader> class_loader)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
void RegisterDexFile(const DexFile& dex_file, Handle<mirror::DexCache> dex_cache)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
const std::vector<const DexFile*>& GetBootClassPath() {
@@ -415,22 +404,22 @@
// can race with insertion and deletion of classes while the visitor is being called.
void VisitClassesWithoutClassesLock(ClassVisitor* visitor)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
void VisitClassRoots(RootVisitor* visitor, VisitRootFlags flags)
REQUIRES(!Locks::classlinker_classes_lock_, !Locks::trace_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
void VisitRoots(RootVisitor* visitor, VisitRootFlags flags)
- REQUIRES(!dex_lock_, !Locks::classlinker_classes_lock_, !Locks::trace_lock_)
+ REQUIRES(!Locks::dex_lock_, !Locks::classlinker_classes_lock_, !Locks::trace_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
mirror::DexCache* FindDexCache(Thread* self,
const DexFile& dex_file,
bool allow_failure = false)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
void FixupDexCaches(ArtMethod* resolution_method)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
// Allocate an instance of a java.lang.Object.
@@ -478,18 +467,18 @@
Handle<mirror::Class> klass,
verifier::HardFailLogMode log_level = verifier::HardFailLogMode::kLogNone)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
bool VerifyClassUsingOatFile(const DexFile& dex_file,
ObjPtr<mirror::Class> klass,
mirror::Class::Status& oat_file_class_status)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
void ResolveClassExceptionHandlerTypes(Handle<mirror::Class> klass)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
void ResolveMethodExceptionHandlerTypes(ArtMethod* klass)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
mirror::Class* CreateProxyClass(ScopedObjectAccessAlreadyRunnable& soa,
jstring name,
@@ -502,7 +491,7 @@
REQUIRES_SHARED(Locks::mutator_lock_);
template<ReadBarrierOption kReadBarrierOption = kWithReadBarrier>
ArtMethod* FindMethodForProxy(ObjPtr<mirror::Class> proxy_class, ArtMethod* proxy_method)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
// Get the oat code for a method when its class isn't yet initialized.
@@ -565,7 +554,7 @@
// Note: the objects are not completely set up. Do not use this outside of tests and the compiler.
jobject CreatePathClassLoader(Thread* self, const std::vector<const DexFile*>& dex_files)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
PointerSize GetImagePointerSize() const {
return image_pointer_size_;
@@ -576,8 +565,6 @@
REQUIRES(Locks::classlinker_classes_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
- ArtMethod* CreateRuntimeMethod(LinearAlloc* linear_alloc);
-
// Clear the ArrayClass cache. This is necessary when cleaning up for the image, as the cache
// entries are roots, but potentially not image classes.
void DropFindArrayClassCache() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -608,11 +595,11 @@
REQUIRES_SHARED(Locks::mutator_lock_);
std::set<DexCacheResolvedClasses> GetResolvedClasses(bool ignore_boot_classes)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
std::unordered_set<std::string> GetClassDescriptorsForProfileKeys(
const std::set<DexCacheResolvedClasses>& classes)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
static bool IsBootClassLoader(ScopedObjectAccessAlreadyRunnable& soa,
ObjPtr<mirror::ClassLoader> class_loader)
@@ -647,7 +634,7 @@
// class.
void ThrowEarlierClassFailure(ObjPtr<mirror::Class> c, bool wrap_in_no_class_def = false)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
// Get the actual holding class for a copied method. Pretty slow, don't call often.
mirror::Class* GetHoldingClassOfCopiedMethod(ArtMethod* method)
@@ -677,7 +664,7 @@
bool AttemptSupertypeVerification(Thread* self,
Handle<mirror::Class> klass,
Handle<mirror::Class> supertype)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
static void DeleteClassLoader(Thread* self, const ClassLoaderData& data)
@@ -701,7 +688,7 @@
void FinishInit(Thread* self)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
// For early bootstrapping by Init
mirror::Class* AllocClass(Thread* self,
@@ -728,17 +715,9 @@
const DexFile& dex_file,
LinearAlloc* linear_alloc)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES(!Roles::uninterruptible_);
- void InitializeDexCache(Thread* self,
- ObjPtr<mirror::DexCache> dex_cache,
- ObjPtr<mirror::String> location,
- const DexFile& dex_file,
- LinearAlloc* linear_alloc)
- REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(dex_lock_);
-
mirror::Class* CreatePrimitiveClass(Thread* self, Primitive::Type type)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Roles::uninterruptible_);
@@ -752,14 +731,14 @@
size_t hash,
Handle<mirror::ClassLoader> class_loader)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_, !Roles::uninterruptible_);
+ REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
void AppendToBootClassPath(Thread* self, const DexFile& dex_file)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
void AppendToBootClassPath(const DexFile& dex_file, Handle<mirror::DexCache> dex_cache)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
// Precomputes size needed for Class, in the case of a non-temporary class this size must be
// sufficient to hold all static fields.
@@ -807,7 +786,7 @@
Handle<mirror::ClassLoader> class_loader,
ObjPtr<mirror::Class>* result)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
// Finds a class by its descriptor, returning NULL if it isn't wasn't loaded
// by the given 'class_loader'. Uses the provided hash for the descriptor.
@@ -819,10 +798,10 @@
REQUIRES_SHARED(Locks::mutator_lock_);
void RegisterDexFileLocked(const DexFile& dex_file, Handle<mirror::DexCache> dex_cache)
- REQUIRES(dex_lock_)
+ REQUIRES(Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
mirror::DexCache* FindDexCacheLocked(Thread* self, const DexFile& dex_file, bool allow_failure)
- REQUIRES(dex_lock_)
+ REQUIRES(Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
bool InitializeClass(Thread* self,
@@ -830,12 +809,12 @@
bool can_run_clinit,
bool can_init_parents)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
bool InitializeDefaultInterfaceRecursive(Thread* self,
Handle<mirror::Class> klass,
bool can_run_clinit,
bool can_init_parents)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
bool WaitForInitializeClass(Handle<mirror::Class> klass,
Thread* self,
@@ -868,7 +847,7 @@
bool LoadSuperAndInterfaces(Handle<mirror::Class> klass, const DexFile& dex_file)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
bool LinkMethods(Thread* self,
Handle<mirror::Class> klass,
@@ -1034,17 +1013,11 @@
void CheckProxyMethod(ArtMethod* method, ArtMethod* prototype) const
REQUIRES_SHARED(Locks::mutator_lock_);
- // For use by ImageWriter to find DexCaches for its roots
- ReaderWriterMutex* DexLock()
- REQUIRES_SHARED(Locks::mutator_lock_)
- LOCK_RETURNED(dex_lock_) {
- return &dex_lock_;
- }
- size_t GetDexCacheCount() REQUIRES_SHARED(Locks::mutator_lock_, dex_lock_) {
+ size_t GetDexCacheCount() REQUIRES_SHARED(Locks::mutator_lock_, Locks::dex_lock_) {
return dex_caches_.size();
}
const std::list<DexCacheData>& GetDexCachesData()
- REQUIRES_SHARED(Locks::mutator_lock_, dex_lock_) {
+ REQUIRES_SHARED(Locks::mutator_lock_, Locks::dex_lock_) {
return dex_caches_;
}
@@ -1053,12 +1026,6 @@
void CreateProxyMethod(Handle<mirror::Class> klass, ArtMethod* prototype, ArtMethod* out)
REQUIRES_SHARED(Locks::mutator_lock_);
- // Ensures that methods have the kAccSkipAccessChecks bit set. We use the
- // kAccVerificationAttempted bit on the class access flags to determine whether this has been done
- // before.
- void EnsureSkipAccessChecksMethods(Handle<mirror::Class> c)
- REQUIRES_SHARED(Locks::mutator_lock_);
-
// Register a class loader and create its class table and allocator. Should not be called if
// these are already created.
void RegisterClassLoader(ObjPtr<mirror::ClassLoader> class_loader)
@@ -1083,7 +1050,7 @@
mirror::Class* EnsureResolved(Thread* self, const char* descriptor, ObjPtr<mirror::Class> klass)
WARN_UNUSED
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!dex_lock_);
+ REQUIRES(!Locks::dex_lock_);
void FixupTemporaryDeclaringClass(ObjPtr<mirror::Class> temp_class,
ObjPtr<mirror::Class> new_class)
@@ -1114,12 +1081,12 @@
ClassTable::ClassSet* new_class_set,
bool* out_forward_dex_cache_array,
std::string* out_error_msg)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
// Check that c1 == FindSystemClass(self, descriptor). Abort with class dumps otherwise.
void CheckSystemClass(Thread* self, Handle<mirror::Class> c1, const char* descriptor)
- REQUIRES(!dex_lock_)
+ REQUIRES(!Locks::dex_lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
// Sets imt_ref appropriately for LinkInterfaceMethods.
@@ -1150,10 +1117,9 @@
std::vector<const DexFile*> boot_class_path_;
std::vector<std::unique_ptr<const DexFile>> boot_dex_files_;
- mutable ReaderWriterMutex dex_lock_ DEFAULT_MUTEX_ACQUIRED_AFTER;
// JNI weak globals and side data to allow dex caches to get unloaded. We lazily delete weak
// globals when we register new dex files.
- std::list<DexCacheData> dex_caches_ GUARDED_BY(dex_lock_);
+ std::list<DexCacheData> dex_caches_ GUARDED_BY(Locks::dex_lock_);
// This contains the class loaders which have class tables. It is populated by
// InsertClassTableForClassLoader.
diff --git a/runtime/class_linker_test.cc b/runtime/class_linker_test.cc
index 44590ba..42108d8 100644
--- a/runtime/class_linker_test.cc
+++ b/runtime/class_linker_test.cc
@@ -19,12 +19,15 @@
#include <memory>
#include <string>
+#include "android-base/strings.h"
+
#include "art_field-inl.h"
#include "art_method-inl.h"
#include "base/enums.h"
#include "class_linker-inl.h"
#include "common_runtime_test.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "experimental_flags.h"
#include "entrypoints/entrypoint_utils-inl.h"
#include "gc/heap.h"
@@ -214,10 +217,12 @@
EXPECT_TRUE(array->ShouldHaveEmbeddedVTable());
EXPECT_EQ(2, array->GetIfTableCount());
ASSERT_TRUE(array->GetIfTable() != nullptr);
- ObjPtr<mirror::Class> direct_interface0 = mirror::Class::GetDirectInterface(self, array, 0);
+ ObjPtr<mirror::Class> direct_interface0 =
+ mirror::Class::GetDirectInterface(self, array.Get(), 0);
EXPECT_TRUE(direct_interface0 != nullptr);
EXPECT_STREQ(direct_interface0->GetDescriptor(&temp), "Ljava/lang/Cloneable;");
- ObjPtr<mirror::Class> direct_interface1 = mirror::Class::GetDirectInterface(self, array, 1);
+ ObjPtr<mirror::Class> direct_interface1 =
+ mirror::Class::GetDirectInterface(self, array.Get(), 1);
EXPECT_STREQ(direct_interface1->GetDescriptor(&temp), "Ljava/io/Serializable;");
ObjPtr<mirror::Class> array_ptr = array->GetComponentType();
EXPECT_OBJ_PTR_EQ(class_linker_->FindArrayClass(self, &array_ptr), array.Get());
@@ -273,8 +278,6 @@
EXPECT_FALSE(klass->IsArrayClass());
EXPECT_TRUE(klass->GetComponentType() == nullptr);
EXPECT_TRUE(klass->IsInSamePackage(klass.Get()));
- EXPECT_TRUE(klass->GetDexCacheStrings() != nullptr);
- EXPECT_EQ(klass->GetDexCacheStrings(), klass->GetDexCache()->GetStrings());
std::string temp2;
EXPECT_TRUE(mirror::Class::IsInSamePackage(klass->GetDescriptor(&temp),
klass->GetDescriptor(&temp2)));
@@ -429,7 +432,7 @@
}
// Verify all the types referenced by this file
for (size_t i = 0; i < dex.NumTypeIds(); i++) {
- const DexFile::TypeId& type_id = dex.GetTypeId(i);
+ const DexFile::TypeId& type_id = dex.GetTypeId(dex::TypeIndex(i));
const char* descriptor = dex.GetTypeDescriptor(type_id);
AssertDexFileClass(class_loader, descriptor);
}
@@ -585,7 +588,6 @@
addOffset(OFFSETOF_MEMBER(mirror::Class, component_type_), "componentType");
addOffset(OFFSETOF_MEMBER(mirror::Class, copied_methods_offset_), "copiedMethodsOffset");
addOffset(OFFSETOF_MEMBER(mirror::Class, dex_cache_), "dexCache");
- addOffset(OFFSETOF_MEMBER(mirror::Class, dex_cache_strings_), "dexCacheStrings");
addOffset(OFFSETOF_MEMBER(mirror::Class, dex_class_def_idx_), "dexClassDefIndex");
addOffset(OFFSETOF_MEMBER(mirror::Class, dex_type_idx_), "dexTypeIndex");
addOffset(OFFSETOF_MEMBER(mirror::Class, ext_data_), "extData");
@@ -613,6 +615,9 @@
struct ClassExtOffsets : public CheckOffsets<mirror::ClassExt> {
ClassExtOffsets() : CheckOffsets<mirror::ClassExt>(false, "Ldalvik/system/ClassExt;") {
+ addOffset(OFFSETOF_MEMBER(mirror::ClassExt, obsolete_dex_caches_), "obsoleteDexCaches");
+ addOffset(OFFSETOF_MEMBER(mirror::ClassExt, obsolete_methods_), "obsoleteMethods");
+ addOffset(OFFSETOF_MEMBER(mirror::ClassExt, original_dex_cache_), "originalDexCache");
addOffset(OFFSETOF_MEMBER(mirror::ClassExt, verify_error_), "verifyError");
}
};
@@ -794,12 +799,12 @@
jobject jclass_loader = LoadDex("Nested");
std::vector<const DexFile*> dex_files(GetDexFiles(jclass_loader));
ASSERT_EQ(dex_files.size(), 1U);
- EXPECT_TRUE(EndsWith(dex_files[0]->GetLocation(), "Nested.jar"));
+ EXPECT_TRUE(android::base::EndsWith(dex_files[0]->GetLocation(), "Nested.jar"));
jobject jclass_loader2 = LoadDex("MultiDex");
std::vector<const DexFile*> dex_files2(GetDexFiles(jclass_loader2));
ASSERT_EQ(dex_files2.size(), 2U);
- EXPECT_TRUE(EndsWith(dex_files2[0]->GetLocation(), "MultiDex.jar"));
+ EXPECT_TRUE(android::base::EndsWith(dex_files2[0]->GetLocation(), "MultiDex.jar"));
}
TEST_F(ClassLinkerTest, FindClassNested) {
@@ -891,7 +896,7 @@
hs.NewHandle(soa.Decode<mirror::ClassLoader>(LoadDex("MyClass"))));
AssertNonExistentClass("LMyClass;");
ObjPtr<mirror::Class> klass = class_linker_->FindClass(soa.Self(), "LMyClass;", class_loader);
- uint32_t type_idx = klass->GetClassDef()->class_idx_;
+ dex::TypeIndex type_idx = klass->GetClassDef()->class_idx_;
ObjPtr<mirror::DexCache> dex_cache = klass->GetDexCache();
const DexFile& dex_file = klass->GetDexFile();
EXPECT_OBJ_PTR_EQ(dex_cache->GetResolvedType(type_idx), klass);
@@ -1015,48 +1020,48 @@
EXPECT_EQ(9U, statics->NumStaticFields());
- ArtField* s0 = mirror::Class::FindStaticField(soa.Self(), statics, "s0", "Z");
+ ArtField* s0 = mirror::Class::FindStaticField(soa.Self(), statics.Get(), "s0", "Z");
EXPECT_EQ(s0->GetTypeAsPrimitiveType(), Primitive::kPrimBoolean);
EXPECT_EQ(true, s0->GetBoolean(statics.Get()));
s0->SetBoolean<false>(statics.Get(), false);
- ArtField* s1 = mirror::Class::FindStaticField(soa.Self(), statics, "s1", "B");
+ ArtField* s1 = mirror::Class::FindStaticField(soa.Self(), statics.Get(), "s1", "B");
EXPECT_EQ(s1->GetTypeAsPrimitiveType(), Primitive::kPrimByte);
EXPECT_EQ(5, s1->GetByte(statics.Get()));
s1->SetByte<false>(statics.Get(), 6);
- ArtField* s2 = mirror::Class::FindStaticField(soa.Self(), statics, "s2", "C");
+ ArtField* s2 = mirror::Class::FindStaticField(soa.Self(), statics.Get(), "s2", "C");
EXPECT_EQ(s2->GetTypeAsPrimitiveType(), Primitive::kPrimChar);
EXPECT_EQ('a', s2->GetChar(statics.Get()));
s2->SetChar<false>(statics.Get(), 'b');
- ArtField* s3 = mirror::Class::FindStaticField(soa.Self(), statics, "s3", "S");
+ ArtField* s3 = mirror::Class::FindStaticField(soa.Self(), statics.Get(), "s3", "S");
EXPECT_EQ(s3->GetTypeAsPrimitiveType(), Primitive::kPrimShort);
EXPECT_EQ(-536, s3->GetShort(statics.Get()));
s3->SetShort<false>(statics.Get(), -535);
- ArtField* s4 = mirror::Class::FindStaticField(soa.Self(), statics, "s4", "I");
+ ArtField* s4 = mirror::Class::FindStaticField(soa.Self(), statics.Get(), "s4", "I");
EXPECT_EQ(s4->GetTypeAsPrimitiveType(), Primitive::kPrimInt);
EXPECT_EQ(2000000000, s4->GetInt(statics.Get()));
s4->SetInt<false>(statics.Get(), 2000000001);
- ArtField* s5 = mirror::Class::FindStaticField(soa.Self(), statics, "s5", "J");
+ ArtField* s5 = mirror::Class::FindStaticField(soa.Self(), statics.Get(), "s5", "J");
EXPECT_EQ(s5->GetTypeAsPrimitiveType(), Primitive::kPrimLong);
EXPECT_EQ(0x1234567890abcdefLL, s5->GetLong(statics.Get()));
s5->SetLong<false>(statics.Get(), INT64_C(0x34567890abcdef12));
- ArtField* s6 = mirror::Class::FindStaticField(soa.Self(), statics, "s6", "F");
+ ArtField* s6 = mirror::Class::FindStaticField(soa.Self(), statics.Get(), "s6", "F");
EXPECT_EQ(s6->GetTypeAsPrimitiveType(), Primitive::kPrimFloat);
EXPECT_DOUBLE_EQ(0.5, s6->GetFloat(statics.Get()));
s6->SetFloat<false>(statics.Get(), 0.75);
- ArtField* s7 = mirror::Class::FindStaticField(soa.Self(), statics, "s7", "D");
+ ArtField* s7 = mirror::Class::FindStaticField(soa.Self(), statics.Get(), "s7", "D");
EXPECT_EQ(s7->GetTypeAsPrimitiveType(), Primitive::kPrimDouble);
EXPECT_DOUBLE_EQ(16777217.0, s7->GetDouble(statics.Get()));
s7->SetDouble<false>(statics.Get(), 16777219);
- ArtField* s8 = mirror::Class::FindStaticField(soa.Self(), statics, "s8",
- "Ljava/lang/String;");
+ ArtField* s8 = mirror::Class::FindStaticField(
+ soa.Self(), statics.Get(), "s8", "Ljava/lang/String;");
EXPECT_EQ(s8->GetTypeAsPrimitiveType(), Primitive::kPrimNot);
EXPECT_TRUE(s8->GetObject(statics.Get())->AsString()->Equals("android"));
mirror::String* str_value = mirror::String::AllocFromModifiedUtf8(soa.Self(), "robot");
@@ -1127,10 +1132,14 @@
EXPECT_EQ(Aj1, A->FindVirtualMethodForVirtualOrInterface(Jj1, kRuntimePointerSize));
EXPECT_EQ(Aj2, A->FindVirtualMethodForVirtualOrInterface(Jj2, kRuntimePointerSize));
- ArtField* Afoo = mirror::Class::FindStaticField(soa.Self(), A, "foo", "Ljava/lang/String;");
- ArtField* Bfoo = mirror::Class::FindStaticField(soa.Self(), B, "foo", "Ljava/lang/String;");
- ArtField* Jfoo = mirror::Class::FindStaticField(soa.Self(), J, "foo", "Ljava/lang/String;");
- ArtField* Kfoo = mirror::Class::FindStaticField(soa.Self(), K, "foo", "Ljava/lang/String;");
+ ArtField* Afoo =
+ mirror::Class::FindStaticField(soa.Self(), A.Get(), "foo", "Ljava/lang/String;");
+ ArtField* Bfoo =
+ mirror::Class::FindStaticField(soa.Self(), B.Get(), "foo", "Ljava/lang/String;");
+ ArtField* Jfoo =
+ mirror::Class::FindStaticField(soa.Self(), J.Get(), "foo", "Ljava/lang/String;");
+ ArtField* Kfoo =
+ mirror::Class::FindStaticField(soa.Self(), K.Get(), "foo", "Ljava/lang/String;");
ASSERT_TRUE(Afoo != nullptr);
EXPECT_EQ(Afoo, Bfoo);
EXPECT_EQ(Afoo, Jfoo);
@@ -1154,7 +1163,7 @@
ArtMethod* getS0 = klass->FindDirectMethod("getS0", "()Ljava/lang/Object;", kRuntimePointerSize);
const DexFile::TypeId* type_id = dex_file->FindTypeId("LStaticsFromCode;");
ASSERT_TRUE(type_id != nullptr);
- uint32_t type_idx = dex_file->GetIndexForTypeId(*type_id);
+ dex::TypeIndex type_idx = dex_file->GetIndexForTypeId(*type_id);
mirror::Class* uninit = ResolveVerifyAndClinit(type_idx, clinit, soa.Self(), true, false);
EXPECT_TRUE(uninit != nullptr);
EXPECT_FALSE(uninit->IsInitialized());
@@ -1163,6 +1172,24 @@
EXPECT_TRUE(init->IsInitialized());
}
+TEST_F(ClassLinkerTest, ErroneousClass) {
+ ScopedObjectAccess soa(Thread::Current());
+ jobject jclass_loader = LoadMultiDex("ErroneousA", "ErroneousB");
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ClassLoader> class_loader(
+ hs.NewHandle(soa.Decode<mirror::ClassLoader>(jclass_loader)));
+ hs.Self()->AssertNoPendingException();
+ const char* descriptor = "LErroneous;";
+ ObjPtr<mirror::Class> klass = class_linker_->FindClass(soa.Self(), descriptor, class_loader);
+ // Erronenous since we are extending final class.
+ hs.Self()->AssertPendingException();
+ EXPECT_TRUE(klass == nullptr);
+ klass = class_linker_->LookupClass(soa.Self(), descriptor, class_loader.Get());
+ EXPECT_FALSE(klass == nullptr);
+ EXPECT_TRUE(klass->IsErroneous());
+ EXPECT_TRUE(klass->GetIfTable() != nullptr);
+}
+
TEST_F(ClassLinkerTest, FinalizableBit) {
ScopedObjectAccess soa(Thread::Current());
mirror::Class* c;
@@ -1315,7 +1342,7 @@
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
MutableHandle<mirror::DexCache> dex_cache(hs.NewHandle<mirror::DexCache>(nullptr));
{
- ReaderMutexLock mu(soa.Self(), *class_linker->DexLock());
+ ReaderMutexLock mu(soa.Self(), *Locks::dex_lock_);
for (const ClassLinker::DexCacheData& data : class_linker->GetDexCachesData()) {
dex_cache.Assign(soa.Self()->DecodeJObject(data.weak_root)->AsDexCache());
if (dex_cache.Get() != nullptr) {
@@ -1339,7 +1366,7 @@
0u,
nullptr));
{
- WriterMutexLock mu(soa.Self(), *class_linker->DexLock());
+ WriterMutexLock mu(soa.Self(), *Locks::dex_lock_);
// Check that inserting with a UTF16 name works.
class_linker->RegisterDexFileLocked(*dex_file, dex_cache);
}
diff --git a/runtime/class_table-inl.h b/runtime/class_table-inl.h
index 3e54a64..dfe8949 100644
--- a/runtime/class_table-inl.h
+++ b/runtime/class_table-inl.h
@@ -26,8 +26,8 @@
void ClassTable::VisitRoots(Visitor& visitor) {
ReaderMutexLock mu(Thread::Current(), lock_);
for (ClassSet& class_set : classes_) {
- for (GcRoot<mirror::Class>& root : class_set) {
- visitor.VisitRoot(root.AddressWithoutBarrier());
+ for (TableSlot& table_slot : class_set) {
+ table_slot.VisitRoot(visitor);
}
}
for (GcRoot<mirror::Object>& root : strong_roots_) {
@@ -44,8 +44,8 @@
void ClassTable::VisitRoots(const Visitor& visitor) {
ReaderMutexLock mu(Thread::Current(), lock_);
for (ClassSet& class_set : classes_) {
- for (GcRoot<mirror::Class>& root : class_set) {
- visitor.VisitRoot(root.AddressWithoutBarrier());
+ for (TableSlot& table_slot : class_set) {
+ table_slot.VisitRoot(visitor);
}
}
for (GcRoot<mirror::Object>& root : strong_roots_) {
@@ -62,8 +62,8 @@
bool ClassTable::Visit(Visitor& visitor) {
ReaderMutexLock mu(Thread::Current(), lock_);
for (ClassSet& class_set : classes_) {
- for (GcRoot<mirror::Class>& root : class_set) {
- if (!visitor(root.Read())) {
+ for (TableSlot& table_slot : class_set) {
+ if (!visitor(table_slot.Read())) {
return false;
}
}
@@ -71,6 +71,64 @@
return true;
}
+template <typename Visitor>
+bool ClassTable::Visit(const Visitor& visitor) {
+ ReaderMutexLock mu(Thread::Current(), lock_);
+ for (ClassSet& class_set : classes_) {
+ for (TableSlot& table_slot : class_set) {
+ if (!visitor(table_slot.Read())) {
+ return false;
+ }
+ }
+ }
+ return true;
+}
+
+template<ReadBarrierOption kReadBarrierOption>
+inline mirror::Class* ClassTable::TableSlot::Read() const {
+ const uint32_t before = data_.LoadRelaxed();
+ ObjPtr<mirror::Class> const before_ptr(ExtractPtr(before));
+ ObjPtr<mirror::Class> const after_ptr(
+ GcRoot<mirror::Class>(before_ptr).Read<kReadBarrierOption>());
+ if (kReadBarrierOption != kWithoutReadBarrier && before_ptr != after_ptr) {
+ // If another thread raced and updated the reference, do not store the read barrier updated
+ // one.
+ data_.CompareExchangeStrongRelaxed(before, Encode(after_ptr, MaskHash(before)));
+ }
+ return after_ptr.Ptr();
+}
+
+template<typename Visitor>
+inline void ClassTable::TableSlot::VisitRoot(const Visitor& visitor) const {
+ const uint32_t before = data_.LoadRelaxed();
+ ObjPtr<mirror::Class> before_ptr(ExtractPtr(before));
+ GcRoot<mirror::Class> root(before_ptr);
+ visitor.VisitRoot(root.AddressWithoutBarrier());
+ ObjPtr<mirror::Class> after_ptr(root.Read<kWithoutReadBarrier>());
+ if (before_ptr != after_ptr) {
+ // If another thread raced and updated the reference, do not store the read barrier updated
+ // one.
+ data_.CompareExchangeStrongRelaxed(before, Encode(after_ptr, MaskHash(before)));
+ }
+}
+
+inline ObjPtr<mirror::Class> ClassTable::TableSlot::ExtractPtr(uint32_t data) {
+ return reinterpret_cast<mirror::Class*>(data & ~kHashMask);
+}
+
+inline uint32_t ClassTable::TableSlot::Encode(ObjPtr<mirror::Class> klass, uint32_t hash_bits) {
+ DCHECK_LE(hash_bits, kHashMask);
+ return reinterpret_cast<uintptr_t>(klass.Ptr()) | hash_bits;
+}
+
+inline ClassTable::TableSlot::TableSlot(ObjPtr<mirror::Class> klass, uint32_t descriptor_hash)
+ : data_(Encode(klass, MaskHash(descriptor_hash))) {
+ if (kIsDebugBuild) {
+ std::string temp;
+ const uint32_t hash = ComputeModifiedUtf8Hash(klass->GetDescriptor(&temp));
+ CHECK_EQ(descriptor_hash, hash);
+ }
+}
} // namespace art
diff --git a/runtime/class_table.cc b/runtime/class_table.cc
index b44104e..0f985c6 100644
--- a/runtime/class_table.cc
+++ b/runtime/class_table.cc
@@ -33,8 +33,9 @@
bool ClassTable::Contains(ObjPtr<mirror::Class> klass) {
ReaderMutexLock mu(Thread::Current(), lock_);
+ TableSlot slot(klass);
for (ClassSet& class_set : classes_) {
- auto it = class_set.Find(GcRoot<mirror::Class>(klass));
+ auto it = class_set.Find(slot);
if (it != class_set.end()) {
return it->Read() == klass;
}
@@ -44,8 +45,9 @@
mirror::Class* ClassTable::LookupByDescriptor(ObjPtr<mirror::Class> klass) {
ReaderMutexLock mu(Thread::Current(), lock_);
+ TableSlot slot(klass);
for (ClassSet& class_set : classes_) {
- auto it = class_set.Find(GcRoot<mirror::Class>(klass));
+ auto it = class_set.Find(slot);
if (it != class_set.end()) {
return it->Read();
}
@@ -60,10 +62,11 @@
mirror::Class* ClassTable::UpdateClass(const char* descriptor, mirror::Class* klass, size_t hash) {
WriterMutexLock mu(Thread::Current(), lock_);
// Should only be updating latest table.
- auto existing_it = classes_.back().FindWithHash(descriptor, hash);
+ DescriptorHashPair pair(descriptor, hash);
+ auto existing_it = classes_.back().FindWithHash(pair, hash);
if (kIsDebugBuild && existing_it == classes_.back().end()) {
for (const ClassSet& class_set : classes_) {
- if (class_set.FindWithHash(descriptor, hash) != class_set.end()) {
+ if (class_set.FindWithHash(pair, hash) != class_set.end()) {
LOG(FATAL) << "Updating class found in frozen table " << descriptor;
}
}
@@ -77,55 +80,70 @@
VerifyObject(klass);
// Update the element in the hash set with the new class. This is safe to do since the descriptor
// doesn't change.
- *existing_it = GcRoot<mirror::Class>(klass);
+ *existing_it = TableSlot(klass, hash);
return existing;
}
#pragma clang diagnostic pop // http://b/31104323
-size_t ClassTable::NumZygoteClasses() const {
+size_t ClassTable::CountDefiningLoaderClasses(ObjPtr<mirror::ClassLoader> defining_loader,
+ const ClassSet& set) const {
+ size_t count = 0;
+ for (const TableSlot& root : set) {
+ if (root.Read()->GetClassLoader() == defining_loader) {
+ ++count;
+ }
+ }
+ return count;
+}
+
+size_t ClassTable::NumZygoteClasses(ObjPtr<mirror::ClassLoader> defining_loader) const {
ReaderMutexLock mu(Thread::Current(), lock_);
size_t sum = 0;
for (size_t i = 0; i < classes_.size() - 1; ++i) {
- sum += classes_[i].Size();
+ sum += CountDefiningLoaderClasses(defining_loader, classes_[i]);
}
return sum;
}
-size_t ClassTable::NumNonZygoteClasses() const {
+size_t ClassTable::NumNonZygoteClasses(ObjPtr<mirror::ClassLoader> defining_loader) const {
ReaderMutexLock mu(Thread::Current(), lock_);
- return classes_.back().Size();
+ return CountDefiningLoaderClasses(defining_loader, classes_.back());
}
mirror::Class* ClassTable::Lookup(const char* descriptor, size_t hash) {
+ DescriptorHashPair pair(descriptor, hash);
ReaderMutexLock mu(Thread::Current(), lock_);
for (ClassSet& class_set : classes_) {
- auto it = class_set.FindWithHash(descriptor, hash);
+ auto it = class_set.FindWithHash(pair, hash);
if (it != class_set.end()) {
- return it->Read();
+ return it->Read();
}
}
return nullptr;
}
void ClassTable::Insert(ObjPtr<mirror::Class> klass) {
+ const uint32_t hash = TableSlot::HashDescriptor(klass);
WriterMutexLock mu(Thread::Current(), lock_);
- classes_.back().Insert(GcRoot<mirror::Class>(klass));
+ classes_.back().InsertWithHash(TableSlot(klass, hash), hash);
}
void ClassTable::InsertWithoutLocks(ObjPtr<mirror::Class> klass) {
- classes_.back().Insert(GcRoot<mirror::Class>(klass));
+ const uint32_t hash = TableSlot::HashDescriptor(klass);
+ classes_.back().InsertWithHash(TableSlot(klass, hash), hash);
}
void ClassTable::InsertWithHash(ObjPtr<mirror::Class> klass, size_t hash) {
WriterMutexLock mu(Thread::Current(), lock_);
- classes_.back().InsertWithHash(GcRoot<mirror::Class>(klass), hash);
+ classes_.back().InsertWithHash(TableSlot(klass, hash), hash);
}
bool ClassTable::Remove(const char* descriptor) {
+ DescriptorHashPair pair(descriptor, ComputeModifiedUtf8Hash(descriptor));
WriterMutexLock mu(Thread::Current(), lock_);
for (ClassSet& class_set : classes_) {
- auto it = class_set.Find(descriptor);
+ auto it = class_set.Find(pair);
if (it != class_set.end()) {
class_set.Erase(it);
return true;
@@ -134,26 +152,34 @@
return false;
}
-uint32_t ClassTable::ClassDescriptorHashEquals::operator()(const GcRoot<mirror::Class>& root)
+uint32_t ClassTable::ClassDescriptorHashEquals::operator()(const TableSlot& slot)
const {
std::string temp;
- return ComputeModifiedUtf8Hash(root.Read()->GetDescriptor(&temp));
+ return ComputeModifiedUtf8Hash(slot.Read()->GetDescriptor(&temp));
}
-bool ClassTable::ClassDescriptorHashEquals::operator()(const GcRoot<mirror::Class>& a,
- const GcRoot<mirror::Class>& b) const {
- DCHECK_EQ(a.Read()->GetClassLoader(), b.Read()->GetClassLoader());
+bool ClassTable::ClassDescriptorHashEquals::operator()(const TableSlot& a,
+ const TableSlot& b) const {
+ if (a.Hash() != b.Hash()) {
+ std::string temp;
+ DCHECK(!a.Read()->DescriptorEquals(b.Read()->GetDescriptor(&temp)));
+ return false;
+ }
std::string temp;
return a.Read()->DescriptorEquals(b.Read()->GetDescriptor(&temp));
}
-bool ClassTable::ClassDescriptorHashEquals::operator()(const GcRoot<mirror::Class>& a,
- const char* descriptor) const {
- return a.Read()->DescriptorEquals(descriptor);
+bool ClassTable::ClassDescriptorHashEquals::operator()(const TableSlot& a,
+ const DescriptorHashPair& b) const {
+ if (!a.MaskedHashEquals(b.second)) {
+ DCHECK(!a.Read()->DescriptorEquals(b.first));
+ return false;
+ }
+ return a.Read()->DescriptorEquals(b.first);
}
-uint32_t ClassTable::ClassDescriptorHashEquals::operator()(const char* descriptor) const {
- return ComputeModifiedUtf8Hash(descriptor);
+uint32_t ClassTable::ClassDescriptorHashEquals::operator()(const DescriptorHashPair& pair) const {
+ return ComputeModifiedUtf8Hash(pair.first);
}
bool ClassTable::InsertStrongRoot(ObjPtr<mirror::Object> obj) {
@@ -170,7 +196,7 @@
const DexFile* dex_file = ObjPtr<mirror::DexCache>::DownCast(obj)->GetDexFile();
if (dex_file != nullptr && dex_file->GetOatDexFile() != nullptr) {
const OatFile* oat_file = dex_file->GetOatDexFile()->GetOatFile();
- if (!oat_file->GetBssGcRoots().empty()) {
+ if (oat_file != nullptr && !oat_file->GetBssGcRoots().empty()) {
InsertOatFileLocked(oat_file); // Ignore return value.
}
}
@@ -197,7 +223,7 @@
// Combine all the class sets in case there are multiple, also adjusts load factor back to
// default in case classes were pruned.
for (const ClassSet& class_set : classes_) {
- for (const GcRoot<mirror::Class>& root : class_set) {
+ for (const TableSlot& root : class_set) {
combined.Insert(root);
}
}
@@ -227,4 +253,13 @@
oat_files_.clear();
strong_roots_.clear();
}
+
+ClassTable::TableSlot::TableSlot(ObjPtr<mirror::Class> klass)
+ : TableSlot(klass, HashDescriptor(klass)) {}
+
+uint32_t ClassTable::TableSlot::HashDescriptor(ObjPtr<mirror::Class> klass) {
+ std::string temp;
+ return ComputeModifiedUtf8Hash(klass->GetDescriptor(&temp));
+}
+
} // namespace art
diff --git a/runtime/class_table.h b/runtime/class_table.h
index 558c144..f27d809 100644
--- a/runtime/class_table.h
+++ b/runtime/class_table.h
@@ -42,33 +42,94 @@
// Each loader has a ClassTable
class ClassTable {
public:
+ class TableSlot {
+ public:
+ TableSlot() : data_(0u) {}
+
+ TableSlot(const TableSlot& copy) : data_(copy.data_.LoadRelaxed()) {}
+
+ explicit TableSlot(ObjPtr<mirror::Class> klass);
+
+ TableSlot(ObjPtr<mirror::Class> klass, uint32_t descriptor_hash);
+
+ TableSlot& operator=(const TableSlot& copy) {
+ data_.StoreRelaxed(copy.data_.LoadRelaxed());
+ return *this;
+ }
+
+ bool IsNull() const REQUIRES_SHARED(Locks::mutator_lock_) {
+ return Read<kWithoutReadBarrier>() == nullptr;
+ }
+
+ uint32_t Hash() const {
+ return MaskHash(data_.LoadRelaxed());
+ }
+
+ static uint32_t MaskHash(uint32_t hash) {
+ return hash & kHashMask;
+ }
+
+ bool MaskedHashEquals(uint32_t other) const {
+ return MaskHash(other) == Hash();
+ }
+
+ static uint32_t HashDescriptor(ObjPtr<mirror::Class> klass)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ template<ReadBarrierOption kReadBarrierOption = kWithReadBarrier>
+ mirror::Class* Read() const REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // NO_THREAD_SAFETY_ANALYSIS since the visitor may require heap bitmap lock.
+ template<typename Visitor>
+ void VisitRoot(const Visitor& visitor) const NO_THREAD_SAFETY_ANALYSIS;
+
+ private:
+ // Extract a raw pointer from an address.
+ static ObjPtr<mirror::Class> ExtractPtr(uint32_t data)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ static uint32_t Encode(ObjPtr<mirror::Class> klass, uint32_t hash_bits)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // Data contains the class pointer GcRoot as well as the low bits of the descriptor hash.
+ mutable Atomic<uint32_t> data_;
+ static const uint32_t kHashMask = kObjectAlignment - 1;
+ };
+
+ using DescriptorHashPair = std::pair<const char*, uint32_t>;
+
class ClassDescriptorHashEquals {
public:
// uint32_t for cross compilation.
- uint32_t operator()(const GcRoot<mirror::Class>& root) const NO_THREAD_SAFETY_ANALYSIS;
+ uint32_t operator()(const TableSlot& slot) const NO_THREAD_SAFETY_ANALYSIS;
// Same class loader and descriptor.
- bool operator()(const GcRoot<mirror::Class>& a, const GcRoot<mirror::Class>& b) const
+ bool operator()(const TableSlot& a, const TableSlot& b) const
NO_THREAD_SAFETY_ANALYSIS;
// Same descriptor.
- bool operator()(const GcRoot<mirror::Class>& a, const char* descriptor) const
+ bool operator()(const TableSlot& a, const DescriptorHashPair& b) const
NO_THREAD_SAFETY_ANALYSIS;
// uint32_t for cross compilation.
- uint32_t operator()(const char* descriptor) const NO_THREAD_SAFETY_ANALYSIS;
+ uint32_t operator()(const DescriptorHashPair& pair) const NO_THREAD_SAFETY_ANALYSIS;
};
- class GcRootEmptyFn {
+
+ class TableSlotEmptyFn {
public:
- void MakeEmpty(GcRoot<mirror::Class>& item) const {
- item = GcRoot<mirror::Class>();
+ void MakeEmpty(TableSlot& item) const NO_THREAD_SAFETY_ANALYSIS {
+ item = TableSlot();
+ DCHECK(IsEmpty(item));
}
- bool IsEmpty(const GcRoot<mirror::Class>& item) const {
+ bool IsEmpty(const TableSlot& item) const NO_THREAD_SAFETY_ANALYSIS {
return item.IsNull();
}
};
- // hash set which hashes class descriptor, and compares descriptors and class loaders. Results
- // should be compared for a matching Class descriptor and class loader.
- typedef HashSet<GcRoot<mirror::Class>, GcRootEmptyFn, ClassDescriptorHashEquals,
- ClassDescriptorHashEquals, TrackingAllocator<GcRoot<mirror::Class>, kAllocatorTagClassTable>>
- ClassSet;
+
+ // Hash set that hashes class descriptor, and compares descriptors and class loaders. Results
+ // should be compared for a matching class descriptor and class loader.
+ typedef HashSet<TableSlot,
+ TableSlotEmptyFn,
+ ClassDescriptorHashEquals,
+ ClassDescriptorHashEquals,
+ TrackingAllocator<TableSlot, kAllocatorTagClassTable>> ClassSet;
ClassTable();
@@ -84,10 +145,14 @@
REQUIRES_SHARED(Locks::mutator_lock_);
// Returns the number of classes in previous snapshots.
- size_t NumZygoteClasses() const REQUIRES(!lock_);
+ size_t NumZygoteClasses(ObjPtr<mirror::ClassLoader> defining_loader) const
+ REQUIRES(!lock_)
+ REQUIRES_SHARED(Locks::mutator_lock_);
// Returns all off the classes in the lastest snapshot.
- size_t NumNonZygoteClasses() const REQUIRES(!lock_);
+ size_t NumNonZygoteClasses(ObjPtr<mirror::ClassLoader> defining_loader) const
+ REQUIRES(!lock_)
+ REQUIRES_SHARED(Locks::mutator_lock_);
// Update a class in the table with the new class. Returns the existing class which was replaced.
mirror::Class* UpdateClass(const char* descriptor, mirror::Class* new_klass, size_t hash)
@@ -112,6 +177,10 @@
bool Visit(Visitor& visitor)
REQUIRES(!lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
+ template <typename Visitor>
+ bool Visit(const Visitor& visitor)
+ REQUIRES(!lock_)
+ REQUIRES_SHARED(Locks::mutator_lock_);
// Return the first class that matches the descriptor. Returns null if there are none.
mirror::Class* Lookup(const char* descriptor, size_t hash)
@@ -173,6 +242,11 @@
private:
void InsertWithoutLocks(ObjPtr<mirror::Class> klass) NO_THREAD_SAFETY_ANALYSIS;
+ size_t CountDefiningLoaderClasses(ObjPtr<mirror::ClassLoader> defining_loader,
+ const ClassSet& set) const
+ REQUIRES(lock_)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
// Return true if we inserted the oat file, false if it already exists.
bool InsertOatFileLocked(const OatFile* oat_file)
REQUIRES(lock_)
diff --git a/runtime/class_table_test.cc b/runtime/class_table_test.cc
new file mode 100644
index 0000000..f1248eb
--- /dev/null
+++ b/runtime/class_table_test.cc
@@ -0,0 +1,163 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "class_table-inl.h"
+
+#include "art_field-inl.h"
+#include "art_method-inl.h"
+#include "class_linker-inl.h"
+#include "common_runtime_test.h"
+#include "dex_file.h"
+#include "gc/accounting/card_table-inl.h"
+#include "gc/heap.h"
+#include "handle_scope-inl.h"
+#include "mirror/class-inl.h"
+#include "obj_ptr.h"
+#include "scoped_thread_state_change-inl.h"
+
+namespace art {
+namespace mirror {
+
+class CollectRootVisitor {
+ public:
+ CollectRootVisitor() {}
+
+ template <class MirrorType>
+ ALWAYS_INLINE void VisitRootIfNonNull(GcRoot<MirrorType>& root) const
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ if (!root.IsNull()) {
+ VisitRoot(root);
+ }
+ }
+
+ template <class MirrorType>
+ ALWAYS_INLINE void VisitRootIfNonNull(mirror::CompressedReference<MirrorType>* root) const
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ if (!root->IsNull()) {
+ VisitRoot(root);
+ }
+ }
+
+ template <class MirrorType>
+ void VisitRoot(GcRoot<MirrorType>& root) const REQUIRES_SHARED(Locks::mutator_lock_) {
+ VisitRoot(root.AddressWithoutBarrier());
+ }
+
+ template <class MirrorType>
+ void VisitRoot(mirror::CompressedReference<MirrorType>* root) const
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ roots_.insert(root->AsMirrorPtr());
+ }
+
+ mutable std::set<mirror::Object*> roots_;
+};
+
+
+class ClassTableTest : public CommonRuntimeTest {};
+
+TEST_F(ClassTableTest, ClassTable) {
+ ScopedObjectAccess soa(Thread::Current());
+ jobject jclass_loader = LoadDex("XandY");
+ VariableSizedHandleScope hs(soa.Self());
+ Handle<ClassLoader> class_loader(hs.NewHandle(soa.Decode<ClassLoader>(jclass_loader)));
+ const char* descriptor_x = "LX;";
+ const char* descriptor_y = "LY;";
+ Handle<mirror::Class> h_X(
+ hs.NewHandle(class_linker_->FindClass(soa.Self(), descriptor_x, class_loader)));
+ Handle<mirror::Class> h_Y(
+ hs.NewHandle(class_linker_->FindClass(soa.Self(), descriptor_y, class_loader)));
+ Handle<mirror::Object> obj_X = hs.NewHandle(h_X->AllocObject(soa.Self()));
+ ASSERT_TRUE(obj_X.Get() != nullptr);
+ ClassTable table;
+ EXPECT_EQ(table.NumZygoteClasses(class_loader.Get()), 0u);
+ EXPECT_EQ(table.NumNonZygoteClasses(class_loader.Get()), 0u);
+
+ // Add h_X to the class table.
+ table.Insert(h_X.Get());
+ EXPECT_EQ(table.LookupByDescriptor(h_X.Get()), h_X.Get());
+ EXPECT_EQ(table.Lookup(descriptor_x, ComputeModifiedUtf8Hash(descriptor_x)), h_X.Get());
+ EXPECT_EQ(table.Lookup("NOT_THERE", ComputeModifiedUtf8Hash("NOT_THERE")), nullptr);
+ EXPECT_EQ(table.NumZygoteClasses(class_loader.Get()), 0u);
+ EXPECT_EQ(table.NumNonZygoteClasses(class_loader.Get()), 1u);
+
+ // Create the zygote snapshot and ensure the accounting is correct.
+ table.FreezeSnapshot();
+ EXPECT_EQ(table.NumZygoteClasses(class_loader.Get()), 1u);
+ EXPECT_EQ(table.NumNonZygoteClasses(class_loader.Get()), 0u);
+
+ // Test inserting and related lookup functions.
+ EXPECT_EQ(table.LookupByDescriptor(h_Y.Get()), nullptr);
+ EXPECT_FALSE(table.Contains(h_Y.Get()));
+ table.Insert(h_Y.Get());
+ EXPECT_EQ(table.LookupByDescriptor(h_X.Get()), h_X.Get());
+ EXPECT_EQ(table.LookupByDescriptor(h_Y.Get()), h_Y.Get());
+ EXPECT_TRUE(table.Contains(h_X.Get()));
+ EXPECT_TRUE(table.Contains(h_Y.Get()));
+
+ EXPECT_EQ(table.NumZygoteClasses(class_loader.Get()), 1u);
+ EXPECT_EQ(table.NumNonZygoteClasses(class_loader.Get()), 1u);
+
+ // Test adding / clearing strong roots.
+ EXPECT_TRUE(table.InsertStrongRoot(obj_X.Get()));
+ EXPECT_FALSE(table.InsertStrongRoot(obj_X.Get()));
+ table.ClearStrongRoots();
+ EXPECT_TRUE(table.InsertStrongRoot(obj_X.Get()));
+
+ // Collect all the roots and make sure there is nothing missing.
+ CollectRootVisitor roots;
+ table.VisitRoots(roots);
+ EXPECT_TRUE(roots.roots_.find(h_X.Get()) != roots.roots_.end());
+ EXPECT_TRUE(roots.roots_.find(h_Y.Get()) != roots.roots_.end());
+ EXPECT_TRUE(roots.roots_.find(obj_X.Get()) != roots.roots_.end());
+
+ // Checks that vising only classes works.
+ std::set<mirror::Class*> classes;
+ table.Visit([&classes](ObjPtr<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) {
+ classes.insert(klass.Ptr());
+ return true;
+ });
+ EXPECT_TRUE(classes.find(h_X.Get()) != classes.end());
+ EXPECT_TRUE(classes.find(h_Y.Get()) != classes.end());
+ EXPECT_EQ(classes.size(), 2u);
+ classes.clear();
+ table.Visit([&classes](ObjPtr<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) {
+ classes.insert(klass.Ptr());
+ // Return false to exit the Visit early.
+ return false;
+ });
+ EXPECT_EQ(classes.size(), 1u);
+
+ // Test remove.
+ table.Remove(descriptor_x);
+ EXPECT_FALSE(table.Contains(h_X.Get()));
+
+ // Test that WriteToMemory and ReadFromMemory work.
+ table.Insert(h_X.Get());
+ const size_t count = table.WriteToMemory(nullptr);
+ std::unique_ptr<uint8_t[]> buffer(new uint8_t[count]());
+ ASSERT_EQ(table.WriteToMemory(&buffer[0]), count);
+ ClassTable table2;
+ size_t count2 = table2.ReadFromMemory(&buffer[0]);
+ EXPECT_EQ(count, count2);
+ // Strong roots are not serialized, only classes.
+ EXPECT_TRUE(table2.Contains(h_X.Get()));
+ EXPECT_TRUE(table2.Contains(h_Y.Get()));
+
+ // TODO: Add tests for UpdateClass, InsertOatFile.
+}
+
+} // namespace mirror
+} // namespace art
diff --git a/runtime/common_runtime_test.cc b/runtime/common_runtime_test.cc
index 8226e60..743fcc8 100644
--- a/runtime/common_runtime_test.cc
+++ b/runtime/common_runtime_test.cc
@@ -24,11 +24,12 @@
#include <stdlib.h>
#include "../../external/icu/icu4c/source/common/unicode/uvernum.h"
+#include "android-base/stringprintf.h"
+
#include "art_field-inl.h"
#include "base/macros.h"
#include "base/logging.h"
#include "base/stl_util.h"
-#include "base/stringprintf.h"
#include "base/unix_file/fd_file.h"
#include "class_linker.h"
#include "compiler_callbacks.h"
@@ -65,6 +66,8 @@
namespace art {
+using android::base::StringPrintf;
+
ScratchFile::ScratchFile() {
// ANDROID_DATA needs to be set
CHECK_NE(static_cast<char*>(nullptr), getenv("ANDROID_DATA")) <<
diff --git a/runtime/common_throws.cc b/runtime/common_throws.cc
index 9f0dbbb..c30272e 100644
--- a/runtime/common_throws.cc
+++ b/runtime/common_throws.cc
@@ -18,6 +18,7 @@
#include <sstream>
+#include "android-base/stringprintf.h"
#include "ScopedLocalRef.h"
#include "art_field-inl.h"
@@ -37,6 +38,9 @@
namespace art {
+using android::base::StringAppendV;
+using android::base::StringPrintf;
+
static void AddReferrerLocation(std::ostream& os, ObjPtr<mirror::Class> referrer)
REQUIRES_SHARED(Locks::mutator_lock_) {
if (referrer != nullptr) {
diff --git a/runtime/compiler_filter.cc b/runtime/compiler_filter.cc
index dc197c1..6e3e1d8 100644
--- a/runtime/compiler_filter.cc
+++ b/runtime/compiler_filter.cc
@@ -33,6 +33,7 @@
case CompilerFilter::kTime:
case CompilerFilter::kSpeedProfile:
case CompilerFilter::kSpeed:
+ case CompilerFilter::kLayoutProfile:
case CompilerFilter::kEverythingProfile:
case CompilerFilter::kEverything: return true;
}
@@ -52,6 +53,7 @@
case CompilerFilter::kTime:
case CompilerFilter::kSpeedProfile:
case CompilerFilter::kSpeed:
+ case CompilerFilter::kLayoutProfile:
case CompilerFilter::kEverythingProfile:
case CompilerFilter::kEverything: return true;
}
@@ -71,6 +73,7 @@
case CompilerFilter::kTime:
case CompilerFilter::kSpeedProfile:
case CompilerFilter::kSpeed:
+ case CompilerFilter::kLayoutProfile:
case CompilerFilter::kEverythingProfile:
case CompilerFilter::kEverything: return true;
}
@@ -97,6 +100,7 @@
case CompilerFilter::kVerifyProfile:
case CompilerFilter::kSpaceProfile:
case CompilerFilter::kSpeedProfile:
+ case CompilerFilter::kLayoutProfile:
case CompilerFilter::kEverythingProfile: return true;
}
UNREACHABLE();
@@ -121,6 +125,7 @@
return CompilerFilter::kSpace;
case CompilerFilter::kSpeedProfile:
+ case CompilerFilter::kLayoutProfile:
return CompilerFilter::kSpeed;
case CompilerFilter::kEverythingProfile:
@@ -146,6 +151,7 @@
case CompilerFilter::kTime: return "time";
case CompilerFilter::kSpeedProfile: return "speed-profile";
case CompilerFilter::kSpeed: return "speed";
+ case CompilerFilter::kLayoutProfile: return "layout-profile";
case CompilerFilter::kEverythingProfile: return "everything-profile";
case CompilerFilter::kEverything: return "everything";
}
@@ -173,6 +179,8 @@
*filter = kSpeed;
} else if (strcmp(option, "speed-profile") == 0) {
*filter = kSpeedProfile;
+ } else if (strcmp(option, "layout-profile") == 0) {
+ *filter = kLayoutProfile;
} else if (strcmp(option, "everything") == 0) {
*filter = kEverything;
} else if (strcmp(option, "everything-profile") == 0) {
diff --git a/runtime/compiler_filter.h b/runtime/compiler_filter.h
index 37631cc..781d43a 100644
--- a/runtime/compiler_filter.h
+++ b/runtime/compiler_filter.h
@@ -39,6 +39,7 @@
kSpace, // Maximize space savings.
kBalanced, // Good performance return on compilation investment.
kSpeedProfile, // Maximize runtime performance based on profile.
+ kLayoutProfile, // Temporary filter for dexlayout. Will be merged with kSpeedProfile.
kSpeed, // Maximize runtime performance.
kEverythingProfile, // Compile everything capable of being compiled based on profile.
kEverything, // Compile everything capable of being compiled.
diff --git a/runtime/debugger.cc b/runtime/debugger.cc
index dc2ae2e..df4413d 100644
--- a/runtime/debugger.cc
+++ b/runtime/debugger.cc
@@ -20,6 +20,8 @@
#include <set>
+#include "android-base/stringprintf.h"
+
#include "arch/context.h"
#include "art_field-inl.h"
#include "art_method-inl.h"
@@ -61,6 +63,8 @@
namespace art {
+using android::base::StringPrintf;
+
// The key identifying the debugger to update instrumentation.
static constexpr const char* kDbgInstrumentationKey = "Debugger";
@@ -1565,16 +1569,16 @@
JDWP::JdwpError Dbg::OutputDeclaredInterfaces(JDWP::RefTypeId class_id, JDWP::ExpandBuf* pReply) {
JDWP::JdwpError error;
Thread* self = Thread::Current();
- StackHandleScope<1> hs(self);
- Handle<mirror::Class> c(hs.NewHandle(DecodeClass(class_id, &error)));
- if (c.Get() == nullptr) {
+ ObjPtr<mirror::Class> c = DecodeClass(class_id, &error);
+ if (c == nullptr) {
return error;
}
size_t interface_count = c->NumDirectInterfaces();
expandBufAdd4BE(pReply, interface_count);
for (size_t i = 0; i < interface_count; ++i) {
- expandBufAddRefTypeId(pReply,
- gRegistry->AddRefType(mirror::Class::GetDirectInterface(self, c, i)));
+ ObjPtr<mirror::Class> interface = mirror::Class::GetDirectInterface(self, c, i);
+ DCHECK(interface != nullptr);
+ expandBufAddRefTypeId(pReply, gRegistry->AddRefType(interface));
}
return JDWP::ERR_NONE;
}
diff --git a/runtime/dex2oat_environment_test.h b/runtime/dex2oat_environment_test.h
index d717ec0..b0c4597 100644
--- a/runtime/dex2oat_environment_test.h
+++ b/runtime/dex2oat_environment_test.h
@@ -136,7 +136,9 @@
+ "/core.art";
}
- bool GetCachedImageFile(/*out*/std::string* image, std::string* error_msg) const {
+ bool GetCachedImageFile(const std::string& image_location,
+ /*out*/std::string* image,
+ /*out*/std::string* error_msg) const {
std::string cache;
bool have_android_data;
bool dalvik_cache_exists;
@@ -151,7 +153,14 @@
*error_msg = "Failed to create dalvik cache";
return false;
}
- return GetDalvikCacheFilename(GetImageLocation().c_str(), cache.c_str(), image, error_msg);
+ return GetDalvikCacheFilename(image_location.c_str(), cache.c_str(), image, error_msg);
+ }
+
+ // Returns the path to an image location whose contents differ from the
+ // image at GetImageLocation(). This is used for testing mismatched
+ // image checksums in the oat_file_assistant_tests.
+ std::string GetImageLocation2() const {
+ return GetImageDirectory() + "/core-npic.art";
}
std::string GetDexSrc1() const {
diff --git a/runtime/dex_cache_resolved_classes.h b/runtime/dex_cache_resolved_classes.h
index 0febbed..f53ca4a 100644
--- a/runtime/dex_cache_resolved_classes.h
+++ b/runtime/dex_cache_resolved_classes.h
@@ -21,6 +21,8 @@
#include <unordered_set>
#include <vector>
+#include "dex_file_types.h"
+
namespace art {
// Data structure for passing around which classes belonging to a dex cache / dex file are resolved.
@@ -59,7 +61,7 @@
return location_checksum_;
}
- const std::unordered_set<uint16_t>& GetClasses() const {
+ const std::unordered_set<dex::TypeIndex>& GetClasses() const {
return classes_;
}
@@ -68,7 +70,7 @@
const std::string base_location_;
const uint32_t location_checksum_;
// Array of resolved class def indexes.
- mutable std::unordered_set<uint16_t> classes_;
+ mutable std::unordered_set<dex::TypeIndex> classes_;
};
inline bool operator<(const DexCacheResolvedClasses& a, const DexCacheResolvedClasses& b) {
diff --git a/runtime/dex_file-inl.h b/runtime/dex_file-inl.h
index 621b2c5..e884e39 100644
--- a/runtime/dex_file-inl.h
+++ b/runtime/dex_file-inl.h
@@ -43,9 +43,9 @@
return GetStringDataAndUtf16Length(string_id, &ignored);
}
-inline const char* DexFile::StringDataAndUtf16LengthByIdx(uint32_t idx,
+inline const char* DexFile::StringDataAndUtf16LengthByIdx(dex::StringIndex idx,
uint32_t* utf16_length) const {
- if (idx == kDexNoIndex) {
+ if (!idx.IsValid()) {
*utf16_length = 0;
return nullptr;
}
@@ -53,17 +53,17 @@
return GetStringDataAndUtf16Length(string_id, utf16_length);
}
-inline const char* DexFile::StringDataByIdx(uint32_t idx) const {
+inline const char* DexFile::StringDataByIdx(dex::StringIndex idx) const {
uint32_t unicode_length;
return StringDataAndUtf16LengthByIdx(idx, &unicode_length);
}
-inline const char* DexFile::StringByTypeIdx(uint32_t idx, uint32_t* unicode_length) const {
+inline const char* DexFile::StringByTypeIdx(dex::TypeIndex idx, uint32_t* unicode_length) const {
const TypeId& type_id = GetTypeId(idx);
return StringDataAndUtf16LengthByIdx(type_id.descriptor_idx_, unicode_length);
}
-inline const char* DexFile::StringByTypeIdx(uint32_t idx) const {
+inline const char* DexFile::StringByTypeIdx(dex::TypeIndex idx) const {
const TypeId& type_id = GetTypeId(idx);
return StringDataByIdx(type_id.descriptor_idx_);
}
@@ -130,8 +130,8 @@
(RoundUp(reinterpret_cast<uintptr_t>(insns_end_), 4)) + offset;
}
-static inline bool DexFileStringEquals(const DexFile* df1, uint32_t sidx1,
- const DexFile* df2, uint32_t sidx2) {
+static inline bool DexFileStringEquals(const DexFile* df1, dex::StringIndex sidx1,
+ const DexFile* df2, dex::StringIndex sidx2) {
uint32_t s1_len; // Note: utf16 length != mutf8 length.
const char* s1_data = df1->StringDataAndUtf16LengthByIdx(sidx1, &s1_len);
uint32_t s2_len;
diff --git a/runtime/dex_file.cc b/runtime/dex_file.cc
index 2ef7509..7d704ad 100644
--- a/runtime/dex_file.cc
+++ b/runtime/dex_file.cc
@@ -26,11 +26,13 @@
#include <memory>
#include <sstream>
+#include <type_traits>
+
+#include "android-base/stringprintf.h"
#include "base/enums.h"
#include "base/file_magic.h"
#include "base/logging.h"
-#include "base/stringprintf.h"
#include "base/systrace.h"
#include "base/unix_file/fd_file.h"
#include "dex_file-inl.h"
@@ -44,6 +46,13 @@
namespace art {
+using android::base::StringPrintf;
+
+static_assert(sizeof(dex::StringIndex) == sizeof(uint32_t), "StringIndex size is wrong");
+static_assert(std::is_trivially_copyable<dex::StringIndex>::value, "StringIndex not trivial");
+static_assert(sizeof(dex::TypeIndex) == sizeof(uint16_t), "TypeIndex size is wrong");
+static_assert(std::is_trivially_copyable<dex::TypeIndex>::value, "TypeIndex not trivial");
+
static constexpr OatDexFile* kNoOatDexFile = nullptr;
const char* DexFile::kClassesDex = "classes.dex";
@@ -550,7 +559,7 @@
return atoi(version);
}
-const DexFile::ClassDef* DexFile::FindClassDef(uint16_t type_idx) const {
+const DexFile::ClassDef* DexFile::FindClassDef(dex::TypeIndex type_idx) const {
size_t num_class_defs = NumClassDefs();
// Fast path for rare no class defs case.
if (num_class_defs == 0) {
@@ -597,9 +606,9 @@
const DexFile::StringId& name,
const DexFile::TypeId& type) const {
// Binary search MethodIds knowing that they are sorted by class_idx, name_idx then proto_idx
- const uint16_t class_idx = GetIndexForTypeId(declaring_klass);
- const uint32_t name_idx = GetIndexForStringId(name);
- const uint16_t type_idx = GetIndexForTypeId(type);
+ const dex::TypeIndex class_idx = GetIndexForTypeId(declaring_klass);
+ const dex::StringIndex name_idx = GetIndexForStringId(name);
+ const dex::TypeIndex type_idx = GetIndexForTypeId(type);
int32_t lo = 0;
int32_t hi = NumFieldIds() - 1;
while (hi >= lo) {
@@ -632,8 +641,8 @@
const DexFile::StringId& name,
const DexFile::ProtoId& signature) const {
// Binary search MethodIds knowing that they are sorted by class_idx, name_idx then proto_idx
- const uint16_t class_idx = GetIndexForTypeId(declaring_klass);
- const uint32_t name_idx = GetIndexForStringId(name);
+ const dex::TypeIndex class_idx = GetIndexForTypeId(declaring_klass);
+ const dex::StringIndex name_idx = GetIndexForStringId(name);
const uint16_t proto_idx = GetIndexForProtoId(signature);
int32_t lo = 0;
int32_t hi = NumMethodIds() - 1;
@@ -668,7 +677,7 @@
int32_t hi = NumStringIds() - 1;
while (hi >= lo) {
int32_t mid = (hi + lo) / 2;
- const DexFile::StringId& str_id = GetStringId(mid);
+ const DexFile::StringId& str_id = GetStringId(dex::StringIndex(mid));
const char* str = GetStringData(str_id);
int compare = CompareModifiedUtf8ToModifiedUtf8AsUtf16CodePointValues(string, str);
if (compare > 0) {
@@ -687,7 +696,7 @@
int32_t hi = NumTypeIds() - 1;
while (hi >= lo) {
int32_t mid = (hi + lo) / 2;
- const TypeId& type_id = GetTypeId(mid);
+ const TypeId& type_id = GetTypeId(dex::TypeIndex(mid));
const DexFile::StringId& str_id = GetStringId(type_id.descriptor_idx_);
const char* str = GetStringData(str_id);
int compare = CompareModifiedUtf8ToModifiedUtf8AsUtf16CodePointValues(string, str);
@@ -707,7 +716,7 @@
int32_t hi = NumStringIds() - 1;
while (hi >= lo) {
int32_t mid = (hi + lo) / 2;
- const DexFile::StringId& str_id = GetStringId(mid);
+ const DexFile::StringId& str_id = GetStringId(dex::StringIndex(mid));
const char* str = GetStringData(str_id);
int compare = CompareModifiedUtf8ToUtf16AsCodePointValues(str, string, length);
if (compare > 0) {
@@ -721,12 +730,12 @@
return nullptr;
}
-const DexFile::TypeId* DexFile::FindTypeId(uint32_t string_idx) const {
+const DexFile::TypeId* DexFile::FindTypeId(dex::StringIndex string_idx) const {
int32_t lo = 0;
int32_t hi = NumTypeIds() - 1;
while (hi >= lo) {
int32_t mid = (hi + lo) / 2;
- const TypeId& type_id = GetTypeId(mid);
+ const TypeId& type_id = GetTypeId(dex::TypeIndex(mid));
if (string_idx > type_id.descriptor_idx_) {
lo = mid + 1;
} else if (string_idx < type_id.descriptor_idx_) {
@@ -738,20 +747,20 @@
return nullptr;
}
-const DexFile::ProtoId* DexFile::FindProtoId(uint16_t return_type_idx,
- const uint16_t* signature_type_idxs,
+const DexFile::ProtoId* DexFile::FindProtoId(dex::TypeIndex return_type_idx,
+ const dex::TypeIndex* signature_type_idxs,
uint32_t signature_length) const {
int32_t lo = 0;
int32_t hi = NumProtoIds() - 1;
while (hi >= lo) {
int32_t mid = (hi + lo) / 2;
const DexFile::ProtoId& proto = GetProtoId(mid);
- int compare = return_type_idx - proto.return_type_idx_;
+ int compare = return_type_idx.index_ - proto.return_type_idx_.index_;
if (compare == 0) {
DexFileParameterIterator it(*this, proto);
size_t i = 0;
while (it.HasNext() && i < signature_length && compare == 0) {
- compare = signature_type_idxs[i] - it.GetTypeIdx();
+ compare = signature_type_idxs[i].index_ - it.GetTypeIdx().index_;
it.Next();
i++;
}
@@ -775,8 +784,9 @@
}
// Given a signature place the type ids into the given vector
-bool DexFile::CreateTypeList(const StringPiece& signature, uint16_t* return_type_idx,
- std::vector<uint16_t>* param_type_idxs) const {
+bool DexFile::CreateTypeList(const StringPiece& signature,
+ dex::TypeIndex* return_type_idx,
+ std::vector<dex::TypeIndex>* param_type_idxs) const {
if (signature[0] != '(') {
return false;
}
@@ -813,7 +823,7 @@
if (type_id == nullptr) {
return false;
}
- uint16_t type_idx = GetIndexForTypeId(*type_id);
+ dex::TypeIndex type_idx = GetIndexForTypeId(*type_id);
if (!process_return) {
param_type_idxs->push_back(type_idx);
} else {
@@ -825,8 +835,8 @@
}
const Signature DexFile::CreateSignature(const StringPiece& signature) const {
- uint16_t return_type_idx;
- std::vector<uint16_t> param_type_indices;
+ dex::TypeIndex return_type_idx;
+ std::vector<dex::TypeIndex> param_type_indices;
bool success = CreateTypeList(signature, &return_type_idx, ¶m_type_indices);
if (!success) {
return Signature::NoSignature();
@@ -907,7 +917,7 @@
}
uint32_t name_idx = DecodeUnsignedLeb128P1(&stream);
const char* descriptor = it.GetDescriptor();
- local_in_reg[arg_reg].name_ = StringDataByIdx(name_idx);
+ local_in_reg[arg_reg].name_ = StringDataByIdx(dex::StringIndex(name_idx));
local_in_reg[arg_reg].descriptor_ = descriptor;
local_in_reg[arg_reg].signature_ = nullptr;
local_in_reg[arg_reg].start_address_ = 0;
@@ -970,9 +980,10 @@
local_cb(context, local_in_reg[reg]);
}
- local_in_reg[reg].name_ = StringDataByIdx(name_idx);
- local_in_reg[reg].descriptor_ = StringByTypeIdx(descriptor_idx);
- local_in_reg[reg].signature_ = StringDataByIdx(signature_idx);
+ local_in_reg[reg].name_ = StringDataByIdx(dex::StringIndex(name_idx));
+ local_in_reg[reg].descriptor_ =
+ StringByTypeIdx(dex::TypeIndex(dchecked_integral_cast<uint16_t>(descriptor_idx)));;
+ local_in_reg[reg].signature_ = StringDataByIdx(dex::StringIndex(signature_idx));
local_in_reg[reg].start_address_ = address;
local_in_reg[reg].reg_ = reg;
local_in_reg[reg].is_live_ = true;
@@ -1074,7 +1085,7 @@
break;
case DBG_SET_FILE: {
uint32_t name_idx = DecodeUnsignedLeb128P1(&stream);
- entry.source_file_ = StringDataByIdx(name_idx);
+ entry.source_file_ = StringDataByIdx(dex::StringIndex(name_idx));
break;
}
default: {
@@ -1225,9 +1236,9 @@
return result;
}
-std::string DexFile::PrettyType(uint32_t type_idx) const {
- if (type_idx >= NumTypeIds()) {
- return StringPrintf("<<invalid-type-idx-%d>>", type_idx);
+std::string DexFile::PrettyType(dex::TypeIndex type_idx) const {
+ if (type_idx.index_ >= NumTypeIds()) {
+ return StringPrintf("<<invalid-type-idx-%d>>", type_idx.index_);
}
const DexFile::TypeId& type_id = GetTypeId(type_idx);
return PrettyDescriptor(GetTypeDescriptor(type_id));
@@ -1457,14 +1468,14 @@
void CatchHandlerIterator::Next() {
if (remaining_count_ > 0) {
- handler_.type_idx_ = DecodeUnsignedLeb128(¤t_data_);
+ handler_.type_idx_ = dex::TypeIndex(DecodeUnsignedLeb128(¤t_data_));
handler_.address_ = DecodeUnsignedLeb128(¤t_data_);
remaining_count_--;
return;
}
if (catch_all_) {
- handler_.type_idx_ = DexFile::kDexNoIndex16;
+ handler_.type_idx_ = dex::TypeIndex(DexFile::kDexNoIndex16);
handler_.address_ = DecodeUnsignedLeb128(¤t_data_);
catch_all_ = false;
return;
@@ -1474,4 +1485,18 @@
remaining_count_ = -1;
}
+namespace dex {
+
+std::ostream& operator<<(std::ostream& os, const StringIndex& index) {
+ os << "StringIndex[" << index.index_ << "]";
+ return os;
+}
+
+std::ostream& operator<<(std::ostream& os, const TypeIndex& index) {
+ os << "TypeIndex[" << index.index_ << "]";
+ return os;
+}
+
+} // namespace dex
+
} // namespace art
diff --git a/runtime/dex_file.h b/runtime/dex_file.h
index da9fa50..250795b 100644
--- a/runtime/dex_file.h
+++ b/runtime/dex_file.h
@@ -23,6 +23,7 @@
#include "base/logging.h"
#include "base/value_object.h"
+#include "dex_file_types.h"
#include "globals.h"
#include "invoke_type.h"
#include "jni.h"
@@ -151,7 +152,7 @@
// Raw type_id_item.
struct TypeId {
- uint32_t descriptor_idx_; // index into string_ids
+ dex::StringIndex descriptor_idx_; // index into string_ids
private:
DISALLOW_COPY_AND_ASSIGN(TypeId);
@@ -159,44 +160,44 @@
// Raw field_id_item.
struct FieldId {
- uint16_t class_idx_; // index into type_ids_ array for defining class
- uint16_t type_idx_; // index into type_ids_ array for field type
- uint32_t name_idx_; // index into string_ids_ array for field name
+ dex::TypeIndex class_idx_; // index into type_ids_ array for defining class
+ dex::TypeIndex type_idx_; // index into type_ids_ array for field type
+ dex::StringIndex name_idx_; // index into string_ids_ array for field name
private:
DISALLOW_COPY_AND_ASSIGN(FieldId);
};
- // Raw method_id_item.
- struct MethodId {
- uint16_t class_idx_; // index into type_ids_ array for defining class
- uint16_t proto_idx_; // index into proto_ids_ array for method prototype
- uint32_t name_idx_; // index into string_ids_ array for method name
-
- private:
- DISALLOW_COPY_AND_ASSIGN(MethodId);
- };
-
// Raw proto_id_item.
struct ProtoId {
- uint32_t shorty_idx_; // index into string_ids array for shorty descriptor
- uint16_t return_type_idx_; // index into type_ids array for return type
- uint16_t pad_; // padding = 0
- uint32_t parameters_off_; // file offset to type_list for parameter types
+ dex::StringIndex shorty_idx_; // index into string_ids array for shorty descriptor
+ dex::TypeIndex return_type_idx_; // index into type_ids array for return type
+ uint16_t pad_; // padding = 0
+ uint32_t parameters_off_; // file offset to type_list for parameter types
private:
DISALLOW_COPY_AND_ASSIGN(ProtoId);
};
+ // Raw method_id_item.
+ struct MethodId {
+ dex::TypeIndex class_idx_; // index into type_ids_ array for defining class
+ uint16_t proto_idx_; // index into proto_ids_ array for method prototype
+ dex::StringIndex name_idx_; // index into string_ids_ array for method name
+
+ private:
+ DISALLOW_COPY_AND_ASSIGN(MethodId);
+ };
+
// Raw class_def_item.
struct ClassDef {
- uint16_t class_idx_; // index into type_ids_ array for this class
+ dex::TypeIndex class_idx_; // index into type_ids_ array for this class
uint16_t pad1_; // padding = 0
uint32_t access_flags_;
- uint16_t superclass_idx_; // index into type_ids_ array for superclass
+ dex::TypeIndex superclass_idx_; // index into type_ids_ array for superclass
uint16_t pad2_; // padding = 0
uint32_t interfaces_off_; // file offset to TypeList
- uint32_t source_file_idx_; // index into string_ids_ for source file name
+ dex::StringIndex source_file_idx_; // index into string_ids_ for source file name
uint32_t annotations_off_; // file offset to annotations_directory_item
uint32_t class_data_off_; // file offset to class_data_item
uint32_t static_values_off_; // file offset to EncodedArray
@@ -225,7 +226,7 @@
// Raw type_item.
struct TypeItem {
- uint16_t type_idx_; // index into type_ids section
+ dex::TypeIndex type_idx_; // index into type_ids section
private:
DISALLOW_COPY_AND_ASSIGN(TypeItem);
@@ -500,15 +501,15 @@
}
// Returns the StringId at the specified index.
- const StringId& GetStringId(uint32_t idx) const {
- DCHECK_LT(idx, NumStringIds()) << GetLocation();
- return string_ids_[idx];
+ const StringId& GetStringId(dex::StringIndex idx) const {
+ DCHECK_LT(idx.index_, NumStringIds()) << GetLocation();
+ return string_ids_[idx.index_];
}
- uint32_t GetIndexForStringId(const StringId& string_id) const {
+ dex::StringIndex GetIndexForStringId(const StringId& string_id) const {
CHECK_GE(&string_id, string_ids_) << GetLocation();
CHECK_LT(&string_id, string_ids_ + header_->string_ids_size_) << GetLocation();
- return &string_id - string_ids_;
+ return dex::StringIndex(&string_id - string_ids_);
}
int32_t GetStringLength(const StringId& string_id) const;
@@ -521,9 +522,9 @@
const char* GetStringData(const StringId& string_id) const;
// Index version of GetStringDataAndUtf16Length.
- const char* StringDataAndUtf16LengthByIdx(uint32_t idx, uint32_t* utf16_length) const;
+ const char* StringDataAndUtf16LengthByIdx(dex::StringIndex idx, uint32_t* utf16_length) const;
- const char* StringDataByIdx(uint32_t idx) const;
+ const char* StringDataByIdx(dex::StringIndex idx) const;
// Looks up a string id for a given modified utf8 string.
const StringId* FindStringId(const char* string) const;
@@ -540,29 +541,29 @@
}
// Returns the TypeId at the specified index.
- const TypeId& GetTypeId(uint32_t idx) const {
- DCHECK_LT(idx, NumTypeIds()) << GetLocation();
- return type_ids_[idx];
+ const TypeId& GetTypeId(dex::TypeIndex idx) const {
+ DCHECK_LT(idx.index_, NumTypeIds()) << GetLocation();
+ return type_ids_[idx.index_];
}
- uint16_t GetIndexForTypeId(const TypeId& type_id) const {
+ dex::TypeIndex GetIndexForTypeId(const TypeId& type_id) const {
CHECK_GE(&type_id, type_ids_) << GetLocation();
CHECK_LT(&type_id, type_ids_ + header_->type_ids_size_) << GetLocation();
size_t result = &type_id - type_ids_;
DCHECK_LT(result, 65536U) << GetLocation();
- return static_cast<uint16_t>(result);
+ return dex::TypeIndex(static_cast<uint16_t>(result));
}
// Get the descriptor string associated with a given type index.
- const char* StringByTypeIdx(uint32_t idx, uint32_t* unicode_length) const;
+ const char* StringByTypeIdx(dex::TypeIndex idx, uint32_t* unicode_length) const;
- const char* StringByTypeIdx(uint32_t idx) const;
+ const char* StringByTypeIdx(dex::TypeIndex idx) const;
// Returns the type descriptor string of a type id.
const char* GetTypeDescriptor(const TypeId& type_id) const;
// Looks up a type for the given string index
- const TypeId* FindTypeId(uint32_t string_idx) const;
+ const TypeId* FindTypeId(dex::StringIndex string_idx) const;
// Returns the number of field identifiers in the .dex file.
size_t NumFieldIds() const {
@@ -671,7 +672,7 @@
const char* GetClassDescriptor(const ClassDef& class_def) const;
// Looks up a class definition by its type index.
- const ClassDef* FindClassDef(uint16_t type_idx) const;
+ const ClassDef* FindClassDef(dex::TypeIndex type_idx) const;
const TypeList* GetInterfacesList(const ClassDef& class_def) const {
if (class_def.interfaces_off_ == 0) {
@@ -711,7 +712,7 @@
}
// Returns the ProtoId at the specified index.
- const ProtoId& GetProtoId(uint32_t idx) const {
+ const ProtoId& GetProtoId(uint16_t idx) const {
DCHECK_LT(idx, NumProtoIds()) << GetLocation();
return proto_ids_[idx];
}
@@ -723,16 +724,18 @@
}
// Looks up a proto id for a given return type and signature type list
- const ProtoId* FindProtoId(uint16_t return_type_idx,
- const uint16_t* signature_type_idxs, uint32_t signature_length) const;
- const ProtoId* FindProtoId(uint16_t return_type_idx,
- const std::vector<uint16_t>& signature_type_idxs) const {
+ const ProtoId* FindProtoId(dex::TypeIndex return_type_idx,
+ const dex::TypeIndex* signature_type_idxs,
+ uint32_t signature_length) const;
+ const ProtoId* FindProtoId(dex::TypeIndex return_type_idx,
+ const std::vector<dex::TypeIndex>& signature_type_idxs) const {
return FindProtoId(return_type_idx, &signature_type_idxs[0], signature_type_idxs.size());
}
// Given a signature place the type ids into the given vector, returns true on success
- bool CreateTypeList(const StringPiece& signature, uint16_t* return_type_idx,
- std::vector<uint16_t>* param_type_idxs) const;
+ bool CreateTypeList(const StringPiece& signature,
+ dex::TypeIndex* return_type_idx,
+ std::vector<dex::TypeIndex>* param_type_idxs) const;
// Create a Signature from the given string signature or return Signature::NoSignature if not
// possible.
@@ -960,7 +963,7 @@
void* context) const;
const char* GetSourceFile(const ClassDef& class_def) const {
- if (class_def.source_file_idx_ == 0xffffffff) {
+ if (!class_def.source_file_idx_.IsValid()) {
return nullptr;
} else {
return StringDataByIdx(class_def.source_file_idx_);
@@ -1010,6 +1013,11 @@
return oat_dex_file_;
}
+ // Used by oat writer.
+ void SetOatDexFile(OatDexFile* oat_dex_file) const {
+ oat_dex_file_ = oat_dex_file;
+ }
+
// Utility methods for reading integral values from a buffer.
static int32_t ReadSignedInt(const uint8_t* ptr, int zwidth);
static uint32_t ReadUnsignedInt(const uint8_t* ptr, int zwidth, bool fill_on_right);
@@ -1021,7 +1029,7 @@
// Returns a human-readable form of the field at an index.
std::string PrettyField(uint32_t field_idx, bool with_type = true) const;
// Returns a human-readable form of the type at an index.
- std::string PrettyType(uint32_t type_idx) const;
+ std::string PrettyType(dex::TypeIndex type_idx) const;
private:
static std::unique_ptr<const DexFile> OpenFile(int fd,
@@ -1138,9 +1146,10 @@
// If this dex file was loaded from an oat file, oat_dex_file_ contains a
// pointer to the OatDexFile it was loaded from. Otherwise oat_dex_file_ is
// null.
- const OatDexFile* oat_dex_file_;
+ mutable const OatDexFile* oat_dex_file_;
friend class DexFileVerifierTest;
+ friend class OatWriter;
ART_FRIEND_TEST(ClassLinkerTest, RegisterDexFileName); // for constructor
};
@@ -1165,11 +1174,11 @@
bool HasNext() const { return pos_ < size_; }
size_t Size() const { return size_; }
void Next() { ++pos_; }
- uint16_t GetTypeIdx() {
+ dex::TypeIndex GetTypeIdx() {
return type_list_->GetTypeItem(pos_).type_idx_;
}
const char* GetDescriptor() {
- return dex_file_.StringByTypeIdx(GetTypeIdx());
+ return dex_file_.StringByTypeIdx(dex::TypeIndex(GetTypeIdx()));
}
private:
const DexFile& dex_file_;
@@ -1455,7 +1464,7 @@
Init(handler_data);
}
- uint16_t GetHandlerTypeIndex() const {
+ dex::TypeIndex GetHandlerTypeIndex() const {
return handler_.type_idx_;
}
uint32_t GetHandlerAddress() const {
@@ -1476,7 +1485,7 @@
void Init(const uint8_t* handler_data);
struct CatchHandlerItem {
- uint16_t type_idx_; // type index of the caught exception type
+ dex::TypeIndex type_idx_; // type index of the caught exception type
uint32_t address_; // handler address
} handler_;
const uint8_t* current_data_; // the current handler in dex file.
diff --git a/runtime/dex_file_annotations.cc b/runtime/dex_file_annotations.cc
index 835f456..9504e8b 100644
--- a/runtime/dex_file_annotations.cc
+++ b/runtime/dex_file_annotations.cc
@@ -18,6 +18,8 @@
#include <stdlib.h>
+#include "android-base/stringprintf.h"
+
#include "art_field-inl.h"
#include "art_method-inl.h"
#include "class_linker-inl.h"
@@ -31,6 +33,8 @@
namespace art {
+using android::base::StringPrintf;
+
struct DexFile::AnnotationValue {
JValue value_;
uint8_t type_;
@@ -90,7 +94,7 @@
const uint8_t* annotation = annotation_item->annotation_;
uint32_t type_index = DecodeUnsignedLeb128(&annotation);
- if (strcmp(descriptor, dex_file.StringByTypeIdx(type_index)) == 0) {
+ if (strcmp(descriptor, dex_file.StringByTypeIdx(dex::TypeIndex(type_index))) == 0) {
result = annotation_item;
break;
}
@@ -167,7 +171,8 @@
while (size != 0) {
uint32_t element_name_index = DecodeUnsignedLeb128(&annotation);
- const char* element_name = dex_file.GetStringData(dex_file.GetStringId(element_name_index));
+ const char* element_name =
+ dex_file.GetStringData(dex_file.GetStringId(dex::StringIndex(element_name_index)));
if (strcmp(name, element_name) == 0) {
return annotation;
}
@@ -246,7 +251,7 @@
StackHandleScope<2> hs(self);
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
Handle<mirror::Class> annotation_class(hs.NewHandle(
- class_linker->ResolveType(klass->GetDexFile(), type_index, klass.Get())));
+ class_linker->ResolveType(klass->GetDexFile(), dex::TypeIndex(type_index), klass.Get())));
if (annotation_class.Get() == nullptr) {
LOG(INFO) << "Unable to resolve " << klass->PrettyClass() << " annotation class " << type_index;
DCHECK(Thread::Current()->IsExceptionPending());
@@ -357,7 +362,7 @@
StackHandleScope<1> hs(self);
Handle<mirror::DexCache> dex_cache(hs.NewHandle(klass->GetDexCache()));
element_object = Runtime::Current()->GetClassLinker()->ResolveString(
- klass->GetDexFile(), index, dex_cache);
+ klass->GetDexFile(), dex::StringIndex(index), dex_cache);
set_object = true;
if (element_object == nullptr) {
return false;
@@ -370,13 +375,14 @@
if (result_style == DexFile::kAllRaw) {
annotation_value->value_.SetI(index);
} else {
+ dex::TypeIndex type_index(index);
element_object = Runtime::Current()->GetClassLinker()->ResolveType(
- klass->GetDexFile(), index, klass.Get());
+ klass->GetDexFile(), type_index, klass.Get());
set_object = true;
if (element_object == nullptr) {
CHECK(self->IsExceptionPending());
if (result_style == DexFile::kAllObjects) {
- const char* msg = dex_file.StringByTypeIdx(index);
+ const char* msg = dex_file.StringByTypeIdx(type_index);
self->ThrowNewWrappedException("Ljava/lang/TypeNotPresentException;", msg);
element_object = self->GetException();
self->ClearException();
@@ -591,7 +597,7 @@
ScopedObjectAccessUnchecked soa(self);
StackHandleScope<5> hs(self);
uint32_t element_name_index = DecodeUnsignedLeb128(annotation);
- const char* name = dex_file.StringDataByIdx(element_name_index);
+ const char* name = dex_file.StringDataByIdx(dex::StringIndex(element_name_index));
Handle<mirror::String> string_name(
hs.NewHandle(mirror::String::AllocFromModifiedUtf8(self, name)));
@@ -665,7 +671,7 @@
const uint8_t* annotation = annotation_item->annotation_;
uint32_t type_index = DecodeUnsignedLeb128(&annotation);
mirror::Class* resolved_class = Runtime::Current()->GetClassLinker()->ResolveType(
- klass->GetDexFile(), type_index, klass.Get());
+ klass->GetDexFile(), dex::TypeIndex(type_index), klass.Get());
if (resolved_class == nullptr) {
std::string temp;
LOG(WARNING) << StringPrintf("Unable to resolve %s annotation class %d",
@@ -1340,12 +1346,16 @@
case kDouble: field->SetDouble<kTransactionActive>(field->GetDeclaringClass(), jval_.d); break;
case kNull: field->SetObject<kTransactionActive>(field->GetDeclaringClass(), nullptr); break;
case kString: {
- mirror::String* resolved = linker_->ResolveString(dex_file_, jval_.i, *dex_cache_);
+ mirror::String* resolved = linker_->ResolveString(dex_file_,
+ dex::StringIndex(jval_.i),
+ *dex_cache_);
field->SetObject<kTransactionActive>(field->GetDeclaringClass(), resolved);
break;
}
case kType: {
- mirror::Class* resolved = linker_->ResolveType(dex_file_, jval_.i, *dex_cache_,
+ mirror::Class* resolved = linker_->ResolveType(dex_file_,
+ dex::TypeIndex(jval_.i),
+ *dex_cache_,
*class_loader_);
field->SetObject<kTransactionActive>(field->GetDeclaringClass(), resolved);
break;
diff --git a/runtime/dex_file_test.cc b/runtime/dex_file_test.cc
index 8e1501f..0fec856 100644
--- a/runtime/dex_file_test.cc
+++ b/runtime/dex_file_test.cc
@@ -415,14 +415,14 @@
TEST_F(DexFileTest, FindTypeId) {
for (size_t i = 0; i < java_lang_dex_file_->NumTypeIds(); i++) {
- const char* type_str = java_lang_dex_file_->StringByTypeIdx(i);
+ const char* type_str = java_lang_dex_file_->StringByTypeIdx(dex::TypeIndex(i));
const DexFile::StringId* type_str_id = java_lang_dex_file_->FindStringId(type_str);
ASSERT_TRUE(type_str_id != nullptr);
- uint32_t type_str_idx = java_lang_dex_file_->GetIndexForStringId(*type_str_id);
+ dex::StringIndex type_str_idx = java_lang_dex_file_->GetIndexForStringId(*type_str_id);
const DexFile::TypeId* type_id = java_lang_dex_file_->FindTypeId(type_str_idx);
ASSERT_EQ(type_id, java_lang_dex_file_->FindTypeId(type_str));
ASSERT_TRUE(type_id != nullptr);
- EXPECT_EQ(java_lang_dex_file_->GetIndexForTypeId(*type_id), i);
+ EXPECT_EQ(java_lang_dex_file_->GetIndexForTypeId(*type_id).index_, i);
}
}
@@ -430,7 +430,7 @@
for (size_t i = 0; i < java_lang_dex_file_->NumProtoIds(); i++) {
const DexFile::ProtoId& to_find = java_lang_dex_file_->GetProtoId(i);
const DexFile::TypeList* to_find_tl = java_lang_dex_file_->GetProtoParameters(to_find);
- std::vector<uint16_t> to_find_types;
+ std::vector<dex::TypeIndex> to_find_types;
if (to_find_tl != nullptr) {
for (size_t j = 0; j < to_find_tl->Size(); j++) {
to_find_types.push_back(to_find_tl->GetTypeItem(j).type_idx_);
diff --git a/runtime/dex_file_types.h b/runtime/dex_file_types.h
new file mode 100644
index 0000000..bd779c4
--- /dev/null
+++ b/runtime/dex_file_types.h
@@ -0,0 +1,115 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_RUNTIME_DEX_FILE_TYPES_H_
+#define ART_RUNTIME_DEX_FILE_TYPES_H_
+
+#include <limits>
+#include <ostream>
+
+namespace art {
+namespace dex {
+
+class StringIndex {
+ public:
+ uint32_t index_;
+
+ constexpr StringIndex() : index_(std::numeric_limits<decltype(index_)>::max()) {}
+ explicit constexpr StringIndex(uint32_t idx) : index_(idx) {}
+
+ bool IsValid() const {
+ return index_ != std::numeric_limits<decltype(index_)>::max();
+ }
+ static StringIndex Invalid() {
+ return StringIndex(std::numeric_limits<decltype(index_)>::max());
+ }
+
+ bool operator==(const StringIndex& other) const {
+ return index_ == other.index_;
+ }
+ bool operator!=(const StringIndex& other) const {
+ return index_ != other.index_;
+ }
+ bool operator<(const StringIndex& other) const {
+ return index_ < other.index_;
+ }
+ bool operator<=(const StringIndex& other) const {
+ return index_ <= other.index_;
+ }
+ bool operator>(const StringIndex& other) const {
+ return index_ > other.index_;
+ }
+ bool operator>=(const StringIndex& other) const {
+ return index_ >= other.index_;
+ }
+};
+std::ostream& operator<<(std::ostream& os, const StringIndex& index);
+
+class TypeIndex {
+ public:
+ uint16_t index_;
+
+ constexpr TypeIndex() : index_(std::numeric_limits<decltype(index_)>::max()) {}
+ explicit constexpr TypeIndex(uint16_t idx) : index_(idx) {}
+
+ bool IsValid() const {
+ return index_ != std::numeric_limits<decltype(index_)>::max();
+ }
+ static TypeIndex Invalid() {
+ return TypeIndex(std::numeric_limits<decltype(index_)>::max());
+ }
+
+ bool operator==(const TypeIndex& other) const {
+ return index_ == other.index_;
+ }
+ bool operator!=(const TypeIndex& other) const {
+ return index_ != other.index_;
+ }
+ bool operator<(const TypeIndex& other) const {
+ return index_ < other.index_;
+ }
+ bool operator<=(const TypeIndex& other) const {
+ return index_ <= other.index_;
+ }
+ bool operator>(const TypeIndex& other) const {
+ return index_ > other.index_;
+ }
+ bool operator>=(const TypeIndex& other) const {
+ return index_ >= other.index_;
+ }
+};
+std::ostream& operator<<(std::ostream& os, const TypeIndex& index);
+
+} // namespace dex
+} // namespace art
+
+namespace std {
+
+template<> struct hash<art::dex::StringIndex> {
+ size_t operator()(const art::dex::StringIndex& index) const {
+ return hash<uint32_t>()(index.index_);
+ }
+};
+
+template<> struct hash<art::dex::TypeIndex> {
+ size_t operator()(const art::dex::TypeIndex& index) const {
+ return hash<uint16_t>()(index.index_);
+ }
+};
+
+} // namespace std
+
+#endif // ART_RUNTIME_DEX_FILE_TYPES_H_
diff --git a/runtime/dex_file_verifier.cc b/runtime/dex_file_verifier.cc
index be25803..a3ab9fa 100644
--- a/runtime/dex_file_verifier.cc
+++ b/runtime/dex_file_verifier.cc
@@ -19,9 +19,11 @@
#include <inttypes.h>
#include <zlib.h>
+#include <limits>
#include <memory>
-#include "base/stringprintf.h"
+#include "android-base/stringprintf.h"
+
#include "dex_file-inl.h"
#include "experimental_flags.h"
#include "leb128.h"
@@ -31,6 +33,19 @@
namespace art {
+using android::base::StringAppendV;
+using android::base::StringPrintf;
+
+static constexpr uint32_t kTypeIdLimit = std::numeric_limits<uint16_t>::max();
+
+static bool IsValidOrNoTypeId(uint16_t low, uint16_t high) {
+ return (high == 0) || ((high == 0xffffU) && (low == 0xffffU));
+}
+
+static bool IsValidTypeId(uint16_t low ATTRIBUTE_UNUSED, uint16_t high) {
+ return (high == 0);
+}
+
static uint32_t MapTypeToBitMask(uint32_t map_type) {
switch (map_type) {
case DexFile::kDexTypeHeaderItem: return 1 << 0;
@@ -69,20 +84,19 @@
return true;
}
-const char* DexFileVerifier::CheckLoadStringByIdx(uint32_t idx, const char* error_string) {
- if (UNLIKELY(!CheckIndex(idx, dex_file_->NumStringIds(), error_string))) {
+const char* DexFileVerifier::CheckLoadStringByIdx(dex::StringIndex idx, const char* error_string) {
+ if (UNLIKELY(!CheckIndex(idx.index_, dex_file_->NumStringIds(), error_string))) {
return nullptr;
}
return dex_file_->StringDataByIdx(idx);
}
-const char* DexFileVerifier::CheckLoadStringByTypeIdx(uint32_t type_idx, const char* error_string) {
- if (UNLIKELY(!CheckIndex(type_idx, dex_file_->NumTypeIds(), error_string))) {
+const char* DexFileVerifier::CheckLoadStringByTypeIdx(dex::TypeIndex type_idx,
+ const char* error_string) {
+ if (UNLIKELY(!CheckIndex(type_idx.index_, dex_file_->NumTypeIds(), error_string))) {
return nullptr;
}
- const DexFile::TypeId& type_id = dex_file_->GetTypeId(type_idx);
- uint32_t idx = type_id.descriptor_idx_;
- return CheckLoadStringByIdx(idx, error_string);
+ return CheckLoadStringByIdx(dex_file_->GetTypeId(type_idx).descriptor_idx_, error_string);
}
const DexFile::FieldId* DexFileVerifier::CheckLoadFieldId(uint32_t idx, const char* error_string) {
@@ -525,7 +539,7 @@
bool DexFileVerifier::CheckClassDataItemField(uint32_t idx,
uint32_t access_flags,
uint32_t class_access_flags,
- uint16_t class_type_index,
+ dex::TypeIndex class_type_index,
bool expect_static) {
// Check for overflow.
if (!CheckIndex(idx, header_->field_ids_size_, "class_data_item field_idx")) {
@@ -533,13 +547,13 @@
}
// Check that it's the right class.
- uint16_t my_class_index =
+ dex::TypeIndex my_class_index =
(reinterpret_cast<const DexFile::FieldId*>(begin_ + header_->field_ids_off_) + idx)->
class_idx_;
if (class_type_index != my_class_index) {
ErrorStringPrintf("Field's class index unexpected, %" PRIu16 "vs %" PRIu16,
- my_class_index,
- class_type_index);
+ my_class_index.index_,
+ class_type_index.index_);
return false;
}
@@ -563,7 +577,7 @@
bool DexFileVerifier::CheckClassDataItemMethod(uint32_t idx,
uint32_t access_flags,
uint32_t class_access_flags,
- uint16_t class_type_index,
+ dex::TypeIndex class_type_index,
uint32_t code_offset,
std::unordered_set<uint32_t>* direct_method_indexes,
bool expect_direct) {
@@ -574,13 +588,13 @@
}
// Check that it's the right class.
- uint16_t my_class_index =
+ dex::TypeIndex my_class_index =
(reinterpret_cast<const DexFile::MethodId*>(begin_ + header_->method_ids_off_) + idx)->
class_idx_;
if (class_type_index != my_class_index) {
- ErrorStringPrintf("Method's class index unexpected, %" PRIu16 "vs %" PRIu16,
- my_class_index,
- class_type_index);
+ ErrorStringPrintf("Method's class index unexpected, %" PRIu16 " vs %" PRIu16,
+ my_class_index.index_,
+ class_type_index.index_);
return false;
}
@@ -789,7 +803,7 @@
bool DexFileVerifier::FindClassFlags(uint32_t index,
bool is_field,
- uint16_t* class_type_index,
+ dex::TypeIndex* class_type_index,
uint32_t* class_access_flags) {
DCHECK(class_type_index != nullptr);
DCHECK(class_access_flags != nullptr);
@@ -811,7 +825,7 @@
}
// Check if that is valid.
- if (*class_type_index >= header_->type_ids_size_) {
+ if (class_type_index->index_ >= header_->type_ids_size_) {
return false;
}
@@ -836,7 +850,7 @@
uint32_t curr_index,
uint32_t prev_index,
bool* have_class,
- uint16_t* class_type_index,
+ dex::TypeIndex* class_type_index,
uint32_t* class_access_flags) {
if (curr_index < prev_index) {
ErrorStringPrintf("out-of-order %s indexes %" PRIu32 " and %" PRIu32,
@@ -862,7 +876,7 @@
template <bool kStatic>
bool DexFileVerifier::CheckIntraClassDataItemFields(ClassDataItemIterator* it,
bool* have_class,
- uint16_t* class_type_index,
+ dex::TypeIndex* class_type_index,
uint32_t* class_access_flags) {
DCHECK(it != nullptr);
// These calls use the raw access flags to check whether the whole dex field is valid.
@@ -897,7 +911,7 @@
ClassDataItemIterator* it,
std::unordered_set<uint32_t>* direct_method_indexes,
bool* have_class,
- uint16_t* class_type_index,
+ dex::TypeIndex* class_type_index,
uint32_t* class_access_flags) {
uint32_t prev_index = 0;
for (; kDirect ? it->HasNextDirectMethod() : it->HasNextVirtualMethod(); it->Next()) {
@@ -935,7 +949,7 @@
// So we need to explicitly search with the first item we find (either field or method), and then,
// as the lookup is expensive, cache the result.
bool have_class = false;
- uint16_t class_type_index;
+ dex::TypeIndex class_type_index;
uint32_t class_access_flags;
// Check fields.
@@ -1682,26 +1696,27 @@
return true;
}
-uint16_t DexFileVerifier::FindFirstClassDataDefiner(const uint8_t* ptr, bool* success) {
+dex::TypeIndex DexFileVerifier::FindFirstClassDataDefiner(const uint8_t* ptr, bool* success) {
ClassDataItemIterator it(*dex_file_, ptr);
*success = true;
if (it.HasNextStaticField() || it.HasNextInstanceField()) {
LOAD_FIELD(field, it.GetMemberIndex(), "first_class_data_definer field_id",
- *success = false; return DexFile::kDexNoIndex16)
+ *success = false; return dex::TypeIndex(DexFile::kDexNoIndex16))
return field->class_idx_;
}
if (it.HasNextDirectMethod() || it.HasNextVirtualMethod()) {
LOAD_METHOD(method, it.GetMemberIndex(), "first_class_data_definer method_id",
- *success = false; return DexFile::kDexNoIndex16)
+ *success = false; return dex::TypeIndex(DexFile::kDexNoIndex16))
return method->class_idx_;
}
- return DexFile::kDexNoIndex16;
+ return dex::TypeIndex(DexFile::kDexNoIndex16);
}
-uint16_t DexFileVerifier::FindFirstAnnotationsDirectoryDefiner(const uint8_t* ptr, bool* success) {
+dex::TypeIndex DexFileVerifier::FindFirstAnnotationsDirectoryDefiner(const uint8_t* ptr,
+ bool* success) {
const DexFile::AnnotationsDirectoryItem* item =
reinterpret_cast<const DexFile::AnnotationsDirectoryItem*>(ptr);
*success = true;
@@ -1709,25 +1724,25 @@
if (item->fields_size_ != 0) {
DexFile::FieldAnnotationsItem* field_items = (DexFile::FieldAnnotationsItem*) (item + 1);
LOAD_FIELD(field, field_items[0].field_idx_, "first_annotations_dir_definer field_id",
- *success = false; return DexFile::kDexNoIndex16)
+ *success = false; return dex::TypeIndex(DexFile::kDexNoIndex16))
return field->class_idx_;
}
if (item->methods_size_ != 0) {
DexFile::MethodAnnotationsItem* method_items = (DexFile::MethodAnnotationsItem*) (item + 1);
LOAD_METHOD(method, method_items[0].method_idx_, "first_annotations_dir_definer method id",
- *success = false; return DexFile::kDexNoIndex16)
+ *success = false; return dex::TypeIndex(DexFile::kDexNoIndex16))
return method->class_idx_;
}
if (item->parameters_size_ != 0) {
DexFile::ParameterAnnotationsItem* parameter_items = (DexFile::ParameterAnnotationsItem*) (item + 1);
LOAD_METHOD(method, parameter_items[0].method_idx_, "first_annotations_dir_definer method id",
- *success = false; return DexFile::kDexNoIndex16)
+ *success = false; return dex::TypeIndex(DexFile::kDexNoIndex16))
return method->class_idx_;
}
- return DexFile::kDexNoIndex16;
+ return dex::TypeIndex(DexFile::kDexNoIndex16);
}
bool DexFileVerifier::CheckInterStringIdItem() {
@@ -1769,7 +1784,8 @@
const DexFile::TypeId* prev_item = reinterpret_cast<const DexFile::TypeId*>(previous_item_);
if (UNLIKELY(prev_item->descriptor_idx_ >= item->descriptor_idx_)) {
ErrorStringPrintf("Out-of-order type_ids: %x then %x",
- prev_item->descriptor_idx_, item->descriptor_idx_);
+ prev_item->descriptor_idx_.index_,
+ item->descriptor_idx_.index_);
return false;
}
}
@@ -1788,6 +1804,12 @@
return false;
}
+ // Check that return type is representable as a uint16_t;
+ if (UNLIKELY(!IsValidOrNoTypeId(item->return_type_idx_.index_, item->pad_))) {
+ ErrorStringPrintf("proto with return type idx outside uint16_t range '%x:%x'",
+ item->pad_, item->return_type_idx_.index_);
+ return false;
+ }
// Check the return type and advance the shorty.
LOAD_STRING_BY_TYPE(return_type, item->return_type_idx_, "inter_proto_id_item return_type_idx")
if (!CheckShortyDescriptorMatch(*shorty, return_type, true)) {
@@ -1797,7 +1819,8 @@
DexFileParameterIterator it(*dex_file_, *item);
while (it.HasNext() && *shorty != '\0') {
- if (!CheckIndex(it.GetTypeIdx(), dex_file_->NumTypeIds(),
+ if (!CheckIndex(it.GetTypeIdx().index_,
+ dex_file_->NumTypeIds(),
"inter_proto_id_item shorty type_idx")) {
return false;
}
@@ -1824,10 +1847,10 @@
DexFileParameterIterator prev_it(*dex_file_, *prev);
while (curr_it.HasNext() && prev_it.HasNext()) {
- uint16_t prev_idx = prev_it.GetTypeIdx();
- uint16_t curr_idx = curr_it.GetTypeIdx();
- DCHECK_NE(prev_idx, DexFile::kDexNoIndex16);
- DCHECK_NE(curr_idx, DexFile::kDexNoIndex16);
+ dex::TypeIndex prev_idx = prev_it.GetTypeIdx();
+ dex::TypeIndex curr_idx = curr_it.GetTypeIdx();
+ DCHECK_NE(prev_idx, dex::TypeIndex(DexFile::kDexNoIndex16));
+ DCHECK_NE(curr_idx, dex::TypeIndex(DexFile::kDexNoIndex16));
if (prev_idx < curr_idx) {
break;
@@ -1949,9 +1972,21 @@
bool DexFileVerifier::CheckInterClassDefItem() {
const DexFile::ClassDef* item = reinterpret_cast<const DexFile::ClassDef*>(ptr_);
+ // Check that class_idx_ is representable as a uint16_t;
+ if (UNLIKELY(!IsValidTypeId(item->class_idx_.index_, item->pad1_))) {
+ ErrorStringPrintf("class with type idx outside uint16_t range '%x:%x'", item->pad1_,
+ item->class_idx_.index_);
+ return false;
+ }
+ // Check that superclass_idx_ is representable as a uint16_t;
+ if (UNLIKELY(!IsValidOrNoTypeId(item->superclass_idx_.index_, item->pad2_))) {
+ ErrorStringPrintf("class with superclass type idx outside uint16_t range '%x:%x'", item->pad2_,
+ item->superclass_idx_.index_);
+ return false;
+ }
// Check for duplicate class def.
if (defined_classes_.find(item->class_idx_) != defined_classes_.end()) {
- ErrorStringPrintf("Redefinition of class with type idx: '%d'", item->class_idx_);
+ ErrorStringPrintf("Redefinition of class with type idx: '%d'", item->class_idx_.index_);
return false;
}
defined_classes_.insert(item->class_idx_);
@@ -1985,12 +2020,13 @@
return false;
}
- if (item->superclass_idx_ != DexFile::kDexNoIndex16) {
+ if (item->superclass_idx_.IsValid()) {
if (header_->GetVersion() >= DexFile::kClassDefinitionOrderEnforcedVersion) {
// Check that a class does not inherit from itself directly (by having
// the same type idx as its super class).
if (UNLIKELY(item->superclass_idx_ == item->class_idx_)) {
- ErrorStringPrintf("Class with same type idx as its superclass: '%d'", item->class_idx_);
+ ErrorStringPrintf("Class with same type idx as its superclass: '%d'",
+ item->class_idx_.index_);
return false;
}
@@ -2004,8 +2040,8 @@
ErrorStringPrintf("Invalid class definition ordering:"
" class with type idx: '%d' defined before"
" superclass with type idx: '%d'",
- item->class_idx_,
- item->superclass_idx_);
+ item->class_idx_.index_,
+ item->superclass_idx_.index_);
return false;
}
}
@@ -2029,7 +2065,7 @@
// same type idx as one of its immediate implemented interfaces).
if (UNLIKELY(interfaces->GetTypeItem(i).type_idx_ == item->class_idx_)) {
ErrorStringPrintf("Class with same type idx as implemented interface: '%d'",
- item->class_idx_);
+ item->class_idx_.index_);
return false;
}
@@ -2044,8 +2080,8 @@
ErrorStringPrintf("Invalid class definition ordering:"
" class with type idx: '%d' defined before"
" implemented interface with type idx: '%d'",
- item->class_idx_,
- interfaces->GetTypeItem(i).type_idx_);
+ item->class_idx_.index_,
+ interfaces->GetTypeItem(i).type_idx_.index_);
return false;
}
}
@@ -2065,9 +2101,9 @@
* practice the number of interfaces implemented by any given class is low.
*/
for (uint32_t i = 1; i < size; i++) {
- uint32_t idx1 = interfaces->GetTypeItem(i).type_idx_;
+ dex::TypeIndex idx1 = interfaces->GetTypeItem(i).type_idx_;
for (uint32_t j =0; j < i; j++) {
- uint32_t idx2 = interfaces->GetTypeItem(j).type_idx_;
+ dex::TypeIndex idx2 = interfaces->GetTypeItem(j).type_idx_;
if (UNLIKELY(idx1 == idx2)) {
ErrorStringPrintf("Duplicate interface: '%s'", dex_file_->StringByTypeIdx(idx1));
return false;
@@ -2080,11 +2116,12 @@
if (item->class_data_off_ != 0) {
const uint8_t* data = begin_ + item->class_data_off_;
bool success;
- uint16_t data_definer = FindFirstClassDataDefiner(data, &success);
+ dex::TypeIndex data_definer = FindFirstClassDataDefiner(data, &success);
if (!success) {
return false;
}
- if (UNLIKELY((data_definer != item->class_idx_) && (data_definer != DexFile::kDexNoIndex16))) {
+ if (UNLIKELY((data_definer != item->class_idx_) &&
+ (data_definer != dex::TypeIndex(DexFile::kDexNoIndex16)))) {
ErrorStringPrintf("Invalid class_data_item");
return false;
}
@@ -2099,12 +2136,12 @@
}
const uint8_t* data = begin_ + item->annotations_off_;
bool success;
- uint16_t annotations_definer = FindFirstAnnotationsDirectoryDefiner(data, &success);
+ dex::TypeIndex annotations_definer = FindFirstAnnotationsDirectoryDefiner(data, &success);
if (!success) {
return false;
}
if (UNLIKELY((annotations_definer != item->class_idx_) &&
- (annotations_definer != DexFile::kDexNoIndex16))) {
+ (annotations_definer != dex::TypeIndex(DexFile::kDexNoIndex16)))) {
ErrorStringPrintf("Invalid annotations_directory_item");
return false;
}
@@ -2165,7 +2202,7 @@
bool DexFileVerifier::CheckInterClassDataItem() {
ClassDataItemIterator it(*dex_file_, ptr_);
bool success;
- uint16_t defining_class = FindFirstClassDataDefiner(ptr_, &success);
+ dex::TypeIndex defining_class = FindFirstClassDataDefiner(ptr_, &success);
if (!success) {
return false;
}
@@ -2197,7 +2234,7 @@
const DexFile::AnnotationsDirectoryItem* item =
reinterpret_cast<const DexFile::AnnotationsDirectoryItem*>(ptr_);
bool success;
- uint16_t defining_class = FindFirstAnnotationsDirectoryDefiner(ptr_, &success);
+ dex::TypeIndex defining_class = FindFirstAnnotationsDirectoryDefiner(ptr_, &success);
if (!success) {
return false;
}
@@ -2315,6 +2352,14 @@
break;
}
case DexFile::kDexTypeClassDefItem: {
+ // There shouldn't be more class definitions than type ids allow.
+ // This check should be redundant, since there are checks that the
+ // class_idx_ is within range and that there is only one definition
+ // for a given type id.
+ if (i > kTypeIdLimit) {
+ ErrorStringPrintf("Too many class definition items");
+ return false;
+ }
if (!CheckInterClassDefItem()) {
return false;
}
@@ -2333,6 +2378,14 @@
break;
}
case DexFile::kDexTypeClassDataItem: {
+ // There shouldn't be more class data than type ids allow.
+ // This check should be redundant, since there are checks that the
+ // class_idx_ is within range and that there is only one definition
+ // for a given type id.
+ if (i > kTypeIdLimit) {
+ ErrorStringPrintf("Too many class data items");
+ return false;
+ }
if (!CheckInterClassDataItem()) {
return false;
}
@@ -2450,14 +2503,15 @@
static std::string GetStringOrError(const uint8_t* const begin,
const DexFile::Header* const header,
- uint32_t string_idx) {
+ dex::StringIndex string_idx) {
// The `string_idx` is not guaranteed to be valid yet.
- if (header->string_ids_size_ <= string_idx) {
+ if (header->string_ids_size_ <= string_idx.index_) {
return "(error)";
}
const DexFile::StringId* string_id =
- reinterpret_cast<const DexFile::StringId*>(begin + header->string_ids_off_) + string_idx;
+ reinterpret_cast<const DexFile::StringId*>(begin + header->string_ids_off_)
+ + string_idx.index_;
// Assume that the data is OK at this point. String data has been checked at this point.
@@ -2471,15 +2525,15 @@
static std::string GetClassOrError(const uint8_t* const begin,
const DexFile::Header* const header,
- uint32_t class_idx) {
+ dex::TypeIndex class_idx) {
// The `class_idx` is either `FieldId::class_idx_` or `MethodId::class_idx_` and
// it has already been checked in `DexFileVerifier::CheckClassDataItemField()`
// or `DexFileVerifier::CheckClassDataItemMethod()`, respectively, to match
// a valid defining class.
- CHECK_LT(class_idx, header->type_ids_size_);
+ CHECK_LT(class_idx.index_, header->type_ids_size_);
const DexFile::TypeId* type_id =
- reinterpret_cast<const DexFile::TypeId*>(begin + header->type_ids_off_) + class_idx;
+ reinterpret_cast<const DexFile::TypeId*>(begin + header->type_ids_off_) + class_idx.index_;
// Assume that the data is OK at this point. Type id offsets have been checked at this point.
@@ -2614,7 +2668,7 @@
}
uint32_t string_idx =
(reinterpret_cast<const DexFile::MethodId*>(begin + header->method_ids_off_) +
- method_index)->name_idx_;
+ method_index)->name_idx_.index_;
if (string_idx >= header->string_ids_size_) {
*error_msg = "String index not available for method flags verification";
return false;
diff --git a/runtime/dex_file_verifier.h b/runtime/dex_file_verifier.h
index 133e432..0327367 100644
--- a/runtime/dex_file_verifier.h
+++ b/runtime/dex_file_verifier.h
@@ -20,6 +20,7 @@
#include <unordered_set>
#include "dex_file.h"
+#include "dex_file_types.h"
#include "safe_map.h"
namespace art {
@@ -76,12 +77,12 @@
bool CheckClassDataItemField(uint32_t idx,
uint32_t access_flags,
uint32_t class_access_flags,
- uint16_t class_type_index,
+ dex::TypeIndex class_type_index,
bool expect_static);
bool CheckClassDataItemMethod(uint32_t idx,
uint32_t access_flags,
uint32_t class_access_flags,
- uint16_t class_type_index,
+ dex::TypeIndex class_type_index,
uint32_t code_offset,
std::unordered_set<uint32_t>* direct_method_indexes,
bool expect_direct);
@@ -90,7 +91,7 @@
uint32_t curr_index,
uint32_t prev_index,
bool* have_class,
- uint16_t* class_type_index,
+ dex::TypeIndex* class_type_index,
uint32_t* class_access_flags);
bool CheckPadding(size_t offset, uint32_t aligned_offset);
@@ -104,7 +105,7 @@
template <bool kStatic>
bool CheckIntraClassDataItemFields(ClassDataItemIterator* it,
bool* have_class,
- uint16_t* class_type_index,
+ dex::TypeIndex* class_type_index,
uint32_t* class_access_flags);
// Check all methods of the given type from the given iterator. Load the class data from the first
// method, if necessary (and return it), or use the given values.
@@ -112,7 +113,7 @@
bool CheckIntraClassDataItemMethods(ClassDataItemIterator* it,
std::unordered_set<uint32_t>* direct_method_indexes,
bool* have_class,
- uint16_t* class_type_index,
+ dex::TypeIndex* class_type_index,
uint32_t* class_access_flags);
bool CheckIntraCodeItem();
@@ -130,8 +131,8 @@
// Note: as sometimes kDexNoIndex16, being 0xFFFF, is a valid return value, we need an
// additional out parameter to signal any errors loading an index.
- uint16_t FindFirstClassDataDefiner(const uint8_t* ptr, bool* success);
- uint16_t FindFirstAnnotationsDirectoryDefiner(const uint8_t* ptr, bool* success);
+ dex::TypeIndex FindFirstClassDataDefiner(const uint8_t* ptr, bool* success);
+ dex::TypeIndex FindFirstAnnotationsDirectoryDefiner(const uint8_t* ptr, bool* success);
bool CheckInterStringIdItem();
bool CheckInterTypeIdItem();
@@ -149,8 +150,8 @@
// Load a string by (type) index. Checks whether the index is in bounds, printing the error if
// not. If there is an error, null is returned.
- const char* CheckLoadStringByIdx(uint32_t idx, const char* error_fmt);
- const char* CheckLoadStringByTypeIdx(uint32_t type_idx, const char* error_fmt);
+ const char* CheckLoadStringByIdx(dex::StringIndex idx, const char* error_fmt);
+ const char* CheckLoadStringByTypeIdx(dex::TypeIndex type_idx, const char* error_fmt);
// Load a field/method Id by index. Checks whether the index is in bounds, printing the error if
// not. If there is an error, null is returned.
@@ -168,7 +169,7 @@
// linear search. The output values should thus be cached by the caller.
bool FindClassFlags(uint32_t index,
bool is_field,
- uint16_t* class_type_index,
+ dex::TypeIndex* class_type_index,
uint32_t* class_access_flags);
// Check validity of the given access flags, interpreted for a field in the context of a class
diff --git a/runtime/dex_file_verifier_test.cc b/runtime/dex_file_verifier_test.cc
index 3801c22..f14b1d5 100644
--- a/runtime/dex_file_verifier_test.cc
+++ b/runtime/dex_file_verifier_test.cc
@@ -26,6 +26,7 @@
#include "base/macros.h"
#include "common_runtime_test.h"
#include "dex_file-inl.h"
+#include "dex_file_types.h"
#include "leb128.h"
#include "scoped_thread_state_change-inl.h"
#include "thread-inl.h"
@@ -155,7 +156,7 @@
"method_id_class_idx",
[](DexFile* dex_file) {
DexFile::MethodId* method_id = const_cast<DexFile::MethodId*>(&dex_file->GetMethodId(0));
- method_id->class_idx_ = 0xFF;
+ method_id->class_idx_ = dex::TypeIndex(0xFF);
},
"could not find declaring class for direct method index 0");
@@ -175,7 +176,7 @@
"method_id_name_idx",
[](DexFile* dex_file) {
DexFile::MethodId* method_id = const_cast<DexFile::MethodId*>(&dex_file->GetMethodId(0));
- method_id->name_idx_ = 0xFF;
+ method_id->name_idx_ = dex::StringIndex(0xFF);
},
"String index not available for method flags verification");
}
@@ -246,7 +247,7 @@
while (it.HasNextDirectMethod() || it.HasNextVirtualMethod()) {
uint32_t method_index = it.GetMemberIndex();
- uint32_t name_index = dex_file->GetMethodId(method_index).name_idx_;
+ dex::StringIndex name_index = dex_file->GetMethodId(method_index).name_idx_;
const DexFile::StringId& string_id = dex_file->GetStringId(name_index);
const char* str = dex_file->GetStringData(string_id);
if (strcmp(name, str) == 0) {
@@ -634,7 +635,7 @@
uint32_t method_idx;
FindMethodData(dex_file, "foo", &method_idx);
auto* method_id = const_cast<DexFile::MethodId*>(&dex_file->GetMethodId(method_idx));
- method_id->name_idx_ = dex_file->NumStringIds();
+ method_id->name_idx_ = dex::StringIndex(dex_file->NumStringIds());
},
"Method may have only one of public/protected/private, LMethodFlags;.(error)");
}
@@ -855,7 +856,7 @@
while (it.HasNextStaticField() || it.HasNextInstanceField()) {
uint32_t field_index = it.GetMemberIndex();
- uint32_t name_index = dex_file->GetFieldId(field_index).name_idx_;
+ dex::StringIndex name_index = dex_file->GetFieldId(field_index).name_idx_;
const DexFile::StringId& string_id = dex_file->GetStringId(name_index);
const char* str = dex_file->GetStringData(string_id);
if (strcmp(name, str) == 0) {
@@ -1450,12 +1451,12 @@
// Swap the proto parameters and shorties to break the ordering.
std::swap(const_cast<uint32_t&>(proto1.parameters_off_),
const_cast<uint32_t&>(proto2.parameters_off_));
- std::swap(const_cast<uint32_t&>(proto1.shorty_idx_),
- const_cast<uint32_t&>(proto2.shorty_idx_));
+ std::swap(const_cast<dex::StringIndex&>(proto1.shorty_idx_),
+ const_cast<dex::StringIndex&>(proto2.shorty_idx_));
} else {
// Copy the proto parameters and shorty to create duplicate proto id.
const_cast<uint32_t&>(proto1.parameters_off_) = proto2.parameters_off_;
- const_cast<uint32_t&>(proto1.shorty_idx_) = proto2.shorty_idx_;
+ const_cast<dex::StringIndex&>(proto1.shorty_idx_) = proto2.shorty_idx_;
}
},
"Out-of-order proto_id arguments");
diff --git a/runtime/dex_instruction.cc b/runtime/dex_instruction.cc
index c766b54..7b8974f 100644
--- a/runtime/dex_instruction.cc
+++ b/runtime/dex_instruction.cc
@@ -21,12 +21,15 @@
#include <iomanip>
#include <sstream>
-#include "base/stringprintf.h"
+#include "android-base/stringprintf.h"
+
#include "dex_file-inl.h"
#include "utils.h"
namespace art {
+using android::base::StringPrintf;
+
const char* const Instruction::kInstructionNames[] = {
#define INSTRUCTION_NAME(o, c, pname, f, i, a, v) pname,
#include "dex_instruction_list.h"
@@ -191,10 +194,11 @@
if (file != nullptr) {
uint32_t string_idx = VRegB_21c();
if (string_idx < file->NumStringIds()) {
- os << StringPrintf("const-string v%d, %s // string@%d",
- VRegA_21c(),
- PrintableString(file->StringDataByIdx(string_idx)).c_str(),
- string_idx);
+ os << StringPrintf(
+ "const-string v%d, %s // string@%d",
+ VRegA_21c(),
+ PrintableString(file->StringDataByIdx(dex::StringIndex(string_idx))).c_str(),
+ string_idx);
} else {
os << StringPrintf("const-string v%d, <<invalid-string-idx-%d>> // string@%d",
VRegA_21c(),
@@ -208,9 +212,9 @@
case CONST_CLASS:
case NEW_INSTANCE:
if (file != nullptr) {
- uint32_t type_idx = VRegB_21c();
- os << opcode << " v" << static_cast<int>(VRegA_21c()) << ", " << file->PrettyType(type_idx)
- << " // type@" << type_idx;
+ dex::TypeIndex type_idx(VRegB_21c());
+ os << opcode << " v" << static_cast<int>(VRegA_21c()) << ", "
+ << file->PrettyType(type_idx) << " // type@" << type_idx;
break;
}
FALLTHROUGH_INTENDED;
@@ -302,17 +306,19 @@
FALLTHROUGH_INTENDED;
case INSTANCE_OF:
if (file != nullptr) {
- uint32_t type_idx = VRegC_22c();
- os << opcode << " v" << static_cast<int>(VRegA_22c()) << ", v" << static_cast<int>(VRegB_22c()) << ", "
- << file->PrettyType(type_idx) << " // type@" << type_idx;
+ dex::TypeIndex type_idx(VRegC_22c());
+ os << opcode << " v" << static_cast<int>(VRegA_22c()) << ", v"
+ << static_cast<int>(VRegB_22c()) << ", " << file->PrettyType(type_idx)
+ << " // type@" << type_idx.index_;
break;
}
FALLTHROUGH_INTENDED;
case NEW_ARRAY:
if (file != nullptr) {
- uint32_t type_idx = VRegC_22c();
- os << opcode << " v" << static_cast<int>(VRegA_22c()) << ", v" << static_cast<int>(VRegB_22c()) << ", "
- << file->PrettyType(type_idx) << " // type@" << type_idx;
+ dex::TypeIndex type_idx(VRegC_22c());
+ os << opcode << " v" << static_cast<int>(VRegA_22c()) << ", v"
+ << static_cast<int>(VRegB_22c()) << ", " << file->PrettyType(type_idx)
+ << " // type@" << type_idx.index_;
break;
}
FALLTHROUGH_INTENDED;
@@ -331,11 +337,12 @@
uint32_t string_idx = VRegB_31c();
if (file != nullptr) {
if (string_idx < file->NumStringIds()) {
- os << StringPrintf("%s v%d, %s // string@%d",
- opcode,
- VRegA_31c(),
- PrintableString(file->StringDataByIdx(string_idx)).c_str(),
- string_idx);
+ os << StringPrintf(
+ "%s v%d, %s // string@%d",
+ opcode,
+ VRegA_31c(),
+ PrintableString(file->StringDataByIdx(dex::StringIndex(string_idx))).c_str(),
+ string_idx);
} else {
os << StringPrintf("%s v%d, <<invalid-string-idx-%d>> // string@%d",
opcode,
diff --git a/runtime/dex_instruction.h b/runtime/dex_instruction.h
index 99b9f9d..578550c 100644
--- a/runtime/dex_instruction.h
+++ b/runtime/dex_instruction.h
@@ -189,6 +189,7 @@
kVerifyVarArgRangeNonZero = 0x100000,
kVerifyRuntimeOnly = 0x200000,
kVerifyError = 0x400000,
+ kVerifyRegHPrototype = 0x800000
};
static constexpr uint32_t kMaxVarArgRegs = 5;
@@ -579,6 +580,10 @@
kVerifyRegCNewArray | kVerifyRegCType | kVerifyRegCWide));
}
+ int GetVerifyTypeArgumentH() const {
+ return (kInstructionVerifyFlags[Opcode()] & kVerifyRegHPrototype);
+ }
+
int GetVerifyExtraFlags() const {
return (kInstructionVerifyFlags[Opcode()] & (kVerifyArrayData | kVerifyBranchTarget |
kVerifySwitchTargets | kVerifyVarArg | kVerifyVarArgNonZero | kVerifyVarArgRange |
diff --git a/runtime/dex_instruction_list.h b/runtime/dex_instruction_list.h
index e537afe..ca2ce1d 100644
--- a/runtime/dex_instruction_list.h
+++ b/runtime/dex_instruction_list.h
@@ -269,8 +269,8 @@
V(0xF7, UNUSED_F7, "unused-f7", k10x, kIndexUnknown, 0, kVerifyError) \
V(0xF8, UNUSED_F8, "unused-f8", k10x, kIndexUnknown, 0, kVerifyError) \
V(0xF9, UNUSED_F9, "unused-f9", k10x, kIndexUnknown, 0, kVerifyError) \
- V(0xFA, INVOKE_POLYMORPHIC, "invoke-polymorphic", k45cc, kIndexMethodAndProtoRef, kContinue | kThrow | kInvoke, kVerifyRegBMethod | kVerifyVarArgNonZero | kExperimental) \
- V(0xFB, INVOKE_POLYMORPHIC_RANGE, "invoke-polymorphic/range", k4rcc, kIndexMethodAndProtoRef, kContinue | kThrow | kInvoke, kVerifyRegBMethod | kVerifyVarArgRangeNonZero | kExperimental) \
+ V(0xFA, INVOKE_POLYMORPHIC, "invoke-polymorphic", k45cc, kIndexMethodAndProtoRef, kContinue | kThrow | kInvoke, kVerifyRegBMethod | kVerifyVarArgNonZero | kVerifyRegHPrototype) \
+ V(0xFB, INVOKE_POLYMORPHIC_RANGE, "invoke-polymorphic/range", k4rcc, kIndexMethodAndProtoRef, kContinue | kThrow | kInvoke, kVerifyRegBMethod | kVerifyVarArgRangeNonZero | kVerifyRegHPrototype) \
V(0xFC, UNUSED_FC, "unused-fc", k10x, kIndexUnknown, 0, kVerifyError) \
V(0xFD, UNUSED_FD, "unused-fd", k10x, kIndexUnknown, 0, kVerifyError) \
V(0xFE, UNUSED_FE, "unused-fe", k10x, kIndexUnknown, 0, kVerifyError) \
diff --git a/runtime/elf_file.cc b/runtime/elf_file.cc
index 2ea7bb6..59b734f 100644
--- a/runtime/elf_file.cc
+++ b/runtime/elf_file.cc
@@ -20,9 +20,11 @@
#include <sys/types.h>
#include <unistd.h>
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
#include "arch/instruction_set.h"
#include "base/logging.h"
-#include "base/stringprintf.h"
#include "base/stl_util.h"
#include "base/unix_file/fd_file.h"
#include "elf_file_impl.h"
@@ -32,6 +34,8 @@
namespace art {
+using android::base::StringPrintf;
+
template <typename ElfTypes>
ElfFileImpl<ElfTypes>::ElfFileImpl(File* file, bool writable,
bool program_header_only,
@@ -1451,7 +1455,7 @@
section_headers_original_indexes.push_back(0);
continue;
}
- if (StartsWith(name, ".debug")
+ if (android::base::StartsWith(name, ".debug")
|| (strcmp(name, ".strtab") == 0)
|| (strcmp(name, ".symtab") == 0)) {
continue;
diff --git a/runtime/entrypoints/entrypoint_utils-inl.h b/runtime/entrypoints/entrypoint_utils-inl.h
index ed60f59..f6eeffc 100644
--- a/runtime/entrypoints/entrypoint_utils-inl.h
+++ b/runtime/entrypoints/entrypoint_utils-inl.h
@@ -129,7 +129,7 @@
template <const bool kAccessCheck>
ALWAYS_INLINE
-inline mirror::Class* CheckObjectAlloc(uint32_t type_idx,
+inline mirror::Class* CheckObjectAlloc(dex::TypeIndex type_idx,
ArtMethod* method,
Thread* self,
bool* slow_path) {
@@ -219,7 +219,7 @@
// check.
template <bool kAccessCheck, bool kInstrumented>
ALWAYS_INLINE
-inline mirror::Object* AllocObjectFromCode(uint32_t type_idx,
+inline mirror::Object* AllocObjectFromCode(dex::TypeIndex type_idx,
ArtMethod* method,
Thread* self,
gc::AllocatorType allocator_type) {
@@ -275,7 +275,7 @@
template <bool kAccessCheck>
ALWAYS_INLINE
-inline mirror::Class* CheckArrayAlloc(uint32_t type_idx,
+inline mirror::Class* CheckArrayAlloc(dex::TypeIndex type_idx,
int32_t component_count,
ArtMethod* method,
bool* slow_path) {
@@ -313,7 +313,7 @@
// check.
template <bool kAccessCheck, bool kInstrumented>
ALWAYS_INLINE
-inline mirror::Array* AllocArrayFromCode(uint32_t type_idx,
+inline mirror::Array* AllocArrayFromCode(dex::TypeIndex type_idx,
int32_t component_count,
ArtMethod* method,
Thread* self,
@@ -562,7 +562,7 @@
StackHandleScope<2> hs2(self);
HandleWrapperObjPtr<mirror::Object> h_this(hs2.NewHandleWrapper(this_object));
Handle<mirror::Class> h_referring_class(hs2.NewHandle(referrer->GetDeclaringClass()));
- const uint16_t method_type_idx =
+ const dex::TypeIndex method_type_idx =
h_referring_class->GetDexFile().GetMethodId(method_idx).class_idx_;
mirror::Class* method_reference_class = class_linker->ResolveType(method_type_idx, referrer);
if (UNLIKELY(method_reference_class == nullptr)) {
@@ -758,7 +758,8 @@
return resolved_method;
} else if (type == kSuper) {
// TODO This lookup is rather slow.
- uint16_t method_type_idx = referring_class->GetDexFile().GetMethodId(method_idx).class_idx_;
+ dex::TypeIndex method_type_idx =
+ referring_class->GetDexFile().GetMethodId(method_idx).class_idx_;
mirror::Class* method_reference_class =
referring_class->GetDexCache()->GetResolvedType(method_type_idx);
if (method_reference_class == nullptr) {
@@ -788,8 +789,11 @@
}
}
-inline mirror::Class* ResolveVerifyAndClinit(uint32_t type_idx, ArtMethod* referrer, Thread* self,
- bool can_run_clinit, bool verify_access) {
+inline mirror::Class* ResolveVerifyAndClinit(dex::TypeIndex type_idx,
+ ArtMethod* referrer,
+ Thread* self,
+ bool can_run_clinit,
+ bool verify_access) {
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
mirror::Class* klass = class_linker->ResolveType(type_idx, referrer);
if (UNLIKELY(klass == nullptr)) {
@@ -822,7 +826,7 @@
return h_class.Get();
}
-inline mirror::String* ResolveStringFromCode(ArtMethod* referrer, uint32_t string_idx) {
+inline mirror::String* ResolveStringFromCode(ArtMethod* referrer, dex::StringIndex string_idx) {
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
return class_linker->ResolveString(string_idx, referrer);
}
diff --git a/runtime/entrypoints/entrypoint_utils.cc b/runtime/entrypoints/entrypoint_utils.cc
index 1ccb4b0..5390165 100644
--- a/runtime/entrypoints/entrypoint_utils.cc
+++ b/runtime/entrypoints/entrypoint_utils.cc
@@ -38,7 +38,7 @@
namespace art {
-static inline mirror::Class* CheckFilledNewArrayAlloc(uint32_t type_idx,
+static inline mirror::Class* CheckFilledNewArrayAlloc(dex::TypeIndex type_idx,
int32_t component_count,
ArtMethod* referrer,
Thread* self,
@@ -82,10 +82,12 @@
}
// Helper function to allocate array for FILLED_NEW_ARRAY.
-mirror::Array* CheckAndAllocArrayFromCode(uint32_t type_idx, int32_t component_count,
- ArtMethod* referrer, Thread* self,
+mirror::Array* CheckAndAllocArrayFromCode(dex::TypeIndex type_idx,
+ int32_t component_count,
+ ArtMethod* referrer,
+ Thread* self,
bool access_check,
- gc::AllocatorType /* allocator_type */) {
+ gc::AllocatorType allocator_type ATTRIBUTE_UNUSED) {
mirror::Class* klass = CheckFilledNewArrayAlloc(type_idx, component_count, referrer, self,
access_check);
if (UNLIKELY(klass == nullptr)) {
@@ -101,12 +103,13 @@
}
// Helper function to allocate array for FILLED_NEW_ARRAY.
-mirror::Array* CheckAndAllocArrayFromCodeInstrumented(uint32_t type_idx,
- int32_t component_count,
- ArtMethod* referrer,
- Thread* self,
- bool access_check,
- gc::AllocatorType /* allocator_type */) {
+mirror::Array* CheckAndAllocArrayFromCodeInstrumented(
+ dex::TypeIndex type_idx,
+ int32_t component_count,
+ ArtMethod* referrer,
+ Thread* self,
+ bool access_check,
+ gc::AllocatorType allocator_type ATTRIBUTE_UNUSED) {
mirror::Class* klass = CheckFilledNewArrayAlloc(type_idx, component_count, referrer, self,
access_check);
if (UNLIKELY(klass == nullptr)) {
diff --git a/runtime/entrypoints/entrypoint_utils.h b/runtime/entrypoints/entrypoint_utils.h
index bcddfb0..7cc136e 100644
--- a/runtime/entrypoints/entrypoint_utils.h
+++ b/runtime/entrypoints/entrypoint_utils.h
@@ -23,6 +23,7 @@
#include "base/macros.h"
#include "base/mutex.h"
#include "dex_instruction.h"
+#include "dex_file_types.h"
#include "gc/allocator_type.h"
#include "handle.h"
#include "invoke_type.h"
@@ -45,7 +46,7 @@
class Thread;
template <const bool kAccessCheck>
-ALWAYS_INLINE inline mirror::Class* CheckObjectAlloc(uint32_t type_idx,
+ALWAYS_INLINE inline mirror::Class* CheckObjectAlloc(dex::TypeIndex type_idx,
ArtMethod* method,
Thread* self,
bool* slow_path)
@@ -63,7 +64,7 @@
// When verification/compiler hasn't been able to verify access, optionally perform an access
// check.
template <bool kAccessCheck, bool kInstrumented>
-ALWAYS_INLINE inline mirror::Object* AllocObjectFromCode(uint32_t type_idx,
+ALWAYS_INLINE inline mirror::Object* AllocObjectFromCode(dex::TypeIndex type_idx,
ArtMethod* method,
Thread* self,
gc::AllocatorType allocator_type)
@@ -89,7 +90,7 @@
template <bool kAccessCheck>
-ALWAYS_INLINE inline mirror::Class* CheckArrayAlloc(uint32_t type_idx,
+ALWAYS_INLINE inline mirror::Class* CheckArrayAlloc(dex::TypeIndex type_idx,
int32_t component_count,
ArtMethod* method,
bool* slow_path)
@@ -101,7 +102,7 @@
// When verification/compiler hasn't been able to verify access, optionally perform an access
// check.
template <bool kAccessCheck, bool kInstrumented>
-ALWAYS_INLINE inline mirror::Array* AllocArrayFromCode(uint32_t type_idx,
+ALWAYS_INLINE inline mirror::Array* AllocArrayFromCode(dex::TypeIndex type_idx,
int32_t component_count,
ArtMethod* method,
Thread* self,
@@ -118,19 +119,21 @@
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Roles::uninterruptible_);
-extern mirror::Array* CheckAndAllocArrayFromCode(uint32_t type_idx, int32_t component_count,
- ArtMethod* method, Thread* self,
- bool access_check,
- gc::AllocatorType allocator_type)
+mirror::Array* CheckAndAllocArrayFromCode(dex::TypeIndex type_idx,
+ int32_t component_count,
+ ArtMethod* method,
+ Thread* self,
+ bool access_check,
+ gc::AllocatorType allocator_type)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Roles::uninterruptible_);
-extern mirror::Array* CheckAndAllocArrayFromCodeInstrumented(uint32_t type_idx,
- int32_t component_count,
- ArtMethod* method,
- Thread* self,
- bool access_check,
- gc::AllocatorType allocator_type)
+mirror::Array* CheckAndAllocArrayFromCodeInstrumented(dex::TypeIndex type_idx,
+ int32_t component_count,
+ ArtMethod* method,
+ Thread* self,
+ bool access_check,
+ gc::AllocatorType allocator_type)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Roles::uninterruptible_);
@@ -177,7 +180,7 @@
InvokeType type)
REQUIRES_SHARED(Locks::mutator_lock_);
-inline mirror::Class* ResolveVerifyAndClinit(uint32_t type_idx,
+inline mirror::Class* ResolveVerifyAndClinit(dex::TypeIndex type_idx,
ArtMethod* referrer,
Thread* self,
bool can_run_clinit,
@@ -185,7 +188,7 @@
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Roles::uninterruptible_);
-inline mirror::String* ResolveStringFromCode(ArtMethod* referrer, uint32_t string_idx)
+inline mirror::String* ResolveStringFromCode(ArtMethod* referrer, dex::StringIndex string_idx)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Roles::uninterruptible_);
diff --git a/runtime/entrypoints/quick/quick_alloc_entrypoints.cc b/runtime/entrypoints/quick/quick_alloc_entrypoints.cc
index 515fcbf..82bb8e5 100644
--- a/runtime/entrypoints/quick/quick_alloc_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_alloc_entrypoints.cc
@@ -19,6 +19,7 @@
#include "art_method-inl.h"
#include "base/enums.h"
#include "callee_save_frame.h"
+#include "dex_file_types.h"
#include "entrypoints/entrypoint_utils-inl.h"
#include "mirror/class-inl.h"
#include "mirror/object_array-inl.h"
@@ -34,7 +35,8 @@
REQUIRES_SHARED(Locks::mutator_lock_) { \
ScopedQuickEntrypointChecks sqec(self); \
if (kUseTlabFastPath && !(instrumented_bool) && (allocator_type) == gc::kAllocatorTypeTLAB) { \
- mirror::Class* klass = method->GetDexCacheResolvedType<false>(type_idx, kRuntimePointerSize); \
+ mirror::Class* klass = method->GetDexCacheResolvedType<false>(dex::TypeIndex(type_idx), \
+ kRuntimePointerSize); \
if (LIKELY(klass != nullptr && klass->IsInitialized() && !klass->IsFinalizable())) { \
size_t byte_count = klass->GetObjectSize(); \
byte_count = RoundUp(byte_count, gc::space::BumpPointerSpace::kAlignment); \
@@ -51,7 +53,10 @@
} \
} \
} \
- return AllocObjectFromCode<false, instrumented_bool>(type_idx, method, self, allocator_type); \
+ return AllocObjectFromCode<false, instrumented_bool>(dex::TypeIndex(type_idx), \
+ method, \
+ self, \
+ allocator_type); \
} \
extern "C" mirror::Object* artAllocObjectFromCodeResolved##suffix##suffix2( \
mirror::Class* klass, ArtMethod* method ATTRIBUTE_UNUSED, Thread* self) \
@@ -101,13 +106,19 @@
uint32_t type_idx, ArtMethod* method, Thread* self) \
REQUIRES_SHARED(Locks::mutator_lock_) { \
ScopedQuickEntrypointChecks sqec(self); \
- return AllocObjectFromCode<true, instrumented_bool>(type_idx, method, self, allocator_type); \
+ return AllocObjectFromCode<true, instrumented_bool>(dex::TypeIndex(type_idx), \
+ method, \
+ self, \
+ allocator_type); \
} \
extern "C" mirror::Array* artAllocArrayFromCode##suffix##suffix2( \
uint32_t type_idx, int32_t component_count, ArtMethod* method, Thread* self) \
REQUIRES_SHARED(Locks::mutator_lock_) { \
ScopedQuickEntrypointChecks sqec(self); \
- return AllocArrayFromCode<false, instrumented_bool>(type_idx, component_count, method, self, \
+ return AllocArrayFromCode<false, instrumented_bool>(dex::TypeIndex(type_idx), \
+ component_count, \
+ method, \
+ self, \
allocator_type); \
} \
extern "C" mirror::Array* artAllocArrayFromCodeResolved##suffix##suffix2( \
@@ -121,7 +132,10 @@
uint32_t type_idx, int32_t component_count, ArtMethod* method, Thread* self) \
REQUIRES_SHARED(Locks::mutator_lock_) { \
ScopedQuickEntrypointChecks sqec(self); \
- return AllocArrayFromCode<true, instrumented_bool>(type_idx, component_count, method, self, \
+ return AllocArrayFromCode<true, instrumented_bool>(dex::TypeIndex(type_idx), \
+ component_count, \
+ method, \
+ self, \
allocator_type); \
} \
extern "C" mirror::Array* artCheckAndAllocArrayFromCode##suffix##suffix2( \
@@ -129,9 +143,19 @@
REQUIRES_SHARED(Locks::mutator_lock_) { \
ScopedQuickEntrypointChecks sqec(self); \
if (!(instrumented_bool)) { \
- return CheckAndAllocArrayFromCode(type_idx, component_count, method, self, false, allocator_type); \
+ return CheckAndAllocArrayFromCode(dex::TypeIndex(type_idx), \
+ component_count, \
+ method, \
+ self, \
+ false, \
+ allocator_type); \
} else { \
- return CheckAndAllocArrayFromCodeInstrumented(type_idx, component_count, method, self, false, allocator_type); \
+ return CheckAndAllocArrayFromCodeInstrumented(dex::TypeIndex(type_idx), \
+ component_count, \
+ method, \
+ self, \
+ false, \
+ allocator_type); \
} \
} \
extern "C" mirror::Array* artCheckAndAllocArrayFromCodeWithAccessCheck##suffix##suffix2( \
@@ -139,9 +163,19 @@
REQUIRES_SHARED(Locks::mutator_lock_) { \
ScopedQuickEntrypointChecks sqec(self); \
if (!(instrumented_bool)) { \
- return CheckAndAllocArrayFromCode(type_idx, component_count, method, self, true, allocator_type); \
+ return CheckAndAllocArrayFromCode(dex::TypeIndex(type_idx), \
+ component_count, \
+ method, \
+ self, \
+ true, \
+ allocator_type); \
} else { \
- return CheckAndAllocArrayFromCodeInstrumented(type_idx, component_count, method, self, true, allocator_type); \
+ return CheckAndAllocArrayFromCodeInstrumented(dex::TypeIndex(type_idx), \
+ component_count, \
+ method, \
+ self, \
+ true, \
+ allocator_type); \
} \
} \
extern "C" mirror::String* artAllocStringFromBytesFromCode##suffix##suffix2( \
@@ -258,7 +292,7 @@
entry_points_instrumented = instrumented;
}
-void ResetQuickAllocEntryPoints(QuickEntryPoints* qpoints) {
+void ResetQuickAllocEntryPoints(QuickEntryPoints* qpoints, bool is_marking) {
#if !defined(__APPLE__) || !defined(__LP64__)
switch (entry_points_allocator) {
case gc::kAllocatorTypeDlMalloc: {
@@ -286,7 +320,12 @@
}
case gc::kAllocatorTypeRegionTLAB: {
CHECK(kMovingCollector);
- SetQuickAllocEntryPoints_region_tlab(qpoints, entry_points_instrumented);
+ if (is_marking) {
+ SetQuickAllocEntryPoints_region_tlab(qpoints, entry_points_instrumented);
+ } else {
+ // Not marking means we need no read barriers and can just use the normal TLAB case.
+ SetQuickAllocEntryPoints_tlab(qpoints, entry_points_instrumented);
+ }
return;
}
default:
@@ -294,6 +333,7 @@
}
#else
UNUSED(qpoints);
+ UNUSED(is_marking);
#endif
UNIMPLEMENTED(FATAL);
UNREACHABLE();
diff --git a/runtime/entrypoints/quick/quick_alloc_entrypoints.h b/runtime/entrypoints/quick/quick_alloc_entrypoints.h
index 14a8e04..bd1e295 100644
--- a/runtime/entrypoints/quick/quick_alloc_entrypoints.h
+++ b/runtime/entrypoints/quick/quick_alloc_entrypoints.h
@@ -23,7 +23,9 @@
namespace art {
-void ResetQuickAllocEntryPoints(QuickEntryPoints* qpoints);
+// is_marking is only used for CC, if the GC is marking the allocation entrypoint is the marking
+// one.
+void ResetQuickAllocEntryPoints(QuickEntryPoints* qpoints, bool is_marking);
// Runtime shutdown lock is necessary to prevent races in thread initialization. When the thread is
// starting it doesn't hold the mutator lock until after it has been added to the thread list.
diff --git a/runtime/entrypoints/quick/quick_default_init_entrypoints.h b/runtime/entrypoints/quick/quick_default_init_entrypoints.h
index df23f94..78dad94 100644
--- a/runtime/entrypoints/quick/quick_default_init_entrypoints.h
+++ b/runtime/entrypoints/quick/quick_default_init_entrypoints.h
@@ -31,7 +31,7 @@
jpoints->pDlsymLookup = art_jni_dlsym_lookup_stub;
// Alloc
- ResetQuickAllocEntryPoints(qpoints);
+ ResetQuickAllocEntryPoints(qpoints, /* is_marking */ true);
// DexCache
qpoints->pInitializeStaticStorage = art_quick_initialize_static_storage;
diff --git a/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc b/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc
index d438418..5dad43e 100644
--- a/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc
@@ -20,6 +20,7 @@
#include "class_linker-inl.h"
#include "class_table-inl.h"
#include "dex_file-inl.h"
+#include "dex_file_types.h"
#include "gc/heap.h"
#include "mirror/class-inl.h"
#include "mirror/class_loader.h"
@@ -37,7 +38,7 @@
// given by inheritance.
ScopedQuickEntrypointChecks sqec(self);
auto* caller = GetCalleeSaveMethodCaller(self, Runtime::kSaveRefsOnly);
- return ResolveVerifyAndClinit(type_idx, caller, self, true, false);
+ return ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, true, false);
}
extern "C" mirror::Class* artInitializeTypeFromCode(uint32_t type_idx, Thread* self)
@@ -45,7 +46,7 @@
// Called when method->dex_cache_resolved_types_[] misses.
ScopedQuickEntrypointChecks sqec(self);
auto* caller = GetCalleeSaveMethodCaller(self, Runtime::kSaveRefsOnly);
- return ResolveVerifyAndClinit(type_idx, caller, self, false, false);
+ return ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, false, false);
}
extern "C" mirror::Class* artInitializeTypeAndVerifyAccessFromCode(uint32_t type_idx, Thread* self)
@@ -54,7 +55,7 @@
// unpopulated.
ScopedQuickEntrypointChecks sqec(self);
auto* caller = GetCalleeSaveMethodCaller(self, Runtime::kSaveRefsOnly);
- return ResolveVerifyAndClinit(type_idx, caller, self, false, true);
+ return ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, false, true);
}
extern "C" mirror::String* artResolveStringFromCode(int32_t string_idx, Thread* self)
@@ -65,7 +66,7 @@
// TODO: Change art_quick_resolve_string on MIPS and MIPS64 to kSaveEverything.
(kRuntimeISA == kMips || kRuntimeISA == kMips64) ? Runtime::kSaveRefsOnly
: Runtime::kSaveEverything);
- mirror::String* result = ResolveStringFromCode(caller, string_idx);
+ mirror::String* result = ResolveStringFromCode(caller, dex::StringIndex(string_idx));
if (LIKELY(result != nullptr)) {
// For AOT code, we need a write barrier for the class loader that holds
// the GC roots in the .bss.
diff --git a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
index fe82878..bf1d4ea 100644
--- a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
@@ -134,13 +134,23 @@
// | Method* | ---
// | RA |
// | ... | callee saves
+ // | T1 | arg5
+ // | T0 | arg4
// | A3 | arg3
// | A2 | arg2
// | A1 | arg1
+ // | F19 |
+ // | F18 | f_arg5
+ // | F17 |
+ // | F16 | f_arg4
// | F15 |
- // | F14 | f_arg1
+ // | F14 | f_arg3
// | F13 |
- // | F12 | f_arg0
+ // | F12 | f_arg2
+ // | F11 |
+ // | F10 | f_arg1
+ // | F9 |
+ // | F8 | f_arg0
// | | padding
// | A0/Method* | <- sp
static constexpr bool kSplitPairAcrossRegisterAndStack = false;
@@ -148,14 +158,14 @@
static constexpr bool kQuickSoftFloatAbi = false;
static constexpr bool kQuickDoubleRegAlignedFloatBackFilled = false;
static constexpr bool kQuickSkipOddFpRegisters = true;
- static constexpr size_t kNumQuickGprArgs = 3; // 3 arguments passed in GPRs.
- static constexpr size_t kNumQuickFprArgs = 4; // 2 arguments passed in FPRs. Floats can be passed
- // only in even numbered registers and each double
- // occupies two registers.
+ static constexpr size_t kNumQuickGprArgs = 5; // 5 arguments passed in GPRs.
+ static constexpr size_t kNumQuickFprArgs = 12; // 6 arguments passed in FPRs. Floats can be
+ // passed only in even numbered registers and each
+ // double occupies two registers.
static constexpr bool kGprFprLockstep = false;
- static constexpr size_t kQuickCalleeSaveFrame_RefAndArgs_Fpr1Offset = 16; // Offset of first FPR arg.
- static constexpr size_t kQuickCalleeSaveFrame_RefAndArgs_Gpr1Offset = 32; // Offset of first GPR arg.
- static constexpr size_t kQuickCalleeSaveFrame_RefAndArgs_LrOffset = 76; // Offset of return address.
+ static constexpr size_t kQuickCalleeSaveFrame_RefAndArgs_Fpr1Offset = 8; // Offset of first FPR arg.
+ static constexpr size_t kQuickCalleeSaveFrame_RefAndArgs_Gpr1Offset = 56; // Offset of first GPR arg.
+ static constexpr size_t kQuickCalleeSaveFrame_RefAndArgs_LrOffset = 108; // Offset of return address.
static size_t GprIndexToGprOffset(uint32_t gpr_index) {
return gpr_index * GetBytesPerGprSpillLocation(kRuntimeISA);
}
@@ -187,7 +197,7 @@
// | F12 | f_arg0
// | | padding
// | A0/Method* | <- sp
- // NOTE: for Mip64, when A0 is skipped, F0 is also skipped.
+ // NOTE: for Mip64, when A0 is skipped, F12 is also skipped.
static constexpr bool kSplitPairAcrossRegisterAndStack = false;
static constexpr bool kAlignPairRegister = false;
static constexpr bool kQuickSoftFloatAbi = false;
@@ -197,7 +207,7 @@
static constexpr size_t kNumQuickFprArgs = 7; // 7 arguments passed in FPRs.
static constexpr bool kGprFprLockstep = true;
- static constexpr size_t kQuickCalleeSaveFrame_RefAndArgs_Fpr1Offset = 24; // Offset of first FPR arg (F1).
+ static constexpr size_t kQuickCalleeSaveFrame_RefAndArgs_Fpr1Offset = 24; // Offset of first FPR arg (F13).
static constexpr size_t kQuickCalleeSaveFrame_RefAndArgs_Gpr1Offset = 80; // Offset of first GPR arg (A1).
static constexpr size_t kQuickCalleeSaveFrame_RefAndArgs_LrOffset = 200; // Offset of return address.
static size_t GprIndexToGprOffset(uint32_t gpr_index) {
@@ -501,10 +511,16 @@
case Primitive::kPrimDouble:
case Primitive::kPrimLong:
if (kQuickSoftFloatAbi || (cur_type_ == Primitive::kPrimLong)) {
- if (cur_type_ == Primitive::kPrimLong && kAlignPairRegister && gpr_index_ == 0) {
- // Currently, this is only for ARM and MIPS, where the first available parameter
- // register is R1 (on ARM) or A1 (on MIPS). So we skip it, and use R2 (on ARM) or
- // A2 (on MIPS) instead.
+ if (cur_type_ == Primitive::kPrimLong &&
+#if defined(__mips__) && !defined(__LP64__)
+ (gpr_index_ == 0 || gpr_index_ == 2) &&
+#else
+ gpr_index_ == 0 &&
+#endif
+ kAlignPairRegister) {
+ // Currently, this is only for ARM and MIPS, where we align long parameters with
+ // even-numbered registers by skipping R1 (on ARM) or A1(A3) (on MIPS) and using
+ // R2 (on ARM) or A2(T0) (on MIPS) instead.
IncGprIndex();
}
is_split_long_or_double_ = (GetBytesPerGprSpillLocation(kRuntimeISA) == 4) &&
@@ -2086,6 +2102,41 @@
// Note that the native code pointer will be automatically set by artFindNativeMethod().
}
+#if defined(__mips__) && !defined(__LP64__)
+ // On MIPS32 if the first two arguments are floating-point, we need to know their types
+ // so that art_quick_generic_jni_trampoline can correctly extract them from the stack
+ // and load into floating-point registers.
+ // Possible arrangements of first two floating-point arguments on the stack (32-bit FPU
+ // view):
+ // (1)
+ // | DOUBLE | DOUBLE | other args, if any
+ // | F12 | F13 | F14 | F15 |
+ // | SP+0 | SP+4 | SP+8 | SP+12 | SP+16
+ // (2)
+ // | DOUBLE | FLOAT | (PAD) | other args, if any
+ // | F12 | F13 | F14 | |
+ // | SP+0 | SP+4 | SP+8 | SP+12 | SP+16
+ // (3)
+ // | FLOAT | (PAD) | DOUBLE | other args, if any
+ // | F12 | | F14 | F15 |
+ // | SP+0 | SP+4 | SP+8 | SP+12 | SP+16
+ // (4)
+ // | FLOAT | FLOAT | other args, if any
+ // | F12 | F14 |
+ // | SP+0 | SP+4 | SP+8
+ // As you can see, only the last case (4) is special. In all others we can just
+ // load F12/F13 and F14/F15 in the same manner.
+ // Set bit 0 of the native code address to 1 in this case (valid code addresses
+ // are always a multiple of 4 on MIPS32, so we have 2 spare bits available).
+ if (nativeCode != nullptr &&
+ shorty != nullptr &&
+ shorty_len >= 3 &&
+ shorty[1] == 'F' &&
+ shorty[2] == 'F') {
+ nativeCode = reinterpret_cast<void*>(reinterpret_cast<uintptr_t>(nativeCode) | 1);
+ }
+#endif
+
// Return native code addr(lo) and bottom of alloca address(hi).
return GetTwoWordSuccessValue(reinterpret_cast<uintptr_t>(visitor.GetBottomOfUsedArea()),
reinterpret_cast<uintptr_t>(nativeCode));
diff --git a/runtime/entrypoints_order_test.cc b/runtime/entrypoints_order_test.cc
index b0463d7..1283660 100644
--- a/runtime/entrypoints_order_test.cc
+++ b/runtime/entrypoints_order_test.cc
@@ -94,8 +94,8 @@
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, opeer, jpeer, sizeof(void*));
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, jpeer, stack_begin, sizeof(void*));
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, stack_begin, stack_size, sizeof(void*));
- EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, stack_size, stack_trace_sample, sizeof(void*));
- EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, stack_trace_sample, wait_next, sizeof(void*));
+ EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, stack_size, deps_or_stack_trace_sample, sizeof(void*));
+ EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, deps_or_stack_trace_sample, wait_next, sizeof(void*));
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, wait_next, monitor_enter_object, sizeof(void*));
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, monitor_enter_object, top_handle_scope, sizeof(void*));
EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, top_handle_scope, class_loader_override, sizeof(void*));
diff --git a/runtime/gc/accounting/space_bitmap.cc b/runtime/gc/accounting/space_bitmap.cc
index f4d0bc7..eb9f039 100644
--- a/runtime/gc/accounting/space_bitmap.cc
+++ b/runtime/gc/accounting/space_bitmap.cc
@@ -16,8 +16,9 @@
#include "space_bitmap-inl.h"
+#include "android-base/stringprintf.h"
+
#include "art_field-inl.h"
-#include "base/stringprintf.h"
#include "dex_file-inl.h"
#include "mem_map.h"
#include "mirror/object-inl.h"
@@ -28,6 +29,8 @@
namespace gc {
namespace accounting {
+using android::base::StringPrintf;
+
template<size_t kAlignment>
size_t SpaceBitmap<kAlignment>::ComputeBitmapSize(uint64_t capacity) {
const uint64_t kBytesCoveredPerWord = kAlignment * kBitsPerIntPtrT;
diff --git a/runtime/gc/allocator/rosalloc.cc b/runtime/gc/allocator/rosalloc.cc
index 40186f8..35a251f 100644
--- a/runtime/gc/allocator/rosalloc.cc
+++ b/runtime/gc/allocator/rosalloc.cc
@@ -16,6 +16,13 @@
#include "rosalloc.h"
+#include <map>
+#include <list>
+#include <sstream>
+#include <vector>
+
+#include "android-base/stringprintf.h"
+
#include "base/memory_tool.h"
#include "base/mutex-inl.h"
#include "gc/space/memory_tool_settings.h"
@@ -26,15 +33,12 @@
#include "thread-inl.h"
#include "thread_list.h"
-#include <map>
-#include <list>
-#include <sstream>
-#include <vector>
-
namespace art {
namespace gc {
namespace allocator {
+using android::base::StringPrintf;
+
static constexpr bool kUsePrefetchDuringAllocRun = false;
static constexpr bool kPrefetchNewRunDataByZeroing = false;
static constexpr size_t kPrefetchStride = 64;
@@ -2068,26 +2072,30 @@
size_t largest_continuous_free_pages = 0;
WriterMutexLock wmu(self, bulk_free_lock_);
MutexLock mu(self, lock_);
+ uint64_t total_free = 0;
for (FreePageRun* fpr : free_page_runs_) {
largest_continuous_free_pages = std::max(largest_continuous_free_pages,
fpr->ByteSize(this));
+ total_free += fpr->ByteSize(this);
}
+ size_t required_bytes = 0;
+ const char* new_buffer_msg = "";
if (failed_alloc_bytes > kLargeSizeThreshold) {
// Large allocation.
- size_t required_bytes = RoundUp(failed_alloc_bytes, kPageSize);
- if (required_bytes > largest_continuous_free_pages) {
- os << "; failed due to fragmentation (required continguous free "
- << required_bytes << " bytes where largest contiguous free "
- << largest_continuous_free_pages << " bytes)";
- }
+ required_bytes = RoundUp(failed_alloc_bytes, kPageSize);
} else {
// Non-large allocation.
- size_t required_bytes = numOfPages[SizeToIndex(failed_alloc_bytes)] * kPageSize;
- if (required_bytes > largest_continuous_free_pages) {
- os << "; failed due to fragmentation (required continguous free "
- << required_bytes << " bytes for a new buffer where largest contiguous free "
- << largest_continuous_free_pages << " bytes)";
- }
+ required_bytes = numOfPages[SizeToIndex(failed_alloc_bytes)] * kPageSize;
+ new_buffer_msg = " for a new buffer";
+ }
+ if (required_bytes > largest_continuous_free_pages) {
+ os << "; failed due to fragmentation ("
+ << "required contiguous free " << required_bytes << " bytes" << new_buffer_msg
+ << ", largest contiguous free " << largest_continuous_free_pages << " bytes"
+ << ", total free pages " << total_free << " bytes"
+ << ", space footprint " << footprint_ << " bytes"
+ << ", space max capacity " << max_capacity_ << " bytes"
+ << ")" << std::endl;
}
}
diff --git a/runtime/gc/collector/concurrent_copying.cc b/runtime/gc/collector/concurrent_copying.cc
index 8353b26..b889913 100644
--- a/runtime/gc/collector/concurrent_copying.cc
+++ b/runtime/gc/collector/concurrent_copying.cc
@@ -812,13 +812,13 @@
false_gray_stack_.clear();
}
-
void ConcurrentCopying::IssueEmptyCheckpoint() {
Thread* self = Thread::Current();
ThreadList* thread_list = Runtime::Current()->GetThreadList();
Barrier* barrier = thread_list->EmptyCheckpointBarrier();
barrier->Init(self, 0);
- size_t barrier_count = thread_list->RunEmptyCheckpoint();
+ std::vector<uint32_t> runnable_thread_ids; // Used in debug build only
+ size_t barrier_count = thread_list->RunEmptyCheckpoint(runnable_thread_ids);
// If there are no threads to wait which implys that all the checkpoint functions are finished,
// then no need to release the mutator lock.
if (barrier_count == 0) {
@@ -828,7 +828,27 @@
Locks::mutator_lock_->SharedUnlock(self);
{
ScopedThreadStateChange tsc(self, kWaitingForCheckPointsToRun);
- barrier->Increment(self, barrier_count);
+ if (kIsDebugBuild) {
+ static constexpr uint64_t kEmptyCheckpointTimeoutMs = 600 * 1000; // 10 minutes.
+ bool timed_out = barrier->Increment(self, barrier_count, kEmptyCheckpointTimeoutMs);
+ if (timed_out) {
+ Runtime* runtime = Runtime::Current();
+ std::ostringstream ss;
+ ss << "Empty checkpoint timeout\n";
+ ss << "Barrier count " << barrier->GetCount(self) << "\n";
+ ss << "Runnable thread IDs";
+ for (uint32_t tid : runnable_thread_ids) {
+ ss << " " << tid;
+ }
+ ss << "\n";
+ Locks::mutator_lock_->Dump(ss);
+ ss << "\n";
+ runtime->GetThreadList()->Dump(ss);
+ LOG(FATAL) << ss.str();
+ }
+ } else {
+ barrier->Increment(self, barrier_count);
+ }
}
Locks::mutator_lock_->SharedLock(self);
}
@@ -1340,9 +1360,10 @@
<< " is_marked=" << IsMarked(to_ref);
}
#ifdef USE_BAKER_OR_BROOKS_READ_BARRIER
+ mirror::Object* referent = nullptr;
if (UNLIKELY((to_ref->GetClass<kVerifyNone, kWithoutReadBarrier>()->IsTypeOfReferenceClass() &&
- to_ref->AsReference()->GetReferent<kWithoutReadBarrier>() != nullptr &&
- !IsInToSpace(to_ref->AsReference()->GetReferent<kWithoutReadBarrier>())))) {
+ (referent = to_ref->AsReference()->GetReferent<kWithoutReadBarrier>()) != nullptr &&
+ !IsInToSpace(referent)))) {
// Leave this reference gray in the queue so that GetReferent() will trigger a read barrier. We
// will change it to white later in ReferenceQueue::DequeuePendingReference().
DCHECK(to_ref->AsReference()->GetPendingNext() != nullptr) << "Left unenqueued ref gray " << to_ref;
@@ -2145,14 +2166,18 @@
to_ref->SetReadBarrierState(ReadBarrier::GrayState());
}
+ // Do a fence to prevent the field CAS in ConcurrentCopying::Process from possibly reordering
+ // before the object copy.
+ QuasiAtomic::ThreadFenceRelease();
+
LockWord new_lock_word = LockWord::FromForwardingAddress(reinterpret_cast<size_t>(to_ref));
// Try to atomically write the fwd ptr.
- bool success = from_ref->CasLockWordWeakSequentiallyConsistent(old_lock_word, new_lock_word);
+ bool success = from_ref->CasLockWordWeakRelaxed(old_lock_word, new_lock_word);
if (LIKELY(success)) {
// The CAS succeeded.
- objects_moved_.FetchAndAddSequentiallyConsistent(1);
- bytes_moved_.FetchAndAddSequentiallyConsistent(region_space_alloc_size);
+ objects_moved_.FetchAndAddRelaxed(1);
+ bytes_moved_.FetchAndAddRelaxed(region_space_alloc_size);
if (LIKELY(!fall_back_to_non_moving)) {
DCHECK(region_space_->IsInToSpace(to_ref));
} else {
diff --git a/runtime/gc/collector/garbage_collector.cc b/runtime/gc/collector/garbage_collector.cc
index ed16854..01bcb7d 100644
--- a/runtime/gc/collector/garbage_collector.cc
+++ b/runtime/gc/collector/garbage_collector.cc
@@ -18,6 +18,8 @@
#include "garbage_collector.h"
+#include "android-base/stringprintf.h"
+
#include "base/dumpable.h"
#include "base/histogram-inl.h"
#include "base/logging.h"
@@ -81,7 +83,7 @@
}
void GarbageCollector::Run(GcCause gc_cause, bool clear_soft_references) {
- ScopedTrace trace(StringPrintf("%s %s GC", PrettyCause(gc_cause), GetName()));
+ ScopedTrace trace(android::base::StringPrintf("%s %s GC", PrettyCause(gc_cause), GetName()));
Thread* self = Thread::Current();
uint64_t start_time = NanoTime();
Iteration* current_iteration = GetCurrentIteration();
diff --git a/runtime/gc/collector/mark_sweep.cc b/runtime/gc/collector/mark_sweep.cc
index 673a97e..06ed029 100644
--- a/runtime/gc/collector/mark_sweep.cc
+++ b/runtime/gc/collector/mark_sweep.cc
@@ -413,42 +413,48 @@
if (UNLIKELY(obj == nullptr || !IsAligned<kPageSize>(obj) ||
(kIsDebugBuild && large_object_space != nullptr &&
!large_object_space->Contains(obj)))) {
- LOG(FATAL_WITHOUT_ABORT) << "Tried to mark " << obj << " not contained by any spaces";
+ // Lowest priority logging first:
+ PrintFileToLog("/proc/self/maps", LogSeverity::FATAL_WITHOUT_ABORT);
+ MemMap::DumpMaps(LOG_STREAM(FATAL_WITHOUT_ABORT), true);
+ // Buffer the output in the string stream since it is more important than the stack traces
+ // and we want it to have log priority. The stack traces are printed from Runtime::Abort
+ // which is called from LOG(FATAL) but before the abort message.
+ std::ostringstream oss;
+ oss << "Tried to mark " << obj << " not contained by any spaces" << std::endl;
if (holder_ != nullptr) {
size_t holder_size = holder_->SizeOf();
ArtField* field = holder_->FindFieldByOffset(offset_);
- LOG(FATAL_WITHOUT_ABORT) << "Field info: "
- << " holder=" << holder_
- << " holder is "
- << (mark_sweep_->GetHeap()->IsLiveObjectLocked(holder_)
- ? "alive" : "dead")
- << " holder_size=" << holder_size
- << " holder_type=" << holder_->PrettyTypeOf()
- << " offset=" << offset_.Uint32Value()
- << " field=" << (field != nullptr ? field->GetName() : "nullptr")
- << " field_type="
- << (field != nullptr ? field->GetTypeDescriptor() : "")
- << " first_ref_field_offset="
- << (holder_->IsClass()
- ? holder_->AsClass()->GetFirstReferenceStaticFieldOffset(
- kRuntimePointerSize)
- : holder_->GetClass()->GetFirstReferenceInstanceFieldOffset())
- << " num_of_ref_fields="
- << (holder_->IsClass()
- ? holder_->AsClass()->NumReferenceStaticFields()
- : holder_->GetClass()->NumReferenceInstanceFields());
+ oss << "Field info: "
+ << " holder=" << holder_
+ << " holder is "
+ << (mark_sweep_->GetHeap()->IsLiveObjectLocked(holder_)
+ ? "alive" : "dead")
+ << " holder_size=" << holder_size
+ << " holder_type=" << holder_->PrettyTypeOf()
+ << " offset=" << offset_.Uint32Value()
+ << " field=" << (field != nullptr ? field->GetName() : "nullptr")
+ << " field_type="
+ << (field != nullptr ? field->GetTypeDescriptor() : "")
+ << " first_ref_field_offset="
+ << (holder_->IsClass()
+ ? holder_->AsClass()->GetFirstReferenceStaticFieldOffset(
+ kRuntimePointerSize)
+ : holder_->GetClass()->GetFirstReferenceInstanceFieldOffset())
+ << " num_of_ref_fields="
+ << (holder_->IsClass()
+ ? holder_->AsClass()->NumReferenceStaticFields()
+ : holder_->GetClass()->NumReferenceInstanceFields())
+ << std::endl;
// Print the memory content of the holder.
for (size_t i = 0; i < holder_size / sizeof(uint32_t); ++i) {
uint32_t* p = reinterpret_cast<uint32_t*>(holder_);
- LOG(FATAL_WITHOUT_ABORT) << &p[i] << ": " << "holder+" << (i * sizeof(uint32_t)) << " = "
- << std::hex << p[i];
+ oss << &p[i] << ": " << "holder+" << (i * sizeof(uint32_t)) << " = " << std::hex << p[i]
+ << std::endl;
}
}
- PrintFileToLog("/proc/self/maps", LogSeverity::FATAL_WITHOUT_ABORT);
- MemMap::DumpMaps(LOG_STREAM(FATAL_WITHOUT_ABORT), true);
- LOG(FATAL_WITHOUT_ABORT) << "Attempting see if it's a bad thread root";
- mark_sweep_->VerifySuspendedThreadRoots();
- LOG(FATAL) << "Can't mark invalid object";
+ oss << "Attempting see if it's a bad thread root" << std::endl;
+ mark_sweep_->VerifySuspendedThreadRoots(oss);
+ LOG(FATAL) << oss.str();
}
}
@@ -567,6 +573,8 @@
class MarkSweep::VerifyRootVisitor : public SingleRootVisitor {
public:
+ explicit VerifyRootVisitor(std::ostream& os) : os_(os) {}
+
void VisitRoot(mirror::Object* root, const RootInfo& info) OVERRIDE
REQUIRES_SHARED(Locks::mutator_lock_, Locks::heap_bitmap_lock_) {
// See if the root is on any space bitmap.
@@ -574,14 +582,17 @@
if (heap->GetLiveBitmap()->GetContinuousSpaceBitmap(root) == nullptr) {
space::LargeObjectSpace* large_object_space = heap->GetLargeObjectsSpace();
if (large_object_space != nullptr && !large_object_space->Contains(root)) {
- LOG(FATAL_WITHOUT_ABORT) << "Found invalid root: " << root << " " << info;
+ os_ << "Found invalid root: " << root << " " << info << std::endl;
}
}
}
+
+ private:
+ std::ostream& os_;
};
-void MarkSweep::VerifySuspendedThreadRoots() {
- VerifyRootVisitor visitor;
+void MarkSweep::VerifySuspendedThreadRoots(std::ostream& os) {
+ VerifyRootVisitor visitor(os);
Runtime::Current()->GetThreadList()->VisitRootsForSuspendedThreads(&visitor);
}
diff --git a/runtime/gc/collector/mark_sweep.h b/runtime/gc/collector/mark_sweep.h
index a94cb27..02cf462 100644
--- a/runtime/gc/collector/mark_sweep.h
+++ b/runtime/gc/collector/mark_sweep.h
@@ -250,7 +250,7 @@
// Verify the roots of the heap and print out information related to any invalid roots.
// Called in MarkObject, so may we may not hold the mutator lock.
- void VerifySuspendedThreadRoots()
+ void VerifySuspendedThreadRoots(std::ostream& os)
REQUIRES_SHARED(Locks::mutator_lock_);
// Expand mark stack to 2x its current size.
diff --git a/runtime/gc/heap-inl.h b/runtime/gc/heap-inl.h
index 97129e8..54f2210 100644
--- a/runtime/gc/heap-inl.h
+++ b/runtime/gc/heap-inl.h
@@ -247,7 +247,7 @@
if (allocator_type != kAllocatorTypeTLAB &&
allocator_type != kAllocatorTypeRegionTLAB &&
allocator_type != kAllocatorTypeRosAlloc &&
- UNLIKELY(IsOutOfMemoryOnAllocation<kGrow>(allocator_type, alloc_size))) {
+ UNLIKELY(IsOutOfMemoryOnAllocation(allocator_type, alloc_size, kGrow))) {
return nullptr;
}
mirror::Object* ret;
@@ -267,8 +267,9 @@
if (kInstrumented && UNLIKELY(is_running_on_memory_tool_)) {
// If running on valgrind or asan, we should be using the instrumented path.
size_t max_bytes_tl_bulk_allocated = rosalloc_space_->MaxBytesBulkAllocatedFor(alloc_size);
- if (UNLIKELY(IsOutOfMemoryOnAllocation<kGrow>(allocator_type,
- max_bytes_tl_bulk_allocated))) {
+ if (UNLIKELY(IsOutOfMemoryOnAllocation(allocator_type,
+ max_bytes_tl_bulk_allocated,
+ kGrow))) {
return nullptr;
}
ret = rosalloc_space_->Alloc(self, alloc_size, bytes_allocated, usable_size,
@@ -277,14 +278,18 @@
DCHECK(!is_running_on_memory_tool_);
size_t max_bytes_tl_bulk_allocated =
rosalloc_space_->MaxBytesBulkAllocatedForNonvirtual(alloc_size);
- if (UNLIKELY(IsOutOfMemoryOnAllocation<kGrow>(allocator_type,
- max_bytes_tl_bulk_allocated))) {
+ if (UNLIKELY(IsOutOfMemoryOnAllocation(allocator_type,
+ max_bytes_tl_bulk_allocated,
+ kGrow))) {
return nullptr;
}
if (!kInstrumented) {
DCHECK(!rosalloc_space_->CanAllocThreadLocal(self, alloc_size));
}
- ret = rosalloc_space_->AllocNonvirtual(self, alloc_size, bytes_allocated, usable_size,
+ ret = rosalloc_space_->AllocNonvirtual(self,
+ alloc_size,
+ bytes_allocated,
+ usable_size,
bytes_tl_bulk_allocated);
}
break;
@@ -292,22 +297,34 @@
case kAllocatorTypeDlMalloc: {
if (kInstrumented && UNLIKELY(is_running_on_memory_tool_)) {
// If running on valgrind, we should be using the instrumented path.
- ret = dlmalloc_space_->Alloc(self, alloc_size, bytes_allocated, usable_size,
+ ret = dlmalloc_space_->Alloc(self,
+ alloc_size,
+ bytes_allocated,
+ usable_size,
bytes_tl_bulk_allocated);
} else {
DCHECK(!is_running_on_memory_tool_);
- ret = dlmalloc_space_->AllocNonvirtual(self, alloc_size, bytes_allocated, usable_size,
+ ret = dlmalloc_space_->AllocNonvirtual(self,
+ alloc_size,
+ bytes_allocated,
+ usable_size,
bytes_tl_bulk_allocated);
}
break;
}
case kAllocatorTypeNonMoving: {
- ret = non_moving_space_->Alloc(self, alloc_size, bytes_allocated, usable_size,
+ ret = non_moving_space_->Alloc(self,
+ alloc_size,
+ bytes_allocated,
+ usable_size,
bytes_tl_bulk_allocated);
break;
}
case kAllocatorTypeLOS: {
- ret = large_object_space_->Alloc(self, alloc_size, bytes_allocated, usable_size,
+ ret = large_object_space_->Alloc(self,
+ alloc_size,
+ bytes_allocated,
+ usable_size,
bytes_tl_bulk_allocated);
// Note that the bump pointer spaces aren't necessarily next to
// the other continuous spaces like the non-moving alloc space or
@@ -315,80 +332,38 @@
DCHECK(ret == nullptr || large_object_space_->Contains(ret));
break;
}
- case kAllocatorTypeTLAB: {
- DCHECK_ALIGNED(alloc_size, space::BumpPointerSpace::kAlignment);
- if (UNLIKELY(self->TlabSize() < alloc_size)) {
- const size_t new_tlab_size = alloc_size + kDefaultTLABSize;
- if (UNLIKELY(IsOutOfMemoryOnAllocation<kGrow>(allocator_type, new_tlab_size))) {
- return nullptr;
- }
- // Try allocating a new thread local buffer, if the allocaiton fails the space must be
- // full so return null.
- if (!bump_pointer_space_->AllocNewTlab(self, new_tlab_size)) {
- return nullptr;
- }
- *bytes_tl_bulk_allocated = new_tlab_size;
- } else {
- *bytes_tl_bulk_allocated = 0;
- }
- // The allocation can't fail.
- ret = self->AllocTlab(alloc_size);
- DCHECK(ret != nullptr);
- *bytes_allocated = alloc_size;
- *usable_size = alloc_size;
- break;
- }
case kAllocatorTypeRegion: {
DCHECK(region_space_ != nullptr);
alloc_size = RoundUp(alloc_size, space::RegionSpace::kAlignment);
- ret = region_space_->AllocNonvirtual<false>(alloc_size, bytes_allocated, usable_size,
+ ret = region_space_->AllocNonvirtual<false>(alloc_size,
+ bytes_allocated,
+ usable_size,
bytes_tl_bulk_allocated);
break;
}
+ case kAllocatorTypeTLAB:
+ FALLTHROUGH_INTENDED;
case kAllocatorTypeRegionTLAB: {
- DCHECK(region_space_ != nullptr);
- DCHECK_ALIGNED(alloc_size, space::RegionSpace::kAlignment);
+ DCHECK_ALIGNED(alloc_size, kObjectAlignment);
+ static_assert(space::RegionSpace::kAlignment == space::BumpPointerSpace::kAlignment,
+ "mismatched alignments");
+ static_assert(kObjectAlignment == space::BumpPointerSpace::kAlignment,
+ "mismatched alignments");
if (UNLIKELY(self->TlabSize() < alloc_size)) {
- if (space::RegionSpace::kRegionSize >= alloc_size) {
- // Non-large. Check OOME for a tlab.
- if (LIKELY(!IsOutOfMemoryOnAllocation<kGrow>(allocator_type, space::RegionSpace::kRegionSize))) {
- // Try to allocate a tlab.
- if (!region_space_->AllocNewTlab(self)) {
- // Failed to allocate a tlab. Try non-tlab.
- ret = region_space_->AllocNonvirtual<false>(alloc_size, bytes_allocated, usable_size,
- bytes_tl_bulk_allocated);
- return ret;
- }
- *bytes_tl_bulk_allocated = space::RegionSpace::kRegionSize;
- // Fall-through.
- } else {
- // Check OOME for a non-tlab allocation.
- if (!IsOutOfMemoryOnAllocation<kGrow>(allocator_type, alloc_size)) {
- ret = region_space_->AllocNonvirtual<false>(alloc_size, bytes_allocated, usable_size,
- bytes_tl_bulk_allocated);
- return ret;
- } else {
- // Neither tlab or non-tlab works. Give up.
- return nullptr;
- }
- }
- } else {
- // Large. Check OOME.
- if (LIKELY(!IsOutOfMemoryOnAllocation<kGrow>(allocator_type, alloc_size))) {
- ret = region_space_->AllocNonvirtual<false>(alloc_size, bytes_allocated, usable_size,
- bytes_tl_bulk_allocated);
- return ret;
- } else {
- return nullptr;
- }
- }
- } else {
- *bytes_tl_bulk_allocated = 0; // Allocated in an existing buffer.
+ // kAllocatorTypeTLAB may be the allocator for region space TLAB if the GC is not marking,
+ // that is why the allocator is not passed down.
+ return AllocWithNewTLAB(self,
+ alloc_size,
+ kGrow,
+ bytes_allocated,
+ usable_size,
+ bytes_tl_bulk_allocated);
}
// The allocation can't fail.
ret = self->AllocTlab(alloc_size);
DCHECK(ret != nullptr);
*bytes_allocated = alloc_size;
+ *bytes_tl_bulk_allocated = 0; // Allocated in an existing buffer.
*usable_size = alloc_size;
break;
}
@@ -408,15 +383,16 @@
return byte_count >= large_object_threshold_ && (c->IsPrimitiveArray() || c->IsStringClass());
}
-template <bool kGrow>
-inline bool Heap::IsOutOfMemoryOnAllocation(AllocatorType allocator_type, size_t alloc_size) {
+inline bool Heap::IsOutOfMemoryOnAllocation(AllocatorType allocator_type,
+ size_t alloc_size,
+ bool grow) {
size_t new_footprint = num_bytes_allocated_.LoadSequentiallyConsistent() + alloc_size;
if (UNLIKELY(new_footprint > max_allowed_footprint_)) {
if (UNLIKELY(new_footprint > growth_limit_)) {
return true;
}
if (!AllocatorMayHaveConcurrentGC(allocator_type) || !IsGcConcurrent()) {
- if (!kGrow) {
+ if (!grow) {
return true;
}
// TODO: Grow for allocation is racy, fix it.
diff --git a/runtime/gc/heap.cc b/runtime/gc/heap.cc
index f0e619d..34d8284 100644
--- a/runtime/gc/heap.cc
+++ b/runtime/gc/heap.cc
@@ -21,6 +21,8 @@
#include <unwind.h> // For GC verification.
#include <vector>
+#include "android-base/stringprintf.h"
+
#include "allocation_listener.h"
#include "art_field-inl.h"
#include "base/allocator.h"
@@ -82,6 +84,8 @@
namespace gc {
+using android::base::StringPrintf;
+
static constexpr size_t kCollectorTransitionStressIterations = 0;
static constexpr size_t kCollectorTransitionStressWait = 10 * 1000; // Microseconds
// Minimum amount of remaining bytes before a concurrent GC is triggered.
@@ -294,66 +298,15 @@
}
// Load image space(s).
- if (!image_file_name.empty()) {
- // For code reuse, handle this like a work queue.
- std::vector<std::string> image_file_names;
- image_file_names.push_back(image_file_name);
- // The loaded spaces. Secondary images may fail to load, in which case we need to remove
- // already added spaces.
- std::vector<space::Space*> added_image_spaces;
- uint8_t* const original_requested_alloc_space_begin = requested_alloc_space_begin;
- for (size_t index = 0; index < image_file_names.size(); ++index) {
- std::string& image_name = image_file_names[index];
- std::string error_msg;
- std::unique_ptr<space::ImageSpace> boot_image_space_uptr = space::ImageSpace::CreateBootImage(
- image_name.c_str(),
- image_instruction_set,
- index > 0,
- &error_msg);
- if (boot_image_space_uptr != nullptr) {
- space::ImageSpace* boot_image_space = boot_image_space_uptr.release();
- AddSpace(boot_image_space);
- added_image_spaces.push_back(boot_image_space);
- // Oat files referenced by image files immediately follow them in memory, ensure alloc space
- // isn't going to get in the middle
- uint8_t* oat_file_end_addr = boot_image_space->GetImageHeader().GetOatFileEnd();
- CHECK_GT(oat_file_end_addr, boot_image_space->End());
- requested_alloc_space_begin = AlignUp(oat_file_end_addr, kPageSize);
- boot_image_spaces_.push_back(boot_image_space);
-
- if (index == 0) {
- // If this was the first space, check whether there are more images to load.
- const OatFile* boot_oat_file = boot_image_space->GetOatFile();
- if (boot_oat_file == nullptr) {
- continue;
- }
-
- const OatHeader& boot_oat_header = boot_oat_file->GetOatHeader();
- const char* boot_classpath =
- boot_oat_header.GetStoreValueByKey(OatHeader::kBootClassPathKey);
- if (boot_classpath == nullptr) {
- continue;
- }
-
- space::ImageSpace::ExtractMultiImageLocations(image_file_name,
- boot_classpath,
- &image_file_names);
- }
- } else {
- LOG(ERROR) << "Could not create image space with image file '" << image_file_name << "'. "
- << "Attempting to fall back to imageless running. Error was: " << error_msg
- << "\nAttempted image: " << image_name;
- // Remove already loaded spaces.
- for (space::Space* loaded_space : added_image_spaces) {
- RemoveSpace(loaded_space);
- delete loaded_space;
- }
- boot_image_spaces_.clear();
- requested_alloc_space_begin = original_requested_alloc_space_begin;
- break;
- }
+ if (space::ImageSpace::LoadBootImage(image_file_name,
+ image_instruction_set,
+ &boot_image_spaces_,
+ &requested_alloc_space_begin)) {
+ for (auto space : boot_image_spaces_) {
+ AddSpace(space);
}
}
+
/*
requested_alloc_space_begin -> +-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-+-
+- nonmoving space (non_moving_space_capacity)+-
@@ -1326,7 +1279,9 @@
std::ostringstream oss;
size_t total_bytes_free = GetFreeMemory();
oss << "Failed to allocate a " << byte_count << " byte allocation with " << total_bytes_free
- << " free bytes and " << PrettySize(GetFreeMemoryUntilOOME()) << " until OOM";
+ << " free bytes and " << PrettySize(GetFreeMemoryUntilOOME()) << " until OOM,"
+ << " max allowed footprint " << max_allowed_footprint_ << ", growth limit "
+ << growth_limit_;
// If the allocation failed due to fragmentation, print out the largest continuous allocation.
if (total_bytes_free >= byte_count) {
space::AllocSpace* space = nullptr;
@@ -1819,7 +1774,7 @@
break;
}
// Try to transition the heap if the allocation failure was due to the space being full.
- if (!IsOutOfMemoryOnAllocation<false>(allocator, alloc_size)) {
+ if (!IsOutOfMemoryOnAllocation(allocator, alloc_size, /*grow*/ false)) {
// If we aren't out of memory then the OOM was probably from the non moving space being
// full. Attempt to disable compaction and turn the main space into a non moving space.
DisableMovingGc();
@@ -2742,12 +2697,6 @@
concurrent_start_bytes_ = std::numeric_limits<size_t>::max();
}
- // It's time to clear all inline caches, in case some classes can be unloaded.
- if (((gc_type == collector::kGcTypeFull) || (gc_type == collector::kGcTypePartial)) &&
- (runtime->GetJit() != nullptr)) {
- runtime->GetJit()->GetCodeCache()->ClearGcRootsInInlineCaches(self);
- }
-
CHECK(collector != nullptr)
<< "Could not find garbage collector with collector_type="
<< static_cast<size_t>(collector_type_) << " and gc_type=" << gc_type;
@@ -3974,7 +3923,7 @@
ScopedObjectAccess soa(env);
env->ThrowNew(WellKnownClasses::java_lang_RuntimeException,
StringPrintf("Attempted to free %zd native bytes with only %zd native bytes "
- "registered as allocated", bytes, expected_size).c_str());
+ "registered as allocated", bytes, expected_size).c_str());
break;
}
} while (!native_bytes_allocated_.CompareExchangeWeakRelaxed(expected_size,
@@ -4225,5 +4174,72 @@
gc_pause_listener_.StoreRelaxed(nullptr);
}
+mirror::Object* Heap::AllocWithNewTLAB(Thread* self,
+ size_t alloc_size,
+ bool grow,
+ size_t* bytes_allocated,
+ size_t* usable_size,
+ size_t* bytes_tl_bulk_allocated) {
+ const AllocatorType allocator_type = GetCurrentAllocator();
+ if (allocator_type == kAllocatorTypeTLAB) {
+ DCHECK(bump_pointer_space_ != nullptr);
+ const size_t new_tlab_size = alloc_size + kDefaultTLABSize;
+ if (UNLIKELY(IsOutOfMemoryOnAllocation(allocator_type, new_tlab_size, grow))) {
+ return nullptr;
+ }
+ // Try allocating a new thread local buffer, if the allocation fails the space must be
+ // full so return null.
+ if (!bump_pointer_space_->AllocNewTlab(self, new_tlab_size)) {
+ return nullptr;
+ }
+ *bytes_tl_bulk_allocated = new_tlab_size;
+ } else {
+ DCHECK(allocator_type == kAllocatorTypeRegionTLAB);
+ DCHECK(region_space_ != nullptr);
+ if (space::RegionSpace::kRegionSize >= alloc_size) {
+ // Non-large. Check OOME for a tlab.
+ if (LIKELY(!IsOutOfMemoryOnAllocation(allocator_type,
+ space::RegionSpace::kRegionSize,
+ grow))) {
+ // Try to allocate a tlab.
+ if (!region_space_->AllocNewTlab(self)) {
+ // Failed to allocate a tlab. Try non-tlab.
+ return region_space_->AllocNonvirtual<false>(alloc_size,
+ bytes_allocated,
+ usable_size,
+ bytes_tl_bulk_allocated);
+ }
+ *bytes_tl_bulk_allocated = space::RegionSpace::kRegionSize;
+ // Fall-through to using the TLAB below.
+ } else {
+ // Check OOME for a non-tlab allocation.
+ if (!IsOutOfMemoryOnAllocation(allocator_type, alloc_size, grow)) {
+ return region_space_->AllocNonvirtual<false>(alloc_size,
+ bytes_allocated,
+ usable_size,
+ bytes_tl_bulk_allocated);
+ }
+ // Neither tlab or non-tlab works. Give up.
+ return nullptr;
+ }
+ } else {
+ // Large. Check OOME.
+ if (LIKELY(!IsOutOfMemoryOnAllocation(allocator_type, alloc_size, grow))) {
+ return region_space_->AllocNonvirtual<false>(alloc_size,
+ bytes_allocated,
+ usable_size,
+ bytes_tl_bulk_allocated);
+ }
+ return nullptr;
+ }
+ }
+ // Refilled TLAB, return.
+ mirror::Object* ret = self->AllocTlab(alloc_size);
+ DCHECK(ret != nullptr);
+ *bytes_allocated = alloc_size;
+ *usable_size = alloc_size;
+ return ret;
+}
+
} // namespace gc
} // namespace art
diff --git a/runtime/gc/heap.h b/runtime/gc/heap.h
index 0c671d2..3a8e29b 100644
--- a/runtime/gc/heap.h
+++ b/runtime/gc/heap.h
@@ -854,6 +854,10 @@
allocator_type != kAllocatorTypeRegionTLAB;
}
static ALWAYS_INLINE bool AllocatorMayHaveConcurrentGC(AllocatorType allocator_type) {
+ if (kUseReadBarrier) {
+ // Read barrier may have the TLAB allocator but is always concurrent. TODO: clean this up.
+ return true;
+ }
return
allocator_type != kAllocatorTypeBumpPointer &&
allocator_type != kAllocatorTypeTLAB;
@@ -923,11 +927,20 @@
size_t* bytes_tl_bulk_allocated)
REQUIRES_SHARED(Locks::mutator_lock_);
+ mirror::Object* AllocWithNewTLAB(Thread* self,
+ size_t alloc_size,
+ bool grow,
+ size_t* bytes_allocated,
+ size_t* usable_size,
+ size_t* bytes_tl_bulk_allocated)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
void ThrowOutOfMemoryError(Thread* self, size_t byte_count, AllocatorType allocator_type)
REQUIRES_SHARED(Locks::mutator_lock_);
- template <bool kGrow>
- ALWAYS_INLINE bool IsOutOfMemoryOnAllocation(AllocatorType allocator_type, size_t alloc_size);
+ ALWAYS_INLINE bool IsOutOfMemoryOnAllocation(AllocatorType allocator_type,
+ size_t alloc_size,
+ bool grow);
// Run the finalizers. If timeout is non zero, then we use the VMRuntime version.
void RunFinalization(JNIEnv* env, uint64_t timeout);
diff --git a/runtime/gc/reference_processor.cc b/runtime/gc/reference_processor.cc
index 2cde7d5..081be96 100644
--- a/runtime/gc/reference_processor.cc
+++ b/runtime/gc/reference_processor.cc
@@ -75,11 +75,10 @@
MutexLock mu(self, *Locks::reference_processor_lock_);
while ((!kUseReadBarrier && SlowPathEnabled()) ||
(kUseReadBarrier && !self->GetWeakRefAccessEnabled())) {
- mirror::HeapReference<mirror::Object>* const referent_addr =
- reference->GetReferentReferenceAddr();
+ ObjPtr<mirror::Object> referent = reference->GetReferent<kWithoutReadBarrier>();
// If the referent became cleared, return it. Don't need barrier since thread roots can't get
// updated until after we leave the function due to holding the mutator lock.
- if (referent_addr->AsMirrorPtr() == nullptr) {
+ if (referent == nullptr) {
return nullptr;
}
// Try to see if the referent is already marked by using the is_marked_callback. We can return
@@ -91,10 +90,15 @@
// case only black nodes can be safely returned. If the GC is preserving references, the
// mutator could take a white field from a grey or white node and move it somewhere else
// in the heap causing corruption since this field would get swept.
- if (collector_->IsMarkedHeapReference(referent_addr)) {
+ // Use the cached referent instead of calling GetReferent since other threads could call
+ // Reference.clear() after we did the null check resulting in a null pointer being
+ // incorrectly passed to IsMarked. b/33569625
+ ObjPtr<mirror::Object> forwarded_ref = collector_->IsMarked(referent.Ptr());
+ if (forwarded_ref != nullptr) {
+ // Non null means that it is marked.
if (!preserving_references_ ||
(LIKELY(!reference->IsFinalizerReferenceInstance()) && reference->IsUnprocessed())) {
- return referent_addr->AsMirrorPtr();
+ return forwarded_ref;
}
}
}
@@ -265,11 +269,23 @@
}
}
-bool ReferenceProcessor::MakeCircularListIfUnenqueued(
- ObjPtr<mirror::FinalizerReference> reference) {
+void ReferenceProcessor::ClearReferent(ObjPtr<mirror::Reference> ref) {
Thread* self = Thread::Current();
MutexLock mu(self, *Locks::reference_processor_lock_);
- // Wait untul we are done processing reference.
+ // Need to wait until reference processing is done since IsMarkedHeapReference does not have a
+ // CAS. If we do not wait, it can result in the GC un-clearing references due to race conditions.
+ // This also handles the race where the referent gets cleared after a null check but before
+ // IsMarkedHeapReference is called.
+ WaitUntilDoneProcessingReferences(self);
+ if (Runtime::Current()->IsActiveTransaction()) {
+ ref->ClearReferent<true>();
+ } else {
+ ref->ClearReferent<false>();
+ }
+}
+
+void ReferenceProcessor::WaitUntilDoneProcessingReferences(Thread* self) {
+ // Wait until we are done processing reference.
while ((!kUseReadBarrier && SlowPathEnabled()) ||
(kUseReadBarrier && !self->GetWeakRefAccessEnabled())) {
// Check and run the empty checkpoint before blocking so the empty checkpoint will work in the
@@ -277,6 +293,13 @@
self->CheckEmptyCheckpoint();
condition_.WaitHoldingLocks(self);
}
+}
+
+bool ReferenceProcessor::MakeCircularListIfUnenqueued(
+ ObjPtr<mirror::FinalizerReference> reference) {
+ Thread* self = Thread::Current();
+ MutexLock mu(self, *Locks::reference_processor_lock_);
+ WaitUntilDoneProcessingReferences(self);
// At this point, since the sentinel of the reference is live, it is guaranteed to not be
// enqueued if we just finished processing references. Otherwise, we may be doing the main GC
// phase. Since we are holding the reference processor lock, it guarantees that reference
diff --git a/runtime/gc/reference_processor.h b/runtime/gc/reference_processor.h
index 759b7e1..b15544d 100644
--- a/runtime/gc/reference_processor.h
+++ b/runtime/gc/reference_processor.h
@@ -73,6 +73,9 @@
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Locks::reference_processor_lock_,
!Locks::reference_queue_finalizer_references_lock_);
+ void ClearReferent(ObjPtr<mirror::Reference> ref)
+ REQUIRES_SHARED(Locks::mutator_lock_)
+ REQUIRES(!Locks::reference_processor_lock_);
private:
bool SlowPathEnabled() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -84,6 +87,10 @@
// referents.
void StartPreservingReferences(Thread* self) REQUIRES(!Locks::reference_processor_lock_);
void StopPreservingReferences(Thread* self) REQUIRES(!Locks::reference_processor_lock_);
+ // Wait until reference processing is done.
+ void WaitUntilDoneProcessingReferences(Thread* self)
+ REQUIRES_SHARED(Locks::mutator_lock_)
+ REQUIRES(Locks::reference_processor_lock_);
// Collector which is clearing references, used by the GetReferent to return referents which are
// already marked.
collector::GarbageCollector* collector_ GUARDED_BY(Locks::reference_processor_lock_);
diff --git a/runtime/gc/space/image_space.cc b/runtime/gc/space/image_space.cc
index 6019540..e03958d 100644
--- a/runtime/gc/space/image_space.cc
+++ b/runtime/gc/space/image_space.cc
@@ -22,6 +22,9 @@
#include <sys/types.h>
#include <unistd.h>
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
#include "art_method.h"
#include "base/enums.h"
#include "base/macros.h"
@@ -43,6 +46,9 @@
namespace gc {
namespace space {
+using android::base::StringAppendF;
+using android::base::StringPrintf;
+
Atomic<uint32_t> ImageSpace::bitmap_index_(0);
ImageSpace::ImageSpace(const std::string& image_filename,
@@ -137,7 +143,7 @@
arg_vector.push_back(compiler_options[i].c_str());
}
- std::string command_line(Join(arg_vector, ' '));
+ std::string command_line(android::base::Join(arg_vector, ' '));
LOG(INFO) << "GenerateImage: " << command_line;
return Exec(arg_vector, error_msg);
}
@@ -257,7 +263,7 @@
argv.push_back(instruction_set_arg);
argv.push_back(base_offset_arg);
- std::string command_line(Join(argv, ' '));
+ std::string command_line(android::base::Join(argv, ' '));
LOG(INFO) << "RelocateImage: " << command_line;
return Exec(argv, error_msg);
}
@@ -1617,6 +1623,81 @@
return nullptr;
}
+bool ImageSpace::LoadBootImage(const std::string& image_file_name,
+ const InstructionSet image_instruction_set,
+ std::vector<space::ImageSpace*>* boot_image_spaces,
+ uint8_t** oat_file_end) {
+ DCHECK(boot_image_spaces != nullptr);
+ DCHECK(boot_image_spaces->empty());
+ DCHECK(oat_file_end != nullptr);
+ DCHECK_NE(image_instruction_set, InstructionSet::kNone);
+
+ if (image_file_name.empty()) {
+ return false;
+ }
+
+ // For code reuse, handle this like a work queue.
+ std::vector<std::string> image_file_names;
+ image_file_names.push_back(image_file_name);
+
+ bool error = false;
+ uint8_t* oat_file_end_tmp = *oat_file_end;
+
+ for (size_t index = 0; index < image_file_names.size(); ++index) {
+ std::string& image_name = image_file_names[index];
+ std::string error_msg;
+ std::unique_ptr<space::ImageSpace> boot_image_space_uptr = CreateBootImage(
+ image_name.c_str(),
+ image_instruction_set,
+ index > 0,
+ &error_msg);
+ if (boot_image_space_uptr != nullptr) {
+ space::ImageSpace* boot_image_space = boot_image_space_uptr.release();
+ boot_image_spaces->push_back(boot_image_space);
+ // Oat files referenced by image files immediately follow them in memory, ensure alloc space
+ // isn't going to get in the middle
+ uint8_t* oat_file_end_addr = boot_image_space->GetImageHeader().GetOatFileEnd();
+ CHECK_GT(oat_file_end_addr, boot_image_space->End());
+ oat_file_end_tmp = AlignUp(oat_file_end_addr, kPageSize);
+
+ if (index == 0) {
+ // If this was the first space, check whether there are more images to load.
+ const OatFile* boot_oat_file = boot_image_space->GetOatFile();
+ if (boot_oat_file == nullptr) {
+ continue;
+ }
+
+ const OatHeader& boot_oat_header = boot_oat_file->GetOatHeader();
+ const char* boot_classpath =
+ boot_oat_header.GetStoreValueByKey(OatHeader::kBootClassPathKey);
+ if (boot_classpath == nullptr) {
+ continue;
+ }
+
+ ExtractMultiImageLocations(image_file_name, boot_classpath, &image_file_names);
+ }
+ } else {
+ error = true;
+ LOG(ERROR) << "Could not create image space with image file '" << image_file_name << "'. "
+ << "Attempting to fall back to imageless running. Error was: " << error_msg
+ << "\nAttempted image: " << image_name;
+ break;
+ }
+ }
+
+ if (error) {
+ // Remove already loaded spaces.
+ for (space::Space* loaded_space : *boot_image_spaces) {
+ delete loaded_space;
+ }
+ boot_image_spaces->clear();
+ return false;
+ }
+
+ *oat_file_end = oat_file_end_tmp;
+ return true;
+}
+
std::unique_ptr<ImageSpace> ImageSpace::CreateFromAppImage(const char* image,
const OatFile* oat_file,
std::string* error_msg) {
diff --git a/runtime/gc/space/image_space.h b/runtime/gc/space/image_space.h
index 0ba131b..489a289 100644
--- a/runtime/gc/space/image_space.h
+++ b/runtime/gc/space/image_space.h
@@ -17,6 +17,7 @@
#ifndef ART_RUNTIME_GC_SPACE_IMAGE_SPACE_H_
#define ART_RUNTIME_GC_SPACE_IMAGE_SPACE_H_
+#include "arch/instruction_set.h"
#include "gc/accounting/space_bitmap.h"
#include "runtime.h"
#include "space.h"
@@ -35,18 +36,15 @@
return kSpaceTypeImageSpace;
}
- // Create a boot image space from an image file for a specified instruction
- // set. Cannot be used for future allocation or collected.
+ // Load boot image spaces from a primary image file for a specified instruction set.
//
- // Create also opens the OatFile associated with the image file so
- // that it be contiguously allocated with the image before the
- // creation of the alloc space. The ReleaseOatFile will later be
- // used to transfer ownership of the OatFile to the ClassLinker when
- // it is initialized.
- static std::unique_ptr<ImageSpace> CreateBootImage(const char* image,
- InstructionSet image_isa,
- bool secondary_image,
- std::string* error_msg)
+ // On successful return, the loaded spaces are added to boot_image_spaces (which must be
+ // empty on entry) and oat_file_end is updated with the (page-aligned) end of the last
+ // oat file.
+ static bool LoadBootImage(const std::string& image_file_name,
+ const InstructionSet image_instruction_set,
+ std::vector<space::ImageSpace*>* boot_image_spaces,
+ uint8_t** oat_file_end)
REQUIRES_SHARED(Locks::mutator_lock_);
// Try to open an existing app image space.
@@ -189,6 +187,20 @@
friend class Space;
private:
+ // Create a boot image space from an image file for a specified instruction
+ // set. Cannot be used for future allocation or collected.
+ //
+ // Create also opens the OatFile associated with the image file so
+ // that it be contiguously allocated with the image before the
+ // creation of the alloc space. The ReleaseOatFile will later be
+ // used to transfer ownership of the OatFile to the ClassLinker when
+ // it is initialized.
+ static std::unique_ptr<ImageSpace> CreateBootImage(const char* image,
+ InstructionSet image_isa,
+ bool secondary_image,
+ std::string* error_msg)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
DISALLOW_COPY_AND_ASSIGN(ImageSpace);
};
diff --git a/runtime/gc/space/image_space_fs.h b/runtime/gc/space/image_space_fs.h
index fa941c0..5999548 100644
--- a/runtime/gc/space/image_space_fs.h
+++ b/runtime/gc/space/image_space_fs.h
@@ -20,9 +20,10 @@
#include <dirent.h>
#include <dlfcn.h>
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
#include "base/macros.h"
-#include "base/stringprintf.h"
#include "base/unix_file/fd_file.h"
#include "globals.h"
#include "os.h"
@@ -56,7 +57,7 @@
continue;
}
// We only want to delete regular files and symbolic links.
- std::string file = StringPrintf("%s/%s", dir.c_str(), name);
+ std::string file = android::base::StringPrintf("%s/%s", dir.c_str(), name);
if (de->d_type != DT_REG && de->d_type != DT_LNK) {
if (de->d_type == DT_DIR) {
if (recurse) {
diff --git a/runtime/gc/space/malloc_space.cc b/runtime/gc/space/malloc_space.cc
index b1572cc..a186f4c 100644
--- a/runtime/gc/space/malloc_space.cc
+++ b/runtime/gc/space/malloc_space.cc
@@ -16,6 +16,8 @@
#include "malloc_space.h"
+#include "android-base/stringprintf.h"
+
#include "gc/accounting/card_table-inl.h"
#include "gc/accounting/space_bitmap-inl.h"
#include "gc/heap.h"
@@ -33,6 +35,8 @@
namespace gc {
namespace space {
+using android::base::StringPrintf;
+
size_t MallocSpace::bitmap_index_ = 0;
MallocSpace::MallocSpace(const std::string& name, MemMap* mem_map,
diff --git a/runtime/gc_root.h b/runtime/gc_root.h
index 85cd0a4..79e80f1 100644
--- a/runtime/gc_root.h
+++ b/runtime/gc_root.h
@@ -86,6 +86,22 @@
return os;
}
+// Not all combinations of flags are valid. You may not visit all roots as well as the new roots
+// (no logical reason to do this). You also may not start logging new roots and stop logging new
+// roots (also no logical reason to do this).
+//
+// The precise flag ensures that more metadata is supplied. An example is vreg data for compiled
+// method frames.
+enum VisitRootFlags : uint8_t {
+ kVisitRootFlagAllRoots = 0x1,
+ kVisitRootFlagNewRoots = 0x2,
+ kVisitRootFlagStartLoggingNewRoots = 0x4,
+ kVisitRootFlagStopLoggingNewRoots = 0x8,
+ kVisitRootFlagClearRootLog = 0x10,
+ kVisitRootFlagClassLoader = 0x20,
+ kVisitRootFlagPrecise = 0x80,
+};
+
class RootVisitor {
public:
virtual ~RootVisitor() { }
@@ -267,6 +283,43 @@
size_t buffer_pos_;
};
+class UnbufferedRootVisitor {
+ public:
+ UnbufferedRootVisitor(RootVisitor* visitor, const RootInfo& root_info)
+ : visitor_(visitor), root_info_(root_info) {}
+
+ template <class MirrorType>
+ ALWAYS_INLINE void VisitRootIfNonNull(GcRoot<MirrorType>& root) const
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ if (!root.IsNull()) {
+ VisitRoot(root);
+ }
+ }
+
+ template <class MirrorType>
+ ALWAYS_INLINE void VisitRootIfNonNull(mirror::CompressedReference<MirrorType>* root) const
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ if (!root->IsNull()) {
+ VisitRoot(root);
+ }
+ }
+
+ template <class MirrorType>
+ void VisitRoot(GcRoot<MirrorType>& root) const REQUIRES_SHARED(Locks::mutator_lock_) {
+ VisitRoot(root.AddressWithoutBarrier());
+ }
+
+ template <class MirrorType>
+ void VisitRoot(mirror::CompressedReference<MirrorType>* root) const
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ visitor_->VisitRoots(&root, 1, root_info_);
+ }
+
+ private:
+ RootVisitor* const visitor_;
+ RootInfo root_info_;
+};
+
} // namespace art
#endif // ART_RUNTIME_GC_ROOT_H_
diff --git a/runtime/generated/asm_support_gen.h b/runtime/generated/asm_support_gen.h
index f13ff8c..bebcd71 100644
--- a/runtime/generated/asm_support_gen.h
+++ b/runtime/generated/asm_support_gen.h
@@ -74,8 +74,6 @@
DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_QUICK_CODE_OFFSET_64), (static_cast<int32_t>(art::ArtMethod:: EntryPointFromQuickCompiledCodeOffset(art::PointerSize::k64).Int32Value())))
#define ART_METHOD_DECLARING_CLASS_OFFSET 0
DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_DECLARING_CLASS_OFFSET), (static_cast<int32_t>(art::ArtMethod:: DeclaringClassOffset().Int32Value())))
-#define DECLARING_CLASS_DEX_CACHE_STRINGS_OFFSET 40
-DEFINE_CHECK_EQ(static_cast<int32_t>(DECLARING_CLASS_DEX_CACHE_STRINGS_OFFSET), (static_cast<int32_t>(art::mirror::Class:: DexCacheStringsOffset().Int32Value())))
#define STRING_DEX_CACHE_ELEMENT_SIZE_SHIFT 3
DEFINE_CHECK_EQ(static_cast<int32_t>(STRING_DEX_CACHE_ELEMENT_SIZE_SHIFT), (static_cast<int32_t>(art::WhichPowerOf2(sizeof(art::mirror::StringDexCachePair)))))
#define STRING_DEX_CACHE_SIZE_MINUS_ONE 1023
diff --git a/runtime/handle.h b/runtime/handle.h
index 3db3be2..e4b6d29 100644
--- a/runtime/handle.h
+++ b/runtime/handle.h
@@ -61,6 +61,10 @@
return down_cast<T*>(reference_->AsMirrorPtr());
}
+ ALWAYS_INLINE bool IsNull() const REQUIRES_SHARED(Locks::mutator_lock_) {
+ return Get() == nullptr;
+ }
+
ALWAYS_INLINE jobject ToJObject() const REQUIRES_SHARED(Locks::mutator_lock_) {
if (UNLIKELY(reference_->AsMirrorPtr() == nullptr)) {
// Special case so that we work with null handles.
diff --git a/runtime/hprof/hprof.cc b/runtime/hprof/hprof.cc
index 8cbe491..fe6a6e9 100644
--- a/runtime/hprof/hprof.cc
+++ b/runtime/hprof/hprof.cc
@@ -37,9 +37,10 @@
#include <set>
+#include "android-base/stringprintf.h"
+
#include "art_field-inl.h"
#include "base/logging.h"
-#include "base/stringprintf.h"
#include "base/time_utils.h"
#include "base/unix_file/fd_file.h"
#include "class_linker.h"
@@ -797,8 +798,9 @@
file->Erase();
}
if (!okay) {
- std::string msg(StringPrintf("Couldn't dump heap; writing \"%s\" failed: %s",
- filename_.c_str(), strerror(errno)));
+ std::string msg(android::base::StringPrintf("Couldn't dump heap; writing \"%s\" failed: %s",
+ filename_.c_str(),
+ strerror(errno)));
ThrowRuntimeException("%s", msg.c_str());
LOG(ERROR) << msg;
}
diff --git a/runtime/image.cc b/runtime/image.cc
index bd5ba93..2ef60c3 100644
--- a/runtime/image.cc
+++ b/runtime/image.cc
@@ -25,7 +25,7 @@
namespace art {
const uint8_t ImageHeader::kImageMagic[] = { 'a', 'r', 't', '\n' };
-const uint8_t ImageHeader::kImageVersion[] = { '0', '3', '2', '\0' };
+const uint8_t ImageHeader::kImageVersion[] = { '0', '3', '4', '\0' }; // mirror::Class update
ImageHeader::ImageHeader(uint32_t image_begin,
uint32_t image_size,
diff --git a/runtime/image.h b/runtime/image.h
index da9976a..6c76f49 100644
--- a/runtime/image.h
+++ b/runtime/image.h
@@ -189,6 +189,7 @@
enum ImageRoot {
kDexCaches,
kClassRoots,
+ kClassLoader, // App image only.
kImageRootsMax,
};
@@ -206,6 +207,10 @@
kSectionCount, // Number of elements in enum.
};
+ static size_t NumberOfImageRoots(bool app_image) {
+ return app_image ? kImageRootsMax : kImageRootsMax - 1u;
+ }
+
ArtMethod* GetImageMethod(ImageMethod index) const;
void SetImageMethod(ImageMethod index, ArtMethod* method);
diff --git a/runtime/indirect_reference_table-inl.h b/runtime/indirect_reference_table-inl.h
index 9c634fa..0e66ae9 100644
--- a/runtime/indirect_reference_table-inl.h
+++ b/runtime/indirect_reference_table-inl.h
@@ -19,6 +19,8 @@
#include "indirect_reference_table.h"
+#include "android-base/stringprintf.h"
+
#include "base/dumpable.h"
#include "gc_root-inl.h"
#include "obj_ptr-inl.h"
@@ -38,15 +40,15 @@
return false;
}
if (UNLIKELY(GetIndirectRefKind(iref) == kHandleScopeOrInvalid)) {
- AbortIfNoCheckJNI(StringPrintf("JNI ERROR (app bug): invalid %s %p",
- GetIndirectRefKindString(kind_),
- iref));
+ AbortIfNoCheckJNI(android::base::StringPrintf("JNI ERROR (app bug): invalid %s %p",
+ GetIndirectRefKindString(kind_),
+ iref));
return false;
}
const uint32_t top_index = segment_state_.top_index;
uint32_t idx = ExtractIndex(iref);
if (UNLIKELY(idx >= top_index)) {
- std::string msg = StringPrintf(
+ std::string msg = android::base::StringPrintf(
"JNI ERROR (app bug): accessed stale %s %p (index %d in a table of size %d)",
GetIndirectRefKindString(kind_),
iref,
@@ -56,9 +58,9 @@
return false;
}
if (UNLIKELY(table_[idx].GetReference()->IsNull())) {
- AbortIfNoCheckJNI(StringPrintf("JNI ERROR (app bug): accessed deleted %s %p",
- GetIndirectRefKindString(kind_),
- iref));
+ AbortIfNoCheckJNI(android::base::StringPrintf("JNI ERROR (app bug): accessed deleted %s %p",
+ GetIndirectRefKindString(kind_),
+ iref));
return false;
}
if (UNLIKELY(!CheckEntry("use", iref, idx))) {
@@ -73,7 +75,7 @@
uint32_t idx) const {
IndirectRef checkRef = ToIndirectRef(idx);
if (UNLIKELY(checkRef != iref)) {
- std::string msg = StringPrintf(
+ std::string msg = android::base::StringPrintf(
"JNI ERROR (app bug): attempt to %s stale %s %p (should be %p)",
what,
GetIndirectRefKindString(kind_),
diff --git a/runtime/indirect_reference_table_test.cc b/runtime/indirect_reference_table_test.cc
index 722b411..bf4cab2 100644
--- a/runtime/indirect_reference_table_test.cc
+++ b/runtime/indirect_reference_table_test.cc
@@ -16,6 +16,8 @@
#include "indirect_reference_table-inl.h"
+#include "android-base/stringprintf.h"
+
#include "class_linker-inl.h"
#include "common_runtime_test.h"
#include "mirror/object-inl.h"
@@ -23,6 +25,8 @@
namespace art {
+using android::base::StringPrintf;
+
class IndirectReferenceTableTest : public CommonRuntimeTest {};
static void CheckDump(IndirectReferenceTable* irt, size_t num_objects, size_t num_unique)
diff --git a/runtime/instrumentation.cc b/runtime/instrumentation.cc
index d4c322e..03ef962 100644
--- a/runtime/instrumentation.cc
+++ b/runtime/instrumentation.cc
@@ -630,7 +630,7 @@
}
static void ResetQuickAllocEntryPointsForThread(Thread* thread, void* arg ATTRIBUTE_UNUSED) {
- thread->ResetQuickAllocEntryPointsForThread();
+ thread->ResetQuickAllocEntryPointsForThread(kUseReadBarrier && thread->GetIsGcMarking());
}
void Instrumentation::SetEntrypointsInstrumented(bool instrumented) {
@@ -1098,10 +1098,14 @@
Dbg::IsForcedInterpreterNeededForUpcall(self, visitor.caller));
if (deoptimize && Runtime::Current()->IsDeoptimizeable(*return_pc)) {
if (kVerboseInstrumentation) {
- LOG(INFO) << StringPrintf("Deoptimizing %s by returning from %s with result %#" PRIx64 " in ",
- visitor.caller->PrettyMethod().c_str(),
- method->PrettyMethod().c_str(),
- return_value.GetJ()) << *self;
+ LOG(INFO) << "Deoptimizing "
+ << visitor.caller->PrettyMethod()
+ << " by returning from "
+ << method->PrettyMethod()
+ << " with result "
+ << std::hex << return_value.GetJ() << std::dec
+ << " in "
+ << *self;
}
self->PushDeoptimizationContext(return_value,
return_shorty == 'L',
diff --git a/runtime/interpreter/interpreter.cc b/runtime/interpreter/interpreter.cc
index a32c800..1b3d339 100644
--- a/runtime/interpreter/interpreter.cc
+++ b/runtime/interpreter/interpreter.cc
@@ -543,7 +543,7 @@
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
// This is a suspend point. But it's ok since value has been set into shadow_frame.
ObjPtr<mirror::Class> klass = class_linker->ResolveType(
- instr->VRegB_21c(), shadow_frame->GetMethod());
+ dex::TypeIndex(instr->VRegB_21c()), shadow_frame->GetMethod());
DCHECK(klass->IsStringClass());
}
} else {
diff --git a/runtime/interpreter/interpreter_common.cc b/runtime/interpreter/interpreter_common.cc
index 8c63a9e..a09e71b 100644
--- a/runtime/interpreter/interpreter_common.cc
+++ b/runtime/interpreter/interpreter_common.cc
@@ -427,7 +427,7 @@
if (!reg->VerifierInstanceOf(field_class.Ptr())) {
// This should never happen.
std::string temp1, temp2, temp3;
- self->ThrowNewExceptionF("Ljava/lang/VirtualMachineError;",
+ self->ThrowNewExceptionF("Ljava/lang/InternalError;",
"Put '%s' that is not instance of field '%s' in '%s'",
reg->GetClass()->GetDescriptor(&temp1),
field_class->GetDescriptor(&temp2),
@@ -676,7 +676,7 @@
CHECK(Runtime::Current()->IsActiveTransaction());
// Constructs abort message.
std::string abort_msg;
- StringAppendV(&abort_msg, fmt, args);
+ android::base::StringAppendV(&abort_msg, fmt, args);
// Throws an exception so we can abort the transaction and rollback every change.
Runtime::Current()->AbortTransactionAndThrowAbortError(self, abort_msg);
}
@@ -865,11 +865,6 @@
// The invoke_method_idx here is the name of the signature polymorphic method that
// was symbolically invoked in bytecode (say MethodHandle.invoke or MethodHandle.invokeExact)
// and not the method that we'll dispatch to in the end.
- //
- // TODO(narayan) We'll have to check in the verifier that this is in fact a
- // signature polymorphic method so that we disallow calls via invoke-polymorphic
- // to non sig-poly methods. This would also have the side effect of verifying
- // that vRegC really is a reference type.
StackHandleScope<6> hs(self);
Handle<mirror::MethodHandleImpl> method_handle(hs.NewHandle(
ObjPtr<mirror::MethodHandleImpl>::DownCast(
@@ -922,7 +917,7 @@
ThrowWrongMethodTypeException(check_type.Ptr(), callsite_type.Get());
return false;
}
- } else {
+ } else if (!IsInvokeTransform(handle_kind)) {
if (UNLIKELY(!IsCallerTransformer(callsite_type) &&
!callsite_type->IsConvertible(check_type.Ptr()))) {
ThrowWrongMethodTypeException(check_type.Ptr(), callsite_type.Get());
@@ -990,33 +985,37 @@
CHECK(called_method != nullptr);
}
- bool call_success;
- if (handle_kind == kInvokeTransform) {
- call_success = DoCallTransform<is_range>(called_method,
- callsite_type,
- handle_type,
- self,
- shadow_frame,
- method_handle /* receiver */,
- result,
- arg,
- first_src_reg);
+ if (IsInvokeTransform(handle_kind)) {
+ // There are two cases here - method handles representing regular
+ // transforms and those representing call site transforms. Method
+ // handles for call site transforms adapt their MethodType to match
+ // the call site. For these, the |callee_type| is the same as the
+ // |callsite_type|. The VarargsCollector is such a tranform, its
+ // method type depends on the call site, ie. x(a) or x(a, b), or
+ // x(a, b, c). The VarargsCollector invokes a variable arity method
+ // with the arity arguments in an array.
+ Handle<mirror::MethodType> callee_type =
+ (handle_kind == kInvokeCallSiteTransform) ? callsite_type : handle_type;
+ return DoCallTransform<is_range>(called_method,
+ callsite_type,
+ callee_type,
+ self,
+ shadow_frame,
+ method_handle /* receiver */,
+ result,
+ arg,
+ first_src_reg);
} else {
- call_success = DoCallPolymorphic<is_range>(called_method,
- callsite_type,
- handle_type,
- self,
- shadow_frame,
- result,
- arg,
- first_src_reg,
- handle_kind);
+ return DoCallPolymorphic<is_range>(called_method,
+ callsite_type,
+ handle_type,
+ self,
+ shadow_frame,
+ result,
+ arg,
+ first_src_reg,
+ handle_kind);
}
- if (LIKELY(call_success && ConvertReturnValue(callsite_type, handle_type, result))) {
- return true;
- }
- DCHECK(self->IsExceptionPending());
- return false;
} else {
DCHECK(!is_range);
ArtField* field = method_handle->GetTargetField();
@@ -1097,7 +1096,6 @@
return num_ins;
}
-
inline void PerformCall(Thread* self,
const DexFile::CodeItem* code_item,
ArtMethod* caller_method,
@@ -1251,18 +1249,31 @@
}
PerformCall(self, code_item, shadow_frame.GetMethod(), first_dest_reg, new_shadow_frame, result);
+ if (self->IsExceptionPending()) {
+ return false;
+ }
// If the caller of this signature polymorphic method was a transformer,
// we need to copy the result back out to the emulated stack frame.
- if (is_caller_transformer && !self->IsExceptionPending()) {
- ObjPtr<mirror::EmulatedStackFrame> emulated_stack_frame(
- reinterpret_cast<mirror::EmulatedStackFrame*>(
- shadow_frame.GetVRegReference(first_src_reg)));
+ if (is_caller_transformer) {
+ StackHandleScope<2> hs(self);
+ Handle<mirror::EmulatedStackFrame> emulated_stack_frame(
+ hs.NewHandle(reinterpret_cast<mirror::EmulatedStackFrame*>(
+ shadow_frame.GetVRegReference(first_src_reg))));
+ Handle<mirror::MethodType> emulated_stack_type(hs.NewHandle(emulated_stack_frame->GetType()));
+ JValue local_result;
+ local_result.SetJ(result->GetJ());
- emulated_stack_frame->SetReturnValue(self, *result);
+ if (ConvertReturnValue(emulated_stack_type, target_type, &local_result)) {
+ emulated_stack_frame->SetReturnValue(self, local_result);
+ return true;
+ } else {
+ DCHECK(self->IsExceptionPending());
+ return false;
+ }
+ } else {
+ return ConvertReturnValue(callsite_type, target_type, result);
}
-
- return !self->IsExceptionPending();
}
template <bool is_range>
@@ -1329,14 +1340,14 @@
0 /* first dest reg */,
new_shadow_frame,
result);
+ if (self->IsExceptionPending()) {
+ return false;
+ }
// If the called transformer method we called has returned a value, then we
// need to copy it back to |result|.
- if (!self->IsExceptionPending()) {
- sf->GetReturnValue(self, result);
- }
-
- return !self->IsExceptionPending();
+ sf->GetReturnValue(self, result);
+ return ConvertReturnValue(callsite_type, callee_type, result);
}
template <bool is_range,
@@ -1460,7 +1471,7 @@
ObjPtr<mirror::Object> o = shadow_frame.GetVRegReference(src_reg);
if (do_assignability_check && o != nullptr) {
PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
- const uint32_t type_idx = params->GetTypeItem(shorty_pos).type_idx_;
+ const dex::TypeIndex type_idx = params->GetTypeItem(shorty_pos).type_idx_;
ObjPtr<mirror::Class> arg_type = method->GetDexCacheResolvedType(type_idx,
pointer_size);
if (arg_type == nullptr) {
@@ -1477,7 +1488,7 @@
if (!o->VerifierInstanceOf(arg_type)) {
// This should never happen.
std::string temp1, temp2;
- self->ThrowNewExceptionF("Ljava/lang/VirtualMachineError;",
+ self->ThrowNewExceptionF("Ljava/lang/InternalError;",
"Invoking %s with bad arg %d, type '%s' not instance of '%s'",
new_shadow_frame->GetMethod()->GetName(), shorty_pos,
o->GetClass()->GetDescriptor(&temp1),
@@ -1568,7 +1579,7 @@
return false;
}
uint16_t type_idx = is_range ? inst->VRegB_3rc() : inst->VRegB_35c();
- ObjPtr<mirror::Class> array_class = ResolveVerifyAndClinit(type_idx,
+ ObjPtr<mirror::Class> array_class = ResolveVerifyAndClinit(dex::TypeIndex(type_idx),
shadow_frame.GetMethod(),
self,
false,
diff --git a/runtime/interpreter/interpreter_common.h b/runtime/interpreter/interpreter_common.h
index 9c26d24..423f054 100644
--- a/runtime/interpreter/interpreter_common.h
+++ b/runtime/interpreter/interpreter_common.h
@@ -25,6 +25,8 @@
#include <sstream>
#include <atomic>
+#include "android-base/stringprintf.h"
+
#include "art_field-inl.h"
#include "art_method-inl.h"
#include "base/enums.h"
@@ -236,7 +238,7 @@
// java.lang.String class is initialized.
static inline ObjPtr<mirror::String> ResolveString(Thread* self,
ShadowFrame& shadow_frame,
- uint32_t string_idx)
+ dex::StringIndex string_idx)
REQUIRES_SHARED(Locks::mutator_lock_) {
ObjPtr<mirror::Class> java_lang_string_class = mirror::String::GetJavaLangString();
if (UNLIKELY(!java_lang_string_class->IsInitialized())) {
@@ -251,11 +253,11 @@
ArtMethod* method = shadow_frame.GetMethod();
ObjPtr<mirror::Class> declaring_class = method->GetDeclaringClass();
// MethodVerifier refuses methods with string_idx out of bounds.
- DCHECK_LT(string_idx % mirror::DexCache::kDexCacheStringCacheSize,
+ DCHECK_LT(string_idx.index_ % mirror::DexCache::kDexCacheStringCacheSize,
declaring_class->GetDexFile().NumStringIds());
ObjPtr<mirror::String> string_ptr =
- mirror::StringDexCachePair::Lookup(declaring_class->GetDexCacheStrings(),
- string_idx,
+ mirror::StringDexCachePair::Lookup(declaring_class->GetDexCache()->GetStrings(),
+ string_idx.index_,
mirror::DexCache::kDexCacheStringCacheSize).Read();
if (UNLIKELY(string_ptr == nullptr)) {
StackHandleScope<1> hs(self);
@@ -430,12 +432,12 @@
#define TRACE_LOG std::cerr
std::ostringstream oss;
oss << shadow_frame.GetMethod()->PrettyMethod()
- << StringPrintf("\n0x%x: ", dex_pc)
+ << android::base::StringPrintf("\n0x%x: ", dex_pc)
<< inst->DumpString(shadow_frame.GetMethod()->GetDexFile()) << "\n";
for (uint32_t i = 0; i < shadow_frame.NumberOfVRegs(); ++i) {
uint32_t raw_value = shadow_frame.GetVReg(i);
ObjPtr<mirror::Object> ref_value = shadow_frame.GetVRegReference(i);
- oss << StringPrintf(" vreg%u=0x%08X", i, raw_value);
+ oss << android::base::StringPrintf(" vreg%u=0x%08X", i, raw_value);
if (ref_value != nullptr) {
if (ref_value->GetClass()->IsStringClass() &&
!ref_value->AsString()->IsValueNull()) {
diff --git a/runtime/interpreter/interpreter_switch_impl.cc b/runtime/interpreter/interpreter_switch_impl.cc
index 435ac62..b0d7fb2 100644
--- a/runtime/interpreter/interpreter_switch_impl.cc
+++ b/runtime/interpreter/interpreter_switch_impl.cc
@@ -92,6 +92,16 @@
} \
} while (false)
+#define HANDLE_BACKWARD_BRANCH(offset) \
+ do { \
+ if (IsBackwardBranch(offset)) { \
+ HOTNESS_UPDATE(); \
+ /* Record new dex pc early to have consistent suspend point at loop header. */ \
+ shadow_frame.SetDexPC(inst->GetDexPc(insns)); \
+ self->AllowThreadSuspension(); \
+ } \
+ } while (false)
+
template<bool do_access_check, bool transaction_active>
JValue ExecuteSwitchImpl(Thread* self, const DexFile::CodeItem* code_item,
ShadowFrame& shadow_frame, JValue result_register,
@@ -287,7 +297,7 @@
if (!obj_result->VerifierInstanceOf(return_type)) {
// This should never happen.
std::string temp1, temp2;
- self->ThrowNewExceptionF("Ljava/lang/VirtualMachineError;",
+ self->ThrowNewExceptionF("Ljava/lang/InternalError;",
"Returning '%s' that is not instance of return type '%s'",
obj_result->GetClass()->GetDescriptor(&temp1),
return_type->GetDescriptor(&temp2));
@@ -373,7 +383,9 @@
break;
case Instruction::CONST_STRING: {
PREAMBLE();
- ObjPtr<mirror::String> s = ResolveString(self, shadow_frame, inst->VRegB_21c());
+ ObjPtr<mirror::String> s = ResolveString(self,
+ shadow_frame,
+ dex::StringIndex(inst->VRegB_21c()));
if (UNLIKELY(s == nullptr)) {
HANDLE_PENDING_EXCEPTION();
} else {
@@ -384,7 +396,9 @@
}
case Instruction::CONST_STRING_JUMBO: {
PREAMBLE();
- ObjPtr<mirror::String> s = ResolveString(self, shadow_frame, inst->VRegB_31c());
+ ObjPtr<mirror::String> s = ResolveString(self,
+ shadow_frame,
+ dex::StringIndex(inst->VRegB_31c()));
if (UNLIKELY(s == nullptr)) {
HANDLE_PENDING_EXCEPTION();
} else {
@@ -395,7 +409,7 @@
}
case Instruction::CONST_CLASS: {
PREAMBLE();
- ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(inst->VRegB_21c(),
+ ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(dex::TypeIndex(inst->VRegB_21c()),
shadow_frame.GetMethod(),
self,
false,
@@ -434,7 +448,7 @@
}
case Instruction::CHECK_CAST: {
PREAMBLE();
- ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(inst->VRegB_21c(),
+ ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(dex::TypeIndex(inst->VRegB_21c()),
shadow_frame.GetMethod(),
self,
false,
@@ -454,7 +468,7 @@
}
case Instruction::INSTANCE_OF: {
PREAMBLE();
- ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(inst->VRegC_22c(),
+ ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(dex::TypeIndex(inst->VRegC_22c()),
shadow_frame.GetMethod(),
self,
false,
@@ -484,7 +498,7 @@
case Instruction::NEW_INSTANCE: {
PREAMBLE();
ObjPtr<mirror::Object> obj = nullptr;
- ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(inst->VRegB_21c(),
+ ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(dex::TypeIndex(inst->VRegB_21c()),
shadow_frame.GetMethod(),
self,
false,
@@ -495,8 +509,10 @@
obj = mirror::String::AllocEmptyString<true>(self, allocator_type);
} else {
obj = AllocObjectFromCode<do_access_check, true>(
- inst->VRegB_21c(), shadow_frame.GetMethod(), self,
- Runtime::Current()->GetHeap()->GetCurrentAllocator());
+ dex::TypeIndex(inst->VRegB_21c()),
+ shadow_frame.GetMethod(),
+ self,
+ Runtime::Current()->GetHeap()->GetCurrentAllocator());
}
}
if (UNLIKELY(obj == nullptr)) {
@@ -520,7 +536,10 @@
PREAMBLE();
int32_t length = shadow_frame.GetVReg(inst->VRegB_22c(inst_data));
ObjPtr<mirror::Object> obj = AllocArrayFromCode<do_access_check, true>(
- inst->VRegC_22c(), length, shadow_frame.GetMethod(), self,
+ dex::TypeIndex(inst->VRegC_22c()),
+ length,
+ shadow_frame.GetMethod(),
+ self,
Runtime::Current()->GetHeap()->GetCurrentAllocator());
if (UNLIKELY(obj == nullptr)) {
HANDLE_PENDING_EXCEPTION();
@@ -572,7 +591,7 @@
} else if (do_assignability_check && !exception->GetClass()->IsThrowableClass()) {
// This should never happen.
std::string temp;
- self->ThrowNewExceptionF("Ljava/lang/VirtualMachineError;",
+ self->ThrowNewExceptionF("Ljava/lang/InternalError;",
"Throwing '%s' that is not instance of Throwable",
exception->GetClass()->GetDescriptor(&temp));
} else {
@@ -585,55 +604,40 @@
PREAMBLE();
int8_t offset = inst->VRegA_10t(inst_data);
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
break;
}
case Instruction::GOTO_16: {
PREAMBLE();
int16_t offset = inst->VRegA_20t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
break;
}
case Instruction::GOTO_32: {
PREAMBLE();
int32_t offset = inst->VRegA_30t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
break;
}
case Instruction::PACKED_SWITCH: {
PREAMBLE();
int32_t offset = DoPackedSwitch(inst, shadow_frame, inst_data);
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
break;
}
case Instruction::SPARSE_SWITCH: {
PREAMBLE();
int32_t offset = DoSparseSwitch(inst, shadow_frame, inst_data);
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
break;
}
@@ -730,11 +734,8 @@
shadow_frame.GetVReg(inst->VRegB_22t(inst_data))) {
int16_t offset = inst->VRegC_22t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
@@ -747,11 +748,8 @@
shadow_frame.GetVReg(inst->VRegB_22t(inst_data))) {
int16_t offset = inst->VRegC_22t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
@@ -764,11 +762,8 @@
shadow_frame.GetVReg(inst->VRegB_22t(inst_data))) {
int16_t offset = inst->VRegC_22t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
@@ -781,11 +776,8 @@
shadow_frame.GetVReg(inst->VRegB_22t(inst_data))) {
int16_t offset = inst->VRegC_22t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
@@ -798,11 +790,8 @@
shadow_frame.GetVReg(inst->VRegB_22t(inst_data))) {
int16_t offset = inst->VRegC_22t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
@@ -815,11 +804,8 @@
shadow_frame.GetVReg(inst->VRegB_22t(inst_data))) {
int16_t offset = inst->VRegC_22t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
@@ -831,11 +817,8 @@
if (shadow_frame.GetVReg(inst->VRegA_21t(inst_data)) == 0) {
int16_t offset = inst->VRegB_21t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
@@ -847,11 +830,8 @@
if (shadow_frame.GetVReg(inst->VRegA_21t(inst_data)) != 0) {
int16_t offset = inst->VRegB_21t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
@@ -863,11 +843,8 @@
if (shadow_frame.GetVReg(inst->VRegA_21t(inst_data)) < 0) {
int16_t offset = inst->VRegB_21t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
@@ -879,11 +856,8 @@
if (shadow_frame.GetVReg(inst->VRegA_21t(inst_data)) >= 0) {
int16_t offset = inst->VRegB_21t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
@@ -895,11 +869,8 @@
if (shadow_frame.GetVReg(inst->VRegA_21t(inst_data)) > 0) {
int16_t offset = inst->VRegB_21t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
@@ -911,11 +882,8 @@
if (shadow_frame.GetVReg(inst->VRegA_21t(inst_data)) <= 0) {
int16_t offset = inst->VRegB_21t();
BRANCH_INSTRUMENTATION(offset);
- if (IsBackwardBranch(offset)) {
- HOTNESS_UPDATE();
- self->AllowThreadSuspension();
- }
inst = inst->RelativeAt(offset);
+ HANDLE_BACKWARD_BRANCH(offset);
} else {
BRANCH_INSTRUMENTATION(2);
inst = inst->Next_2xx();
diff --git a/runtime/interpreter/mterp/arm/entry.S b/runtime/interpreter/mterp/arm/entry.S
index a6b131d..e53c054 100644
--- a/runtime/interpreter/mterp/arm/entry.S
+++ b/runtime/interpreter/mterp/arm/entry.S
@@ -31,10 +31,19 @@
*
*/
-ExecuteMterpImpl:
- .fnstart
- .save {r3-r10,fp,lr}
+ENTRY ExecuteMterpImpl
stmfd sp!, {r3-r10,fp,lr} @ save 10 regs, (r3 just to align 64)
+ .cfi_adjust_cfa_offset 40
+ .cfi_rel_offset r3, 0
+ .cfi_rel_offset r4, 4
+ .cfi_rel_offset r5, 8
+ .cfi_rel_offset r6, 12
+ .cfi_rel_offset r7, 16
+ .cfi_rel_offset r8, 20
+ .cfi_rel_offset r9, 24
+ .cfi_rel_offset r10, 28
+ .cfi_rel_offset fp, 32
+ .cfi_rel_offset lr, 36
/* Remember the return register */
str r3, [r2, #SHADOWFRAME_RESULT_REGISTER_OFFSET]
diff --git a/runtime/interpreter/mterp/arm/footer.S b/runtime/interpreter/mterp/arm/footer.S
index cd32ea2..c6801e5 100644
--- a/runtime/interpreter/mterp/arm/footer.S
+++ b/runtime/interpreter/mterp/arm/footer.S
@@ -294,6 +294,5 @@
mov r0, rINST @ restore return value
ldmfd sp!, {r3-r10,fp,pc} @ restore 10 regs and return
- .fnend
- .size ExecuteMterpImpl, .-ExecuteMterpImpl
+ END ExecuteMterpImpl
diff --git a/runtime/interpreter/mterp/arm/header.S b/runtime/interpreter/mterp/arm/header.S
index 039bcbe..597d9d4 100644
--- a/runtime/interpreter/mterp/arm/header.S
+++ b/runtime/interpreter/mterp/arm/header.S
@@ -287,3 +287,24 @@
.macro REFRESH_IBASE
ldr rIBASE, [rSELF, #THREAD_CURRENT_IBASE_OFFSET]
.endm
+
+/*
+ * cfi support macros.
+ */
+.macro ENTRY name
+ .arm
+ .type \name, #function
+ .hidden \name // Hide this as a global symbol, so we do not incur plt calls.
+ .global \name
+ /* Cache alignment for function entry */
+ .balign 16
+\name:
+ .cfi_startproc
+ .fnstart
+.endm
+
+.macro END name
+ .fnend
+ .cfi_endproc
+ .size \name, .-\name
+.endm
diff --git a/runtime/interpreter/mterp/arm/op_double_to_long.S b/runtime/interpreter/mterp/arm/op_double_to_long.S
index b100810..19ff723 100644
--- a/runtime/interpreter/mterp/arm/op_double_to_long.S
+++ b/runtime/interpreter/mterp/arm/op_double_to_long.S
@@ -1,4 +1,3 @@
-@include "arm/unopWide.S" {"instr":"bl __aeabi_d2lz"}
%include "arm/unopWide.S" {"instr":"bl d2l_doconv"}
%break
@@ -10,43 +9,25 @@
* to modest integer. The EABI convert function isn't doing this for us.
*/
d2l_doconv:
- stmfd sp!, {r4, r5, lr} @ save regs
- mov r3, #0x43000000 @ maxlong, as a double (high word)
- add r3, #0x00e00000 @ 0x43e00000
- mov r2, #0 @ maxlong, as a double (low word)
- sub sp, sp, #4 @ align for EABI
- mov r4, r0 @ save a copy of r0
- mov r5, r1 @ and r1
- bl __aeabi_dcmpge @ is arg >= maxlong?
- cmp r0, #0 @ nonzero == yes
- mvnne r0, #0 @ return maxlong (7fffffffffffffff)
- mvnne r1, #0x80000000
- bne 1f
-
- mov r0, r4 @ recover arg
- mov r1, r5
- mov r3, #0xc3000000 @ minlong, as a double (high word)
- add r3, #0x00e00000 @ 0xc3e00000
- mov r2, #0 @ minlong, as a double (low word)
- bl __aeabi_dcmple @ is arg <= minlong?
- cmp r0, #0 @ nonzero == yes
- movne r0, #0 @ return minlong (8000000000000000)
- movne r1, #0x80000000
- bne 1f
-
- mov r0, r4 @ recover arg
- mov r1, r5
- mov r2, r4 @ compare against self
- mov r3, r5
- bl __aeabi_dcmpeq @ is arg == self?
- cmp r0, #0 @ zero == no
- moveq r1, #0 @ return zero for NaN
- beq 1f
-
- mov r0, r4 @ recover arg
- mov r1, r5
- bl __aeabi_d2lz @ convert double to long
-
-1:
- add sp, sp, #4
- ldmfd sp!, {r4, r5, pc}
+ ubfx r2, r1, #20, #11 @ grab the exponent
+ movw r3, #0x43e
+ cmp r2, r3 @ MINLONG < x > MAXLONG?
+ bhs d2l_special_cases
+ b __aeabi_d2lz @ tail call to convert double to long
+d2l_special_cases:
+ movw r3, #0x7ff
+ cmp r2, r3
+ beq d2l_maybeNaN @ NaN?
+d2l_notNaN:
+ adds r1, r1, r1 @ sign bit to carry
+ mov r0, #0xffffffff @ assume maxlong for lsw
+ mov r1, #0x7fffffff @ assume maxlong for msw
+ adc r0, r0, #0
+ adc r1, r1, #0 @ convert maxlong to minlong if exp negative
+ bx lr @ return
+d2l_maybeNaN:
+ orrs r3, r0, r1, lsl #12
+ beq d2l_notNaN @ if fraction is non-zero, it's a NaN
+ mov r0, #0
+ mov r1, #0
+ bx lr @ return 0 for NaN
diff --git a/runtime/interpreter/mterp/arm/op_float_to_long.S b/runtime/interpreter/mterp/arm/op_float_to_long.S
index 5c8680f..42bd98d 100644
--- a/runtime/interpreter/mterp/arm/op_float_to_long.S
+++ b/runtime/interpreter/mterp/arm/op_float_to_long.S
@@ -1,4 +1,3 @@
-@include "arm/unopWider.S" {"instr":"bl __aeabi_f2lz"}
%include "arm/unopWider.S" {"instr":"bl f2l_doconv"}
%break
@@ -10,30 +9,23 @@
* to modest integer. The EABI convert function isn't doing this for us.
*/
f2l_doconv:
- stmfd sp!, {r4, lr}
- mov r1, #0x5f000000 @ (float)maxlong
- mov r4, r0
- bl __aeabi_fcmpge @ is arg >= maxlong?
- cmp r0, #0 @ nonzero == yes
- mvnne r0, #0 @ return maxlong (7fffffff)
- mvnne r1, #0x80000000
- popne {r4, pc}
-
- mov r0, r4 @ recover arg
- mov r1, #0xdf000000 @ (float)minlong
- bl __aeabi_fcmple @ is arg <= minlong?
- cmp r0, #0 @ nonzero == yes
- movne r0, #0 @ return minlong (80000000)
- movne r1, #0x80000000
- popne {r4, pc}
-
- mov r0, r4 @ recover arg
- mov r1, r4
- bl __aeabi_fcmpeq @ is arg == self?
- cmp r0, #0 @ zero == no
- moveq r1, #0 @ return zero for NaN
- popeq {r4, pc}
-
- mov r0, r4 @ recover arg
- bl __aeabi_f2lz @ convert float to long
- ldmfd sp!, {r4, pc}
+ ubfx r2, r0, #23, #8 @ grab the exponent
+ cmp r2, #0xbe @ MININT < x > MAXINT?
+ bhs f2l_special_cases
+ b __aeabi_f2lz @ tail call to convert float to long
+f2l_special_cases:
+ cmp r2, #0xff @ NaN or infinity?
+ beq f2l_maybeNaN
+f2l_notNaN:
+ adds r0, r0, r0 @ sign bit to carry
+ mov r0, #0xffffffff @ assume maxlong for lsw
+ mov r1, #0x7fffffff @ assume maxlong for msw
+ adc r0, r0, #0
+ adc r1, r1, #0 @ convert maxlong to minlong if exp negative
+ bx lr @ return
+f2l_maybeNaN:
+ lsls r3, r0, #9
+ beq f2l_notNaN @ if fraction is non-zero, it's a NaN
+ mov r0, #0
+ mov r1, #0
+ bx lr @ return 0 for NaN
diff --git a/runtime/interpreter/mterp/arm64/entry.S b/runtime/interpreter/mterp/arm64/entry.S
index 9fbbbd3..441c1a1 100644
--- a/runtime/interpreter/mterp/arm64/entry.S
+++ b/runtime/interpreter/mterp/arm64/entry.S
@@ -31,11 +31,11 @@
ExecuteMterpImpl:
.cfi_startproc
- stp xPROFILE, x27, [sp, #-80]!
- stp xIBASE, xREFS, [sp, #16]
- stp xSELF, xINST, [sp, #32]
- stp xPC, xFP, [sp, #48]
- stp fp, lr, [sp, #64]
+ SAVE_TWO_REGS_INCREASE_FRAME xPROFILE, x27, 80
+ SAVE_TWO_REGS xIBASE, xREFS, 16
+ SAVE_TWO_REGS xSELF, xINST, 32
+ SAVE_TWO_REGS xPC, xFP, 48
+ SAVE_TWO_REGS fp, lr, 64
add fp, sp, #64
/* Remember the return register */
diff --git a/runtime/interpreter/mterp/arm64/footer.S b/runtime/interpreter/mterp/arm64/footer.S
index ada0326..6ffbd3f 100644
--- a/runtime/interpreter/mterp/arm64/footer.S
+++ b/runtime/interpreter/mterp/arm64/footer.S
@@ -285,12 +285,15 @@
*/
cmp wPROFILE, #0
bgt MterpProfileActive // if > 0, we may have some counts to report.
- ldp fp, lr, [sp, #64]
- ldp xPC, xFP, [sp, #48]
- ldp xSELF, xINST, [sp, #32]
- ldp xIBASE, xREFS, [sp, #16]
- ldp xPROFILE, x27, [sp], #80
+ .cfi_remember_state
+ RESTORE_TWO_REGS fp, lr, 64
+ RESTORE_TWO_REGS xPC, xFP, 48
+ RESTORE_TWO_REGS xSELF, xINST, 32
+ RESTORE_TWO_REGS xIBASE, xREFS, 16
+ RESTORE_TWO_REGS_DECREASE_FRAME xPROFILE, x27, 80
ret
+ .cfi_restore_state // Reset unwind info so following code unwinds.
+ .cfi_def_cfa_offset 80 // workaround for clang bug: 31975598
MterpProfileActive:
mov xINST, x0 // stash return value
@@ -301,11 +304,11 @@
strh wPROFILE, [x1, #SHADOWFRAME_HOTNESS_COUNTDOWN_OFFSET]
bl MterpAddHotnessBatch // (method, shadow_frame, self)
mov x0, xINST // restore return value
- ldp fp, lr, [sp, #64]
- ldp xPC, xFP, [sp, #48]
- ldp xSELF, xINST, [sp, #32]
- ldp xIBASE, xREFS, [sp, #16]
- ldp xPROFILE, x27, [sp], #80
+ RESTORE_TWO_REGS fp, lr, 64
+ RESTORE_TWO_REGS xPC, xFP, 48
+ RESTORE_TWO_REGS xSELF, xINST, 32
+ RESTORE_TWO_REGS xIBASE, xREFS, 16
+ RESTORE_TWO_REGS_DECREASE_FRAME xPROFILE, x27, 80
ret
.cfi_endproc
diff --git a/runtime/interpreter/mterp/arm64/header.S b/runtime/interpreter/mterp/arm64/header.S
index c791eb5..7125d5a 100644
--- a/runtime/interpreter/mterp/arm64/header.S
+++ b/runtime/interpreter/mterp/arm64/header.S
@@ -292,3 +292,41 @@
.macro REFRESH_IBASE
ldr xIBASE, [xSELF, #THREAD_CURRENT_IBASE_OFFSET]
.endm
+
+/*
+ * Save two registers to the stack.
+ */
+.macro SAVE_TWO_REGS reg1, reg2, offset
+ stp \reg1, \reg2, [sp, #(\offset)]
+ .cfi_rel_offset \reg1, (\offset)
+ .cfi_rel_offset \reg2, (\offset) + 8
+.endm
+
+/*
+ * Restore two registers from the stack.
+ */
+.macro RESTORE_TWO_REGS reg1, reg2, offset
+ ldp \reg1, \reg2, [sp, #(\offset)]
+ .cfi_restore \reg1
+ .cfi_restore \reg2
+.endm
+
+/*
+ * Increase frame size and save two registers to the bottom of the stack.
+ */
+.macro SAVE_TWO_REGS_INCREASE_FRAME reg1, reg2, frame_adjustment
+ stp \reg1, \reg2, [sp, #-(\frame_adjustment)]!
+ .cfi_adjust_cfa_offset (\frame_adjustment)
+ .cfi_rel_offset \reg1, 0
+ .cfi_rel_offset \reg2, 8
+.endm
+
+/*
+ * Restore two registers from the bottom of the stack and decrease frame size.
+ */
+.macro RESTORE_TWO_REGS_DECREASE_FRAME reg1, reg2, frame_adjustment
+ ldp \reg1, \reg2, [sp], #(\frame_adjustment)
+ .cfi_restore \reg1
+ .cfi_restore \reg2
+ .cfi_adjust_cfa_offset -(\frame_adjustment)
+.endm
diff --git a/runtime/interpreter/mterp/mterp.cc b/runtime/interpreter/mterp/mterp.cc
index 2bd47bb..c8c1563 100644
--- a/runtime/interpreter/mterp/mterp.cc
+++ b/runtime/interpreter/mterp/mterp.cc
@@ -291,7 +291,7 @@
ShadowFrame* shadow_frame,
Thread* self)
REQUIRES_SHARED(Locks::mutator_lock_) {
- ObjPtr<mirror::String> s = ResolveString(self, *shadow_frame, index);
+ ObjPtr<mirror::String> s = ResolveString(self, *shadow_frame, dex::StringIndex(index));
if (UNLIKELY(s == nullptr)) {
return true;
}
@@ -304,7 +304,11 @@
ShadowFrame* shadow_frame,
Thread* self)
REQUIRES_SHARED(Locks::mutator_lock_) {
- mirror::Class* c = ResolveVerifyAndClinit(index, shadow_frame->GetMethod(), self, false, false);
+ mirror::Class* c = ResolveVerifyAndClinit(dex::TypeIndex(index),
+ shadow_frame->GetMethod(),
+ self,
+ false,
+ false);
if (UNLIKELY(c == nullptr)) {
return true;
}
@@ -317,7 +321,11 @@
art::ArtMethod* method,
Thread* self)
REQUIRES_SHARED(Locks::mutator_lock_) {
- ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(index, method, self, false, false);
+ ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(dex::TypeIndex(index),
+ method,
+ self,
+ false,
+ false);
if (UNLIKELY(c == nullptr)) {
return true;
}
@@ -335,7 +343,11 @@
art::ArtMethod* method,
Thread* self)
REQUIRES_SHARED(Locks::mutator_lock_) {
- ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(index, method, self, false, false);
+ ObjPtr<mirror::Class> c = ResolveVerifyAndClinit(dex::TypeIndex(index),
+ method,
+ self,
+ false,
+ false);
if (UNLIKELY(c == nullptr)) {
return false; // Caller will check for pending exception. Return value unimportant.
}
@@ -353,7 +365,7 @@
REQUIRES_SHARED(Locks::mutator_lock_) {
const Instruction* inst = Instruction::At(shadow_frame->GetDexPCPtr());
mirror::Object* obj = nullptr;
- mirror::Class* c = ResolveVerifyAndClinit(inst->VRegB_21c(),
+ mirror::Class* c = ResolveVerifyAndClinit(dex::TypeIndex(inst->VRegB_21c()),
shadow_frame->GetMethod(),
self,
false,
@@ -363,9 +375,10 @@
gc::AllocatorType allocator_type = Runtime::Current()->GetHeap()->GetCurrentAllocator();
obj = mirror::String::AllocEmptyString<true>(self, allocator_type);
} else {
- obj = AllocObjectFromCode<false, true>(
- inst->VRegB_21c(), shadow_frame->GetMethod(), self,
- Runtime::Current()->GetHeap()->GetCurrentAllocator());
+ obj = AllocObjectFromCode<false, true>(dex::TypeIndex(inst->VRegB_21c()),
+ shadow_frame->GetMethod(),
+ self,
+ Runtime::Current()->GetHeap()->GetCurrentAllocator());
}
}
if (UNLIKELY(obj == nullptr)) {
@@ -446,7 +459,7 @@
const Instruction* inst = Instruction::At(dex_pc_ptr);
int32_t length = shadow_frame->GetVReg(inst->VRegB_22c(inst_data));
mirror::Object* obj = AllocArrayFromCode<false, true>(
- inst->VRegC_22c(), length, shadow_frame->GetMethod(), self,
+ dex::TypeIndex(inst->VRegC_22c()), length, shadow_frame->GetMethod(), self,
Runtime::Current()->GetHeap()->GetCurrentAllocator());
if (UNLIKELY(obj == nullptr)) {
return false;
diff --git a/runtime/interpreter/mterp/out/mterp_arm.S b/runtime/interpreter/mterp/out/mterp_arm.S
index 4d540d7..8916241 100644
--- a/runtime/interpreter/mterp/out/mterp_arm.S
+++ b/runtime/interpreter/mterp/out/mterp_arm.S
@@ -295,6 +295,27 @@
ldr rIBASE, [rSELF, #THREAD_CURRENT_IBASE_OFFSET]
.endm
+/*
+ * cfi support macros.
+ */
+.macro ENTRY name
+ .arm
+ .type \name, #function
+ .hidden \name // Hide this as a global symbol, so we do not incur plt calls.
+ .global \name
+ /* Cache alignment for function entry */
+ .balign 16
+\name:
+ .cfi_startproc
+ .fnstart
+.endm
+
+.macro END name
+ .fnend
+ .cfi_endproc
+ .size \name, .-\name
+.endm
+
/* File: arm/entry.S */
/*
* Copyright (C) 2016 The Android Open Source Project
@@ -329,10 +350,19 @@
*
*/
-ExecuteMterpImpl:
- .fnstart
- .save {r3-r10,fp,lr}
+ENTRY ExecuteMterpImpl
stmfd sp!, {r3-r10,fp,lr} @ save 10 regs, (r3 just to align 64)
+ .cfi_adjust_cfa_offset 40
+ .cfi_rel_offset r3, 0
+ .cfi_rel_offset r4, 4
+ .cfi_rel_offset r5, 8
+ .cfi_rel_offset r6, 12
+ .cfi_rel_offset r7, 16
+ .cfi_rel_offset r8, 20
+ .cfi_rel_offset r9, 24
+ .cfi_rel_offset r10, 28
+ .cfi_rel_offset fp, 32
+ .cfi_rel_offset lr, 36
/* Remember the return register */
str r3, [r2, #SHADOWFRAME_RESULT_REGISTER_OFFSET]
@@ -3664,7 +3694,6 @@
.balign 128
.L_op_float_to_long: /* 0x88 */
/* File: arm/op_float_to_long.S */
-@include "arm/unopWider.S" {"instr":"bl __aeabi_f2lz"}
/* File: arm/unopWider.S */
/*
* Generic 32bit-to-64bit unary operation. Provide an "instr" line
@@ -3742,7 +3771,6 @@
.balign 128
.L_op_double_to_long: /* 0x8b */
/* File: arm/op_double_to_long.S */
-@include "arm/unopWide.S" {"instr":"bl __aeabi_d2lz"}
/* File: arm/unopWide.S */
/*
* Generic 64-bit unary operation. Provide an "instr" line that
@@ -7386,33 +7414,26 @@
* to modest integer. The EABI convert function isn't doing this for us.
*/
f2l_doconv:
- stmfd sp!, {r4, lr}
- mov r1, #0x5f000000 @ (float)maxlong
- mov r4, r0
- bl __aeabi_fcmpge @ is arg >= maxlong?
- cmp r0, #0 @ nonzero == yes
- mvnne r0, #0 @ return maxlong (7fffffff)
- mvnne r1, #0x80000000
- popne {r4, pc}
-
- mov r0, r4 @ recover arg
- mov r1, #0xdf000000 @ (float)minlong
- bl __aeabi_fcmple @ is arg <= minlong?
- cmp r0, #0 @ nonzero == yes
- movne r0, #0 @ return minlong (80000000)
- movne r1, #0x80000000
- popne {r4, pc}
-
- mov r0, r4 @ recover arg
- mov r1, r4
- bl __aeabi_fcmpeq @ is arg == self?
- cmp r0, #0 @ zero == no
- moveq r1, #0 @ return zero for NaN
- popeq {r4, pc}
-
- mov r0, r4 @ recover arg
- bl __aeabi_f2lz @ convert float to long
- ldmfd sp!, {r4, pc}
+ ubfx r2, r0, #23, #8 @ grab the exponent
+ cmp r2, #0xbe @ MININT < x > MAXINT?
+ bhs f2l_special_cases
+ b __aeabi_f2lz @ tail call to convert float to long
+f2l_special_cases:
+ cmp r2, #0xff @ NaN or infinity?
+ beq f2l_maybeNaN
+f2l_notNaN:
+ adds r0, r0, r0 @ sign bit to carry
+ mov r0, #0xffffffff @ assume maxlong for lsw
+ mov r1, #0x7fffffff @ assume maxlong for msw
+ adc r0, r0, #0
+ adc r1, r1, #0 @ convert maxlong to minlong if exp negative
+ bx lr @ return
+f2l_maybeNaN:
+ lsls r3, r0, #9
+ beq f2l_notNaN @ if fraction is non-zero, it's a NaN
+ mov r0, #0
+ mov r1, #0
+ bx lr @ return 0 for NaN
/* continuation for op_double_to_long */
/*
@@ -7423,46 +7444,28 @@
* to modest integer. The EABI convert function isn't doing this for us.
*/
d2l_doconv:
- stmfd sp!, {r4, r5, lr} @ save regs
- mov r3, #0x43000000 @ maxlong, as a double (high word)
- add r3, #0x00e00000 @ 0x43e00000
- mov r2, #0 @ maxlong, as a double (low word)
- sub sp, sp, #4 @ align for EABI
- mov r4, r0 @ save a copy of r0
- mov r5, r1 @ and r1
- bl __aeabi_dcmpge @ is arg >= maxlong?
- cmp r0, #0 @ nonzero == yes
- mvnne r0, #0 @ return maxlong (7fffffffffffffff)
- mvnne r1, #0x80000000
- bne 1f
-
- mov r0, r4 @ recover arg
- mov r1, r5
- mov r3, #0xc3000000 @ minlong, as a double (high word)
- add r3, #0x00e00000 @ 0xc3e00000
- mov r2, #0 @ minlong, as a double (low word)
- bl __aeabi_dcmple @ is arg <= minlong?
- cmp r0, #0 @ nonzero == yes
- movne r0, #0 @ return minlong (8000000000000000)
- movne r1, #0x80000000
- bne 1f
-
- mov r0, r4 @ recover arg
- mov r1, r5
- mov r2, r4 @ compare against self
- mov r3, r5
- bl __aeabi_dcmpeq @ is arg == self?
- cmp r0, #0 @ zero == no
- moveq r1, #0 @ return zero for NaN
- beq 1f
-
- mov r0, r4 @ recover arg
- mov r1, r5
- bl __aeabi_d2lz @ convert double to long
-
-1:
- add sp, sp, #4
- ldmfd sp!, {r4, r5, pc}
+ ubfx r2, r1, #20, #11 @ grab the exponent
+ movw r3, #0x43e
+ cmp r2, r3 @ MINLONG < x > MAXLONG?
+ bhs d2l_special_cases
+ b __aeabi_d2lz @ tail call to convert double to long
+d2l_special_cases:
+ movw r3, #0x7ff
+ cmp r2, r3
+ beq d2l_maybeNaN @ NaN?
+d2l_notNaN:
+ adds r1, r1, r1 @ sign bit to carry
+ mov r0, #0xffffffff @ assume maxlong for lsw
+ mov r1, #0x7fffffff @ assume maxlong for msw
+ adc r0, r0, #0
+ adc r1, r1, #0 @ convert maxlong to minlong if exp negative
+ bx lr @ return
+d2l_maybeNaN:
+ orrs r3, r0, r1, lsl #12
+ beq d2l_notNaN @ if fraction is non-zero, it's a NaN
+ mov r0, #0
+ mov r1, #0
+ bx lr @ return 0 for NaN
.size artMterpAsmSisterStart, .-artMterpAsmSisterStart
.global artMterpAsmSisterEnd
@@ -12127,7 +12130,6 @@
mov r0, rINST @ restore return value
ldmfd sp!, {r3-r10,fp,pc} @ restore 10 regs and return
- .fnend
- .size ExecuteMterpImpl, .-ExecuteMterpImpl
+ END ExecuteMterpImpl
diff --git a/runtime/interpreter/mterp/out/mterp_arm64.S b/runtime/interpreter/mterp/out/mterp_arm64.S
index 42f8c1b..34d99a8 100644
--- a/runtime/interpreter/mterp/out/mterp_arm64.S
+++ b/runtime/interpreter/mterp/out/mterp_arm64.S
@@ -300,6 +300,44 @@
ldr xIBASE, [xSELF, #THREAD_CURRENT_IBASE_OFFSET]
.endm
+/*
+ * Save two registers to the stack.
+ */
+.macro SAVE_TWO_REGS reg1, reg2, offset
+ stp \reg1, \reg2, [sp, #(\offset)]
+ .cfi_rel_offset \reg1, (\offset)
+ .cfi_rel_offset \reg2, (\offset) + 8
+.endm
+
+/*
+ * Restore two registers from the stack.
+ */
+.macro RESTORE_TWO_REGS reg1, reg2, offset
+ ldp \reg1, \reg2, [sp, #(\offset)]
+ .cfi_restore \reg1
+ .cfi_restore \reg2
+.endm
+
+/*
+ * Increase frame size and save two registers to the bottom of the stack.
+ */
+.macro SAVE_TWO_REGS_INCREASE_FRAME reg1, reg2, frame_adjustment
+ stp \reg1, \reg2, [sp, #-(\frame_adjustment)]!
+ .cfi_adjust_cfa_offset (\frame_adjustment)
+ .cfi_rel_offset \reg1, 0
+ .cfi_rel_offset \reg2, 8
+.endm
+
+/*
+ * Restore two registers from the bottom of the stack and decrease frame size.
+ */
+.macro RESTORE_TWO_REGS_DECREASE_FRAME reg1, reg2, frame_adjustment
+ ldp \reg1, \reg2, [sp], #(\frame_adjustment)
+ .cfi_restore \reg1
+ .cfi_restore \reg2
+ .cfi_adjust_cfa_offset -(\frame_adjustment)
+.endm
+
/* File: arm64/entry.S */
/*
* Copyright (C) 2016 The Android Open Source Project
@@ -334,11 +372,11 @@
ExecuteMterpImpl:
.cfi_startproc
- stp xPROFILE, x27, [sp, #-80]!
- stp xIBASE, xREFS, [sp, #16]
- stp xSELF, xINST, [sp, #32]
- stp xPC, xFP, [sp, #48]
- stp fp, lr, [sp, #64]
+ SAVE_TWO_REGS_INCREASE_FRAME xPROFILE, x27, 80
+ SAVE_TWO_REGS xIBASE, xREFS, 16
+ SAVE_TWO_REGS xSELF, xINST, 32
+ SAVE_TWO_REGS xPC, xFP, 48
+ SAVE_TWO_REGS fp, lr, 64
add fp, sp, #64
/* Remember the return register */
@@ -7226,12 +7264,15 @@
*/
cmp wPROFILE, #0
bgt MterpProfileActive // if > 0, we may have some counts to report.
- ldp fp, lr, [sp, #64]
- ldp xPC, xFP, [sp, #48]
- ldp xSELF, xINST, [sp, #32]
- ldp xIBASE, xREFS, [sp, #16]
- ldp xPROFILE, x27, [sp], #80
+ .cfi_remember_state
+ RESTORE_TWO_REGS fp, lr, 64
+ RESTORE_TWO_REGS xPC, xFP, 48
+ RESTORE_TWO_REGS xSELF, xINST, 32
+ RESTORE_TWO_REGS xIBASE, xREFS, 16
+ RESTORE_TWO_REGS_DECREASE_FRAME xPROFILE, x27, 80
ret
+ .cfi_restore_state // Reset unwind info so following code unwinds.
+ .cfi_def_cfa_offset 80 // workaround for clang bug: 31975598
MterpProfileActive:
mov xINST, x0 // stash return value
@@ -7242,11 +7283,11 @@
strh wPROFILE, [x1, #SHADOWFRAME_HOTNESS_COUNTDOWN_OFFSET]
bl MterpAddHotnessBatch // (method, shadow_frame, self)
mov x0, xINST // restore return value
- ldp fp, lr, [sp, #64]
- ldp xPC, xFP, [sp, #48]
- ldp xSELF, xINST, [sp, #32]
- ldp xIBASE, xREFS, [sp, #16]
- ldp xPROFILE, x27, [sp], #80
+ RESTORE_TWO_REGS fp, lr, 64
+ RESTORE_TWO_REGS xPC, xFP, 48
+ RESTORE_TWO_REGS xSELF, xINST, 32
+ RESTORE_TWO_REGS xIBASE, xREFS, 16
+ RESTORE_TWO_REGS_DECREASE_FRAME xPROFILE, x27, 80
ret
.cfi_endproc
diff --git a/runtime/interpreter/unstarted_runtime.cc b/runtime/interpreter/unstarted_runtime.cc
index a5b1038..7dd3d3d 100644
--- a/runtime/interpreter/unstarted_runtime.cc
+++ b/runtime/interpreter/unstarted_runtime.cc
@@ -25,6 +25,7 @@
#include <locale>
#include <unordered_map>
+#include "android-base/stringprintf.h"
#include "ScopedLocalRef.h"
#include "art_method-inl.h"
@@ -56,6 +57,9 @@
namespace art {
namespace interpreter {
+using android::base::StringAppendV;
+using android::base::StringPrintf;
+
static void AbortTransactionOrFail(Thread* self, const char* fmt, ...)
__attribute__((__format__(__printf__, 2, 3)))
REQUIRES_SHARED(Locks::mutator_lock_);
diff --git a/runtime/java_vm_ext.cc b/runtime/java_vm_ext.cc
index caf705a..f80c43d 100644
--- a/runtime/java_vm_ext.cc
+++ b/runtime/java_vm_ext.cc
@@ -18,6 +18,8 @@
#include <dlfcn.h>
+#include "android-base/stringprintf.h"
+
#include "art_method.h"
#include "base/dumpable.h"
#include "base/mutex.h"
@@ -42,6 +44,9 @@
namespace art {
+using android::base::StringAppendF;
+using android::base::StringAppendV;
+
static constexpr size_t kGlobalsMax = 51200; // Arbitrary sanity check. (Must fit in 16 bits.)
static constexpr size_t kWeakGlobalsMax = 51200; // Arbitrary sanity check. (Must fit in 16 bits.)
diff --git a/runtime/jdwp/jdwp_adb.cc b/runtime/jdwp/jdwp_adb.cc
index e9d6d07..0eff2ab 100644
--- a/runtime/jdwp/jdwp_adb.cc
+++ b/runtime/jdwp/jdwp_adb.cc
@@ -20,8 +20,9 @@
#include <sys/un.h>
#include <unistd.h>
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
-#include "base/stringprintf.h"
#include "jdwp/jdwp_priv.h"
#ifdef ART_TARGET_ANDROID
@@ -52,6 +53,8 @@
namespace JDWP {
+using android::base::StringPrintf;
+
struct JdwpAdbState : public JdwpNetStateBase {
public:
explicit JdwpAdbState(JdwpState* state) : JdwpNetStateBase(state) {
diff --git a/runtime/jdwp/jdwp_event.cc b/runtime/jdwp/jdwp_event.cc
index fad7d90..172f52a 100644
--- a/runtime/jdwp/jdwp_event.cc
+++ b/runtime/jdwp/jdwp_event.cc
@@ -21,10 +21,11 @@
#include <string.h>
#include <unistd.h>
+#include "android-base/stringprintf.h"
+
#include "art_field-inl.h"
#include "art_method-inl.h"
#include "base/logging.h"
-#include "base/stringprintf.h"
#include "debugger.h"
#include "jdwp/jdwp_constants.h"
#include "jdwp/jdwp_expand_buf.h"
@@ -103,6 +104,8 @@
namespace JDWP {
+using android::base::StringPrintf;
+
/*
* Stuff to compare against when deciding if a mod matches. Only the
* values for mods valid for the event being evaluated will be filled in.
@@ -621,8 +624,8 @@
Thread* const self = Thread::Current();
self->AssertThreadSuspensionIsAllowable();
CHECK(pReq != nullptr);
+ CHECK_EQ(threadId, Dbg::GetThreadSelfId()) << "Only the current thread can suspend itself";
/* send request and possibly suspend ourselves */
- JDWP::ObjectId thread_self_id = Dbg::GetThreadSelfId();
ScopedThreadSuspension sts(self, kWaitingForDebuggerSend);
if (suspend_policy != SP_NONE) {
AcquireJdwpTokenForEvent(threadId);
@@ -631,7 +634,7 @@
{
// Before suspending, we change our state to kSuspended so the debugger sees us as RUNNING.
ScopedThreadStateChange stsc(self, kSuspended);
- SuspendByPolicy(suspend_policy, thread_self_id);
+ SuspendByPolicy(suspend_policy, threadId);
}
}
@@ -658,13 +661,10 @@
}
void JdwpState::AcquireJdwpTokenForEvent(ObjectId threadId) {
- CHECK_NE(Thread::Current(), GetDebugThread()) << "Expected event thread";
- CHECK_NE(debug_thread_id_, threadId) << "Not expected debug thread";
SetWaitForJdwpToken(threadId);
}
void JdwpState::ReleaseJdwpTokenForEvent() {
- CHECK_NE(Thread::Current(), GetDebugThread()) << "Expected event thread";
ClearWaitForJdwpToken();
}
@@ -685,23 +685,28 @@
/* this is held for very brief periods; contention is unlikely */
MutexLock mu(self, jdwp_token_lock_);
- CHECK_NE(jdwp_token_owner_thread_id_, threadId) << "Thread is already holding event thread lock";
+ if (jdwp_token_owner_thread_id_ == threadId) {
+ // Only the debugger thread may already hold the event token. For instance, it may trigger
+ // a CLASS_PREPARE event while processing a command that initializes a class.
+ CHECK_EQ(threadId, debug_thread_id_) << "Non-debugger thread is already holding event token";
+ } else {
+ /*
+ * If another thread is already doing stuff, wait for it. This can
+ * go to sleep indefinitely.
+ */
- /*
- * If another thread is already doing stuff, wait for it. This can
- * go to sleep indefinitely.
- */
- while (jdwp_token_owner_thread_id_ != 0) {
- VLOG(jdwp) << StringPrintf("event in progress (%#" PRIx64 "), %#" PRIx64 " sleeping",
- jdwp_token_owner_thread_id_, threadId);
- waited = true;
- jdwp_token_cond_.Wait(self);
- }
+ while (jdwp_token_owner_thread_id_ != 0) {
+ VLOG(jdwp) << StringPrintf("event in progress (%#" PRIx64 "), %#" PRIx64 " sleeping",
+ jdwp_token_owner_thread_id_, threadId);
+ waited = true;
+ jdwp_token_cond_.Wait(self);
+ }
- if (waited || threadId != debug_thread_id_) {
- VLOG(jdwp) << StringPrintf("event token grabbed (%#" PRIx64 ")", threadId);
+ if (waited || threadId != debug_thread_id_) {
+ VLOG(jdwp) << StringPrintf("event token grabbed (%#" PRIx64 ")", threadId);
+ }
+ jdwp_token_owner_thread_id_ = threadId;
}
- jdwp_token_owner_thread_id_ = threadId;
}
/*
@@ -1224,14 +1229,15 @@
VLOG(jdwp) << " suspend_policy=" << suspend_policy;
}
- if (thread_id == debug_thread_id_) {
+ ObjectId reported_thread_id = thread_id;
+ if (reported_thread_id == debug_thread_id_) {
/*
* JDWP says that, for a class prep in the debugger thread, we
* should set thread to null and if any threads were supposed
* to be suspended then we suspend all other threads.
*/
VLOG(jdwp) << " NOTE: class prepare in debugger thread!";
- thread_id = 0;
+ reported_thread_id = 0;
if (suspend_policy == SP_EVENT_THREAD) {
suspend_policy = SP_ALL;
}
@@ -1244,7 +1250,7 @@
for (const JdwpEvent* pEvent : match_list) {
expandBufAdd1(pReq, pEvent->eventKind);
expandBufAdd4BE(pReq, pEvent->requestId);
- expandBufAddObjectId(pReq, thread_id);
+ expandBufAddObjectId(pReq, reported_thread_id);
expandBufAdd1(pReq, tag);
expandBufAddRefTypeId(pReq, class_id);
expandBufAddUtf8String(pReq, signature);
diff --git a/runtime/jdwp/jdwp_handler.cc b/runtime/jdwp/jdwp_handler.cc
index 0f2d188..964c567 100644
--- a/runtime/jdwp/jdwp_handler.cc
+++ b/runtime/jdwp/jdwp_handler.cc
@@ -20,11 +20,12 @@
#include <memory>
#include <string>
+#include "android-base/stringprintf.h"
+
#include "atomic.h"
#include "base/hex_dump.h"
#include "base/logging.h"
#include "base/macros.h"
-#include "base/stringprintf.h"
#include "debugger.h"
#include "jdwp/jdwp_constants.h"
#include "jdwp/jdwp_event.h"
@@ -39,6 +40,8 @@
namespace JDWP {
+using android::base::StringPrintf;
+
std::string DescribeField(const FieldId& field_id) {
return StringPrintf("%#" PRIx64 " (%s)", field_id, Dbg::GetFieldName(field_id).c_str());
}
diff --git a/runtime/jdwp/jdwp_main.cc b/runtime/jdwp/jdwp_main.cc
index e3bf3e5..7707ba4 100644
--- a/runtime/jdwp/jdwp_main.cc
+++ b/runtime/jdwp/jdwp_main.cc
@@ -20,6 +20,8 @@
#include <time.h>
#include <unistd.h>
+#include "android-base/stringprintf.h"
+
#include "atomic.h"
#include "base/logging.h"
#include "base/time_utils.h"
@@ -31,6 +33,8 @@
namespace JDWP {
+using android::base::StringPrintf;
+
static void* StartJdwpThread(void* arg);
/*
diff --git a/runtime/jdwp/jdwp_request.cc b/runtime/jdwp/jdwp_request.cc
index 18f40a1..6af267e 100644
--- a/runtime/jdwp/jdwp_request.cc
+++ b/runtime/jdwp/jdwp_request.cc
@@ -18,7 +18,8 @@
#include <inttypes.h>
-#include "base/stringprintf.h"
+#include "android-base/stringprintf.h"
+
#include "jdwp/jdwp_priv.h"
namespace art {
@@ -100,7 +101,7 @@
ObjectId Request::ReadObjectId(const char* specific_kind) {
ObjectId id = Read8BE();
- VLOG(jdwp) << StringPrintf(" %s id %#" PRIx64, specific_kind, id);
+ VLOG(jdwp) << android::base::StringPrintf(" %s id %#" PRIx64, specific_kind, id);
return id;
}
diff --git a/runtime/jdwp/jdwp_socket.cc b/runtime/jdwp/jdwp_socket.cc
index 3be7fd6..97662f0 100644
--- a/runtime/jdwp/jdwp_socket.cc
+++ b/runtime/jdwp/jdwp_socket.cc
@@ -26,8 +26,9 @@
#include <sys/types.h>
#include <unistd.h>
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
-#include "base/stringprintf.h"
#include "jdwp/jdwp_priv.h"
namespace art {
@@ -500,7 +501,7 @@
*/
if (IsAwaitingHandshake()) {
if (memcmp(input_buffer_, kMagicHandshake, kMagicHandshakeLen) != 0) {
- LOG(ERROR) << StringPrintf("ERROR: bad handshake '%.14s'", input_buffer_);
+ LOG(ERROR) << android::base::StringPrintf("ERROR: bad handshake '%.14s'", input_buffer_);
goto fail;
}
diff --git a/runtime/jit/jit.cc b/runtime/jit/jit.cc
index 803e9d5..dac2e60 100644
--- a/runtime/jit/jit.cc
+++ b/runtime/jit/jit.cc
@@ -274,6 +274,15 @@
<< ArtMethod::PrettyMethod(method_to_compile)
<< " osr=" << std::boolalpha << osr;
}
+ if (kIsDebugBuild) {
+ if (self->IsExceptionPending()) {
+ mirror::Throwable* exception = self->GetException();
+ LOG(FATAL) << "No pending exception expected after compiling "
+ << ArtMethod::PrettyMethod(method)
+ << ": "
+ << exception->Dump();
+ }
+ }
return success;
}
diff --git a/runtime/jit/jit_code_cache.cc b/runtime/jit/jit_code_cache.cc
index a26d850..f43e30d 100644
--- a/runtime/jit/jit_code_cache.cc
+++ b/runtime/jit/jit_code_cache.cc
@@ -23,6 +23,7 @@
#include "base/stl_util.h"
#include "base/systrace.h"
#include "base/time_utils.h"
+#include "cha.h"
#include "debugger_interface.h"
#include "entrypoints/runtime_asm_entrypoints.h"
#include "gc/accounting/bitmap-inl.h"
@@ -80,8 +81,18 @@
std::string error_str;
// Map name specific for android_os_Debug.cpp accounting.
+ // Map in low 4gb to simplify accessing root tables for x86_64.
+ // We could do PC-relative addressing to avoid this problem, but that
+ // would require reserving code and data area before submitting, which
+ // means more windows for the code memory to be RWX.
MemMap* data_map = MemMap::MapAnonymous(
- "data-code-cache", nullptr, max_capacity, kProtAll, false, false, &error_str, use_ashmem);
+ "data-code-cache", nullptr,
+ max_capacity,
+ kProtAll,
+ /* low_4gb */ true,
+ /* reuse */ false,
+ &error_str,
+ use_ashmem);
if (data_map == nullptr) {
std::ostringstream oss;
oss << "Failed to create read write execute cache: " << error_str << " size=" << max_capacity;
@@ -123,7 +134,7 @@
size_t max_capacity,
bool garbage_collect_code)
: lock_("Jit code cache", kJitCodeCacheLock),
- lock_cond_("Jit code cache variable", lock_),
+ lock_cond_("Jit code cache condition variable", lock_),
collection_in_progress_(false),
code_map_(code_map),
data_map_(data_map),
@@ -142,7 +153,9 @@
number_of_collections_(0),
histogram_stack_map_memory_use_("Memory used for stack maps", 16),
histogram_code_memory_use_("Memory used for compiled code", 16),
- histogram_profiling_info_memory_use_("Memory used for profiling info", 16) {
+ histogram_profiling_info_memory_use_("Memory used for profiling info", 16),
+ is_weak_access_enabled_(true),
+ inline_cache_cond_("Jit inline cache condition variable", lock_) {
DCHECK_GE(max_capacity, initial_code_capacity + initial_data_capacity);
code_mspace_ = create_mspace_with_base(code_map_->Begin(), code_end_, false /*locked*/);
@@ -197,34 +210,49 @@
uint8_t* JitCodeCache::CommitCode(Thread* self,
ArtMethod* method,
- const uint8_t* vmap_table,
+ uint8_t* stack_map,
+ uint8_t* roots_data,
size_t frame_size_in_bytes,
size_t core_spill_mask,
size_t fp_spill_mask,
const uint8_t* code,
size_t code_size,
- bool osr) {
+ size_t data_size,
+ bool osr,
+ Handle<mirror::ObjectArray<mirror::Object>> roots,
+ bool has_should_deoptimize_flag,
+ const ArenaSet<ArtMethod*>& cha_single_implementation_list) {
uint8_t* result = CommitCodeInternal(self,
method,
- vmap_table,
+ stack_map,
+ roots_data,
frame_size_in_bytes,
core_spill_mask,
fp_spill_mask,
code,
code_size,
- osr);
+ data_size,
+ osr,
+ roots,
+ has_should_deoptimize_flag,
+ cha_single_implementation_list);
if (result == nullptr) {
// Retry.
GarbageCollectCache(self);
result = CommitCodeInternal(self,
method,
- vmap_table,
+ stack_map,
+ roots_data,
frame_size_in_bytes,
core_spill_mask,
fp_spill_mask,
code,
code_size,
- osr);
+ data_size,
+ osr,
+ roots,
+ has_should_deoptimize_flag,
+ cha_single_implementation_list);
}
return result;
}
@@ -243,78 +271,258 @@
return reinterpret_cast<uintptr_t>(code) - RoundUp(sizeof(OatQuickMethodHeader), alignment);
}
-void JitCodeCache::FreeCode(const void* code_ptr, ArtMethod* method ATTRIBUTE_UNUSED) {
+static uint32_t ComputeRootTableSize(uint32_t number_of_roots) {
+ return sizeof(uint32_t) + number_of_roots * sizeof(GcRoot<mirror::Object>);
+}
+
+static uint32_t GetNumberOfRoots(const uint8_t* stack_map) {
+ // The length of the table is stored just before the stack map (and therefore at the end of
+ // the table itself), in order to be able to fetch it from a `stack_map` pointer.
+ return reinterpret_cast<const uint32_t*>(stack_map)[-1];
+}
+
+static void FillRootTableLength(uint8_t* roots_data, uint32_t length) {
+ // Store the length of the table at the end. This will allow fetching it from a `stack_map`
+ // pointer.
+ reinterpret_cast<uint32_t*>(roots_data)[length] = length;
+}
+
+static const uint8_t* FromStackMapToRoots(const uint8_t* stack_map_data) {
+ return stack_map_data - ComputeRootTableSize(GetNumberOfRoots(stack_map_data));
+}
+
+static void FillRootTable(uint8_t* roots_data, Handle<mirror::ObjectArray<mirror::Object>> roots)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ GcRoot<mirror::Object>* gc_roots = reinterpret_cast<GcRoot<mirror::Object>*>(roots_data);
+ const uint32_t length = roots->GetLength();
+ // Put all roots in `roots_data`.
+ for (uint32_t i = 0; i < length; ++i) {
+ ObjPtr<mirror::Object> object = roots->Get(i);
+ if (kIsDebugBuild) {
+ // Ensure the string is strongly interned. b/32995596
+ if (object->IsString()) {
+ ObjPtr<mirror::String> str = reinterpret_cast<mirror::String*>(object.Ptr());
+ ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+ CHECK(class_linker->GetInternTable()->LookupStrong(Thread::Current(), str) != nullptr);
+ }
+ }
+ gc_roots[i] = GcRoot<mirror::Object>(object);
+ }
+}
+
+static uint8_t* GetRootTable(const void* code_ptr, uint32_t* number_of_roots = nullptr) {
+ OatQuickMethodHeader* method_header = OatQuickMethodHeader::FromCodePointer(code_ptr);
+ uint8_t* data = method_header->GetOptimizedCodeInfoPtr();
+ uint32_t roots = GetNumberOfRoots(data);
+ if (number_of_roots != nullptr) {
+ *number_of_roots = roots;
+ }
+ return data - ComputeRootTableSize(roots);
+}
+
+// Helper for the GC to process a weak class in a JIT root table.
+static inline void ProcessWeakClass(GcRoot<mirror::Class>* root_ptr, IsMarkedVisitor* visitor)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ // This does not need a read barrier because this is called by GC.
+ mirror::Class* cls = root_ptr->Read<kWithoutReadBarrier>();
+ if (cls != nullptr) {
+ DCHECK((cls->IsClass<kDefaultVerifyFlags, kWithoutReadBarrier>()));
+ // Look at the classloader of the class to know if it has been unloaded.
+ // This does not need a read barrier because this is called by GC.
+ mirror::Object* class_loader =
+ cls->GetClassLoader<kDefaultVerifyFlags, kWithoutReadBarrier>();
+ if (class_loader == nullptr || visitor->IsMarked(class_loader) != nullptr) {
+ // The class loader is live, update the entry if the class has moved.
+ mirror::Class* new_cls = down_cast<mirror::Class*>(visitor->IsMarked(cls));
+ // Note that new_object can be null for CMS and newly allocated objects.
+ if (new_cls != nullptr && new_cls != cls) {
+ *root_ptr = GcRoot<mirror::Class>(new_cls);
+ }
+ } else {
+ // The class loader is not live, clear the entry.
+ *root_ptr = GcRoot<mirror::Class>(nullptr);
+ }
+ }
+}
+
+void JitCodeCache::SweepRootTables(IsMarkedVisitor* visitor) {
+ MutexLock mu(Thread::Current(), lock_);
+ for (const auto& entry : method_code_map_) {
+ uint32_t number_of_roots = 0;
+ uint8_t* roots_data = GetRootTable(entry.first, &number_of_roots);
+ GcRoot<mirror::Object>* roots = reinterpret_cast<GcRoot<mirror::Object>*>(roots_data);
+ for (uint32_t i = 0; i < number_of_roots; ++i) {
+ // This does not need a read barrier because this is called by GC.
+ mirror::Object* object = roots[i].Read<kWithoutReadBarrier>();
+ if (object == nullptr) {
+ // entry got deleted in a previous sweep.
+ } else if (object->IsString<kDefaultVerifyFlags, kWithoutReadBarrier>()) {
+ mirror::Object* new_object = visitor->IsMarked(object);
+ // We know the string is marked because it's a strongly-interned string that
+ // is always alive. The IsMarked implementation of the CMS collector returns
+ // null for newly allocated objects, but we know those haven't moved. Therefore,
+ // only update the entry if we get a different non-null string.
+ // TODO: Do not use IsMarked for j.l.Class, and adjust once we move this method
+ // out of the weak access/creation pause. b/32167580
+ if (new_object != nullptr && new_object != object) {
+ DCHECK(new_object->IsString());
+ roots[i] = GcRoot<mirror::Object>(new_object);
+ }
+ } else {
+ ProcessWeakClass(reinterpret_cast<GcRoot<mirror::Class>*>(&roots[i]), visitor);
+ }
+ }
+ }
+ // Walk over inline caches to clear entries containing unloaded classes.
+ for (ProfilingInfo* info : profiling_infos_) {
+ for (size_t i = 0; i < info->number_of_inline_caches_; ++i) {
+ InlineCache* cache = &info->cache_[i];
+ for (size_t j = 0; j < InlineCache::kIndividualCacheSize; ++j) {
+ ProcessWeakClass(&cache->classes_[j], visitor);
+ }
+ }
+ }
+}
+
+void JitCodeCache::FreeCode(const void* code_ptr) {
uintptr_t allocation = FromCodeToAllocation(code_ptr);
- const OatQuickMethodHeader* method_header = OatQuickMethodHeader::FromCodePointer(code_ptr);
// Notify native debugger that we are about to remove the code.
// It does nothing if we are not using native debugger.
DeleteJITCodeEntryForAddress(reinterpret_cast<uintptr_t>(code_ptr));
-
- // Use the offset directly to prevent sanity check that the method is
- // compiled with optimizing.
- // TODO(ngeoffray): Clean up.
- if (method_header->vmap_table_offset_ != 0) {
- const uint8_t* data = method_header->code_ - method_header->vmap_table_offset_;
- FreeData(const_cast<uint8_t*>(data));
- }
+ FreeData(GetRootTable(code_ptr));
FreeCode(reinterpret_cast<uint8_t*>(allocation));
}
+void JitCodeCache::FreeAllMethodHeaders(
+ const std::unordered_set<OatQuickMethodHeader*>& method_headers) {
+ {
+ MutexLock mu(Thread::Current(), *Locks::cha_lock_);
+ Runtime::Current()->GetClassHierarchyAnalysis()
+ ->RemoveDependentsWithMethodHeaders(method_headers);
+ }
+
+ // We need to remove entries in method_headers from CHA dependencies
+ // first since once we do FreeCode() below, the memory can be reused
+ // so it's possible for the same method_header to start representing
+ // different compile code.
+ MutexLock mu(Thread::Current(), lock_);
+ ScopedCodeCacheWrite scc(code_map_.get());
+ for (const OatQuickMethodHeader* method_header : method_headers) {
+ FreeCode(method_header->GetCode());
+ }
+}
+
void JitCodeCache::RemoveMethodsIn(Thread* self, const LinearAlloc& alloc) {
ScopedTrace trace(__PRETTY_FUNCTION__);
- MutexLock mu(self, lock_);
- // We do not check if a code cache GC is in progress, as this method comes
- // with the classlinker_classes_lock_ held, and suspending ourselves could
- // lead to a deadlock.
+ // We use a set to first collect all method_headers whose code need to be
+ // removed. We need to free the underlying code after we remove CHA dependencies
+ // for entries in this set. And it's more efficient to iterate through
+ // the CHA dependency map just once with an unordered_set.
+ std::unordered_set<OatQuickMethodHeader*> method_headers;
{
- ScopedCodeCacheWrite scc(code_map_.get());
- for (auto it = method_code_map_.begin(); it != method_code_map_.end();) {
- if (alloc.ContainsUnsafe(it->second)) {
- FreeCode(it->first, it->second);
- it = method_code_map_.erase(it);
+ MutexLock mu(self, lock_);
+ // We do not check if a code cache GC is in progress, as this method comes
+ // with the classlinker_classes_lock_ held, and suspending ourselves could
+ // lead to a deadlock.
+ {
+ ScopedCodeCacheWrite scc(code_map_.get());
+ for (auto it = method_code_map_.begin(); it != method_code_map_.end();) {
+ if (alloc.ContainsUnsafe(it->second)) {
+ method_headers.insert(OatQuickMethodHeader::FromCodePointer(it->first));
+ it = method_code_map_.erase(it);
+ } else {
+ ++it;
+ }
+ }
+ }
+ for (auto it = osr_code_map_.begin(); it != osr_code_map_.end();) {
+ if (alloc.ContainsUnsafe(it->first)) {
+ // Note that the code has already been pushed to method_headers in the loop
+ // above and is going to be removed in FreeCode() below.
+ it = osr_code_map_.erase(it);
+ } else {
+ ++it;
+ }
+ }
+ for (auto it = profiling_infos_.begin(); it != profiling_infos_.end();) {
+ ProfilingInfo* info = *it;
+ if (alloc.ContainsUnsafe(info->GetMethod())) {
+ info->GetMethod()->SetProfilingInfo(nullptr);
+ FreeData(reinterpret_cast<uint8_t*>(info));
+ it = profiling_infos_.erase(it);
} else {
++it;
}
}
}
- for (auto it = osr_code_map_.begin(); it != osr_code_map_.end();) {
- if (alloc.ContainsUnsafe(it->first)) {
- // Note that the code has already been removed in the loop above.
- it = osr_code_map_.erase(it);
- } else {
- ++it;
- }
+ FreeAllMethodHeaders(method_headers);
+}
+
+bool JitCodeCache::IsWeakAccessEnabled(Thread* self) const {
+ return kUseReadBarrier
+ ? self->GetWeakRefAccessEnabled()
+ : is_weak_access_enabled_.LoadSequentiallyConsistent();
+}
+
+void JitCodeCache::WaitUntilInlineCacheAccessible(Thread* self) {
+ if (IsWeakAccessEnabled(self)) {
+ return;
}
- for (auto it = profiling_infos_.begin(); it != profiling_infos_.end();) {
- ProfilingInfo* info = *it;
- if (alloc.ContainsUnsafe(info->GetMethod())) {
- info->GetMethod()->SetProfilingInfo(nullptr);
- FreeData(reinterpret_cast<uint8_t*>(info));
- it = profiling_infos_.erase(it);
- } else {
- ++it;
- }
+ ScopedThreadSuspension sts(self, kWaitingWeakGcRootRead);
+ MutexLock mu(self, lock_);
+ while (!IsWeakAccessEnabled(self)) {
+ inline_cache_cond_.Wait(self);
}
}
-void JitCodeCache::ClearGcRootsInInlineCaches(Thread* self) {
+void JitCodeCache::BroadcastForInlineCacheAccess() {
+ Thread* self = Thread::Current();
MutexLock mu(self, lock_);
- for (ProfilingInfo* info : profiling_infos_) {
- if (!info->IsInUseByCompiler()) {
- info->ClearGcRootsInInlineCaches();
+ inline_cache_cond_.Broadcast(self);
+}
+
+void JitCodeCache::AllowInlineCacheAccess() {
+ DCHECK(!kUseReadBarrier);
+ is_weak_access_enabled_.StoreSequentiallyConsistent(true);
+ BroadcastForInlineCacheAccess();
+}
+
+void JitCodeCache::DisallowInlineCacheAccess() {
+ DCHECK(!kUseReadBarrier);
+ is_weak_access_enabled_.StoreSequentiallyConsistent(false);
+}
+
+void JitCodeCache::CopyInlineCacheInto(const InlineCache& ic,
+ Handle<mirror::ObjectArray<mirror::Class>> array) {
+ WaitUntilInlineCacheAccessible(Thread::Current());
+ // Note that we don't need to lock `lock_` here, the compiler calling
+ // this method has already ensured the inline cache will not be deleted.
+ for (size_t in_cache = 0, in_array = 0;
+ in_cache < InlineCache::kIndividualCacheSize;
+ ++in_cache) {
+ mirror::Class* object = ic.classes_[in_cache].Read();
+ if (object != nullptr) {
+ array->Set(in_array++, object);
}
}
}
uint8_t* JitCodeCache::CommitCodeInternal(Thread* self,
ArtMethod* method,
- const uint8_t* vmap_table,
+ uint8_t* stack_map,
+ uint8_t* roots_data,
size_t frame_size_in_bytes,
size_t core_spill_mask,
size_t fp_spill_mask,
const uint8_t* code,
size_t code_size,
- bool osr) {
+ size_t data_size,
+ bool osr,
+ Handle<mirror::ObjectArray<mirror::Object>> roots,
+ bool has_should_deoptimize_flag,
+ const ArenaSet<ArtMethod*>&
+ cha_single_implementation_list) {
+ DCHECK(stack_map != nullptr);
size_t alignment = GetInstructionSetAlignment(kRuntimeISA);
// Ensure the header ends up at expected instruction alignment.
size_t header_size = RoundUp(sizeof(OatQuickMethodHeader), alignment);
@@ -338,21 +546,67 @@
std::copy(code, code + code_size, code_ptr);
method_header = OatQuickMethodHeader::FromCodePointer(code_ptr);
new (method_header) OatQuickMethodHeader(
- (vmap_table == nullptr) ? 0 : code_ptr - vmap_table,
+ code_ptr - stack_map,
frame_size_in_bytes,
core_spill_mask,
fp_spill_mask,
code_size);
+ DCHECK_EQ(FromStackMapToRoots(stack_map), roots_data);
+ DCHECK_LE(roots_data, stack_map);
+ // Flush data cache, as compiled code references literals in it.
+ FlushDataCache(reinterpret_cast<char*>(roots_data),
+ reinterpret_cast<char*>(roots_data + data_size));
+ // Flush caches before we remove write permission because on some ARMv8 hardware,
+ // flushing caches require write permissions.
+ //
+ // For reference, here are kernel patches discussing about this issue:
+ // https://android.googlesource.com/kernel/msm/%2B/0e7f7bcc3fc87489cda5aa6aff8ce40eed912279
+ // https://patchwork.kernel.org/patch/9047921/
+ FlushInstructionCache(reinterpret_cast<char*>(code_ptr),
+ reinterpret_cast<char*>(code_ptr + code_size));
+ DCHECK(!Runtime::Current()->IsAotCompiler());
+ if (has_should_deoptimize_flag) {
+ method_header->SetHasShouldDeoptimizeFlag();
+ }
}
- FlushInstructionCache(reinterpret_cast<char*>(code_ptr),
- reinterpret_cast<char*>(code_ptr + code_size));
number_of_compilations_++;
}
// We need to update the entry point in the runnable state for the instrumentation.
{
+ // Need cha_lock_ for checking all single-implementation flags and register
+ // dependencies.
+ MutexLock cha_mu(self, *Locks::cha_lock_);
+ bool single_impl_still_valid = true;
+ for (ArtMethod* single_impl : cha_single_implementation_list) {
+ if (!single_impl->HasSingleImplementation()) {
+ // We simply discard the compiled code. Clear the
+ // counter so that it may be recompiled later. Hopefully the
+ // class hierarchy will be more stable when compilation is retried.
+ single_impl_still_valid = false;
+ method->ClearCounter();
+ break;
+ }
+ }
+
+ // Discard the code if any single-implementation assumptions are now invalid.
+ if (!single_impl_still_valid) {
+ VLOG(jit) << "JIT discarded jitted code due to invalid single-implementation assumptions.";
+ return nullptr;
+ }
+ for (ArtMethod* single_impl : cha_single_implementation_list) {
+ Runtime::Current()->GetClassHierarchyAnalysis()->AddDependency(
+ single_impl, method, method_header);
+ }
+
+ // The following needs to be guarded by cha_lock_ also. Otherwise it's
+ // possible that the compiled code is considered invalidated by some class linking,
+ // but below we still make the compiled code valid for the method.
MutexLock mu(self, lock_);
method_code_map_.Put(code_ptr, method);
+ // Fill the root table before updating the entry point.
+ DCHECK_EQ(FromStackMapToRoots(stack_map), roots_data);
+ FillRootTable(roots_data, roots);
if (osr) {
number_of_osr_compilations_++;
osr_code_map_.Put(method, code_ptr);
@@ -372,7 +626,8 @@
<< " ccache_size=" << PrettySize(CodeCacheSizeLocked()) << ": "
<< " dcache_size=" << PrettySize(DataCacheSizeLocked()) << ": "
<< reinterpret_cast<const void*>(method_header->GetEntryPoint()) << ","
- << reinterpret_cast<const void*>(method_header->GetEntryPoint() + method_header->code_size_);
+ << reinterpret_cast<const void*>(method_header->GetEntryPoint() +
+ method_header->GetCodeSize());
histogram_code_memory_use_.AddValue(code_size);
if (code_size > kCodeSizeLogThreshold) {
LOG(INFO) << "JIT allocated "
@@ -403,13 +658,22 @@
return used_memory_for_data_;
}
-void JitCodeCache::ClearData(Thread* self, void* data) {
+void JitCodeCache::ClearData(Thread* self,
+ uint8_t* stack_map_data,
+ uint8_t* roots_data) {
+ DCHECK_EQ(FromStackMapToRoots(stack_map_data), roots_data);
MutexLock mu(self, lock_);
- FreeData(reinterpret_cast<uint8_t*>(data));
+ FreeData(reinterpret_cast<uint8_t*>(roots_data));
}
-uint8_t* JitCodeCache::ReserveData(Thread* self, size_t size, ArtMethod* method) {
- size = RoundUp(size, sizeof(void*));
+size_t JitCodeCache::ReserveData(Thread* self,
+ size_t stack_map_size,
+ size_t number_of_roots,
+ ArtMethod* method,
+ uint8_t** stack_map_data,
+ uint8_t** roots_data) {
+ size_t table_size = ComputeRootTableSize(number_of_roots);
+ size_t size = RoundUp(stack_map_size + table_size, sizeof(void*));
uint8_t* result = nullptr;
{
@@ -436,7 +700,16 @@
<< " for stack maps of "
<< ArtMethod::PrettyMethod(method);
}
- return result;
+ if (result != nullptr) {
+ *roots_data = result;
+ *stack_map_data = result + table_size;
+ FillRootTableLength(*roots_data, number_of_roots);
+ return size;
+ } else {
+ *roots_data = nullptr;
+ *stack_map_data = nullptr;
+ return 0;
+ }
}
class MarkCodeVisitor FINAL : public StackVisitor {
@@ -659,20 +932,23 @@
void JitCodeCache::RemoveUnmarkedCode(Thread* self) {
ScopedTrace trace(__FUNCTION__);
- MutexLock mu(self, lock_);
- ScopedCodeCacheWrite scc(code_map_.get());
- // Iterate over all compiled code and remove entries that are not marked.
- for (auto it = method_code_map_.begin(); it != method_code_map_.end();) {
- const void* code_ptr = it->first;
- ArtMethod* method = it->second;
- uintptr_t allocation = FromCodeToAllocation(code_ptr);
- if (GetLiveBitmap()->Test(allocation)) {
- ++it;
- } else {
- FreeCode(code_ptr, method);
- it = method_code_map_.erase(it);
+ std::unordered_set<OatQuickMethodHeader*> method_headers;
+ {
+ MutexLock mu(self, lock_);
+ ScopedCodeCacheWrite scc(code_map_.get());
+ // Iterate over all compiled code and remove entries that are not marked.
+ for (auto it = method_code_map_.begin(); it != method_code_map_.end();) {
+ const void* code_ptr = it->first;
+ uintptr_t allocation = FromCodeToAllocation(code_ptr);
+ if (GetLiveBitmap()->Test(allocation)) {
+ ++it;
+ } else {
+ method_headers.insert(OatQuickMethodHeader::FromCodePointer(it->first));
+ it = method_code_map_.erase(it);
+ }
}
}
+ FreeAllMethodHeaders(method_headers);
}
void JitCodeCache::DoCollection(Thread* self, bool collect_profiling_info) {
@@ -730,8 +1006,6 @@
if (collect_profiling_info) {
ScopedThreadSuspension sts(self, kSuspended);
- gc::ScopedGCCriticalSection gcs(
- self, gc::kGcCauseJitCodeCache, gc::kCollectorTypeJitCodeCache);
MutexLock mu(self, lock_);
// Free all profiling infos of methods not compiled nor being compiled.
auto profiling_kept_end = std::remove_if(profiling_infos_.begin(), profiling_infos_.end(),
@@ -745,10 +1019,6 @@
// code cache collection.
if (ContainsPc(ptr) &&
info->GetMethod()->GetProfilingInfo(kRuntimePointerSize) == nullptr) {
- // We clear the inline caches as classes in it might be stalled.
- info->ClearGcRootsInInlineCaches();
- // Do a fence to make sure the clearing is seen before attaching to the method.
- QuasiAtomic::ThreadFenceRelease();
info->GetMethod()->SetProfilingInfo(info);
} else if (info->GetMethod()->GetProfilingInfo(kRuntimePointerSize) != info) {
// No need for this ProfilingInfo object anymore.
diff --git a/runtime/jit/jit_code_cache.h b/runtime/jit/jit_code_cache.h
index e15c93a..d97742d 100644
--- a/runtime/jit/jit_code_cache.h
+++ b/runtime/jit/jit_code_cache.h
@@ -20,6 +20,7 @@
#include "instrumentation.h"
#include "atomic.h"
+#include "base/arena_containers.h"
#include "base/histogram-inl.h"
#include "base/macros.h"
#include "base/mutex.h"
@@ -36,6 +37,7 @@
class ArtMethod;
class LinearAlloc;
+class InlineCache;
class ProfilingInfo;
namespace jit {
@@ -90,15 +92,25 @@
REQUIRES(!lock_);
// Allocate and write code and its metadata to the code cache.
+ // `cha_single_implementation_list` needs to be registered via CHA (if it's
+ // still valid), since the compiled code still needs to be invalidated if the
+ // single-implementation assumptions are violated later. This needs to be done
+ // even if `has_should_deoptimize_flag` is false, which can happen due to CHA
+ // guard elimination.
uint8_t* CommitCode(Thread* self,
ArtMethod* method,
- const uint8_t* vmap_table,
+ uint8_t* stack_map,
+ uint8_t* roots_data,
size_t frame_size_in_bytes,
size_t core_spill_mask,
size_t fp_spill_mask,
const uint8_t* code,
size_t code_size,
- bool osr)
+ size_t data_size,
+ bool osr,
+ Handle<mirror::ObjectArray<mirror::Object>> roots,
+ bool has_should_deoptimize_flag,
+ const ArenaSet<ArtMethod*>& cha_single_implementation_list)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!lock_);
@@ -108,13 +120,20 @@
// Return true if the code cache contains this method.
bool ContainsMethod(ArtMethod* method) REQUIRES(!lock_);
- // Reserve a region of data of size at least "size". Returns null if there is no more room.
- uint8_t* ReserveData(Thread* self, size_t size, ArtMethod* method)
+ // Allocate a region of data that contain `size` bytes, and potentially space
+ // for storing `number_of_roots` roots. Returns null if there is no more room.
+ // Return the number of bytes allocated.
+ size_t ReserveData(Thread* self,
+ size_t size,
+ size_t number_of_roots,
+ ArtMethod* method,
+ uint8_t** stack_map_data,
+ uint8_t** roots_data)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!lock_);
// Clear data from the data portion of the code cache.
- void ClearData(Thread* self, void* data)
+ void ClearData(Thread* self, uint8_t* stack_map_data, uint8_t* roots_data)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!lock_);
@@ -148,7 +167,9 @@
REQUIRES(!lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
- void ClearGcRootsInInlineCaches(Thread* self) REQUIRES(!lock_);
+ void CopyInlineCacheInto(const InlineCache& ic, Handle<mirror::ObjectArray<mirror::Class>> array)
+ REQUIRES(!lock_)
+ REQUIRES_SHARED(Locks::mutator_lock_);
// Create a 'ProfileInfo' for 'method'. If 'retry_allocation' is true,
// will collect and retry if the first allocation is unsuccessful.
@@ -188,6 +209,16 @@
bool IsOsrCompiled(ArtMethod* method) REQUIRES(!lock_);
+ void SweepRootTables(IsMarkedVisitor* visitor)
+ REQUIRES(!lock_)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // The GC needs to disallow the reading of inline caches when it processes them,
+ // to avoid having a class being used while it is being deleted.
+ void AllowInlineCacheAccess() REQUIRES(!lock_);
+ void DisallowInlineCacheAccess() REQUIRES(!lock_);
+ void BroadcastForInlineCacheAccess() REQUIRES(!lock_);
+
private:
// Take ownership of maps.
JitCodeCache(MemMap* code_map,
@@ -201,13 +232,18 @@
// allocation fails. Return null if the allocation fails.
uint8_t* CommitCodeInternal(Thread* self,
ArtMethod* method,
- const uint8_t* vmap_table,
+ uint8_t* stack_map,
+ uint8_t* roots_data,
size_t frame_size_in_bytes,
size_t core_spill_mask,
size_t fp_spill_mask,
const uint8_t* code,
size_t code_size,
- bool osr)
+ size_t data_size,
+ bool osr,
+ Handle<mirror::ObjectArray<mirror::Object>> roots,
+ bool has_should_deoptimize_flag,
+ const ArenaSet<ArtMethod*>& cha_single_implementation_list)
REQUIRES(!lock_)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -222,8 +258,13 @@
bool WaitForPotentialCollectionToComplete(Thread* self)
REQUIRES(lock_) REQUIRES(!Locks::mutator_lock_);
- // Free in the mspace allocations taken by 'method'.
- void FreeCode(const void* code_ptr, ArtMethod* method) REQUIRES(lock_);
+ // Remove CHA dependents and underlying allocations for entries in `method_headers`.
+ void FreeAllMethodHeaders(const std::unordered_set<OatQuickMethodHeader*>& method_headers)
+ REQUIRES(!lock_)
+ REQUIRES(!Locks::cha_lock_);
+
+ // Free in the mspace allocations for `code_ptr`.
+ void FreeCode(const void* code_ptr) REQUIRES(lock_);
// Number of bytes allocated in the code cache.
size_t CodeCacheSizeLocked() REQUIRES(lock_);
@@ -261,6 +302,11 @@
void FreeData(uint8_t* data) REQUIRES(lock_);
uint8_t* AllocateData(size_t data_size) REQUIRES(lock_);
+ bool IsWeakAccessEnabled(Thread* self) const;
+ void WaitUntilInlineCacheAccessible(Thread* self)
+ REQUIRES(!lock_)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
// Lock for guarding allocations, collections, and the method_code_map_.
Mutex lock_;
// Condition to wait on during collection.
@@ -333,6 +379,14 @@
// Histograms for keeping track of profiling info statistics.
Histogram<uint64_t> histogram_profiling_info_memory_use_ GUARDED_BY(lock_);
+ // Whether the GC allows accessing weaks in inline caches. Note that this
+ // is not used by the concurrent collector, which uses
+ // Thread::SetWeakRefAccessEnabled instead.
+ Atomic<bool> is_weak_access_enabled_;
+
+ // Condition to wait on for accessing inline caches.
+ ConditionVariable inline_cache_cond_ GUARDED_BY(lock_);
+
DISALLOW_IMPLICIT_CONSTRUCTORS(JitCodeCache);
};
diff --git a/runtime/jit/offline_profiling_info.cc b/runtime/jit/offline_profiling_info.cc
index b9f5981..6f2a8c6 100644
--- a/runtime/jit/offline_profiling_info.cc
+++ b/runtime/jit/offline_profiling_info.cc
@@ -235,7 +235,7 @@
AddUintToBuffer(&buffer, method_it);
}
for (auto class_id : dex_data.class_set) {
- AddUintToBuffer(&buffer, class_id);
+ AddUintToBuffer(&buffer, class_id.index_);
}
DCHECK_EQ(required_capacity, buffer.size())
<< "Failed to add the expected number of bytes in the buffer";
@@ -282,7 +282,7 @@
bool ProfileCompilationInfo::AddClassIndex(const std::string& dex_location,
uint32_t checksum,
- uint16_t type_idx) {
+ dex::TypeIndex type_idx) {
DexFileData* const data = GetOrAddDexFileData(dex_location, checksum);
if (data == nullptr) {
return false;
@@ -305,7 +305,7 @@
for (uint16_t i = 0; i < class_set_size; i++) {
uint16_t type_idx = line_buffer.ReadUintAndAdvance<uint16_t>();
- if (!AddClassIndex(dex_location, checksum, type_idx)) {
+ if (!AddClassIndex(dex_location, checksum, dex::TypeIndex(type_idx))) {
return false;
}
}
@@ -569,13 +569,13 @@
return false;
}
-bool ProfileCompilationInfo::ContainsClass(const DexFile& dex_file, uint16_t type_idx) const {
+bool ProfileCompilationInfo::ContainsClass(const DexFile& dex_file, dex::TypeIndex type_idx) const {
auto info_it = info_.find(GetProfileDexFileKey(dex_file.GetLocation()));
if (info_it != info_.end()) {
if (!ChecksumMatch(dex_file, info_it->second.checksum)) {
return false;
}
- const std::set<uint16_t>& classes = info_it->second.class_set;
+ const std::set<dex::TypeIndex>& classes = info_it->second.class_set;
return classes.find(type_idx) != classes.end();
}
return false;
@@ -706,7 +706,7 @@
if (c < (number_of_classes / kFavorSplit)) {
type_idx %= kFavorFirstN;
}
- info.AddClassIndex(profile_key, 0, type_idx);
+ info.AddClassIndex(profile_key, 0, dex::TypeIndex(type_idx));
}
}
return info.Save(fd);
diff --git a/runtime/jit/offline_profiling_info.h b/runtime/jit/offline_profiling_info.h
index f8ed573..53d0eea 100644
--- a/runtime/jit/offline_profiling_info.h
+++ b/runtime/jit/offline_profiling_info.h
@@ -23,6 +23,7 @@
#include "atomic.h"
#include "dex_cache_resolved_classes.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "method_reference.h"
#include "safe_map.h"
@@ -66,7 +67,7 @@
bool ContainsMethod(const MethodReference& method_ref) const;
// Returns true if the class's type is present in the profiling info.
- bool ContainsClass(const DexFile& dex_file, uint16_t type_idx) const;
+ bool ContainsClass(const DexFile& dex_file, dex::TypeIndex type_idx) const;
// Dumps all the loaded profile info into a string and returns it.
// If dex_files is not null then the method indices will be resolved to their
@@ -104,7 +105,7 @@
explicit DexFileData(uint32_t location_checksum) : checksum(location_checksum) {}
uint32_t checksum;
std::set<uint16_t> method_set;
- std::set<uint16_t> class_set;
+ std::set<dex::TypeIndex> class_set;
bool operator==(const DexFileData& other) const {
return checksum == other.checksum && method_set == other.method_set;
@@ -115,7 +116,7 @@
DexFileData* GetOrAddDexFileData(const std::string& dex_location, uint32_t checksum);
bool AddMethodIndex(const std::string& dex_location, uint32_t checksum, uint16_t method_idx);
- bool AddClassIndex(const std::string& dex_location, uint32_t checksum, uint16_t type_idx);
+ bool AddClassIndex(const std::string& dex_location, uint32_t checksum, dex::TypeIndex type_idx);
bool AddResolvedClasses(const DexCacheResolvedClasses& classes);
// Parsing functionality.
@@ -179,6 +180,7 @@
friend class ProfileCompilationInfoTest;
friend class CompilerDriverProfileTest;
friend class ProfileAssistantTest;
+ friend class Dex2oatLayoutTest;
DexFileToProfileInfoMap info_;
};
diff --git a/runtime/jit/profile_saver.cc b/runtime/jit/profile_saver.cc
index 11d601e..025d10c 100644
--- a/runtime/jit/profile_saver.cc
+++ b/runtime/jit/profile_saver.cc
@@ -20,6 +20,8 @@
#include <sys/stat.h>
#include <fcntl.h>
+#include "android-base/strings.h"
+
#include "art_method-inl.h"
#include "base/enums.h"
#include "base/systrace.h"
@@ -412,7 +414,7 @@
}
VLOG(profiler) << "Starting profile saver using output file: " << output_filename
- << ". Tracking: " << Join(code_paths_to_profile, ':');
+ << ". Tracking: " << android::base::Join(code_paths_to_profile, ':');
instance_ = new ProfileSaver(options,
output_filename,
diff --git a/runtime/jit/profiling_info.cc b/runtime/jit/profiling_info.cc
index 9ec46f0..405280d 100644
--- a/runtime/jit/profiling_info.cc
+++ b/runtime/jit/profiling_info.cc
@@ -36,15 +36,6 @@
for (size_t i = 0; i < number_of_inline_caches_; ++i) {
cache_[i].dex_pc_ = entries[i];
}
- if (method->IsCopied()) {
- // GetHoldingClassOfCopiedMethod is expensive, but creating a profiling info for a copied method
- // appears to happen very rarely in practice.
- holding_class_ = GcRoot<mirror::Class>(
- Runtime::Current()->GetClassLinker()->GetHoldingClassOfCopiedMethod(method));
- } else {
- holding_class_ = GcRoot<mirror::Class>(method->GetDeclaringClass());
- }
- DCHECK(!holding_class_.IsNull());
}
bool ProfilingInfo::Create(Thread* self, ArtMethod* method, bool retry_allocation) {
@@ -116,14 +107,6 @@
--i;
} else {
// We successfully set `cls`, just return.
- // Since the instrumentation is marked from the declaring class we need to mark the card so
- // that mod-union tables and card rescanning know about the update.
- // Note that the declaring class is not necessarily the holding class if the method is
- // copied. We need the card mark to be in the holding class since that is from where we
- // will visit the profiling info.
- if (!holding_class_.IsNull()) {
- Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(holding_class_.Read());
- }
return;
}
}
diff --git a/runtime/jit/profiling_info.h b/runtime/jit/profiling_info.h
index 1056fac..9902bb5 100644
--- a/runtime/jit/profiling_info.h
+++ b/runtime/jit/profiling_info.h
@@ -39,46 +39,13 @@
// Once the classes_ array is full, we consider the INVOKE to be megamorphic.
class InlineCache {
public:
- bool IsMonomorphic() const {
- DCHECK_GE(kIndividualCacheSize, 2);
- return !classes_[0].IsNull() && classes_[1].IsNull();
- }
-
- bool IsMegamorphic() const {
- for (size_t i = 0; i < kIndividualCacheSize; ++i) {
- if (classes_[i].IsNull()) {
- return false;
- }
- }
- return true;
- }
-
- mirror::Class* GetMonomorphicType() const REQUIRES_SHARED(Locks::mutator_lock_) {
- // Note that we cannot ensure the inline cache is actually monomorphic
- // at this point, as other threads may have updated it.
- DCHECK(!classes_[0].IsNull());
- return classes_[0].Read();
- }
-
- bool IsUninitialized() const {
- return classes_[0].IsNull();
- }
-
- bool IsPolymorphic() const {
- DCHECK_GE(kIndividualCacheSize, 3);
- return !classes_[1].IsNull() && classes_[kIndividualCacheSize - 1].IsNull();
- }
-
- mirror::Class* GetTypeAt(size_t i) const REQUIRES_SHARED(Locks::mutator_lock_) {
- return classes_[i].Read();
- }
-
static constexpr uint16_t kIndividualCacheSize = 5;
private:
uint32_t dex_pc_;
GcRoot<mirror::Class> classes_[kIndividualCacheSize];
+ friend class jit::JitCodeCache;
friend class ProfilingInfo;
DISALLOW_COPY_AND_ASSIGN(InlineCache);
@@ -102,18 +69,6 @@
REQUIRES(Roles::uninterruptible_)
REQUIRES_SHARED(Locks::mutator_lock_);
- // NO_THREAD_SAFETY_ANALYSIS since we don't know what the callback requires.
- template<typename RootVisitorType>
- void VisitRoots(RootVisitorType& visitor) NO_THREAD_SAFETY_ANALYSIS {
- visitor.VisitRootIfNonNull(holding_class_.AddressWithoutBarrier());
- for (size_t i = 0; i < number_of_inline_caches_; ++i) {
- InlineCache* cache = &cache_[i];
- for (size_t j = 0; j < InlineCache::kIndividualCacheSize; ++j) {
- visitor.VisitRootIfNonNull(cache->classes_[j].AddressWithoutBarrier());
- }
- }
- }
-
ArtMethod* GetMethod() const {
return method_;
}
@@ -175,9 +130,6 @@
// Method this profiling info is for.
ArtMethod* const method_;
- // Holding class for the method in case method is a copied method.
- GcRoot<mirror::Class> holding_class_;
-
// Whether the ArtMethod is currently being compiled. This flag
// is implicitly guarded by the JIT code cache lock.
// TODO: Make the JIT code cache lock global.
diff --git a/runtime/jni_env_ext.cc b/runtime/jni_env_ext.cc
index 342e0d2..5a3fafa 100644
--- a/runtime/jni_env_ext.cc
+++ b/runtime/jni_env_ext.cc
@@ -19,6 +19,8 @@
#include <algorithm>
#include <vector>
+#include "android-base/stringprintf.h"
+
#include "check_jni.h"
#include "indirect_reference_table.h"
#include "java_vm_ext.h"
@@ -30,6 +32,8 @@
namespace art {
+using android::base::StringPrintf;
+
static constexpr size_t kMonitorsInitial = 32; // Arbitrary.
static constexpr size_t kMonitorsMax = 4096; // Arbitrary sanity check.
diff --git a/runtime/jni_internal.cc b/runtime/jni_internal.cc
index 01a2ad8..3c641b0 100644
--- a/runtime/jni_internal.cc
+++ b/runtime/jni_internal.cc
@@ -224,8 +224,8 @@
}
std::string temp;
if (is_static) {
- field = mirror::Class::FindStaticField(soa.Self(), c, name,
- field_type->GetDescriptor(&temp));
+ field = mirror::Class::FindStaticField(
+ soa.Self(), c.Get(), name, field_type->GetDescriptor(&temp));
} else {
field = c->FindInstanceField(name, field_type->GetDescriptor(&temp));
}
diff --git a/runtime/jni_internal_test.cc b/runtime/jni_internal_test.cc
index a421c34..4da5e23 100644
--- a/runtime/jni_internal_test.cc
+++ b/runtime/jni_internal_test.cc
@@ -16,6 +16,8 @@
#include "jni_internal.h"
+#include "android-base/stringprintf.h"
+
#include "art_method-inl.h"
#include "common_compiler_test.h"
#include "indirect_reference_table.h"
@@ -27,6 +29,8 @@
namespace art {
+using android::base::StringPrintf;
+
// TODO: Convert to CommonRuntimeTest. Currently MakeExecutable is used.
class JniInternalTest : public CommonCompilerTest {
protected:
diff --git a/runtime/jvalue.h b/runtime/jvalue.h
index 52a0f23..398bfbc 100644
--- a/runtime/jvalue.h
+++ b/runtime/jvalue.h
@@ -29,7 +29,7 @@
class Object;
} // namespace mirror
-union PACKED(4) JValue {
+union PACKED(alignof(mirror::Object*)) JValue {
// We default initialize JValue instances to all-zeros.
JValue() : j(0) {}
diff --git a/runtime/mem_map.cc b/runtime/mem_map.cc
index 1ec59b3..19a65bb 100644
--- a/runtime/mem_map.cc
+++ b/runtime/mem_map.cc
@@ -24,7 +24,8 @@
#include <memory>
#include <sstream>
-#include "base/stringprintf.h"
+#include "android-base/stringprintf.h"
+
#include "base/unix_file/fd_file.h"
#include "os.h"
#include "thread-inl.h"
@@ -42,6 +43,8 @@
namespace art {
+using android::base::StringPrintf;
+
static std::ostream& operator<<(
std::ostream& os,
std::pair<BacktraceMap::const_iterator, BacktraceMap::const_iterator> iters) {
@@ -282,6 +285,7 @@
#ifndef __LP64__
UNUSED(low_4gb);
#endif
+ use_ashmem = use_ashmem && !kIsTargetLinux;
if (byte_count == 0) {
return new MemMap(name, nullptr, 0, nullptr, 0, prot, false);
}
@@ -522,6 +526,7 @@
MemMap* MemMap::RemapAtEnd(uint8_t* new_end, const char* tail_name, int tail_prot,
std::string* error_msg, bool use_ashmem) {
+ use_ashmem = use_ashmem && !kIsTargetLinux;
DCHECK_GE(new_end, Begin());
DCHECK_LE(new_end, End());
DCHECK_LE(begin_ + size_, reinterpret_cast<uint8_t*>(base_begin_) + base_size_);
diff --git a/runtime/mem_map.h b/runtime/mem_map.h
index 049ae12..0fea1a5 100644
--- a/runtime/mem_map.h
+++ b/runtime/mem_map.h
@@ -68,7 +68,7 @@
bool low_4gb,
bool reuse,
std::string* error_msg,
- bool use_ashmem = !kIsTargetLinux);
+ bool use_ashmem = true);
// Create placeholder for a region allocated by direct call to mmap.
// This is useful when we do not have control over the code calling mmap,
@@ -172,7 +172,7 @@
const char* tail_name,
int tail_prot,
std::string* error_msg,
- bool use_ashmem = !kIsTargetLinux);
+ bool use_ashmem = true);
static bool CheckNoGaps(MemMap* begin_map, MemMap* end_map)
REQUIRES(!Locks::mem_maps_lock_);
diff --git a/runtime/method_handles.cc b/runtime/method_handles.cc
index 3c22d7f..da510ce 100644
--- a/runtime/method_handles.cc
+++ b/runtime/method_handles.cc
@@ -14,9 +14,10 @@
* limitations under the License.
*/
-#include "method_handles.h"
-
#include "method_handles-inl.h"
+
+#include "android-base/stringprintf.h"
+
#include "jvalue.h"
#include "jvalue-inl.h"
#include "reflection.h"
@@ -25,6 +26,8 @@
namespace art {
+using android::base::StringPrintf;
+
namespace {
#define PRIMITIVES_LIST(V) \
diff --git a/runtime/method_handles.h b/runtime/method_handles.h
index 54c772a..d0a4902 100644
--- a/runtime/method_handles.h
+++ b/runtime/method_handles.h
@@ -46,12 +46,13 @@
kInvokeStatic,
kInvokeInterface,
kInvokeTransform,
+ kInvokeCallSiteTransform,
kInstanceGet,
kInstancePut,
kStaticGet,
kStaticPut,
kLastValidKind = kStaticPut,
- kLastInvokeKind = kInvokeTransform
+ kLastInvokeKind = kInvokeCallSiteTransform
};
// Whether the given method handle kind is some variant of an invoke.
@@ -59,6 +60,11 @@
return handle_kind <= kLastInvokeKind;
}
+// Whether the given method handle kind is some variant of a tranform.
+inline bool IsInvokeTransform(const MethodHandleKind handle_kind) {
+ return handle_kind == kInvokeTransform || handle_kind == kInvokeCallSiteTransform;
+}
+
// Returns true if there is a possible conversion from |from| to |to|
// for a MethodHandle parameter.
bool IsParameterTypeConvertible(ObjPtr<mirror::Class> from,
diff --git a/runtime/mirror/array-inl.h b/runtime/mirror/array-inl.h
index b11dad8..a5db0c0 100644
--- a/runtime/mirror/array-inl.h
+++ b/runtime/mirror/array-inl.h
@@ -19,10 +19,11 @@
#include "array.h"
+#include "android-base/stringprintf.h"
+
#include "base/bit_utils.h"
#include "base/casts.h"
#include "base/logging.h"
-#include "base/stringprintf.h"
#include "class-inl.h"
#include "gc/heap-inl.h"
#include "obj_ptr-inl.h"
@@ -167,9 +168,9 @@
#else
// 32-bit.
if (UNLIKELY(size == 0)) {
- self->ThrowOutOfMemoryError(StringPrintf("%s of length %d would overflow",
- array_class->PrettyDescriptor().c_str(),
- component_count).c_str());
+ self->ThrowOutOfMemoryError(android::base::StringPrintf("%s of length %d would overflow",
+ array_class->PrettyDescriptor().c_str(),
+ component_count).c_str());
return nullptr;
}
#endif
@@ -424,6 +425,29 @@
}
}
+template<bool kUnchecked>
+void PointerArray::Memcpy(int32_t dst_pos,
+ ObjPtr<PointerArray> src,
+ int32_t src_pos,
+ int32_t count,
+ PointerSize ptr_size) {
+ DCHECK(!Runtime::Current()->IsActiveTransaction());
+ DCHECK(!src.IsNull());
+ if (ptr_size == PointerSize::k64) {
+ LongArray* l_this = (kUnchecked ? down_cast<LongArray*>(static_cast<Object*>(this))
+ : AsLongArray());
+ LongArray* l_src = (kUnchecked ? down_cast<LongArray*>(static_cast<Object*>(src.Ptr()))
+ : src->AsLongArray());
+ l_this->Memcpy(dst_pos, l_src, src_pos, count);
+ } else {
+ IntArray* i_this = (kUnchecked ? down_cast<IntArray*>(static_cast<Object*>(this))
+ : AsIntArray());
+ IntArray* i_src = (kUnchecked ? down_cast<IntArray*>(static_cast<Object*>(src.Ptr()))
+ : src->AsIntArray());
+ i_this->Memcpy(dst_pos, i_src, src_pos, count);
+ }
+}
+
template<typename T>
inline void PrimitiveArray<T>::SetArrayClass(ObjPtr<Class> array_class) {
CHECK(array_class_.IsNull());
diff --git a/runtime/mirror/array.cc b/runtime/mirror/array.cc
index 8afa4aa..cc548b9 100644
--- a/runtime/mirror/array.cc
+++ b/runtime/mirror/array.cc
@@ -14,7 +14,7 @@
* limitations under the License.
*/
-#include "array.h"
+#include "array-inl.h"
#include "class.h"
#include "class-inl.h"
@@ -23,7 +23,6 @@
#include "dex_file-inl.h"
#include "gc/accounting/card_table-inl.h"
#include "object-inl.h"
-#include "object_array.h"
#include "object_array-inl.h"
#include "handle_scope-inl.h"
#include "thread.h"
@@ -32,6 +31,8 @@
namespace art {
namespace mirror {
+using android::base::StringPrintf;
+
// Create a multi-dimensional array of Objects or primitive types.
//
// We have to generate the names for X[], X[][], X[][][], and so on. The
diff --git a/runtime/mirror/array.h b/runtime/mirror/array.h
index 994e9b2..19d300e 100644
--- a/runtime/mirror/array.h
+++ b/runtime/mirror/array.h
@@ -208,6 +208,17 @@
typename Visitor>
void Fixup(mirror::PointerArray* dest, PointerSize pointer_size, const Visitor& visitor)
REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // Works like memcpy(), except we guarantee not to allow tearing of array values (ie using smaller
+ // than element size copies). Arguments are assumed to be within the bounds of the array and the
+ // arrays non-null. Cannot be called in an active transaction.
+ template<bool kUnchecked = false>
+ void Memcpy(int32_t dst_pos,
+ ObjPtr<PointerArray> src,
+ int32_t src_pos,
+ int32_t count,
+ PointerSize pointer_size)
+ REQUIRES_SHARED(Locks::mutator_lock_);
};
} // namespace mirror
diff --git a/runtime/mirror/class-inl.h b/runtime/mirror/class-inl.h
index 9a6d60e..2fb8d28 100644
--- a/runtime/mirror/class-inl.h
+++ b/runtime/mirror/class-inl.h
@@ -65,8 +65,10 @@
OFFSET_OF_OBJECT_MEMBER(Class, super_class_));
}
+template<VerifyObjectFlags kVerifyFlags, ReadBarrierOption kReadBarrierOption>
inline ClassLoader* Class::GetClassLoader() {
- return GetFieldObject<ClassLoader>(OFFSET_OF_OBJECT_MEMBER(Class, class_loader_));
+ return GetFieldObject<ClassLoader, kVerifyFlags, kReadBarrierOption>(
+ OFFSET_OF_OBJECT_MEMBER(Class, class_loader_));
}
template<VerifyObjectFlags kVerifyFlags>
@@ -236,7 +238,7 @@
template<VerifyObjectFlags kVerifyFlags,
ReadBarrierOption kReadBarrierOption>
inline PointerArray* Class::GetVTable() {
- DCHECK(IsResolved<kVerifyFlags>() || IsErroneous<kVerifyFlags>());
+ DCHECK(IsLoaded<kVerifyFlags>() || IsErroneous<kVerifyFlags>());
return GetFieldObject<PointerArray, kVerifyFlags, kReadBarrierOption>(
OFFSET_OF_OBJECT_MEMBER(Class, vtable_));
}
@@ -372,7 +374,7 @@
// to access the field if the FieldId specifies an accessible subclass of the declaring
// class rather than the declaring class itself.
ObjPtr<DexCache> referrer_dex_cache = use_referrers_cache ? this->GetDexCache() : dex_cache;
- uint32_t class_idx = referrer_dex_cache->GetDexFile()->GetFieldId(field_idx).class_idx_;
+ dex::TypeIndex class_idx = referrer_dex_cache->GetDexFile()->GetFieldId(field_idx).class_idx_;
// The referenced class has already been resolved with the field, but may not be in the dex
// cache. Use LookupResolveType here to search the class table if it is not in the dex cache.
// should be no thread suspension due to the class being resolved.
@@ -410,7 +412,7 @@
// to access the method if the MethodId specifies an accessible subclass of the declaring
// class rather than the declaring class itself.
ObjPtr<DexCache> referrer_dex_cache = use_referrers_cache ? this->GetDexCache() : dex_cache;
- uint32_t class_idx = referrer_dex_cache->GetDexFile()->GetMethodId(method_idx).class_idx_;
+ dex::TypeIndex class_idx = referrer_dex_cache->GetDexFile()->GetMethodId(method_idx).class_idx_;
// The referenced class has already been resolved with the method, but may not be in the dex
// cache.
ObjPtr<Class> dex_access_to = Runtime::Current()->GetClassLinker()->LookupResolvedType(
@@ -894,7 +896,8 @@
klass->SetClassSize(class_size_);
klass->SetPrimitiveType(Primitive::kPrimNot); // Default to not being primitive.
klass->SetDexClassDefIndex(DexFile::kDexNoIndex16); // Default to no valid class def index.
- klass->SetDexTypeIndex(DexFile::kDexNoIndex16); // Default to no valid type index.
+ klass->SetDexTypeIndex(dex::TypeIndex(DexFile::kDexNoIndex16)); // Default to no valid type
+ // index.
// Default to force slow path until initialized.
klass->SetObjectSizeAllocFastPath(std::numeric_limits<uint32_t>::max());
}
@@ -934,14 +937,6 @@
}
}
-inline void Class::SetDexCacheStrings(StringDexCacheType* new_dex_cache_strings) {
- SetFieldPtr<false>(DexCacheStringsOffset(), new_dex_cache_strings);
-}
-
-inline StringDexCacheType* Class::GetDexCacheStrings() {
- return GetFieldPtr64<StringDexCacheType*>(DexCacheStringsOffset());
-}
-
template<ReadBarrierOption kReadBarrierOption, class Visitor>
void Class::VisitNativeRoots(Visitor& visitor, PointerSize pointer_size) {
for (ArtField& field : GetSFieldsUnchecked()) {
@@ -1092,12 +1087,6 @@
if (methods != new_methods) {
dest->SetMethodsPtrInternal(new_methods);
}
- // Update dex cache strings.
- StringDexCacheType* strings = GetDexCacheStrings();
- StringDexCacheType* new_strings = visitor(strings);
- if (strings != new_strings) {
- dest->SetDexCacheStrings(new_strings);
- }
// Fix up embedded tables.
if (!IsTemp() && ShouldHaveEmbeddedVTable<kVerifyNone, kReadBarrierOption>()) {
for (int32_t i = 0, count = GetEmbeddedVTableLength(); i < count; ++i) {
diff --git a/runtime/mirror/class.cc b/runtime/mirror/class.cc
index db46027..9964b73 100644
--- a/runtime/mirror/class.cc
+++ b/runtime/mirror/class.cc
@@ -16,6 +16,8 @@
#include "class.h"
+#include "android-base/stringprintf.h"
+
#include "art_field-inl.h"
#include "art_method-inl.h"
#include "class_ext.h"
@@ -40,6 +42,8 @@
namespace art {
namespace mirror {
+using android::base::StringPrintf;
+
GcRoot<Class> Class::java_lang_Class_;
void Class::SetClassClass(ObjPtr<Class> java_lang_Class) {
@@ -187,7 +191,6 @@
void Class::SetDexCache(ObjPtr<DexCache> new_dex_cache) {
SetFieldObject<false>(OFFSET_OF_OBJECT_MEMBER(Class, dex_cache_), new_dex_cache);
- SetDexCacheStrings(new_dex_cache != nullptr ? new_dex_cache->GetStrings() : nullptr);
}
void Class::SetClassSize(uint32_t new_class_size) {
@@ -276,7 +279,7 @@
if (num_direct_interfaces > 0) {
os << " interfaces (" << num_direct_interfaces << "):\n";
for (size_t i = 0; i < num_direct_interfaces; ++i) {
- ObjPtr<Class> interface = GetDirectInterface(self, h_this, i);
+ ObjPtr<Class> interface = GetDirectInterface(self, h_this.Get(), i);
if (interface == nullptr) {
os << StringPrintf(" %2zd: nullptr!\n", i);
} else {
@@ -799,24 +802,21 @@
}
ArtField* Class::FindStaticField(Thread* self,
- Handle<Class> klass,
+ ObjPtr<Class> klass,
const StringPiece& name,
const StringPiece& type) {
// Is the field in this class (or its interfaces), or any of its
// superclasses (or their interfaces)?
- for (ObjPtr<Class> k = klass.Get(); k != nullptr; k = k->GetSuperClass()) {
+ for (ObjPtr<Class> k = klass; k != nullptr; k = k->GetSuperClass()) {
// Is the field in this class?
ArtField* f = k->FindDeclaredStaticField(name, type);
if (f != nullptr) {
return f;
}
- // Wrap k incase it moves during GetDirectInterface.
- StackHandleScope<1> hs(self);
- HandleWrapperObjPtr<Class> h_k(hs.NewHandleWrapper(&k));
// Is this field in any of this class' interfaces?
- for (uint32_t i = 0; i < h_k->NumDirectInterfaces(); ++i) {
- StackHandleScope<1> hs2(self);
- Handle<Class> interface(hs2.NewHandle(GetDirectInterface(self, h_k, i)));
+ for (uint32_t i = 0, num_interfaces = k->NumDirectInterfaces(); i != num_interfaces; ++i) {
+ ObjPtr<Class> interface = GetDirectInterface(self, k, i);
+ DCHECK(interface != nullptr);
f = FindStaticField(self, interface, name, type);
if (f != nullptr) {
return f;
@@ -839,11 +839,10 @@
// Though GetDirectInterface() should not cause thread suspension when called
// from here, it takes a Handle as an argument, so we need to wrap `k`.
ScopedAssertNoThreadSuspension ants(__FUNCTION__);
- StackHandleScope<1> hs(self);
- Handle<Class> h_k(hs.NewHandle(k));
// Is this field in any of this class' interfaces?
- for (uint32_t i = 0; i < h_k->NumDirectInterfaces(); ++i) {
- ObjPtr<Class> interface = GetDirectInterface(self, h_k, i);
+ for (uint32_t i = 0, num_interfaces = k->NumDirectInterfaces(); i != num_interfaces; ++i) {
+ ObjPtr<Class> interface = GetDirectInterface(self, k, i);
+ DCHECK(interface != nullptr);
f = FindStaticField(self, interface, dex_cache, dex_field_idx);
if (f != nullptr) {
return f;
@@ -854,11 +853,11 @@
}
ArtField* Class::FindField(Thread* self,
- Handle<Class> klass,
+ ObjPtr<Class> klass,
const StringPiece& name,
const StringPiece& type) {
// Find a field using the JLS field resolution order
- for (ObjPtr<Class> k = klass.Get(); k != nullptr; k = k->GetSuperClass()) {
+ for (ObjPtr<Class> k = klass; k != nullptr; k = k->GetSuperClass()) {
// Is the field in this class?
ArtField* f = k->FindDeclaredInstanceField(name, type);
if (f != nullptr) {
@@ -869,12 +868,10 @@
return f;
}
// Is this field in any of this class' interfaces?
- StackHandleScope<1> hs(self);
- HandleWrapperObjPtr<Class> h_k(hs.NewHandleWrapper(&k));
- for (uint32_t i = 0; i < h_k->NumDirectInterfaces(); ++i) {
- StackHandleScope<1> hs2(self);
- Handle<Class> interface(hs2.NewHandle(GetDirectInterface(self, h_k, i)));
- f = interface->FindStaticField(self, interface, name, type);
+ for (uint32_t i = 0, num_interfaces = k->NumDirectInterfaces(); i != num_interfaces; ++i) {
+ ObjPtr<Class> interface = GetDirectInterface(self, k, i);
+ DCHECK(interface != nullptr);
+ f = FindStaticField(self, interface, name, type);
if (f != nullptr) {
return f;
}
@@ -923,41 +920,52 @@
return &GetDexFile().GetClassDef(class_def_idx);
}
-uint16_t Class::GetDirectInterfaceTypeIdx(uint32_t idx) {
+dex::TypeIndex Class::GetDirectInterfaceTypeIdx(uint32_t idx) {
DCHECK(!IsPrimitive());
DCHECK(!IsArrayClass());
return GetInterfaceTypeList()->GetTypeItem(idx).type_idx_;
}
-ObjPtr<Class> Class::GetDirectInterface(Thread* self,
- Handle<Class> klass,
- uint32_t idx) {
- DCHECK(klass.Get() != nullptr);
+ObjPtr<Class> Class::GetDirectInterface(Thread* self, ObjPtr<Class> klass, uint32_t idx) {
+ DCHECK(klass != nullptr);
DCHECK(!klass->IsPrimitive());
if (klass->IsArrayClass()) {
ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+ // Use ClassLinker::LookupClass(); avoid poisoning ObjPtr<>s by ClassLinker::FindSystemClass().
+ ObjPtr<Class> interface;
if (idx == 0) {
- return class_linker->FindSystemClass(self, "Ljava/lang/Cloneable;");
+ interface = class_linker->LookupClass(self, "Ljava/lang/Cloneable;", nullptr);
} else {
DCHECK_EQ(1U, idx);
- return class_linker->FindSystemClass(self, "Ljava/io/Serializable;");
+ interface = class_linker->LookupClass(self, "Ljava/io/Serializable;", nullptr);
}
+ DCHECK(interface != nullptr);
+ return interface;
} else if (klass->IsProxyClass()) {
- ObjPtr<ObjectArray<Class>> interfaces = klass.Get()->GetInterfaces();
+ ObjPtr<ObjectArray<Class>> interfaces = klass->GetInterfaces();
DCHECK(interfaces != nullptr);
return interfaces->Get(idx);
} else {
- uint16_t type_idx = klass->GetDirectInterfaceTypeIdx(idx);
+ dex::TypeIndex type_idx = klass->GetDirectInterfaceTypeIdx(idx);
ObjPtr<Class> interface = klass->GetDexCache()->GetResolvedType(type_idx);
- if (interface == nullptr) {
- interface = Runtime::Current()->GetClassLinker()->ResolveType(klass->GetDexFile(), type_idx,
- klass.Get());
- CHECK(interface != nullptr || self->IsExceptionPending());
- }
return interface;
}
}
+ObjPtr<Class> Class::ResolveDirectInterface(Thread* self, Handle<Class> klass, uint32_t idx) {
+ ObjPtr<Class> interface = GetDirectInterface(self, klass.Get(), idx);
+ if (interface == nullptr) {
+ DCHECK(!klass->IsArrayClass());
+ DCHECK(!klass->IsProxyClass());
+ dex::TypeIndex type_idx = klass->GetDirectInterfaceTypeIdx(idx);
+ interface = Runtime::Current()->GetClassLinker()->ResolveType(klass->GetDexFile(),
+ type_idx,
+ klass.Get());
+ CHECK(interface != nullptr || self->IsExceptionPending());
+ }
+ return interface;
+}
+
ObjPtr<Class> Class::GetCommonSuperClass(Handle<Class> klass) {
DCHECK(klass.Get() != nullptr);
DCHECK(!klass->IsInterface());
@@ -1130,10 +1138,12 @@
return depth;
}
-uint32_t Class::FindTypeIndexInOtherDexFile(const DexFile& dex_file) {
+dex::TypeIndex Class::FindTypeIndexInOtherDexFile(const DexFile& dex_file) {
std::string temp;
const DexFile::TypeId* type_id = dex_file.FindTypeId(GetDescriptor(&temp));
- return (type_id == nullptr) ? DexFile::kDexNoIndex : dex_file.GetIndexForTypeId(*type_id);
+ return (type_id == nullptr)
+ ? dex::TypeIndex(DexFile::kDexNoIndex)
+ : dex_file.GetIndexForTypeId(*type_id);
}
template <PointerSize kPointerSize, bool kTransactionActive>
diff --git a/runtime/mirror/class.h b/runtime/mirror/class.h
index 711914d..fb2792a 100644
--- a/runtime/mirror/class.h
+++ b/runtime/mirror/class.h
@@ -20,6 +20,7 @@
#include "base/enums.h"
#include "base/iteration_range.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "class_flags.h"
#include "gc_root.h"
#include "gc/allocator_type.h"
@@ -673,6 +674,8 @@
return MemberOffset(OFFSETOF_MEMBER(Class, super_class_));
}
+ template<VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags,
+ ReadBarrierOption kReadBarrierOption = kWithReadBarrier>
ClassLoader* GetClassLoader() ALWAYS_INLINE REQUIRES_SHARED(Locks::mutator_lock_);
void SetClassLoader(ObjPtr<ClassLoader> new_cl) REQUIRES_SHARED(Locks::mutator_lock_);
@@ -1084,7 +1087,9 @@
ArtField* GetStaticField(uint32_t i) REQUIRES_SHARED(Locks::mutator_lock_);
// Find a static or instance field using the JLS resolution order
- static ArtField* FindField(Thread* self, Handle<Class> klass, const StringPiece& name,
+ static ArtField* FindField(Thread* self,
+ ObjPtr<Class> klass,
+ const StringPiece& name,
const StringPiece& type)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -1105,7 +1110,7 @@
// Finds the given static field in this class or a superclass.
static ArtField* FindStaticField(Thread* self,
- Handle<Class> klass,
+ ObjPtr<Class> klass,
const StringPiece& name,
const StringPiece& type)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -1148,16 +1153,17 @@
SetField32<false>(OFFSET_OF_OBJECT_MEMBER(Class, dex_class_def_idx_), class_def_idx);
}
- uint16_t GetDexTypeIndex() REQUIRES_SHARED(Locks::mutator_lock_) {
- return GetField32(OFFSET_OF_OBJECT_MEMBER(Class, dex_type_idx_));
+ dex::TypeIndex GetDexTypeIndex() REQUIRES_SHARED(Locks::mutator_lock_) {
+ return dex::TypeIndex(
+ static_cast<uint16_t>(GetField32(OFFSET_OF_OBJECT_MEMBER(Class, dex_type_idx_))));
}
- void SetDexTypeIndex(uint16_t type_idx) REQUIRES_SHARED(Locks::mutator_lock_) {
+ void SetDexTypeIndex(dex::TypeIndex type_idx) REQUIRES_SHARED(Locks::mutator_lock_) {
// Not called within a transaction.
- SetField32<false>(OFFSET_OF_OBJECT_MEMBER(Class, dex_type_idx_), type_idx);
+ SetField32<false>(OFFSET_OF_OBJECT_MEMBER(Class, dex_type_idx_), type_idx.index_);
}
- uint32_t FindTypeIndexInOtherDexFile(const DexFile& dex_file)
+ dex::TypeIndex FindTypeIndexInOtherDexFile(const DexFile& dex_file)
REQUIRES_SHARED(Locks::mutator_lock_);
static Class* GetJavaLangClass() REQUIRES_SHARED(Locks::mutator_lock_) {
@@ -1198,11 +1204,17 @@
ALWAYS_INLINE uint32_t NumDirectInterfaces() REQUIRES_SHARED(Locks::mutator_lock_);
- uint16_t GetDirectInterfaceTypeIdx(uint32_t idx) REQUIRES_SHARED(Locks::mutator_lock_);
+ dex::TypeIndex GetDirectInterfaceTypeIdx(uint32_t idx) REQUIRES_SHARED(Locks::mutator_lock_);
- static ObjPtr<Class> GetDirectInterface(Thread* self,
- Handle<Class> klass,
- uint32_t idx)
+ // Get the direct interface of the `klass` at index `idx` if resolved, otherwise return null.
+ // If the caller expects the interface to be resolved, for example for a resolved `klass`,
+ // that assumption should be checked by `DCHECK(result != nullptr)`.
+ static ObjPtr<Class> GetDirectInterface(Thread* self, ObjPtr<Class> klass, uint32_t idx)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // Resolve and get the direct interface of the `klass` at index `idx`.
+ // Returns null with a pending exception if the resolution fails.
+ static ObjPtr<Class> ResolveDirectInterface(Thread* self, Handle<Class> klass, uint32_t idx)
REQUIRES_SHARED(Locks::mutator_lock_);
const char* GetSourceFile() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -1235,13 +1247,6 @@
bool GetSlowPathEnabled() REQUIRES_SHARED(Locks::mutator_lock_);
void SetSlowPath(bool enabled) REQUIRES_SHARED(Locks::mutator_lock_);
- StringDexCacheType* GetDexCacheStrings() REQUIRES_SHARED(Locks::mutator_lock_);
- void SetDexCacheStrings(StringDexCacheType* new_dex_cache_strings)
- REQUIRES_SHARED(Locks::mutator_lock_);
- static MemberOffset DexCacheStringsOffset() {
- return OFFSET_OF_OBJECT_MEMBER(Class, dex_cache_strings_);
- }
-
// May cause thread suspension due to EqualParameters.
ArtMethod* GetDeclaredConstructor(Thread* self,
Handle<ObjectArray<Class>> args,
@@ -1426,9 +1431,6 @@
// virtual_ methods_ for miranda methods.
HeapReference<PointerArray> vtable_;
- // Short cuts to dex_cache_ member for fast compiled code access.
- uint64_t dex_cache_strings_;
-
// instance fields
//
// These describe the layout of the contents of an Object.
diff --git a/runtime/mirror/class_ext.cc b/runtime/mirror/class_ext.cc
index cc208e4..7c6a710 100644
--- a/runtime/mirror/class_ext.cc
+++ b/runtime/mirror/class_ext.cc
@@ -34,6 +34,72 @@
GcRoot<Class> ClassExt::dalvik_system_ClassExt_;
+void ClassExt::SetObsoleteArrays(ObjPtr<PointerArray> methods,
+ ObjPtr<ObjectArray<DexCache>> dex_caches) {
+ DCHECK_EQ(GetLockOwnerThreadId(), Thread::Current()->GetThreadId())
+ << "Obsolete arrays are set without synchronization!";
+ CHECK_EQ(methods.IsNull(), dex_caches.IsNull());
+ auto obsolete_dex_cache_off = OFFSET_OF_OBJECT_MEMBER(ClassExt, obsolete_dex_caches_);
+ auto obsolete_methods_off = OFFSET_OF_OBJECT_MEMBER(ClassExt, obsolete_methods_);
+ DCHECK(!Runtime::Current()->IsActiveTransaction());
+ SetFieldObject<false>(obsolete_dex_cache_off, dex_caches.Ptr());
+ SetFieldObject<false>(obsolete_methods_off, methods.Ptr());
+}
+
+// We really need to be careful how we update this. If we ever in the future make it so that
+// these arrays are written into without all threads being suspended we have a race condition! This
+// race could cause obsolete methods to be missed.
+bool ClassExt::ExtendObsoleteArrays(Thread* self, uint32_t increase) {
+ DCHECK_EQ(GetLockOwnerThreadId(), Thread::Current()->GetThreadId())
+ << "Obsolete arrays are set without synchronization!";
+ StackHandleScope<5> hs(self);
+ Handle<ClassExt> h_this(hs.NewHandle(this));
+ Handle<PointerArray> old_methods(hs.NewHandle(h_this->GetObsoleteMethods()));
+ Handle<ObjectArray<DexCache>> old_dex_caches(hs.NewHandle(h_this->GetObsoleteDexCaches()));
+ ClassLinker* cl = Runtime::Current()->GetClassLinker();
+ size_t new_len;
+ if (old_methods.Get() == nullptr) {
+ CHECK(old_dex_caches.Get() == nullptr);
+ new_len = increase;
+ } else {
+ CHECK_EQ(old_methods->GetLength(), old_dex_caches->GetLength());
+ new_len = increase + old_methods->GetLength();
+ }
+ Handle<PointerArray> new_methods(hs.NewHandle<PointerArray>(
+ cl->AllocPointerArray(self, new_len)));
+ if (new_methods.IsNull()) {
+ // Fail.
+ self->AssertPendingOOMException();
+ return false;
+ }
+ Handle<ObjectArray<DexCache>> new_dex_caches(hs.NewHandle<ObjectArray<DexCache>>(
+ ObjectArray<DexCache>::Alloc(self,
+ cl->FindClass(self,
+ "[Ljava/lang/DexCache;",
+ ScopedNullHandle<ClassLoader>()),
+ new_len)));
+ if (new_dex_caches.IsNull()) {
+ // Fail.
+ self->AssertPendingOOMException();
+ return false;
+ }
+
+ if (!old_methods.IsNull()) {
+ // Copy the old contents.
+ new_methods->Memcpy(0,
+ old_methods.Get(),
+ 0,
+ old_methods->GetLength(),
+ cl->GetImagePointerSize());
+ new_dex_caches->AsObjectArray<Object>()->AssignableCheckingMemcpy<false>(
+ 0, old_dex_caches->AsObjectArray<Object>(), 0, old_dex_caches->GetLength(), false);
+ }
+ // Set the fields.
+ h_this->SetObsoleteArrays(new_methods.Get(), new_dex_caches.Get());
+
+ return true;
+}
+
ClassExt* ClassExt::Alloc(Thread* self) {
DCHECK(dalvik_system_ClassExt_.Read() != nullptr);
return down_cast<ClassExt*>(dalvik_system_ClassExt_.Read()->AllocObject(self).Ptr());
diff --git a/runtime/mirror/class_ext.h b/runtime/mirror/class_ext.h
index 35eaae1..9104631 100644
--- a/runtime/mirror/class_ext.h
+++ b/runtime/mirror/class_ext.h
@@ -19,8 +19,11 @@
#include "class-inl.h"
+#include "array.h"
+#include "dex_cache.h"
#include "gc_root.h"
#include "object.h"
+#include "object_array.h"
#include "object_callbacks.h"
#include "string.h"
@@ -49,6 +52,22 @@
return GetFieldObject<ClassExt>(OFFSET_OF_OBJECT_MEMBER(ClassExt, verify_error_));
}
+ ObjectArray<DexCache>* GetObsoleteDexCaches() REQUIRES_SHARED(Locks::mutator_lock_) {
+ return GetFieldObject<ObjectArray<DexCache>>(
+ OFFSET_OF_OBJECT_MEMBER(ClassExt, obsolete_dex_caches_));
+ }
+
+ PointerArray* GetObsoleteMethods() REQUIRES_SHARED(Locks::mutator_lock_) {
+ return GetFieldObject<PointerArray>(OFFSET_OF_OBJECT_MEMBER(ClassExt, obsolete_methods_));
+ }
+
+ void SetObsoleteArrays(ObjPtr<PointerArray> methods, ObjPtr<ObjectArray<DexCache>> dex_caches)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // Extend the obsolete arrays by the given amount.
+ bool ExtendObsoleteArrays(Thread* self, uint32_t increase)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
static void SetClass(ObjPtr<Class> dalvik_system_ClassExt);
static void ResetClass();
static void VisitRoots(RootVisitor* visitor) REQUIRES_SHARED(Locks::mutator_lock_);
@@ -57,6 +76,13 @@
private:
// Field order required by test "ValidateFieldOrderOfJavaCppUnionClasses".
+ HeapReference<ObjectArray<DexCache>> obsolete_dex_caches_;
+
+ HeapReference<PointerArray> obsolete_methods_;
+
+ HeapReference<DexCache> original_dex_cache_;
+
+ // The saved verification error of this class.
HeapReference<Object> verify_error_;
static GcRoot<Class> dalvik_system_ClassExt_;
diff --git a/runtime/mirror/dex_cache-inl.h b/runtime/mirror/dex_cache-inl.h
index c7a123b..a59bb7b 100644
--- a/runtime/mirror/dex_cache-inl.h
+++ b/runtime/mirror/dex_cache-inl.h
@@ -40,13 +40,14 @@
return Class::ComputeClassSize(true, vtable_entries, 0, 0, 0, 0, 0, pointer_size);
}
-inline mirror::String* DexCache::GetResolvedString(uint32_t string_idx) {
- DCHECK_LT(string_idx, GetDexFile()->NumStringIds());
- return StringDexCachePair::Lookup(GetStrings(), string_idx, NumStrings()).Read();
+inline mirror::String* DexCache::GetResolvedString(dex::StringIndex string_idx) {
+ DCHECK_LT(string_idx.index_, GetDexFile()->NumStringIds());
+ return StringDexCachePair::Lookup(GetStrings(), string_idx.index_, NumStrings()).Read();
}
-inline void DexCache::SetResolvedString(uint32_t string_idx, ObjPtr<mirror::String> resolved) {
- StringDexCachePair::Assign(GetStrings(), string_idx, resolved.Ptr(), NumStrings());
+inline void DexCache::SetResolvedString(dex::StringIndex string_idx,
+ ObjPtr<mirror::String> resolved) {
+ StringDexCachePair::Assign(GetStrings(), string_idx.index_, resolved.Ptr(), NumStrings());
Runtime* const runtime = Runtime::Current();
if (UNLIKELY(runtime->IsActiveTransaction())) {
DCHECK(runtime->IsAotCompiler());
@@ -56,12 +57,12 @@
runtime->GetHeap()->WriteBarrierEveryFieldOf(this);
}
-inline void DexCache::ClearString(uint32_t string_idx) {
- const uint32_t slot_idx = string_idx % NumStrings();
+inline void DexCache::ClearString(dex::StringIndex string_idx) {
+ const uint32_t slot_idx = string_idx.index_ % NumStrings();
DCHECK(Runtime::Current()->IsAotCompiler());
StringDexCacheType* slot = &GetStrings()[slot_idx];
// This is racy but should only be called from the transactional interpreter.
- if (slot->load(std::memory_order_relaxed).index == string_idx) {
+ if (slot->load(std::memory_order_relaxed).index == string_idx.index_) {
StringDexCachePair cleared(
nullptr,
StringDexCachePair::InvalidIndexForSlot(slot_idx));
@@ -69,15 +70,21 @@
}
}
-inline Class* DexCache::GetResolvedType(uint32_t type_idx) {
- DCHECK_LT(type_idx, NumResolvedTypes());
- return GetResolvedTypes()[type_idx].Read();
+inline Class* DexCache::GetResolvedType(dex::TypeIndex type_idx) {
+ // It is theorized that a load acquire is not required since obtaining the resolved class will
+ // always have an address dependency or a lock.
+ DCHECK_LT(type_idx.index_, NumResolvedTypes());
+ return GetResolvedTypes()[type_idx.index_].Read();
}
-inline void DexCache::SetResolvedType(uint32_t type_idx, ObjPtr<Class> resolved) {
- DCHECK_LT(type_idx, NumResolvedTypes()); // NOTE: Unchecked, i.e. not throwing AIOOB.
+inline void DexCache::SetResolvedType(dex::TypeIndex type_idx, ObjPtr<Class> resolved) {
+ DCHECK_LT(type_idx.index_, NumResolvedTypes()); // NOTE: Unchecked, i.e. not throwing AIOOB.
// TODO default transaction support.
- GetResolvedTypes()[type_idx] = GcRoot<Class>(resolved);
+ // Use a release store for SetResolvedType. This is done to prevent other threads from seeing a
+ // class but not necessarily seeing the loaded members like the static fields array.
+ // See b/32075261.
+ reinterpret_cast<Atomic<GcRoot<mirror::Class>>&>(GetResolvedTypes()[type_idx.index_]).
+ StoreRelease(GcRoot<Class>(resolved));
// TODO: Fine-grained marking, so that we don't need to go through all arrays in full.
Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(this);
}
diff --git a/runtime/mirror/dex_cache.cc b/runtime/mirror/dex_cache.cc
index a32d51f..741cf3b 100644
--- a/runtime/mirror/dex_cache.cc
+++ b/runtime/mirror/dex_cache.cc
@@ -22,15 +22,123 @@
#include "gc/accounting/card_table-inl.h"
#include "gc/heap.h"
#include "globals.h"
+#include "linear_alloc.h"
#include "object.h"
#include "object-inl.h"
#include "object_array-inl.h"
#include "runtime.h"
#include "string.h"
+#include "thread.h"
+#include "utils/dex_cache_arrays_layout-inl.h"
namespace art {
namespace mirror {
+void DexCache::InitializeDexCache(Thread* self,
+ ObjPtr<mirror::DexCache> dex_cache,
+ ObjPtr<mirror::String> location,
+ const DexFile* dex_file,
+ LinearAlloc* linear_alloc,
+ PointerSize image_pointer_size) {
+ DCHECK(dex_file != nullptr);
+ ScopedAssertNoThreadSuspension sants(__FUNCTION__);
+ DexCacheArraysLayout layout(image_pointer_size, dex_file);
+ uint8_t* raw_arrays = nullptr;
+
+ const OatDexFile* const oat_dex = dex_file->GetOatDexFile();
+ if (oat_dex != nullptr && oat_dex->GetDexCacheArrays() != nullptr) {
+ raw_arrays = oat_dex->GetDexCacheArrays();
+ } else if (dex_file->NumStringIds() != 0u ||
+ dex_file->NumTypeIds() != 0u ||
+ dex_file->NumMethodIds() != 0u ||
+ dex_file->NumFieldIds() != 0u) {
+ // Zero-initialized.
+ raw_arrays = reinterpret_cast<uint8_t*>(linear_alloc->Alloc(self, layout.Size()));
+ }
+
+ mirror::StringDexCacheType* strings = (dex_file->NumStringIds() == 0u) ? nullptr :
+ reinterpret_cast<mirror::StringDexCacheType*>(raw_arrays + layout.StringsOffset());
+ GcRoot<mirror::Class>* types = (dex_file->NumTypeIds() == 0u) ? nullptr :
+ reinterpret_cast<GcRoot<mirror::Class>*>(raw_arrays + layout.TypesOffset());
+ ArtMethod** methods = (dex_file->NumMethodIds() == 0u) ? nullptr :
+ reinterpret_cast<ArtMethod**>(raw_arrays + layout.MethodsOffset());
+ ArtField** fields = (dex_file->NumFieldIds() == 0u) ? nullptr :
+ reinterpret_cast<ArtField**>(raw_arrays + layout.FieldsOffset());
+
+ size_t num_strings = mirror::DexCache::kDexCacheStringCacheSize;
+ if (dex_file->NumStringIds() < num_strings) {
+ num_strings = dex_file->NumStringIds();
+ }
+
+ // Note that we allocate the method type dex caches regardless of this flag,
+ // and we make sure here that they're not used by the runtime. This is in the
+ // interest of simplicity and to avoid extensive compiler and layout class changes.
+ //
+ // If this needs to be mitigated in a production system running this code,
+ // DexCache::kDexCacheMethodTypeCacheSize can be set to zero.
+ mirror::MethodTypeDexCacheType* method_types = nullptr;
+ size_t num_method_types = 0;
+
+ if (dex_file->NumProtoIds() < mirror::DexCache::kDexCacheMethodTypeCacheSize) {
+ num_method_types = dex_file->NumProtoIds();
+ } else {
+ num_method_types = mirror::DexCache::kDexCacheMethodTypeCacheSize;
+ }
+
+ if (num_method_types > 0) {
+ method_types = reinterpret_cast<mirror::MethodTypeDexCacheType*>(
+ raw_arrays + layout.MethodTypesOffset());
+ }
+
+ DCHECK_ALIGNED(raw_arrays, alignof(mirror::StringDexCacheType)) <<
+ "Expected raw_arrays to align to StringDexCacheType.";
+ DCHECK_ALIGNED(layout.StringsOffset(), alignof(mirror::StringDexCacheType)) <<
+ "Expected StringsOffset() to align to StringDexCacheType.";
+ DCHECK_ALIGNED(strings, alignof(mirror::StringDexCacheType)) <<
+ "Expected strings to align to StringDexCacheType.";
+ static_assert(alignof(mirror::StringDexCacheType) == 8u,
+ "Expected StringDexCacheType to have align of 8.");
+ if (kIsDebugBuild) {
+ // Sanity check to make sure all the dex cache arrays are empty. b/28992179
+ for (size_t i = 0; i < num_strings; ++i) {
+ CHECK_EQ(strings[i].load(std::memory_order_relaxed).index, 0u);
+ CHECK(strings[i].load(std::memory_order_relaxed).object.IsNull());
+ }
+ for (size_t i = 0; i < dex_file->NumTypeIds(); ++i) {
+ CHECK(types[i].IsNull());
+ }
+ for (size_t i = 0; i < dex_file->NumMethodIds(); ++i) {
+ CHECK(mirror::DexCache::GetElementPtrSize(methods, i, image_pointer_size) == nullptr);
+ }
+ for (size_t i = 0; i < dex_file->NumFieldIds(); ++i) {
+ CHECK(mirror::DexCache::GetElementPtrSize(fields, i, image_pointer_size) == nullptr);
+ }
+ for (size_t i = 0; i < num_method_types; ++i) {
+ CHECK_EQ(method_types[i].load(std::memory_order_relaxed).index, 0u);
+ CHECK(method_types[i].load(std::memory_order_relaxed).object.IsNull());
+ }
+ }
+ if (strings != nullptr) {
+ mirror::StringDexCachePair::Initialize(strings);
+ }
+ if (method_types != nullptr) {
+ mirror::MethodTypeDexCachePair::Initialize(method_types);
+ }
+ dex_cache->Init(dex_file,
+ location,
+ strings,
+ num_strings,
+ types,
+ dex_file->NumTypeIds(),
+ methods,
+ dex_file->NumMethodIds(),
+ fields,
+ dex_file->NumFieldIds(),
+ method_types,
+ num_method_types,
+ image_pointer_size);
+}
+
void DexCache::Init(const DexFile* dex_file,
ObjPtr<String> location,
StringDexCacheType* strings,
diff --git a/runtime/mirror/dex_cache.h b/runtime/mirror/dex_cache.h
index 1ae694d..ec265e5 100644
--- a/runtime/mirror/dex_cache.h
+++ b/runtime/mirror/dex_cache.h
@@ -21,6 +21,7 @@
#include "art_field.h"
#include "art_method.h"
#include "class.h"
+#include "dex_file_types.h"
#include "object.h"
#include "object_array.h"
@@ -30,6 +31,8 @@
class DexFile;
class ImageWriter;
union JValue;
+class LinearAlloc;
+class Thread;
namespace mirror {
@@ -136,19 +139,14 @@
return sizeof(DexCache);
}
- void Init(const DexFile* dex_file,
- ObjPtr<String> location,
- StringDexCacheType* strings,
- uint32_t num_strings,
- GcRoot<Class>* resolved_types,
- uint32_t num_resolved_types,
- ArtMethod** resolved_methods,
- uint32_t num_resolved_methods,
- ArtField** resolved_fields,
- uint32_t num_resolved_fields,
- MethodTypeDexCacheType* resolved_methodtypes,
- uint32_t num_resolved_methodtypes,
- PointerSize pointer_size) REQUIRES_SHARED(Locks::mutator_lock_);
+ static void InitializeDexCache(Thread* self,
+ ObjPtr<mirror::DexCache> dex_cache,
+ ObjPtr<mirror::String> location,
+ const DexFile* dex_file,
+ LinearAlloc* linear_alloc,
+ PointerSize image_pointer_size)
+ REQUIRES_SHARED(Locks::mutator_lock_)
+ REQUIRES(Locks::dex_lock_);
void Fixup(ArtMethod* trampoline, PointerSize pointer_size)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -213,19 +211,19 @@
return OFFSET_OF_OBJECT_MEMBER(DexCache, num_resolved_method_types_);
}
- mirror::String* GetResolvedString(uint32_t string_idx) ALWAYS_INLINE
+ mirror::String* GetResolvedString(dex::StringIndex string_idx) ALWAYS_INLINE
REQUIRES_SHARED(Locks::mutator_lock_);
- void SetResolvedString(uint32_t string_idx, ObjPtr<mirror::String> resolved) ALWAYS_INLINE
+ void SetResolvedString(dex::StringIndex string_idx, ObjPtr<mirror::String> resolved) ALWAYS_INLINE
REQUIRES_SHARED(Locks::mutator_lock_);
// Clear a string for a string_idx, used to undo string intern transactions to make sure
// the string isn't kept live.
- void ClearString(uint32_t string_idx) REQUIRES_SHARED(Locks::mutator_lock_);
+ void ClearString(dex::StringIndex string_idx) REQUIRES_SHARED(Locks::mutator_lock_);
- Class* GetResolvedType(uint32_t type_idx) REQUIRES_SHARED(Locks::mutator_lock_);
+ Class* GetResolvedType(dex::TypeIndex type_idx) REQUIRES_SHARED(Locks::mutator_lock_);
- void SetResolvedType(uint32_t type_idx, ObjPtr<Class> resolved)
+ void SetResolvedType(dex::TypeIndex type_idx, ObjPtr<Class> resolved)
REQUIRES_SHARED(Locks::mutator_lock_);
ALWAYS_INLINE ArtMethod* GetResolvedMethod(uint32_t method_idx, PointerSize ptr_size)
@@ -338,6 +336,21 @@
static void SetElementPtrSize(PtrType* ptr_array, size_t idx, PtrType ptr, PointerSize ptr_size);
private:
+ void Init(const DexFile* dex_file,
+ ObjPtr<String> location,
+ StringDexCacheType* strings,
+ uint32_t num_strings,
+ GcRoot<Class>* resolved_types,
+ uint32_t num_resolved_types,
+ ArtMethod** resolved_methods,
+ uint32_t num_resolved_methods,
+ ArtField** resolved_fields,
+ uint32_t num_resolved_fields,
+ MethodTypeDexCacheType* resolved_methodtypes,
+ uint32_t num_resolved_methodtypes,
+ PointerSize pointer_size)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
// Visit instance fields of the dex cache as well as its associated arrays.
template <bool kVisitNativeRoots,
VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags,
diff --git a/runtime/mirror/emulated_stack_frame.h b/runtime/mirror/emulated_stack_frame.h
index 9fa06b7..d83a536 100644
--- a/runtime/mirror/emulated_stack_frame.h
+++ b/runtime/mirror/emulated_stack_frame.h
@@ -58,6 +58,10 @@
// Sets the return value slot of this emulated stack frame to |value|.
void SetReturnValue(Thread* self, const JValue& value) REQUIRES_SHARED(Locks::mutator_lock_);
+ mirror::MethodType* GetType() REQUIRES_SHARED(Locks::mutator_lock_) {
+ return GetFieldObject<MethodType>(OFFSET_OF_OBJECT_MEMBER(EmulatedStackFrame, type_));
+ }
+
static void SetClass(Class* klass) REQUIRES_SHARED(Locks::mutator_lock_);
static void ResetClass() REQUIRES_SHARED(Locks::mutator_lock_);
static void VisitRoots(RootVisitor* visitor) REQUIRES_SHARED(Locks::mutator_lock_);
@@ -67,10 +71,6 @@
return static_class_.Read();
}
- mirror::MethodType* GetType() REQUIRES_SHARED(Locks::mutator_lock_) {
- return GetFieldObject<MethodType>(OFFSET_OF_OBJECT_MEMBER(EmulatedStackFrame, type_));
- }
-
mirror::ObjectArray<mirror::Object>* GetReferences() REQUIRES_SHARED(Locks::mutator_lock_) {
return GetFieldObject<mirror::ObjectArray<mirror::Object>>(
OFFSET_OF_OBJECT_MEMBER(EmulatedStackFrame, references_));
diff --git a/runtime/mirror/method_handle_impl.cc b/runtime/mirror/method_handle_impl.cc
index fdfaaa8..4f1c448 100644
--- a/runtime/mirror/method_handle_impl.cc
+++ b/runtime/mirror/method_handle_impl.cc
@@ -22,6 +22,12 @@
namespace art {
namespace mirror {
+mirror::Class* MethodHandle::StaticClass() {
+ mirror::Class* klass = MethodHandleImpl::StaticClass()->GetSuperClass();
+ DCHECK(klass->DescriptorEquals("Ljava/lang/invoke/MethodHandle;"));
+ return klass;
+}
+
GcRoot<mirror::Class> MethodHandleImpl::static_class_;
void MethodHandleImpl::SetClass(Class* klass) {
diff --git a/runtime/mirror/method_handle_impl.h b/runtime/mirror/method_handle_impl.h
index 9054216..5ea82b5 100644
--- a/runtime/mirror/method_handle_impl.h
+++ b/runtime/mirror/method_handle_impl.h
@@ -57,6 +57,8 @@
return static_cast<MethodHandleKind>(handle_kind);
}
+ static mirror::Class* StaticClass() REQUIRES_SHARED(Locks::mutator_lock_);
+
private:
HeapReference<mirror::MethodType> nominal_type_;
HeapReference<mirror::MethodType> method_type_;
diff --git a/runtime/mirror/object_array-inl.h b/runtime/mirror/object_array-inl.h
index 0fdf132..3e04bf6 100644
--- a/runtime/mirror/object_array-inl.h
+++ b/runtime/mirror/object_array-inl.h
@@ -17,12 +17,13 @@
#ifndef ART_RUNTIME_MIRROR_OBJECT_ARRAY_INL_H_
#define ART_RUNTIME_MIRROR_OBJECT_ARRAY_INL_H_
-#include <string>
-
#include "object_array.h"
+#include <string>
+
+#include "android-base/stringprintf.h"
+
#include "array-inl.h"
-#include "base/stringprintf.h"
#include "gc/heap.h"
#include "mirror/class.h"
#include "obj_ptr-inl.h"
@@ -330,13 +331,15 @@
std::string actualSrcType(mirror::Object::PrettyTypeOf(o));
std::string dstType(PrettyTypeOf());
Thread* self = Thread::Current();
+ std::string msg = android::base::StringPrintf(
+ "source[%d] of type %s cannot be stored in destination array of type %s",
+ src_pos + i,
+ actualSrcType.c_str(),
+ dstType.c_str());
if (throw_exception) {
- self->ThrowNewExceptionF("Ljava/lang/ArrayStoreException;",
- "source[%d] of type %s cannot be stored in destination array of type %s",
- src_pos + i, actualSrcType.c_str(), dstType.c_str());
+ self->ThrowNewException("Ljava/lang/ArrayStoreException;", msg.c_str());
} else {
- LOG(FATAL) << StringPrintf("source[%d] of type %s cannot be stored in destination array of type %s",
- src_pos + i, actualSrcType.c_str(), dstType.c_str());
+ LOG(FATAL) << msg;
}
}
}
diff --git a/runtime/mirror/object_test.cc b/runtime/mirror/object_test.cc
index 5bf254d..a6f56ae 100644
--- a/runtime/mirror/object_test.cc
+++ b/runtime/mirror/object_test.cc
@@ -140,9 +140,9 @@
Handle<mirror::Class> klass(hs.NewHandle(oa->GetClass()));
ASSERT_EQ(2U, klass->NumDirectInterfaces());
EXPECT_OBJ_PTR_EQ(class_linker_->FindSystemClass(soa.Self(), "Ljava/lang/Cloneable;"),
- mirror::Class::GetDirectInterface(soa.Self(), klass, 0));
+ mirror::Class::GetDirectInterface(soa.Self(), klass.Get(), 0));
EXPECT_OBJ_PTR_EQ(class_linker_->FindSystemClass(soa.Self(), "Ljava/io/Serializable;"),
- mirror::Class::GetDirectInterface(soa.Self(), klass, 1));
+ mirror::Class::GetDirectInterface(soa.Self(), klass.Get(), 1));
}
TEST_F(ObjectTest, AllocArray) {
@@ -313,7 +313,7 @@
ArtMethod* sort = java_util_Arrays->FindDirectMethod("sort", "([I)V", kRuntimePointerSize);
const DexFile::TypeId* type_id = java_lang_dex_file_->FindTypeId("[I");
ASSERT_TRUE(type_id != nullptr);
- uint32_t type_idx = java_lang_dex_file_->GetIndexForTypeId(*type_id);
+ dex::TypeIndex type_idx = java_lang_dex_file_->GetIndexForTypeId(*type_id);
Object* array = CheckAndAllocArrayFromCodeInstrumented(
type_idx, 3, sort, Thread::Current(), false,
Runtime::Current()->GetHeap()->GetCurrentAllocator());
@@ -708,19 +708,19 @@
// Wrong type.
EXPECT_TRUE(c->FindDeclaredStaticField("CASE_INSENSITIVE_ORDER", "I") == nullptr);
EXPECT_TRUE(mirror::Class::FindStaticField(
- soa.Self(), c, "CASE_INSENSITIVE_ORDER", "I") == nullptr);
+ soa.Self(), c.Get(), "CASE_INSENSITIVE_ORDER", "I") == nullptr);
// Wrong name.
EXPECT_TRUE(c->FindDeclaredStaticField(
"cASE_INSENSITIVE_ORDER", "Ljava/util/Comparator;") == nullptr);
EXPECT_TRUE(
- mirror::Class::FindStaticField(soa.Self(), c, "cASE_INSENSITIVE_ORDER",
- "Ljava/util/Comparator;") == nullptr);
+ mirror::Class::FindStaticField(
+ soa.Self(), c.Get(), "cASE_INSENSITIVE_ORDER", "Ljava/util/Comparator;") == nullptr);
// Right name and type.
ArtField* f1 = c->FindDeclaredStaticField("CASE_INSENSITIVE_ORDER", "Ljava/util/Comparator;");
- ArtField* f2 = mirror::Class::FindStaticField(soa.Self(), c, "CASE_INSENSITIVE_ORDER",
- "Ljava/util/Comparator;");
+ ArtField* f2 = mirror::Class::FindStaticField(
+ soa.Self(), c.Get(), "CASE_INSENSITIVE_ORDER", "Ljava/util/Comparator;");
EXPECT_TRUE(f1 != nullptr);
EXPECT_TRUE(f2 != nullptr);
EXPECT_EQ(f1, f2);
diff --git a/runtime/mirror/string-inl.h b/runtime/mirror/string-inl.h
index 6870fda..9b8445d 100644
--- a/runtime/mirror/string-inl.h
+++ b/runtime/mirror/string-inl.h
@@ -16,6 +16,10 @@
#ifndef ART_RUNTIME_MIRROR_STRING_INL_H_
#define ART_RUNTIME_MIRROR_STRING_INL_H_
+#include "string.h"
+
+#include "android-base/stringprintf.h"
+
#include "array.h"
#include "base/bit_utils.h"
#include "class.h"
@@ -24,7 +28,6 @@
#include "globals.h"
#include "intern_table.h"
#include "runtime.h"
-#include "string.h"
#include "thread.h"
#include "utf.h"
#include "utils.h"
@@ -228,9 +231,10 @@
"kObjectAlignment must be at least as big as Java char alignment");
const size_t max_length = RoundDown(max_alloc_length, kObjectAlignment / block_size);
if (UNLIKELY(length > max_length)) {
- self->ThrowOutOfMemoryError(StringPrintf("%s of length %d would overflow",
- Class::PrettyDescriptor(string_class).c_str(),
- static_cast<int>(length)).c_str());
+ self->ThrowOutOfMemoryError(
+ android::base::StringPrintf("%s of length %d would overflow",
+ Class::PrettyDescriptor(string_class).c_str(),
+ static_cast<int>(length)).c_str());
return nullptr;
}
@@ -305,8 +309,11 @@
template<typename MemoryType>
bool String::AllASCII(const MemoryType* const chars, const int length) {
+ static_assert(std::is_unsigned<MemoryType>::value, "Expecting unsigned MemoryType");
for (int i = 0; i < length; ++i) {
- if (chars[i] >= 0x80) {
+ // Valid ASCII characters are in range 1..0x7f. Zero is not considered ASCII
+ // because it would complicate the detection of ASCII strings in Modified-UTF8.
+ if ((chars[i] - 1u) >= 0x7fu) {
return false;
}
}
diff --git a/runtime/mirror/throwable.cc b/runtime/mirror/throwable.cc
index b866a63..e50409f 100644
--- a/runtime/mirror/throwable.cc
+++ b/runtime/mirror/throwable.cc
@@ -16,6 +16,8 @@
#include "throwable.h"
+#include "android-base/stringprintf.h"
+
#include "art_method-inl.h"
#include "base/enums.h"
#include "class-inl.h"
@@ -31,6 +33,8 @@
namespace art {
namespace mirror {
+using android::base::StringPrintf;
+
GcRoot<Class> Throwable::java_lang_Throwable_;
void Throwable::SetDetailMessage(ObjPtr<String> new_detail_message) {
@@ -104,7 +108,7 @@
CHECK_EQ(array_len % 2, 0);
const auto depth = array_len / 2;
if (depth == 0) {
- result += "(Throwable with empty stack trace)";
+ result += "(Throwable with empty stack trace)\n";
} else {
const PointerSize ptr_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
for (int32_t i = 0; i < depth; ++i) {
@@ -124,7 +128,7 @@
ObjPtr<ObjectArray<StackTraceElement>> ste_array =
ObjPtr<ObjectArray<StackTraceElement>>::DownCast(stack_trace);
if (ste_array->GetLength() == 0) {
- result += "(Throwable with empty stack trace)";
+ result += "(Throwable with empty stack trace)\n";
} else {
for (int32_t i = 0; i < ste_array->GetLength(); ++i) {
StackTraceElement* ste = ste_array->Get(i);
@@ -139,7 +143,7 @@
}
}
} else {
- result += "(Throwable with no stack trace)";
+ result += "(Throwable with no stack trace)\n";
}
}
ObjPtr<Throwable> cause = GetFieldObject<Throwable>(OFFSET_OF_OBJECT_MEMBER(Throwable, cause_));
diff --git a/runtime/modifiers.h b/runtime/modifiers.h
index dd32df6..ae6b31d 100644
--- a/runtime/modifiers.h
+++ b/runtime/modifiers.h
@@ -67,6 +67,15 @@
// Set by the verifier for a method that could not be verified to follow structured locking.
static constexpr uint32_t kAccMustCountLocks = 0x02000000; // method (runtime)
+// Set to indicate that the ArtMethod is obsolete and has a different DexCache from its declaring
+// class.
+// TODO Might want to re-arrange some of these so that we can have obsolete + intrinsic methods.
+static constexpr uint32_t kAccObsoleteMethod = 0x04000000; // method (runtime)
+
+// Set by the class linker for a method that has only one implementation for a
+// virtual call.
+static constexpr uint32_t kAccSingleImplementation = 0x08000000; // method (runtime)
+
static constexpr uint32_t kAccIntrinsic = 0x80000000; // method (runtime)
// Special runtime-only flags.
diff --git a/runtime/monitor.cc b/runtime/monitor.cc
index e7de7e6..222eb5c 100644
--- a/runtime/monitor.cc
+++ b/runtime/monitor.cc
@@ -18,6 +18,8 @@
#include <vector>
+#include "android-base/stringprintf.h"
+
#include "art_method-inl.h"
#include "base/mutex.h"
#include "base/stl_util.h"
@@ -38,6 +40,8 @@
namespace art {
+using android::base::StringPrintf;
+
static constexpr uint64_t kLongWaitMs = 100;
/*
diff --git a/runtime/native/dalvik_system_DexFile.cc b/runtime/native/dalvik_system_DexFile.cc
index df0849a..cd0e55f 100644
--- a/runtime/native/dalvik_system_DexFile.cc
+++ b/runtime/native/dalvik_system_DexFile.cc
@@ -18,9 +18,10 @@
#include <sstream>
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
#include "base/stl_util.h"
-#include "base/stringprintf.h"
#include "class_linker.h"
#include "common_throws.h"
#include "compiler_filter.h"
@@ -43,6 +44,8 @@
namespace art {
+using android::base::StringPrintf;
+
static bool ConvertJavaArrayToDexFiles(
JNIEnv* env,
jobject arrayObject,
@@ -413,33 +416,7 @@
OatFileAssistant oat_file_assistant(filename.c_str(), target_instruction_set,
false /* load_executable */);
-
- std::ostringstream status;
- bool oat_file_exists = false;
- bool odex_file_exists = false;
- if (oat_file_assistant.OatFileExists()) {
- oat_file_exists = true;
- status << *oat_file_assistant.OatFileName() << " [compilation_filter=";
- status << CompilerFilter::NameOfFilter(oat_file_assistant.OatFileCompilerFilter());
- status << ", status=" << oat_file_assistant.OatFileStatus();
- }
-
- if (oat_file_assistant.OdexFileExists()) {
- odex_file_exists = true;
- if (oat_file_exists) {
- status << "] ";
- }
- status << *oat_file_assistant.OdexFileName() << " [compilation_filter=";
- status << CompilerFilter::NameOfFilter(oat_file_assistant.OdexFileCompilerFilter());
- status << ", status=" << oat_file_assistant.OdexFileStatus();
- }
-
- if (!oat_file_exists && !odex_file_exists) {
- status << "invalid[";
- }
-
- status << "]";
- return env->NewStringUTF(status.str().c_str());
+ return env->NewStringUTF(oat_file_assistant.GetStatusDump().c_str());
}
static jint DexFile_getDexOptNeeded(JNIEnv* env,
diff --git a/runtime/native/dalvik_system_InMemoryDexClassLoader_DexData.cc b/runtime/native/dalvik_system_InMemoryDexClassLoader_DexData.cc
index db245aa..981be68 100644
--- a/runtime/native/dalvik_system_InMemoryDexClassLoader_DexData.cc
+++ b/runtime/native/dalvik_system_InMemoryDexClassLoader_DexData.cc
@@ -16,6 +16,8 @@
#include "dalvik_system_InMemoryDexClassLoader_DexData.h"
+#include "android-base/stringprintf.h"
+
#include "class_linker.h"
#include "common_throws.h"
#include "dex_file.h"
@@ -29,6 +31,8 @@
namespace art {
+using android::base::StringPrintf;
+
static std::unique_ptr<MemMap> AllocateDexMemoryMap(JNIEnv* env, jint start, jint end) {
if (end <= start) {
ScopedObjectAccess soa(env);
diff --git a/runtime/native/dalvik_system_VMDebug.cc b/runtime/native/dalvik_system_VMDebug.cc
index adf35b6..67b2e1c 100644
--- a/runtime/native/dalvik_system_VMDebug.cc
+++ b/runtime/native/dalvik_system_VMDebug.cc
@@ -177,8 +177,22 @@
}
static void VMDebug_printLoadedClasses(JNIEnv* env, jclass, jint flags) {
+ class DumpClassVisitor : public ClassVisitor {
+ public:
+ explicit DumpClassVisitor(int dump_flags) : flags_(dump_flags) {}
+
+ bool operator()(ObjPtr<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+ klass->DumpClass(LOG_STREAM(ERROR), flags_);
+ return true;
+ }
+
+ private:
+ const int flags_;
+ };
+ DumpClassVisitor visitor(flags);
+
ScopedFastNativeObjectAccess soa(env);
- return Runtime::Current()->GetClassLinker()->DumpAllClasses(flags);
+ return Runtime::Current()->GetClassLinker()->VisitClasses(&visitor);
}
static jint VMDebug_getLoadedClassCount(JNIEnv* env, jclass) {
diff --git a/runtime/native/dalvik_system_VMRuntime.cc b/runtime/native/dalvik_system_VMRuntime.cc
index 866dc7f..1af8619 100644
--- a/runtime/native/dalvik_system_VMRuntime.cc
+++ b/runtime/native/dalvik_system_VMRuntime.cc
@@ -27,6 +27,8 @@
#include "toStringArray.h"
#pragma GCC diagnostic pop
+#include "android-base/stringprintf.h"
+
#include "art_method-inl.h"
#include "arch/instruction_set.h"
#include "base/enums.h"
@@ -34,6 +36,7 @@
#include "common_throws.h"
#include "debugger.h"
#include "dex_file-inl.h"
+#include "dex_file_types.h"
#include "gc/accounting/card_table-inl.h"
#include "gc/allocator/dlmalloc.h"
#include "gc/heap.h"
@@ -53,6 +56,8 @@
namespace art {
+using android::base::StringPrintf;
+
static jfloat VMRuntime_getTargetHeapUtilization(JNIEnv*, jobject) {
return Runtime::Current()->GetHeap()->GetTargetHeapUtilization();
}
@@ -286,7 +291,7 @@
// Based on ClassLinker::ResolveString.
static void PreloadDexCachesResolveString(
- Handle<mirror::DexCache> dex_cache, uint32_t string_idx, StringTable& strings)
+ Handle<mirror::DexCache> dex_cache, dex::StringIndex string_idx, StringTable& strings)
REQUIRES_SHARED(Locks::mutator_lock_) {
ObjPtr<mirror::String> string = dex_cache->GetResolvedString(string_idx);
if (string != nullptr) {
@@ -305,7 +310,7 @@
// Based on ClassLinker::ResolveType.
static void PreloadDexCachesResolveType(Thread* self,
ObjPtr<mirror::DexCache> dex_cache,
- uint32_t type_idx)
+ dex::TypeIndex type_idx)
REQUIRES_SHARED(Locks::mutator_lock_) {
ObjPtr<mirror::Class> klass = dex_cache->GetResolvedType(type_idx);
if (klass != nullptr) {
@@ -449,13 +454,13 @@
continue;
}
for (size_t j = 0; j < dex_cache->NumStrings(); j++) {
- ObjPtr<mirror::String> string = dex_cache->GetResolvedString(j);
+ ObjPtr<mirror::String> string = dex_cache->GetResolvedString(dex::StringIndex(j));
if (string != nullptr) {
filled->num_strings++;
}
}
for (size_t j = 0; j < dex_cache->NumResolvedTypes(); j++) {
- ObjPtr<mirror::Class> klass = dex_cache->GetResolvedType(j);
+ ObjPtr<mirror::Class> klass = dex_cache->GetResolvedType(dex::TypeIndex(j));
if (klass != nullptr) {
filled->num_types++;
}
@@ -513,13 +518,13 @@
if (kPreloadDexCachesStrings) {
for (size_t j = 0; j < dex_cache->NumStrings(); j++) {
- PreloadDexCachesResolveString(dex_cache, j, strings);
+ PreloadDexCachesResolveString(dex_cache, dex::StringIndex(j), strings);
}
}
if (kPreloadDexCachesTypes) {
for (size_t j = 0; j < dex_cache->NumResolvedTypes(); j++) {
- PreloadDexCachesResolveType(soa.Self(), dex_cache.Get(), j);
+ PreloadDexCachesResolveType(soa.Self(), dex_cache.Get(), dex::TypeIndex(j));
}
}
diff --git a/runtime/native/dalvik_system_ZygoteHooks.cc b/runtime/native/dalvik_system_ZygoteHooks.cc
index a78909b..10fc90b 100644
--- a/runtime/native/dalvik_system_ZygoteHooks.cc
+++ b/runtime/native/dalvik_system_ZygoteHooks.cc
@@ -18,6 +18,8 @@
#include <stdlib.h>
+#include "android-base/stringprintf.h"
+
#include "arch/instruction_set.h"
#include "debugger.h"
#include "java_vm_ext.h"
@@ -37,6 +39,8 @@
namespace art {
+using android::base::StringPrintf;
+
static void EnableDebugger() {
#if defined(__linux__)
// To let a non-privileged gdbserver attach to this
diff --git a/runtime/native/java_lang_Class.cc b/runtime/native/java_lang_Class.cc
index 642826c..3341f53 100644
--- a/runtime/native/java_lang_Class.cc
+++ b/runtime/native/java_lang_Class.cc
@@ -278,7 +278,7 @@
uint32_t num_direct_interfaces = h_clazz->NumDirectInterfaces();
for (uint32_t i = 0; i < num_direct_interfaces; i++) {
- ObjPtr<mirror::Class> iface = mirror::Class::GetDirectInterface(self, h_clazz, i);
+ ObjPtr<mirror::Class> iface = mirror::Class::ResolveDirectInterface(self, h_clazz, i);
if (UNLIKELY(iface == nullptr)) {
self->AssertPendingException();
return nullptr;
diff --git a/runtime/native/java_lang_DexCache.cc b/runtime/native/java_lang_DexCache.cc
index 71379a5..f1c350f 100644
--- a/runtime/native/java_lang_DexCache.cc
+++ b/runtime/native/java_lang_DexCache.cc
@@ -17,6 +17,7 @@
#include "java_lang_DexCache.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "jni_internal.h"
#include "mirror/class-inl.h"
#include "mirror/dex_cache-inl.h"
@@ -53,14 +54,15 @@
ScopedFastNativeObjectAccess soa(env);
ObjPtr<mirror::DexCache> dex_cache = soa.Decode<mirror::DexCache>(javaDexCache);
CHECK_LT(static_cast<size_t>(type_index), dex_cache->NumResolvedTypes());
- return soa.AddLocalReference<jobject>(dex_cache->GetResolvedType(type_index));
+ return soa.AddLocalReference<jobject>(dex_cache->GetResolvedType(dex::TypeIndex(type_index)));
}
static jobject DexCache_getResolvedString(JNIEnv* env, jobject javaDexCache, jint string_index) {
ScopedFastNativeObjectAccess soa(env);
ObjPtr<mirror::DexCache> dex_cache = soa.Decode<mirror::DexCache>(javaDexCache);
CHECK_LT(static_cast<size_t>(string_index), dex_cache->GetDexFile()->NumStringIds());
- return soa.AddLocalReference<jobject>(dex_cache->GetResolvedString(string_index));
+ return soa.AddLocalReference<jobject>(
+ dex_cache->GetResolvedString(dex::StringIndex(string_index)));
}
static void DexCache_setResolvedType(JNIEnv* env, jobject javaDexCache, jint type_index,
@@ -68,7 +70,7 @@
ScopedFastNativeObjectAccess soa(env);
ObjPtr<mirror::DexCache> dex_cache = soa.Decode<mirror::DexCache>(javaDexCache);
CHECK_LT(static_cast<size_t>(type_index), dex_cache->NumResolvedTypes());
- dex_cache->SetResolvedType(type_index, soa.Decode<mirror::Class>(type));
+ dex_cache->SetResolvedType(dex::TypeIndex(type_index), soa.Decode<mirror::Class>(type));
}
static void DexCache_setResolvedString(JNIEnv* env, jobject javaDexCache, jint string_index,
@@ -76,7 +78,7 @@
ScopedFastNativeObjectAccess soa(env);
ObjPtr<mirror::DexCache> dex_cache = soa.Decode<mirror::DexCache>(javaDexCache);
CHECK_LT(static_cast<size_t>(string_index), dex_cache->GetDexFile()->NumStringIds());
- dex_cache->SetResolvedString(string_index, soa.Decode<mirror::String>(string));
+ dex_cache->SetResolvedString(dex::StringIndex(string_index), soa.Decode<mirror::String>(string));
}
static JNINativeMethod gMethods[] = {
diff --git a/runtime/native/java_lang_ref_FinalizerReference.cc b/runtime/native/java_lang_ref_FinalizerReference.cc
index c7d06f4..ecafd0e 100644
--- a/runtime/native/java_lang_ref_FinalizerReference.cc
+++ b/runtime/native/java_lang_ref_FinalizerReference.cc
@@ -31,8 +31,17 @@
return Runtime::Current()->GetHeap()->GetReferenceProcessor()->MakeCircularListIfUnenqueued(ref);
}
+static jobject FinalizerReference_getReferent(JNIEnv* env, jobject javaThis) {
+ ScopedFastNativeObjectAccess soa(env);
+ ObjPtr<mirror::Reference> ref = soa.Decode<mirror::Reference>(javaThis);
+ ObjPtr<mirror::Object> const referent =
+ Runtime::Current()->GetHeap()->GetReferenceProcessor()->GetReferent(soa.Self(), ref);
+ return soa.AddLocalReference<jobject>(referent);
+}
+
static JNINativeMethod gMethods[] = {
NATIVE_METHOD(FinalizerReference, makeCircularListIfUnenqueued, "!()Z"),
+ NATIVE_METHOD(FinalizerReference, getReferent, "!()Ljava/lang/Object;"),
};
void register_java_lang_ref_FinalizerReference(JNIEnv* env) {
diff --git a/runtime/native/java_lang_ref_Reference.cc b/runtime/native/java_lang_ref_Reference.cc
index bedca10..c778068 100644
--- a/runtime/native/java_lang_ref_Reference.cc
+++ b/runtime/native/java_lang_ref_Reference.cc
@@ -33,8 +33,15 @@
return soa.AddLocalReference<jobject>(referent);
}
+static void Reference_clearReferent(JNIEnv* env, jobject javaThis) {
+ ScopedFastNativeObjectAccess soa(env);
+ ObjPtr<mirror::Reference> ref = soa.Decode<mirror::Reference>(javaThis);
+ Runtime::Current()->GetHeap()->GetReferenceProcessor()->ClearReferent(ref);
+}
+
static JNINativeMethod gMethods[] = {
NATIVE_METHOD(Reference, getReferent, "!()Ljava/lang/Object;"),
+ NATIVE_METHOD(Reference, clearReferent, "!()V"),
};
void register_java_lang_ref_Reference(JNIEnv* env) {
diff --git a/runtime/native/java_lang_reflect_Executable.cc b/runtime/native/java_lang_reflect_Executable.cc
index 73b81a7..ee59c4a 100644
--- a/runtime/native/java_lang_reflect_Executable.cc
+++ b/runtime/native/java_lang_reflect_Executable.cc
@@ -16,6 +16,8 @@
#include "java_lang_reflect_Executable.h"
+#include "android-base/stringprintf.h"
+
#include "art_method-inl.h"
#include "dex_file_annotations.h"
#include "handle.h"
@@ -30,6 +32,8 @@
namespace art {
+using android::base::StringPrintf;
+
static jobjectArray Executable_getDeclaredAnnotationsNative(JNIEnv* env, jobject javaMethod) {
ScopedFastNativeObjectAccess soa(env);
ArtMethod* method = ArtMethod::FromReflectedMethod(soa, javaMethod);
diff --git a/runtime/native/java_lang_reflect_Field.cc b/runtime/native/java_lang_reflect_Field.cc
index 6206948..374eeb5 100644
--- a/runtime/native/java_lang_reflect_Field.cc
+++ b/runtime/native/java_lang_reflect_Field.cc
@@ -16,6 +16,8 @@
#include "java_lang_reflect_Field.h"
+#include "android-base/stringprintf.h"
+
#include "class_linker.h"
#include "class_linker-inl.h"
#include "common_throws.h"
@@ -30,6 +32,8 @@
namespace art {
+using android::base::StringPrintf;
+
template<bool kIsSet>
ALWAYS_INLINE inline static bool VerifyFieldAccess(Thread* self,
ObjPtr<mirror::Field> field,
diff --git a/runtime/native/java_lang_reflect_Parameter.cc b/runtime/native/java_lang_reflect_Parameter.cc
index 16164d2..0bb9e38 100644
--- a/runtime/native/java_lang_reflect_Parameter.cc
+++ b/runtime/native/java_lang_reflect_Parameter.cc
@@ -16,6 +16,8 @@
#include "java_lang_reflect_Parameter.h"
+#include "android-base/stringprintf.h"
+
#include "art_method-inl.h"
#include "common_throws.h"
#include "dex_file-inl.h"
@@ -26,6 +28,8 @@
namespace art {
+using android::base::StringPrintf;
+
static jobject Parameter_getAnnotationNative(JNIEnv* env,
jclass,
jobject javaMethod,
diff --git a/runtime/native_stack_dump.cc b/runtime/native_stack_dump.cc
index 2376889..7460d62 100644
--- a/runtime/native_stack_dump.cc
+++ b/runtime/native_stack_dump.cc
@@ -37,10 +37,11 @@
#include <sys/time.h>
#include <sys/types.h>
+#include "android-base/stringprintf.h"
+
#include "arch/instruction_set.h"
#include "base/memory_tool.h"
#include "base/mutex.h"
-#include "base/stringprintf.h"
#include "base/unix_file/fd_file.h"
#include "oat_quick_method_header.h"
#include "os.h"
@@ -53,6 +54,8 @@
#if defined(__linux__)
+using android::base::StringPrintf;
+
static constexpr bool kUseAddr2line = !kIsTargetBuild;
ALWAYS_INLINE
@@ -272,7 +275,7 @@
if (code == 0) {
return pc == 0;
}
- uintptr_t code_size = reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].code_size_;
+ uintptr_t code_size = reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetCodeSize();
return code <= pc && pc <= (code + code_size);
}
diff --git a/runtime/oat.cc b/runtime/oat.cc
index aab0e81..cebe765 100644
--- a/runtime/oat.cc
+++ b/runtime/oat.cc
@@ -19,12 +19,15 @@
#include <string.h>
#include <zlib.h>
+#include "android-base/stringprintf.h"
+
#include "arch/instruction_set_features.h"
#include "base/bit_utils.h"
-#include "base/stringprintf.h"
namespace art {
+using android::base::StringPrintf;
+
constexpr uint8_t OatHeader::kOatMagic[4];
constexpr uint8_t OatHeader::kOatVersion[4];
constexpr const char OatHeader::kTrueValue[];
diff --git a/runtime/oat.h b/runtime/oat.h
index 8c84d42..0f4cbbb 100644
--- a/runtime/oat.h
+++ b/runtime/oat.h
@@ -32,7 +32,7 @@
class PACKED(4) OatHeader {
public:
static constexpr uint8_t kOatMagic[] = { 'o', 'a', 't', '\n' };
- static constexpr uint8_t kOatVersion[] = { '0', '9', '2', '\0' };
+ static constexpr uint8_t kOatVersion[] = { '0', '9', '3', '\0' };
static constexpr const char* kImageLocationKey = "image-location";
static constexpr const char* kDex2OatCmdLineKey = "dex2oat-cmdline";
diff --git a/runtime/oat_file-inl.h b/runtime/oat_file-inl.h
index d7d0c4f..721fab9 100644
--- a/runtime/oat_file-inl.h
+++ b/runtime/oat_file-inl.h
@@ -44,7 +44,7 @@
if (method_header == nullptr) {
return 0u;
}
- return reinterpret_cast<const uint8_t*>(&method_header->code_size_) - begin_;
+ return reinterpret_cast<const uint8_t*>(method_header->GetCodeSizeAddr()) - begin_;
}
inline size_t OatFile::OatMethod::GetFrameSizeInBytes() const {
@@ -52,7 +52,7 @@
if (code == nullptr) {
return 0u;
}
- return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].frame_info_.FrameSizeInBytes();
+ return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetFrameInfo().FrameSizeInBytes();
}
inline uint32_t OatFile::OatMethod::GetCoreSpillMask() const {
@@ -60,7 +60,7 @@
if (code == nullptr) {
return 0u;
}
- return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].frame_info_.CoreSpillMask();
+ return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetFrameInfo().CoreSpillMask();
}
inline uint32_t OatFile::OatMethod::GetFpSpillMask() const {
@@ -68,7 +68,7 @@
if (code == nullptr) {
return 0u;
}
- return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].frame_info_.FpSpillMask();
+ return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetFrameInfo().FpSpillMask();
}
inline uint32_t OatFile::OatMethod::GetVmapTableOffset() const {
@@ -81,7 +81,7 @@
if (method_header == nullptr) {
return 0u;
}
- return reinterpret_cast<const uint8_t*>(&method_header->vmap_table_offset_) - begin_;
+ return reinterpret_cast<const uint8_t*>(method_header->GetVmapTableOffsetAddr()) - begin_;
}
inline const uint8_t* OatFile::OatMethod::GetVmapTable() const {
@@ -89,7 +89,7 @@
if (code == nullptr) {
return nullptr;
}
- uint32_t offset = reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].vmap_table_offset_;
+ uint32_t offset = reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetVmapTableOffset();
if (UNLIKELY(offset == 0u)) {
return nullptr;
}
@@ -101,7 +101,7 @@
if (code == nullptr) {
return 0u;
}
- return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].code_size_;
+ return reinterpret_cast<const OatQuickMethodHeader*>(code)[-1].GetCodeSize();
}
inline uint32_t OatFile::OatMethod::GetCodeOffset() const {
diff --git a/runtime/oat_file.cc b/runtime/oat_file.cc
index c14b616..0bf7136 100644
--- a/runtime/oat_file.cc
+++ b/runtime/oat_file.cc
@@ -32,12 +32,15 @@
#include "android/dlext.h"
#endif
+#include "android-base/stringprintf.h"
+
#include "art_method-inl.h"
#include "base/bit_vector.h"
#include "base/enums.h"
#include "base/stl_util.h"
#include "base/systrace.h"
#include "base/unix_file/fd_file.h"
+#include "dex_file_types.h"
#include "elf_file.h"
#include "elf_utils.h"
#include "gc_root.h"
@@ -57,6 +60,8 @@
namespace art {
+using android::base::StringPrintf;
+
// Whether OatFile::Open will try dlopen. Fallback is our own ELF loader.
static constexpr bool kUseDlopen = true;
@@ -718,7 +723,7 @@
dlopen_handle_ = android_dlopen_ext(absolute_path.get(), RTLD_NOW, &extinfo);
#else
UNUSED(oat_file_begin);
- static_assert(!kIsTargetBuild, "host_dlopen_handles_ will leak handles");
+ static_assert(!kIsTargetBuild || kIsTargetLinux, "host_dlopen_handles_ will leak handles");
MutexLock mu(Thread::Current(), *Locks::host_dlopen_handles_lock_);
dlopen_handle_ = dlopen(absolute_path.get(), RTLD_NOW);
if (dlopen_handle_ != nullptr) {
@@ -1252,13 +1257,14 @@
if (lookup_table_data_ + TypeLookupTable::RawDataLength(num_class_defs) > GetOatFile()->End()) {
LOG(WARNING) << "found truncated lookup table in " << dex_file_location_;
} else {
- lookup_table_.reset(TypeLookupTable::Open(dex_file_pointer_,
- lookup_table_data_,
- num_class_defs));
+ lookup_table_ = TypeLookupTable::Open(dex_file_pointer_, lookup_table_data_, num_class_defs);
}
}
}
+OatFile::OatDexFile::OatDexFile(std::unique_ptr<TypeLookupTable>&& lookup_table)
+ : lookup_table_(std::move(lookup_table)) {}
+
OatFile::OatDexFile::~OatDexFile() {}
size_t OatFile::OatDexFile::FileSize() const {
@@ -1342,7 +1348,7 @@
}
const DexFile::TypeId* type_id = dex_file.FindTypeId(descriptor);
if (type_id != nullptr) {
- uint16_t type_idx = dex_file.GetIndexForTypeId(*type_id);
+ dex::TypeIndex type_idx = dex_file.GetIndexForTypeId(*type_id);
return dex_file.FindClassDef(type_idx);
}
return nullptr;
@@ -1540,7 +1546,7 @@
bool* found) {
DCHECK_NE(class_def_idx, DexFile::kDexNoIndex16);
const OatFile::OatDexFile* oat_dex_file = dex_file.GetOatDexFile();
- if (oat_dex_file == nullptr) {
+ if (oat_dex_file == nullptr || oat_dex_file->GetOatFile() == nullptr) {
*found = false;
return OatFile::OatClass::Invalid();
}
@@ -1548,4 +1554,8 @@
return oat_dex_file->GetOatClass(class_def_idx);
}
+void OatFile::OatDexFile::AssertAotCompiler() {
+ CHECK(Runtime::Current()->IsAotCompiler());
+}
+
} // namespace art
diff --git a/runtime/oat_file.h b/runtime/oat_file.h
index 63a0e14..29add5b 100644
--- a/runtime/oat_file.h
+++ b/runtime/oat_file.h
@@ -384,7 +384,13 @@
// Opens the DexFile referred to by this OatDexFile from within the containing OatFile.
std::unique_ptr<const DexFile> OpenDexFile(std::string* error_msg) const;
+ // May return null if the OatDexFile only contains a type lookup table. This case only happens
+ // for the compiler to speed up compilation.
const OatFile* GetOatFile() const {
+ // Avoid pulling in runtime.h in the header file.
+ if (kIsDebugBuild && oat_file_ == nullptr) {
+ AssertAotCompiler();
+ }
return oat_file_;
}
@@ -436,6 +442,9 @@
~OatDexFile();
+ // Create only with a type lookup table, used by the compiler to speed up compilation.
+ explicit OatDexFile(std::unique_ptr<TypeLookupTable>&& lookup_table);
+
private:
OatDexFile(const OatFile* oat_file,
const std::string& dex_file_location,
@@ -446,14 +455,16 @@
const uint32_t* oat_class_offsets_pointer,
uint8_t* dex_cache_arrays);
- const OatFile* const oat_file_;
+ static void AssertAotCompiler();
+
+ const OatFile* const oat_file_ = nullptr;
const std::string dex_file_location_;
const std::string canonical_dex_file_location_;
- const uint32_t dex_file_location_checksum_;
- const uint8_t* const dex_file_pointer_;
- const uint8_t* lookup_table_data_;
- const uint32_t* const oat_class_offsets_pointer_;
- uint8_t* const dex_cache_arrays_;
+ const uint32_t dex_file_location_checksum_ = 0u;
+ const uint8_t* const dex_file_pointer_ = nullptr;
+ const uint8_t* lookup_table_data_ = nullptr;
+ const uint32_t* const oat_class_offsets_pointer_ = 0u;
+ uint8_t* const dex_cache_arrays_ = nullptr;
mutable std::unique_ptr<TypeLookupTable> lookup_table_;
friend class OatFile;
diff --git a/runtime/oat_file_assistant.cc b/runtime/oat_file_assistant.cc
index 0679360..ee7cf9d 100644
--- a/runtime/oat_file_assistant.cc
+++ b/runtime/oat_file_assistant.cc
@@ -16,9 +16,13 @@
#include "oat_file_assistant.h"
+#include <sstream>
+
#include <sys/stat.h>
+
+#include "android-base/strings.h"
+
#include "base/logging.h"
-#include "base/stringprintf.h"
#include "compiler_filter.h"
#include "class_linker.h"
#include "gc/heap.h"
@@ -34,15 +38,21 @@
std::ostream& operator << (std::ostream& stream, const OatFileAssistant::OatStatus status) {
switch (status) {
- case OatFileAssistant::kOatOutOfDate:
- stream << "kOatOutOfDate";
+ case OatFileAssistant::kOatCannotOpen:
+ stream << "kOatCannotOpen";
+ break;
+ case OatFileAssistant::kOatDexOutOfDate:
+ stream << "kOatDexOutOfDate";
+ break;
+ case OatFileAssistant::kOatBootImageOutOfDate:
+ stream << "kOatBootImageOutOfDate";
+ break;
+ case OatFileAssistant::kOatRelocationOutOfDate:
+ stream << "kOatRelocationOutOfDate";
break;
case OatFileAssistant::kOatUpToDate:
stream << "kOatUpToDate";
break;
- case OatFileAssistant::kOatNeedsRelocation:
- stream << "kOatNeedsRelocation";
- break;
default:
UNREACHABLE();
}
@@ -60,7 +70,10 @@
const char* oat_location,
const InstructionSet isa,
bool load_executable)
- : isa_(isa), load_executable_(load_executable), odex_(this), oat_(this) {
+ : isa_(isa),
+ load_executable_(load_executable),
+ odex_(this, /*is_oat_location*/ false),
+ oat_(this, /*is_oat_location*/ true) {
CHECK(dex_location != nullptr) << "OatFileAssistant: null dex location";
dex_location_.assign(dex_location);
@@ -135,51 +148,13 @@
return true;
}
-OatFileAssistant::DexOptNeeded
-OatFileAssistant::GetDexOptNeeded(CompilerFilter::Filter target, bool profile_changed) {
- bool compilation_desired = CompilerFilter::IsBytecodeCompilationEnabled(target);
-
- // See if the oat file is in good shape as is.
- bool oat_okay = oat_.CompilerFilterIsOkay(target, profile_changed);
- if (oat_okay) {
- if (compilation_desired) {
- if (oat_.IsUpToDate()) {
- return kNoDexOptNeeded;
- }
- } else {
- if (!oat_.IsOutOfDate()) {
- return kNoDexOptNeeded;
- }
- }
+int OatFileAssistant::GetDexOptNeeded(CompilerFilter::Filter target, bool profile_changed) {
+ OatFileInfo& info = GetBestInfo();
+ DexOptNeeded dexopt_needed = info.GetDexOptNeeded(target, profile_changed);
+ if (info.IsOatLocation() || dexopt_needed == kDex2OatFromScratch) {
+ return dexopt_needed;
}
-
- // See if the odex file is in good shape as is.
- bool odex_okay = odex_.CompilerFilterIsOkay(target, profile_changed);
- if (odex_okay) {
- if (compilation_desired) {
- if (odex_.IsUpToDate()) {
- return kNoDexOptNeeded;
- }
- } else {
- if (!odex_.IsOutOfDate()) {
- return kNoDexOptNeeded;
- }
- }
- }
-
- // See if we can get an up-to-date file by running patchoat.
- if (compilation_desired) {
- if (odex_okay && odex_.NeedsRelocation() && odex_.HasPatchInfo()) {
- return kPatchOatNeeded;
- }
-
- if (oat_okay && oat_.NeedsRelocation() && oat_.HasPatchInfo()) {
- return kSelfPatchOatNeeded;
- }
- }
-
- // We can only run dex2oat if there are original dex files.
- return HasOriginalDexFiles() ? kDex2OatNeeded : kNoDexOptNeeded;
+ return -dexopt_needed;
}
// Figure out the currently specified compile filter option in the runtime.
@@ -205,7 +180,7 @@
}
bool OatFileAssistant::IsUpToDate() {
- return OatFileIsUpToDate() || OdexFileIsUpToDate();
+ return GetBestInfo().Status() == kOatUpToDate;
}
OatFileAssistant::ResultOfAttemptToUpdate
@@ -215,59 +190,66 @@
return kUpdateNotAttempted;
}
- switch (GetDexOptNeeded(target, profile_changed)) {
- case kNoDexOptNeeded: return kUpdateSucceeded;
- case kDex2OatNeeded: return GenerateOatFile(error_msg);
- case kPatchOatNeeded: return RelocateOatFile(odex_.Filename(), error_msg);
- case kSelfPatchOatNeeded: return RelocateOatFile(oat_.Filename(), error_msg);
+ OatFileInfo& info = GetBestInfo();
+ switch (info.GetDexOptNeeded(target, profile_changed)) {
+ case kNoDexOptNeeded:
+ return kUpdateSucceeded;
+
+ // TODO: For now, don't bother with all the different ways we can call
+ // dex2oat to generate the oat file. Always generate the oat file as if it
+ // were kDex2OatFromScratch.
+ case kDex2OatFromScratch:
+ case kDex2OatForBootImage:
+ case kDex2OatForRelocation:
+ case kDex2OatForFilter:
+ return GenerateOatFile(error_msg);
+
+ case kPatchoatForRelocation: {
+ return RelocateOatFile(info.Filename(), error_msg);
+ }
}
UNREACHABLE();
}
std::unique_ptr<OatFile> OatFileAssistant::GetBestOatFile() {
- // The best oat files are, in descending order of bestness:
- // 1. Properly relocated files. These may be opened executable.
- // 2. Not out-of-date files that are already opened non-executable.
- // 3. Not out-of-date files that we must reopen non-executable.
+ return GetBestInfo().ReleaseFileForUse();
+}
- if (oat_.IsUpToDate()) {
- return oat_.ReleaseFile();
+std::string OatFileAssistant::GetStatusDump() {
+ std::ostringstream status;
+ bool oat_file_exists = false;
+ bool odex_file_exists = false;
+ if (oat_.Status() != kOatCannotOpen) {
+ // If we can open the file, neither Filename nor GetFile should return null.
+ CHECK(oat_.Filename() != nullptr);
+ CHECK(oat_.GetFile() != nullptr);
+
+ oat_file_exists = true;
+ status << *oat_.Filename() << " [compilation_filter=";
+ status << CompilerFilter::NameOfFilter(oat_.GetFile()->GetCompilerFilter());
+ status << ", status=" << oat_.Status();
}
- if (odex_.IsUpToDate()) {
- return odex_.ReleaseFile();
- }
+ if (odex_.Status() != kOatCannotOpen) {
+ // If we can open the file, neither Filename nor GetFile should return null.
+ CHECK(odex_.Filename() != nullptr);
+ CHECK(odex_.GetFile() != nullptr);
- VLOG(oat) << "Oat File Assistant: No relocated oat file found,"
- << " attempting to fall back to interpreting oat file instead.";
-
- if (!oat_.IsOutOfDate() && !oat_.IsExecutable()) {
- return oat_.ReleaseFile();
- }
-
- if (!odex_.IsOutOfDate() && !odex_.IsExecutable()) {
- return odex_.ReleaseFile();
- }
-
- if (!oat_.IsOutOfDate()) {
- load_executable_ = false;
- oat_.Reset();
- if (!oat_.IsOutOfDate()) {
- CHECK(!oat_.IsExecutable());
- return oat_.ReleaseFile();
+ odex_file_exists = true;
+ if (oat_file_exists) {
+ status << "] ";
}
+ status << *odex_.Filename() << " [compilation_filter=";
+ status << CompilerFilter::NameOfFilter(odex_.GetFile()->GetCompilerFilter());
+ status << ", status=" << odex_.Status();
}
- if (!odex_.IsOutOfDate()) {
- load_executable_ = false;
- odex_.Reset();
- if (!odex_.IsOutOfDate()) {
- CHECK(!odex_.IsExecutable());
- return odex_.ReleaseFile();
- }
+ if (!oat_file_exists && !odex_file_exists) {
+ status << "invalid[";
}
- return std::unique_ptr<OatFile>();
+ status << "]";
+ return status.str();
}
std::vector<std::unique_ptr<const DexFile>> OatFileAssistant::LoadDexFiles(
@@ -317,62 +299,14 @@
return has_original_dex_files_;
}
-const std::string* OatFileAssistant::OdexFileName() {
- return odex_.Filename();
-}
-
-bool OatFileAssistant::OdexFileExists() {
- return odex_.Exists();
-}
-
OatFileAssistant::OatStatus OatFileAssistant::OdexFileStatus() {
return odex_.Status();
}
-bool OatFileAssistant::OdexFileIsOutOfDate() {
- return odex_.IsOutOfDate();
-}
-
-bool OatFileAssistant::OdexFileNeedsRelocation() {
- return odex_.NeedsRelocation();
-}
-
-bool OatFileAssistant::OdexFileIsUpToDate() {
- return odex_.IsUpToDate();
-}
-
-CompilerFilter::Filter OatFileAssistant::OdexFileCompilerFilter() {
- return odex_.CompilerFilter();
-}
-
-const std::string* OatFileAssistant::OatFileName() {
- return oat_.Filename();
-}
-
-bool OatFileAssistant::OatFileExists() {
- return oat_.Exists();
-}
-
OatFileAssistant::OatStatus OatFileAssistant::OatFileStatus() {
return oat_.Status();
}
-bool OatFileAssistant::OatFileIsOutOfDate() {
- return oat_.IsOutOfDate();
-}
-
-bool OatFileAssistant::OatFileNeedsRelocation() {
- return oat_.NeedsRelocation();
-}
-
-bool OatFileAssistant::OatFileIsUpToDate() {
- return oat_.IsUpToDate();
-}
-
-CompilerFilter::Filter OatFileAssistant::OatFileCompilerFilter() {
- return oat_.CompilerFilter();
-}
-
OatFileAssistant::OatStatus OatFileAssistant::GivenOatFileStatus(const OatFile& file) {
// Verify the dex checksum.
// Note: GetOatDexFile will return null if the dex checksum doesn't match
@@ -382,8 +316,8 @@
const OatFile::OatDexFile* oat_dex_file = file.GetOatDexFile(
dex_location_.c_str(), dex_checksum_pointer, &error_msg);
if (oat_dex_file == nullptr) {
- VLOG(oat) << error_msg;
- return kOatOutOfDate;
+ LOG(ERROR) << error_msg;
+ return kOatDexOutOfDate;
}
// Verify the dex checksums for any secondary multidex files
@@ -406,7 +340,7 @@
<< secondary_dex_location
<< ". Expected: " << expected_secondary_checksum
<< ", Actual: " << actual_secondary_checksum;
- return kOatOutOfDate;
+ return kOatDexOutOfDate;
}
} else {
// If we can't get the checksum for the secondary location, we assume
@@ -425,7 +359,7 @@
VLOG(oat) << "No image for oat image checksum to match against.";
if (HasOriginalDexFiles()) {
- return kOatOutOfDate;
+ return kOatBootImageOutOfDate;
}
// If there is no original dex file to fall back to, grudgingly accept
@@ -439,7 +373,7 @@
} else if (file.GetOatHeader().GetImageFileLocationOatChecksum()
!= GetCombinedImageChecksum()) {
VLOG(oat) << "Oat image checksum does not match image checksum.";
- return kOatOutOfDate;
+ return kOatBootImageOutOfDate;
}
} else {
VLOG(oat) << "Image checksum test skipped for compiler filter " << current_compiler_filter;
@@ -450,7 +384,7 @@
const ImageInfo* image_info = GetImageInfo();
if (image_info == nullptr) {
VLOG(oat) << "No image to check oat relocation against.";
- return kOatNeedsRelocation;
+ return kOatRelocationOutOfDate;
}
// Verify the oat_data_begin recorded for the image in the oat file matches
@@ -462,7 +396,7 @@
": Oat file image oat_data_begin (" << oat_data_begin << ")"
<< " does not match actual image oat_data_begin ("
<< image_info->oat_data_begin << ")";
- return kOatNeedsRelocation;
+ return kOatRelocationOutOfDate;
}
// Verify the oat_patch_delta recorded for the image in the oat file matches
@@ -473,7 +407,7 @@
": Oat file image patch delta (" << oat_patch_delta << ")"
<< " does not match actual image patch delta ("
<< image_info->patch_delta << ")";
- return kOatNeedsRelocation;
+ return kOatRelocationOutOfDate;
}
} else {
// Oat files compiled in PIC mode do not require relocation.
@@ -524,7 +458,7 @@
argv.push_back("--output-oat-file=" + oat_file_name);
argv.push_back("--patched-image-location=" + image_info->location);
- std::string command_line(Join(argv, ' '));
+ std::string command_line(android::base::Join(argv, ' '));
if (!Exec(argv, error_msg)) {
// Manually delete the file. This ensures there is no garbage left over if
// the process unexpectedly died.
@@ -673,7 +607,7 @@
argv.insert(argv.end(), args.begin(), args.end());
- std::string command_line(Join(argv, ' '));
+ std::string command_line(android::base::Join(argv, ' '));
return Exec(argv, error_msg);
}
@@ -841,6 +775,11 @@
return combined_image_checksum_;
}
+OatFileAssistant::OatFileInfo& OatFileAssistant::GetBestInfo() {
+ bool use_oat = oat_.IsUseable() || odex_.Status() == kOatCannotOpen;
+ return use_oat ? oat_ : odex_;
+}
+
std::unique_ptr<gc::space::ImageSpace> OatFileAssistant::OpenImageSpace(const OatFile* oat_file) {
DCHECK(oat_file != nullptr);
std::string art_file = ReplaceFileExtension(oat_file->GetLocation(), "art");
@@ -857,16 +796,29 @@
return ret;
}
-OatFileAssistant::OatFileInfo::OatFileInfo(OatFileAssistant* oat_file_assistant)
- : oat_file_assistant_(oat_file_assistant)
+OatFileAssistant::OatFileInfo::OatFileInfo(OatFileAssistant* oat_file_assistant,
+ bool is_oat_location)
+ : oat_file_assistant_(oat_file_assistant), is_oat_location_(is_oat_location)
{}
+bool OatFileAssistant::OatFileInfo::IsOatLocation() {
+ return is_oat_location_;
+}
+
const std::string* OatFileAssistant::OatFileInfo::Filename() {
return filename_provided_ ? &filename_ : nullptr;
}
-bool OatFileAssistant::OatFileInfo::Exists() {
- return GetFile() != nullptr;
+bool OatFileAssistant::OatFileInfo::IsUseable() {
+ switch (Status()) {
+ case kOatCannotOpen:
+ case kOatDexOutOfDate:
+ case kOatBootImageOutOfDate: return false;
+
+ case kOatRelocationOutOfDate:
+ case kOatUpToDate: return true;
+ }
+ UNREACHABLE();
}
OatFileAssistant::OatStatus OatFileAssistant::OatFileInfo::Status() {
@@ -874,7 +826,7 @@
status_attempted_ = true;
const OatFile* file = GetFile();
if (file == nullptr) {
- status_ = kOatOutOfDate;
+ status_ = kOatCannotOpen;
} else {
status_ = oat_file_assistant_->GivenOatFileStatus(*file);
VLOG(oat) << file->GetLocation() << " is " << status_
@@ -884,22 +836,46 @@
return status_;
}
-bool OatFileAssistant::OatFileInfo::IsOutOfDate() {
- return Status() == kOatOutOfDate;
-}
+OatFileAssistant::DexOptNeeded OatFileAssistant::OatFileInfo::GetDexOptNeeded(
+ CompilerFilter::Filter target, bool profile_changed) {
+ bool compilation_desired = CompilerFilter::IsBytecodeCompilationEnabled(target);
+ bool filter_okay = CompilerFilterIsOkay(target, profile_changed);
-bool OatFileAssistant::OatFileInfo::NeedsRelocation() {
- return Status() == kOatNeedsRelocation;
-}
+ if (filter_okay && Status() == kOatUpToDate) {
+ // The oat file is in good shape as is.
+ return kNoDexOptNeeded;
+ }
-bool OatFileAssistant::OatFileInfo::IsUpToDate() {
- return Status() == kOatUpToDate;
-}
+ if (filter_okay && !compilation_desired && Status() == kOatRelocationOutOfDate) {
+ // If no compilation is desired, then it doesn't matter if the oat
+ // file needs relocation. It's in good shape as is.
+ return kNoDexOptNeeded;
+ }
-CompilerFilter::Filter OatFileAssistant::OatFileInfo::CompilerFilter() {
- const OatFile* file = GetFile();
- CHECK(file != nullptr);
- return file->GetCompilerFilter();
+ if (filter_okay && Status() == kOatRelocationOutOfDate && HasPatchInfo()) {
+ return kPatchoatForRelocation;
+ }
+
+ if (oat_file_assistant_->HasOriginalDexFiles()) {
+ // Run dex2oat for relocation if we didn't have the patch info necessary
+ // to use patchoat.
+ if (filter_okay && Status() == kOatRelocationOutOfDate) {
+ return kDex2OatForRelocation;
+ }
+
+ if (IsUseable()) {
+ return kDex2OatForFilter;
+ }
+
+ if (Status() == kOatBootImageOutOfDate) {
+ return kDex2OatForBootImage;
+ }
+
+ return kDex2OatFromScratch;
+ }
+
+ // Otherwise there is nothing we can do, even if we want to.
+ return kNoDexOptNeeded;
}
const OatFile* OatFileAssistant::OatFileInfo::GetFile() {
@@ -967,5 +943,31 @@
return std::move(file_);
}
+std::unique_ptr<OatFile> OatFileAssistant::OatFileInfo::ReleaseFileForUse() {
+ if (Status() == kOatUpToDate) {
+ return ReleaseFile();
+ }
+
+ VLOG(oat) << "Oat File Assistant: No relocated oat file found,"
+ << " attempting to fall back to interpreting oat file instead.";
+
+ if (Status() == kOatRelocationOutOfDate && !IsExecutable()) {
+ return ReleaseFile();
+ }
+
+ if (Status() == kOatRelocationOutOfDate) {
+ // We are loading an oat file for runtime use that needs relocation.
+ // Reload the file non-executable to ensure that we interpret out of the
+ // dex code in the oat file rather than trying to execute the unrelocated
+ // compiled code.
+ oat_file_assistant_->load_executable_ = false;
+ Reset();
+ if (IsUseable()) {
+ CHECK(!IsExecutable());
+ return ReleaseFile();
+ }
+ }
+ return std::unique_ptr<OatFile>();
+}
} // namespace art
diff --git a/runtime/oat_file_assistant.h b/runtime/oat_file_assistant.h
index 3f018dc..bed1edc 100644
--- a/runtime/oat_file_assistant.h
+++ b/runtime/oat_file_assistant.h
@@ -48,41 +48,56 @@
class OatFileAssistant {
public:
enum DexOptNeeded {
- // kNoDexOptNeeded - The code for this dex location is up to date and can
- // be used as is.
+ // No dexopt should (or can) be done to update the apk/jar.
// Matches Java: dalvik.system.DexFile.NO_DEXOPT_NEEDED = 0
kNoDexOptNeeded = 0,
- // kDex2OatNeeded - In order to make the code for this dex location up to
- // date, dex2oat must be run on the dex file.
- // Matches Java: dalvik.system.DexFile.DEX2OAT_NEEDED = 1
- kDex2OatNeeded = 1,
+ // dex2oat should be run to update the apk/jar from scratch.
+ // Matches Java: dalvik.system.DexFile.DEX2OAT_FROM_SCRATCH = 1
+ kDex2OatFromScratch = 1,
- // kPatchOatNeeded - In order to make the code for this dex location up to
- // date, patchoat must be run on the odex file.
- // Matches Java: dalvik.system.DexFile.PATCHOAT_NEEDED = 2
- kPatchOatNeeded = 2,
+ // dex2oat should be run to update the apk/jar because the existing code
+ // is out of date with respect to the boot image.
+ // Matches Java: dalvik.system.DexFile.DEX2OAT_FOR_BOOT_IMAGE
+ kDex2OatForBootImage = 2,
- // kSelfPatchOatNeeded - In order to make the code for this dex location
- // up to date, patchoat must be run on the oat file.
- // Matches Java: dalvik.system.DexFile.SELF_PATCHOAT_NEEDED = 3
- kSelfPatchOatNeeded = 3,
+ // dex2oat should be run to update the apk/jar because the existing code
+ // is out of date with respect to the target compiler filter.
+ // Matches Java: dalvik.system.DexFile.DEX2OAT_FOR_FILTER
+ kDex2OatForFilter = 3,
+
+ // dex2oat should be run to update the apk/jar because the existing code
+ // is not relocated to match the boot image and does not have the
+ // necessary patch information to use patchoat.
+ // Matches Java: dalvik.system.DexFile.DEX2OAT_FOR_RELOCATION
+ kDex2OatForRelocation = 4,
+
+ // patchoat should be run to update the apk/jar.
+ // Matches Java: dalvik.system.DexFile.PATCHOAT_FOR_RELOCATION
+ kPatchoatForRelocation = 5,
};
enum OatStatus {
- // kOatOutOfDate - An oat file is said to be out of date if the file does
- // not exist, is out of date with respect to the dex file or boot image,
- // or does not meet the target compilation type.
- kOatOutOfDate,
+ // kOatCannotOpen - The oat file cannot be opened, because it does not
+ // exist, is unreadable, or otherwise corrupted.
+ kOatCannotOpen,
- // kOatNeedsRelocation - An oat file is said to need relocation if the
- // code is up to date, but not yet properly relocated for address space
- // layout randomization (ASLR). In this case, the oat file is neither
- // "out of date" nor "up to date".
- kOatNeedsRelocation,
+ // kOatDexOutOfDate - The oat file is out of date with respect to the dex file.
+ kOatDexOutOfDate,
- // kOatUpToDate - An oat file is said to be up to date if it is not out of
- // date and has been properly relocated for the purposes of ASLR.
+ // kOatBootImageOutOfDate - The oat file is up to date with respect to the
+ // dex file, but is out of date with respect to the boot image.
+ kOatBootImageOutOfDate,
+
+ // kOatRelocationOutOfDate - The oat file is up to date with respect to
+ // the dex file and boot image, but contains compiled code that has the
+ // wrong patch delta with respect to the boot image. Patchoat should be
+ // run on the oat file to update the patch delta of the compiled code to
+ // match the boot image.
+ kOatRelocationOutOfDate,
+
+ // kOatUpToDate - The oat file is completely up to date with respect to
+ // the dex file and boot image.
kOatUpToDate,
};
@@ -142,8 +157,10 @@
// dex location that is at least as good as an oat file generated with the
// given compiler filter. profile_changed should be true to indicate the
// profile has recently changed for this dex location.
- DexOptNeeded GetDexOptNeeded(CompilerFilter::Filter target_compiler_filter,
- bool profile_changed = false);
+ // Returns a positive status code if the status refers to the oat file in
+ // the oat location. Returns a negative status code if the status refers to
+ // the oat file in the odex location.
+ int GetDexOptNeeded(CompilerFilter::Filter target_compiler_filter, bool profile_changed = false);
// Returns true if there is up-to-date code for this dex location,
// irrespective of the compiler filter of the up-to-date code.
@@ -179,6 +196,10 @@
// the OatFileAssistant object.
std::unique_ptr<OatFile> GetBestOatFile();
+ // Returns a human readable description of the status of the code for the
+ // dex file. The returned description is for debugging purposes only.
+ std::string GetStatusDump();
+
// Open and returns an image space associated with the oat file.
static std::unique_ptr<gc::space::ImageSpace> OpenImageSpace(const OatFile* oat_file);
@@ -205,43 +226,16 @@
// really an oat file. The odex file will often, but not always, have a
// patch delta of 0 and need to be relocated before use for the purposes of
// ASLR. The odex file is treated as if it were read-only.
- // These methods return the location and status of the odex file for the dex
- // location.
- // Notes:
- // * OdexFileName may return null if the odex file name could not be
- // determined.
- const std::string* OdexFileName();
- bool OdexFileExists();
+ //
+ // Returns the status of the odex file for the dex location.
OatStatus OdexFileStatus();
- bool OdexFileIsOutOfDate();
- bool OdexFileNeedsRelocation();
- bool OdexFileIsUpToDate();
- // Must only be called if the associated odex file exists, i.e, if
- // |OdexFileExists() == true|.
- CompilerFilter::Filter OdexFileCompilerFilter();
// When the dex files is compiled on the target device, the oat file is the
// result. The oat file will have been relocated to some
// (possibly-out-of-date) offset for ASLR.
- // These methods return the location and status of the target oat file for
- // the dex location.
//
- // Notes:
- // * OatFileName may return null if the oat file name could not be
- // determined.
- const std::string* OatFileName();
- bool OatFileExists();
+ // Returns the status of the oat file for the dex location.
OatStatus OatFileStatus();
- bool OatFileIsOutOfDate();
- bool OatFileNeedsRelocation();
- bool OatFileIsUpToDate();
- // Must only be called if the associated oat file exists, i.e, if
- // |OatFileExists() == true|.
- CompilerFilter::Filter OatFileCompilerFilter();
-
- // Return the status for a given opened oat file with respect to the dex
- // location.
- OatStatus GivenOatFileStatus(const OatFile& file);
// Generates the oat file by relocation from the named input file.
// This does not check the current status before attempting to relocate the
@@ -311,29 +305,39 @@
// Initially the info is for no file in particular. It will treat the
// file as out of date until Reset is called with a real filename to use
// the cache for.
- explicit OatFileInfo(OatFileAssistant* oat_file_assistant);
+ // Pass true for is_oat_location if the information associated with this
+ // OatFileInfo is for the oat location, as opposed to the odex location.
+ OatFileInfo(OatFileAssistant* oat_file_assistant, bool is_oat_location);
+
+ bool IsOatLocation();
const std::string* Filename();
- bool Exists();
+
+ // Returns true if this oat file can be used for running code. The oat
+ // file can be used for running code as long as it is not out of date with
+ // respect to the dex code or boot image. An oat file that is out of date
+ // with respect to relocation is considered useable, because it's possible
+ // to interpret the dex code rather than run the unrelocated compiled
+ // code.
+ bool IsUseable();
+
+ // Returns the status of this oat file.
OatStatus Status();
- bool IsOutOfDate();
- bool NeedsRelocation();
- bool IsUpToDate();
- // Must only be called if the associated file exists, i.e, if
- // |Exists() == true|.
- CompilerFilter::Filter CompilerFilter();
+
+ // Return the DexOptNeeded value for this oat file with respect to the
+ // given target_compilation_filter.
+ // profile_changed should be true to indicate the profile has recently
+ // changed for this dex location.
+ // If patchoat is needed, this function will return the kPatchOatNeeded
+ // status, not the kSelfPatchOatNeeded status.
+ DexOptNeeded GetDexOptNeeded(CompilerFilter::Filter target_compiler_filter,
+ bool profile_changed);
// Returns the loaded file.
// Loads the file if needed. Returns null if the file failed to load.
// The caller shouldn't clean up or free the returned pointer.
const OatFile* GetFile();
- // Returns true if the compiler filter used to generate the file is at
- // least as good as the given target filter. profile_changed should be
- // true to indicate the profile has recently changed for this dex
- // location.
- bool CompilerFilterIsOkay(CompilerFilter::Filter target, bool profile_changed);
-
// Returns true if the file is opened executable.
bool IsExecutable();
@@ -348,6 +352,23 @@
// file with the given filename.
void Reset(const std::string& filename);
+ // Release the loaded oat file for runtime use.
+ // Returns null if the oat file hasn't been loaded or is out of date.
+ // Ensures the returned file is not loaded executable if it has unuseable
+ // compiled code.
+ //
+ // After this call, no other methods of the OatFileInfo should be
+ // called, because access to the loaded oat file has been taken away from
+ // the OatFileInfo object.
+ std::unique_ptr<OatFile> ReleaseFileForUse();
+
+ private:
+ // Returns true if the compiler filter used to generate the file is at
+ // least as good as the given target filter. profile_changed should be
+ // true to indicate the profile has recently changed for this dex
+ // location.
+ bool CompilerFilterIsOkay(CompilerFilter::Filter target, bool profile_changed);
+
// Release the loaded oat file.
// Returns null if the oat file hasn't been loaded.
//
@@ -356,8 +377,8 @@
// the OatFileInfo object.
std::unique_ptr<OatFile> ReleaseFile();
- private:
OatFileAssistant* oat_file_assistant_;
+ const bool is_oat_location_;
bool filename_provided_ = false;
std::string filename_;
@@ -374,6 +395,13 @@
bool file_released_ = false;
};
+ // Return info for the best oat file.
+ OatFileInfo& GetBestInfo();
+
+ // Return the status for a given opened oat file with respect to the dex
+ // location.
+ OatStatus GivenOatFileStatus(const OatFile& file);
+
// Returns the current image location.
// Returns an empty string if the image location could not be retrieved.
//
diff --git a/runtime/oat_file_assistant_test.cc b/runtime/oat_file_assistant_test.cc
index d4337b9..26dbaab 100644
--- a/runtime/oat_file_assistant_test.cc
+++ b/runtime/oat_file_assistant_test.cc
@@ -20,6 +20,7 @@
#include <vector>
#include <sys/param.h>
+#include "android-base/strings.h"
#include <backtrace/BacktraceMap.h>
#include <gtest/gtest.h>
@@ -49,9 +50,9 @@
// Pre-Relocate the image to a known non-zero offset so we don't have to
// deal with the runtime randomly relocating the image by 0 and messing up
// the expected results of the tests.
- bool PreRelocateImage(std::string* error_msg) {
+ bool PreRelocateImage(const std::string& image_location, std::string* error_msg) {
std::string image;
- if (!GetCachedImageFile(&image, error_msg)) {
+ if (!GetCachedImageFile(image_location, &image, error_msg)) {
return false;
}
@@ -60,7 +61,7 @@
std::vector<std::string> argv;
argv.push_back(patchoat);
- argv.push_back("--input-image-location=" + GetImageLocation());
+ argv.push_back("--input-image-location=" + image_location);
argv.push_back("--output-image-file=" + image);
argv.push_back("--instruction-set=" + std::string(GetInstructionSetString(kRuntimeISA)));
argv.push_back("--base-offset-delta=0x00008000");
@@ -69,8 +70,8 @@
virtual void PreRuntimeCreate() {
std::string error_msg;
- ASSERT_TRUE(PreRelocateImage(&error_msg)) << error_msg;
-
+ ASSERT_TRUE(PreRelocateImage(GetImageLocation(), &error_msg)) << error_msg;
+ ASSERT_TRUE(PreRelocateImage(GetImageLocation2(), &error_msg)) << error_msg;
UnreserveImageSpace();
}
@@ -78,24 +79,32 @@
ReserveImageSpace();
}
- // Generate a non-PIC odex file for the purposes of test.
- // The generated odex file will be un-relocated.
- void GenerateOdexForTest(const std::string& dex_location,
- const std::string& odex_location,
- CompilerFilter::Filter filter,
- bool pic = false,
- bool with_patch_info = true) {
- // Temporarily redirect the dalvik cache so dex2oat doesn't find the
- // relocated image file.
+ // Generate an oat file for the purposes of test.
+ void GenerateOatForTest(const std::string& dex_location,
+ const std::string& oat_location,
+ CompilerFilter::Filter filter,
+ bool relocate,
+ bool pic,
+ bool with_patch_info,
+ bool with_alternate_image) {
std::string dalvik_cache = GetDalvikCache(GetInstructionSetString(kRuntimeISA));
std::string dalvik_cache_tmp = dalvik_cache + ".redirected";
- ASSERT_EQ(0, rename(dalvik_cache.c_str(), dalvik_cache_tmp.c_str())) << strerror(errno);
+
+ if (!relocate) {
+ // Temporarily redirect the dalvik cache so dex2oat doesn't find the
+ // relocated image file.
+ ASSERT_EQ(0, rename(dalvik_cache.c_str(), dalvik_cache_tmp.c_str())) << strerror(errno);
+ }
std::vector<std::string> args;
args.push_back("--dex-file=" + dex_location);
- args.push_back("--oat-file=" + odex_location);
+ args.push_back("--oat-file=" + oat_location);
args.push_back("--compiler-filter=" + CompilerFilter::NameOfFilter(filter));
args.push_back("--runtime-arg");
+
+ // Use -Xnorelocate regardless of the relocate argument.
+ // We control relocation by redirecting the dalvik cache when needed
+ // rather than use this flag.
args.push_back("-Xnorelocate");
if (pic) {
@@ -106,14 +115,22 @@
args.push_back("--include-patch-information");
}
+ std::string image_location = GetImageLocation();
+ if (with_alternate_image) {
+ args.push_back("--boot-image=" + GetImageLocation2());
+ }
+
std::string error_msg;
ASSERT_TRUE(OatFileAssistant::Dex2Oat(args, &error_msg)) << error_msg;
- ASSERT_EQ(0, rename(dalvik_cache_tmp.c_str(), dalvik_cache.c_str())) << strerror(errno);
- // Verify the odex file was generated as expected and really is
- // unrelocated.
- std::unique_ptr<OatFile> odex_file(OatFile::Open(odex_location.c_str(),
- odex_location.c_str(),
+ if (!relocate) {
+ // Restore the dalvik cache if needed.
+ ASSERT_EQ(0, rename(dalvik_cache_tmp.c_str(), dalvik_cache.c_str())) << strerror(errno);
+ }
+
+ // Verify the odex file was generated as expected.
+ std::unique_ptr<OatFile> odex_file(OatFile::Open(oat_location.c_str(),
+ oat_location.c_str(),
nullptr,
nullptr,
false,
@@ -125,24 +142,59 @@
EXPECT_EQ(with_patch_info, odex_file->HasPatchInfo());
EXPECT_EQ(filter, odex_file->GetCompilerFilter());
- if (CompilerFilter::IsBytecodeCompilationEnabled(filter)) {
- const std::vector<gc::space::ImageSpace*> image_spaces =
- Runtime::Current()->GetHeap()->GetBootImageSpaces();
- ASSERT_TRUE(!image_spaces.empty() && image_spaces[0] != nullptr);
- const ImageHeader& image_header = image_spaces[0]->GetImageHeader();
- const OatHeader& oat_header = odex_file->GetOatHeader();
- uint32_t combined_checksum = OatFileAssistant::CalculateCombinedImageChecksum();
- EXPECT_EQ(combined_checksum, oat_header.GetImageFileLocationOatChecksum());
- EXPECT_NE(reinterpret_cast<uintptr_t>(image_header.GetOatDataBegin()),
- oat_header.GetImageFileLocationOatDataBegin());
- EXPECT_NE(image_header.GetPatchDelta(), oat_header.GetImagePatchDelta());
+ std::unique_ptr<ImageHeader> image_header(
+ gc::space::ImageSpace::ReadImageHeader(image_location.c_str(),
+ kRuntimeISA,
+ &error_msg));
+ ASSERT_TRUE(image_header != nullptr) << error_msg;
+ const OatHeader& oat_header = odex_file->GetOatHeader();
+ uint32_t combined_checksum = OatFileAssistant::CalculateCombinedImageChecksum();
+
+ if (CompilerFilter::DependsOnImageChecksum(filter)) {
+ if (with_alternate_image) {
+ EXPECT_NE(combined_checksum, oat_header.GetImageFileLocationOatChecksum());
+ } else {
+ EXPECT_EQ(combined_checksum, oat_header.GetImageFileLocationOatChecksum());
+ }
}
+
+ if (CompilerFilter::IsBytecodeCompilationEnabled(filter)) {
+ if (relocate) {
+ EXPECT_EQ(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
+ oat_header.GetImageFileLocationOatDataBegin());
+ EXPECT_EQ(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
+ } else {
+ EXPECT_NE(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
+ oat_header.GetImageFileLocationOatDataBegin());
+ EXPECT_NE(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
+ }
+ }
+ }
+
+ // Generate a non-PIC odex file for the purposes of test.
+ // The generated odex file will be un-relocated.
+ void GenerateOdexForTest(const std::string& dex_location,
+ const std::string& odex_location,
+ CompilerFilter::Filter filter) {
+ GenerateOatForTest(dex_location,
+ odex_location,
+ filter,
+ /*relocate*/false,
+ /*pic*/false,
+ /*with_patch_info*/true,
+ /*with_alternate_image*/false);
}
void GeneratePicOdexForTest(const std::string& dex_location,
const std::string& odex_location,
CompilerFilter::Filter filter) {
- GenerateOdexForTest(dex_location, odex_location, filter, true, false);
+ GenerateOatForTest(dex_location,
+ odex_location,
+ filter,
+ /*relocate*/false,
+ /*pic*/true,
+ /*with_patch_info*/false,
+ /*with_alternate_image*/false);
}
// Generate a non-PIC odex file without patch information for the purposes
@@ -150,7 +202,43 @@
void GenerateNoPatchOdexForTest(const std::string& dex_location,
const std::string& odex_location,
CompilerFilter::Filter filter) {
- GenerateOdexForTest(dex_location, odex_location, filter, false, false);
+ GenerateOatForTest(dex_location,
+ odex_location,
+ filter,
+ /*relocate*/false,
+ /*pic*/false,
+ /*with_patch_info*/false,
+ /*with_alternate_image*/false);
+ }
+
+ // Generate an oat file in the oat location.
+ void GenerateOatForTest(const char* dex_location,
+ CompilerFilter::Filter filter,
+ bool relocate,
+ bool pic,
+ bool with_patch_info,
+ bool with_alternate_image) {
+ std::string oat_location;
+ std::string error_msg;
+ ASSERT_TRUE(OatFileAssistant::DexLocationToOatFilename(
+ dex_location, kRuntimeISA, &oat_location, &error_msg)) << error_msg;
+ GenerateOatForTest(dex_location,
+ oat_location,
+ filter,
+ relocate,
+ pic,
+ with_patch_info,
+ with_alternate_image);
+ }
+
+ // Generate a standard oat file in the oat location.
+ void GenerateOatForTest(const char* dex_location, CompilerFilter::Filter filter) {
+ GenerateOatForTest(dex_location,
+ filter,
+ /*relocate*/true,
+ /*pic*/false,
+ /*with_patch_info*/false,
+ /*with_alternate_image*/false);
}
private:
@@ -211,36 +299,6 @@
}
};
-// Generate an oat file for the purposes of test, as opposed to testing
-// generation of oat files.
-static void GenerateOatForTest(const char* dex_location, CompilerFilter::Filter filter) {
- // Use an oat file assistant to find the proper oat location.
- std::string oat_location;
- std::string error_msg;
- ASSERT_TRUE(OatFileAssistant::DexLocationToOatFilename(
- dex_location, kRuntimeISA, &oat_location, &error_msg)) << error_msg;
-
- std::vector<std::string> args;
- args.push_back("--dex-file=" + std::string(dex_location));
- args.push_back("--oat-file=" + oat_location);
- args.push_back("--compiler-filter=" + CompilerFilter::NameOfFilter(filter));
- args.push_back("--runtime-arg");
- args.push_back("-Xnorelocate");
- ASSERT_TRUE(OatFileAssistant::Dex2Oat(args, &error_msg)) << error_msg;
-
- // Verify the oat file was generated as expected.
- std::unique_ptr<OatFile> oat_file(OatFile::Open(oat_location.c_str(),
- oat_location.c_str(),
- nullptr,
- nullptr,
- false,
- /*low_4gb*/false,
- dex_location,
- &error_msg));
- ASSERT_TRUE(oat_file.get() != nullptr) << error_msg;
- EXPECT_EQ(filter, oat_file->GetCompilerFilter());
-}
-
// Case: We have a DEX file, but no OAT file for it.
// Expect: The status is kDex2OatNeeded.
TEST_F(OatFileAssistantTest, DexNoOat) {
@@ -249,26 +307,18 @@
OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, false);
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kVerifyAtRuntime));
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kInterpretOnly));
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeedProfile));
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_FALSE(oat_file_assistant.OdexFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileNeedsRelocation());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_EQ(OatFileAssistant::kOatOutOfDate, oat_file_assistant.OdexFileStatus());
- EXPECT_FALSE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileNeedsRelocation());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
- EXPECT_EQ(OatFileAssistant::kOatOutOfDate, oat_file_assistant.OatFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
}
@@ -307,17 +357,11 @@
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kInterpretOnly));
EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kVerifyAtRuntime));
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatForFilter,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kEverything));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_FALSE(oat_file_assistant.OdexFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OatFileExists());
- EXPECT_FALSE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileNeedsRelocation());
- EXPECT_TRUE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
EXPECT_EQ(OatFileAssistant::kOatUpToDate, oat_file_assistant.OatFileStatus());
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
}
@@ -337,17 +381,12 @@
OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, false);
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_TRUE(oat_file_assistant.OdexFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_FALSE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileNeedsRelocation());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatDexOutOfDate, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
}
// Case: We have a DEX file and speed-profile OAT file for it.
@@ -364,19 +403,13 @@
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeedProfile, false));
EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kInterpretOnly, false));
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatForFilter,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeedProfile, true));
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatForFilter,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kInterpretOnly, true));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_FALSE(oat_file_assistant.OdexFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OatFileExists());
- EXPECT_FALSE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileNeedsRelocation());
- EXPECT_TRUE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
EXPECT_EQ(OatFileAssistant::kOatUpToDate, oat_file_assistant.OatFileStatus());
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
}
@@ -416,7 +449,7 @@
Copy(GetMultiDexSrc2(), dex_location);
OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, true);
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed, false));
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
}
@@ -453,10 +486,10 @@
EXPECT_EQ(2u, dex_files.size());
}
-// Case: We have a DEX file and out-of-date OAT file.
-// Expect: The status is kDex2OatNeeded.
-TEST_F(OatFileAssistantTest, OatOutOfDate) {
- std::string dex_location = GetScratchDir() + "/OatOutOfDate.jar";
+// Case: We have a DEX file and an OAT file out of date with respect to the
+// dex checksum.
+TEST_F(OatFileAssistantTest, OatDexOutOfDate) {
+ std::string dex_location = GetScratchDir() + "/OatDexOutOfDate.jar";
// We create a dex, generate an oat for it, then overwrite the dex with a
// different dex to make the oat out of date.
@@ -465,18 +498,68 @@
Copy(GetDexSrc2(), dex_location);
OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, false);
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kVerifyAtRuntime));
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_FALSE(oat_file_assistant.OdexFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatDexOutOfDate, oat_file_assistant.OatFileStatus());
+ EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
+}
+
+// Case: We have a DEX file and an OAT file out of date with respect to the
+// boot image.
+TEST_F(OatFileAssistantTest, OatImageOutOfDate) {
+ std::string dex_location = GetScratchDir() + "/OatImageOutOfDate.jar";
+
+ Copy(GetDexSrc1(), dex_location);
+ GenerateOatForTest(dex_location.c_str(),
+ CompilerFilter::kSpeed,
+ /*relocate*/true,
+ /*pic*/false,
+ /*with_patch_info*/false,
+ /*with_alternate_image*/true);
+
+ OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, false);
+ EXPECT_EQ(OatFileAssistant::kDex2OatForBootImage,
+ oat_file_assistant.GetDexOptNeeded(CompilerFilter::kVerifyAtRuntime));
+ EXPECT_EQ(OatFileAssistant::kDex2OatForBootImage,
+ oat_file_assistant.GetDexOptNeeded(CompilerFilter::kInterpretOnly));
+ EXPECT_EQ(OatFileAssistant::kDex2OatForBootImage,
+ oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
+
+ EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatBootImageOutOfDate, oat_file_assistant.OatFileStatus());
+ EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
+}
+
+// Case: We have a DEX file and a verify-at-runtime OAT file out of date with
+// respect to the boot image.
+// It shouldn't matter that the OAT file is out of date, because it is
+// verify-at-runtime.
+TEST_F(OatFileAssistantTest, OatVerifyAtRuntimeImageOutOfDate) {
+ std::string dex_location = GetScratchDir() + "/OatVerifyAtRuntimeImageOutOfDate.jar";
+
+ Copy(GetDexSrc1(), dex_location);
+ GenerateOatForTest(dex_location.c_str(),
+ CompilerFilter::kVerifyAtRuntime,
+ /*relocate*/true,
+ /*pic*/false,
+ /*with_patch_info*/false,
+ /*with_alternate_image*/true);
+
+ OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, false);
+ EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded,
+ oat_file_assistant.GetDexOptNeeded(CompilerFilter::kVerifyAtRuntime));
+ EXPECT_EQ(OatFileAssistant::kDex2OatForFilter,
+ oat_file_assistant.GetDexOptNeeded(CompilerFilter::kInterpretOnly));
+
+ EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatUpToDate, oat_file_assistant.OatFileStatus());
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
}
@@ -495,17 +578,12 @@
EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kVerifyAtRuntime));
- EXPECT_EQ(OatFileAssistant::kPatchOatNeeded,
+ EXPECT_EQ(-OatFileAssistant::kPatchoatForRelocation,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_TRUE(oat_file_assistant.OdexFileExists());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OdexFileNeedsRelocation());
- EXPECT_FALSE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatRelocationOutOfDate, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
// We should still be able to get the non-executable odex file to run from.
@@ -529,16 +607,12 @@
// Verify the status.
OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, true);
- EXPECT_EQ(OatFileAssistant::kPatchOatNeeded,
+ EXPECT_EQ(-OatFileAssistant::kPatchoatForRelocation,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_TRUE(oat_file_assistant.OdexFileExists());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_FALSE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatRelocationOutOfDate, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
EXPECT_FALSE(oat_file_assistant.HasOriginalDexFiles());
// Make the oat file up to date.
@@ -551,12 +625,8 @@
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_TRUE(oat_file_assistant.OdexFileExists());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OatFileExists());
- EXPECT_FALSE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_TRUE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatRelocationOutOfDate, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatUpToDate, oat_file_assistant.OatFileStatus());
EXPECT_FALSE(oat_file_assistant.HasOriginalDexFiles());
// Verify we can load the dex files from it.
@@ -590,19 +660,14 @@
EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kVerifyAtRuntime));
- EXPECT_EQ(OatFileAssistant::kPatchOatNeeded,
+ EXPECT_EQ(-OatFileAssistant::kPatchoatForRelocation,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded, // Can't run dex2oat because dex file is stripped.
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kEverything));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_TRUE(oat_file_assistant.OdexFileExists());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_TRUE(oat_file_assistant.OdexFileNeedsRelocation());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatRelocationOutOfDate, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatDexOutOfDate, oat_file_assistant.OatFileStatus());
EXPECT_FALSE(oat_file_assistant.HasOriginalDexFiles());
// Make the oat file up to date.
@@ -617,14 +682,8 @@
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kEverything));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_TRUE(oat_file_assistant.OdexFileExists());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_TRUE(oat_file_assistant.OdexFileNeedsRelocation());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OatFileExists());
- EXPECT_FALSE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileNeedsRelocation());
- EXPECT_TRUE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatRelocationOutOfDate, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatUpToDate, oat_file_assistant.OatFileStatus());
EXPECT_FALSE(oat_file_assistant.HasOriginalDexFiles());
// Verify we can load the dex files from it.
@@ -654,13 +713,8 @@
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kInterpretOnly));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_FALSE(oat_file_assistant.OdexFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileNeedsRelocation());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_FALSE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
EXPECT_FALSE(oat_file_assistant.HasOriginalDexFiles());
// Make the oat file up to date. This should have no effect.
@@ -673,13 +727,8 @@
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_FALSE(oat_file_assistant.OdexFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileNeedsRelocation());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_FALSE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
EXPECT_FALSE(oat_file_assistant.HasOriginalDexFiles());
}
@@ -699,20 +748,14 @@
EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kInterpretOnly));
- EXPECT_EQ(OatFileAssistant::kSelfPatchOatNeeded,
+ EXPECT_EQ(OatFileAssistant::kPatchoatForRelocation,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatForFilter,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kEverything));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_FALSE(oat_file_assistant.OdexFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileNeedsRelocation());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileNeedsRelocation());
- EXPECT_FALSE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatRelocationOutOfDate, oat_file_assistant.OatFileStatus());
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
// Make the oat file up to date.
@@ -725,14 +768,8 @@
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_FALSE(oat_file_assistant.OdexFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileNeedsRelocation());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OatFileExists());
- EXPECT_FALSE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileNeedsRelocation());
- EXPECT_TRUE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatUpToDate, oat_file_assistant.OatFileStatus());
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
std::unique_ptr<OatFile> oat_file = oat_file_assistant.GetBestOatFile();
@@ -757,7 +794,7 @@
OatFileAssistant oat_file_assistant(dex_location.c_str(),
oat_location.c_str(), kRuntimeISA, true);
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatForRelocation,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
// Make the oat file up to date.
@@ -778,7 +815,7 @@
// Case: We have a DEX file, an ODEX file and an OAT file, where the ODEX and
// OAT files both have patch delta of 0.
-// Expect: It shouldn't crash, and status is kPatchOatNeeded.
+// Expect: It shouldn't crash, and status is kSelfPatchOatNeeded.
TEST_F(OatFileAssistantTest, OdexOatOverlap) {
std::string dex_location = GetScratchDir() + "/OdexOatOverlap.jar";
std::string odex_location = GetOdexDir() + "/OdexOatOverlap.odex";
@@ -796,16 +833,15 @@
OatFileAssistant oat_file_assistant(dex_location.c_str(),
oat_location.c_str(), kRuntimeISA, true);
- EXPECT_EQ(OatFileAssistant::kPatchOatNeeded,
+ // kPatchoatForRelocation is expected rather than -kPatchoatForRelocation
+ // based on the assumption that the oat location is more up-to-date than the odex
+ // location, even if they both need relocation.
+ EXPECT_EQ(OatFileAssistant::kPatchoatForRelocation,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_TRUE(oat_file_assistant.OdexFileExists());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OatFileExists());
- EXPECT_FALSE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatRelocationOutOfDate, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatRelocationOutOfDate, oat_file_assistant.OatFileStatus());
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
// Things aren't relocated, so it should fall back to interpreted.
@@ -833,16 +869,12 @@
EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(-OatFileAssistant::kDex2OatForFilter,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kEverything));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_TRUE(oat_file_assistant.OdexFileExists());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_FALSE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatUpToDate, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
}
@@ -861,16 +893,12 @@
EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kVerifyAtRuntime));
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(-OatFileAssistant::kDex2OatForFilter,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_TRUE(oat_file_assistant.OdexFileExists());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_FALSE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatUpToDate, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
EXPECT_TRUE(oat_file_assistant.HasOriginalDexFiles());
}
@@ -958,7 +986,7 @@
// Verify it didn't create an oat in the default location.
OatFileAssistant ofm(dex_location.c_str(), kRuntimeISA, false);
- EXPECT_FALSE(ofm.OatFileExists());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, ofm.OatFileStatus());
}
// Case: We have a DEX file but can't write the oat file.
@@ -1030,7 +1058,7 @@
// Reverse again to get the right path order, and join to get the result.
std::reverse(target_path.begin(), target_path.end());
- return Join(target_path, '/');
+ return android::base::Join(target_path, '/');
}
// Case: Non-absolute path to Dex location.
@@ -1043,14 +1071,10 @@
OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, true);
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
- EXPECT_FALSE(oat_file_assistant.OdexFileExists());
- EXPECT_FALSE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
}
// Case: Very short, non-existent Dex location.
@@ -1063,12 +1087,8 @@
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
- EXPECT_FALSE(oat_file_assistant.OdexFileExists());
- EXPECT_FALSE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
EXPECT_FALSE(oat_file_assistant.HasOriginalDexFiles());
// Trying to make it up to date should have no effect.
@@ -1087,16 +1107,12 @@
OatFileAssistant oat_file_assistant(dex_location.c_str(), kRuntimeISA, false);
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatFromScratch,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
EXPECT_FALSE(oat_file_assistant.IsInBootClassPath());
- EXPECT_FALSE(oat_file_assistant.OdexFileExists());
- EXPECT_TRUE(oat_file_assistant.OdexFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OdexFileIsUpToDate());
- EXPECT_FALSE(oat_file_assistant.OatFileExists());
- EXPECT_TRUE(oat_file_assistant.OatFileIsOutOfDate());
- EXPECT_FALSE(oat_file_assistant.OatFileIsUpToDate());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OdexFileStatus());
+ EXPECT_EQ(OatFileAssistant::kOatCannotOpen, oat_file_assistant.OatFileStatus());
}
// A task to generate a dex location. Used by the RaceToGenerate test.
@@ -1119,7 +1135,7 @@
/*dex_elements*/nullptr,
&oat_file,
&error_msgs);
- CHECK(!dex_files.empty()) << Join(error_msgs, '\n');
+ CHECK(!dex_files.empty()) << android::base::Join(error_msgs, '\n');
CHECK(dex_files[0]->GetOatDexFile() != nullptr) << dex_files[0]->GetLocation();
loaded_oat_file_ = dex_files[0]->GetOatDexFile()->GetOatFile();
CHECK_EQ(loaded_oat_file_, oat_file);
@@ -1226,7 +1242,7 @@
oat_file_assistant.MakeUpToDate(false, &error_msg)) << error_msg;
EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kInterpretOnly));
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded,
+ EXPECT_EQ(OatFileAssistant::kDex2OatForFilter,
oat_file_assistant.GetDexOptNeeded(CompilerFilter::kSpeed));
Runtime::Current()->AddCompilerOption("--compiler-filter=speed");
@@ -1263,6 +1279,15 @@
// Verify the dexopt status values from dalvik.system.DexFile
// match the OatFileAssistant::DexOptStatus values.
TEST_F(OatFileAssistantTest, DexOptStatusValues) {
+ std::pair<OatFileAssistant::DexOptNeeded, const char*> mapping[] = {
+ {OatFileAssistant::kNoDexOptNeeded, "NO_DEXOPT_NEEDED"},
+ {OatFileAssistant::kDex2OatFromScratch, "DEX2OAT_FROM_SCRATCH"},
+ {OatFileAssistant::kDex2OatForBootImage, "DEX2OAT_FOR_BOOT_IMAGE"},
+ {OatFileAssistant::kDex2OatForFilter, "DEX2OAT_FOR_FILTER"},
+ {OatFileAssistant::kDex2OatForRelocation, "DEX2OAT_FOR_RELOCATION"},
+ {OatFileAssistant::kPatchoatForRelocation, "PATCHOAT_FOR_RELOCATION"}
+ };
+
ScopedObjectAccess soa(Thread::Current());
StackHandleScope<1> hs(soa.Self());
ClassLinker* linker = Runtime::Current()->GetClassLinker();
@@ -1271,35 +1296,16 @@
ASSERT_FALSE(dexfile.Get() == nullptr);
linker->EnsureInitialized(soa.Self(), dexfile, true, true);
- ArtField* no_dexopt_needed = mirror::Class::FindStaticField(
- soa.Self(), dexfile, "NO_DEXOPT_NEEDED", "I");
- ASSERT_FALSE(no_dexopt_needed == nullptr);
- EXPECT_EQ(no_dexopt_needed->GetTypeAsPrimitiveType(), Primitive::kPrimInt);
- EXPECT_EQ(OatFileAssistant::kNoDexOptNeeded, no_dexopt_needed->GetInt(dexfile.Get()));
-
- ArtField* dex2oat_needed = mirror::Class::FindStaticField(
- soa.Self(), dexfile, "DEX2OAT_NEEDED", "I");
- ASSERT_FALSE(dex2oat_needed == nullptr);
- EXPECT_EQ(dex2oat_needed->GetTypeAsPrimitiveType(), Primitive::kPrimInt);
- EXPECT_EQ(OatFileAssistant::kDex2OatNeeded, dex2oat_needed->GetInt(dexfile.Get()));
-
- ArtField* patchoat_needed = mirror::Class::FindStaticField(
- soa.Self(), dexfile, "PATCHOAT_NEEDED", "I");
- ASSERT_FALSE(patchoat_needed == nullptr);
- EXPECT_EQ(patchoat_needed->GetTypeAsPrimitiveType(), Primitive::kPrimInt);
- EXPECT_EQ(OatFileAssistant::kPatchOatNeeded, patchoat_needed->GetInt(dexfile.Get()));
-
- ArtField* self_patchoat_needed = mirror::Class::FindStaticField(
- soa.Self(), dexfile, "SELF_PATCHOAT_NEEDED", "I");
- ASSERT_FALSE(self_patchoat_needed == nullptr);
- EXPECT_EQ(self_patchoat_needed->GetTypeAsPrimitiveType(), Primitive::kPrimInt);
- EXPECT_EQ(OatFileAssistant::kSelfPatchOatNeeded, self_patchoat_needed->GetInt(dexfile.Get()));
+ for (std::pair<OatFileAssistant::DexOptNeeded, const char*> field : mapping) {
+ ArtField* art_field = mirror::Class::FindStaticField(
+ soa.Self(), dexfile.Get(), field.second, "I");
+ ASSERT_FALSE(art_field == nullptr);
+ EXPECT_EQ(art_field->GetTypeAsPrimitiveType(), Primitive::kPrimInt);
+ EXPECT_EQ(field.first, art_field->GetInt(dexfile.Get()));
+ }
}
// TODO: More Tests:
-// * Image checksum change is out of date for kIntepretOnly, but not
-// kVerifyAtRuntime. But target of kVerifyAtRuntime still says current
-// kInterpretOnly is out of date.
// * Test class linker falls back to unquickened dex for DexNoOat
// * Test class linker falls back to unquickened dex for MultiDexNoOat
// * Test using secondary isa
@@ -1313,5 +1319,4 @@
// because it's unrelocated and no dex2oat
// * Test unrelocated specific target compilation type can be relocated to
// make it up to date.
-
} // namespace art
diff --git a/runtime/oat_file_manager.cc b/runtime/oat_file_manager.cc
index 5641459..33bd0f3 100644
--- a/runtime/oat_file_manager.cc
+++ b/runtime/oat_file_manager.cc
@@ -20,6 +20,8 @@
#include <queue>
#include <vector>
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
#include "base/stl_util.h"
#include "base/systrace.h"
@@ -38,6 +40,8 @@
namespace art {
+using android::base::StringPrintf;
+
// If true, then we attempt to load the application image if it exists.
static constexpr bool kEnableAppImage = true;
diff --git a/runtime/oat_quick_method_header.h b/runtime/oat_quick_method_header.h
index ee5002f..3cdde5a 100644
--- a/runtime/oat_quick_method_header.h
+++ b/runtime/oat_quick_method_header.h
@@ -58,7 +58,7 @@
}
bool IsOptimized() const {
- return code_size_ != 0 && vmap_table_offset_ != 0;
+ return GetCodeSize() != 0 && vmap_table_offset_ != 0;
}
const void* GetOptimizedCodeInfoPtr() const {
@@ -67,6 +67,11 @@
return data;
}
+ uint8_t* GetOptimizedCodeInfoPtr() {
+ DCHECK(IsOptimized());
+ return code_ - vmap_table_offset_;
+ }
+
CodeInfo GetOptimizedCodeInfo() const {
return CodeInfo(GetOptimizedCodeInfoPtr());
}
@@ -76,7 +81,23 @@
}
uint32_t GetCodeSize() const {
- return code_size_;
+ return code_size_ & kCodeSizeMask;
+ }
+
+ const uint32_t* GetCodeSizeAddr() const {
+ return &code_size_;
+ }
+
+ uint32_t GetVmapTableOffset() const {
+ return vmap_table_offset_;
+ }
+
+ void SetVmapTableOffset(uint32_t offset) {
+ vmap_table_offset_ = offset;
+ }
+
+ const uint32_t* GetVmapTableOffsetAddr() const {
+ return &vmap_table_offset_;
}
const uint8_t* GetVmapTable() const {
@@ -91,7 +112,7 @@
// On Thumb-2, the pc is offset by one.
code_start++;
}
- return code_start <= pc && pc <= (code_start + code_size_);
+ return code_start <= pc && pc <= (code_start + GetCodeSize());
}
const uint8_t* GetEntryPoint() const {
@@ -125,11 +146,25 @@
uint32_t ToDexPc(ArtMethod* method, const uintptr_t pc, bool abort_on_failure = true) const;
+ void SetHasShouldDeoptimizeFlag() {
+ DCHECK_EQ(code_size_ & kShouldDeoptimizeMask, 0u);
+ code_size_ |= kShouldDeoptimizeMask;
+ }
+
+ bool HasShouldDeoptimizeFlag() const {
+ return (code_size_ & kShouldDeoptimizeMask) != 0;
+ }
+
+ private:
+ static constexpr uint32_t kShouldDeoptimizeMask = 0x80000000;
+ static constexpr uint32_t kCodeSizeMask = ~kShouldDeoptimizeMask;
+
// The offset in bytes from the start of the vmap table to the end of the header.
uint32_t vmap_table_offset_;
// The stack frame information.
QuickMethodFrameInfo frame_info_;
- // The code size in bytes.
+ // The code size in bytes. The highest bit is used to signify if the compiled
+ // code with the method header has should_deoptimize flag.
uint32_t code_size_;
// The actual code.
uint8_t code_[0];
diff --git a/runtime/obj_ptr.h b/runtime/obj_ptr.h
index d24c6fb..2da2ae5 100644
--- a/runtime/obj_ptr.h
+++ b/runtime/obj_ptr.h
@@ -51,27 +51,24 @@
REQUIRES_SHARED(Locks::mutator_lock_)
: reference_(0u) {}
- template <typename Type>
+ template <typename Type,
+ typename = typename std::enable_if<std::is_base_of<MirrorType, Type>::value>::type>
ALWAYS_INLINE ObjPtr(Type* ptr) // NOLINT
REQUIRES_SHARED(Locks::mutator_lock_)
: reference_(Encode(static_cast<MirrorType*>(ptr))) {
- static_assert(std::is_base_of<MirrorType, Type>::value,
- "Input type must be a subtype of the ObjPtr type");
}
- template <typename Type>
+ template <typename Type,
+ typename = typename std::enable_if<std::is_base_of<MirrorType, Type>::value>::type>
ALWAYS_INLINE ObjPtr(const ObjPtr<Type, kPoison>& other) // NOLINT
REQUIRES_SHARED(Locks::mutator_lock_)
: reference_(Encode(static_cast<MirrorType*>(other.Ptr()))) {
- static_assert(std::is_base_of<MirrorType, Type>::value,
- "Input type must be a subtype of the ObjPtr type");
}
- template <typename Type>
+ template <typename Type,
+ typename = typename std::enable_if<std::is_base_of<MirrorType, Type>::value>::type>
ALWAYS_INLINE ObjPtr& operator=(const ObjPtr<Type, kPoison>& other)
REQUIRES_SHARED(Locks::mutator_lock_) {
- static_assert(std::is_base_of<MirrorType, Type>::value,
- "Input type must be a subtype of the ObjPtr type");
reference_ = Encode(static_cast<MirrorType*>(other.Ptr()));
return *this;
}
diff --git a/runtime/object_lock.cc b/runtime/object_lock.cc
index b8754a4..39ab52f 100644
--- a/runtime/object_lock.cc
+++ b/runtime/object_lock.cc
@@ -17,6 +17,7 @@
#include "object_lock.h"
#include "mirror/object-inl.h"
+#include "mirror/class_ext.h"
#include "monitor.h"
namespace art {
@@ -61,6 +62,7 @@
}
template class ObjectLock<mirror::Class>;
+template class ObjectLock<mirror::ClassExt>;
template class ObjectLock<mirror::Object>;
template class ObjectTryLock<mirror::Class>;
template class ObjectTryLock<mirror::Object>;
diff --git a/runtime/openjdkjvmti/Android.bp b/runtime/openjdkjvmti/Android.bp
index b323aef..0f9fbb2 100644
--- a/runtime/openjdkjvmti/Android.bp
+++ b/runtime/openjdkjvmti/Android.bp
@@ -24,6 +24,7 @@
"ti_heap.cc",
"ti_method.cc",
"ti_stack.cc",
+ "ti_redefine.cc",
"transform.cc"],
include_dirs: ["art/runtime"],
shared_libs: [
diff --git a/runtime/openjdkjvmti/OpenjdkJvmTi.cc b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
index 6480843..5f97b60 100644
--- a/runtime/openjdkjvmti/OpenjdkJvmTi.cc
+++ b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
@@ -40,15 +40,16 @@
#include "base/mutex.h"
#include "events-inl.h"
#include "jni_env_ext-inl.h"
-#include "object_tagging.h"
#include "obj_ptr-inl.h"
+#include "object_tagging.h"
#include "runtime.h"
#include "scoped_thread_state_change-inl.h"
-#include "thread_list.h"
#include "thread-inl.h"
+#include "thread_list.h"
#include "ti_class.h"
#include "ti_heap.h"
#include "ti_method.h"
+#include "ti_redefine.h"
#include "ti_stack.h"
#include "transform.h"
@@ -699,7 +700,7 @@
jmethodID method,
jint* entry_count_ptr,
jvmtiLineNumberEntry** table_ptr) {
- return ERR(NOT_IMPLEMENTED);
+ return MethodUtil::GetLineNumberTable(env, method, entry_count_ptr, table_ptr);
}
static jvmtiError GetMethodLocation(jvmtiEnv* env,
@@ -1141,6 +1142,34 @@
return RetransformClassesWithHook(reinterpret_cast<ArtJvmTiEnv*>(env), classes, hook);
}
+ static jvmtiError RedefineClassDirect(ArtJvmTiEnv* env,
+ jclass klass,
+ jint dex_size,
+ unsigned char* dex_file) {
+ if (!IsValidEnv(env)) {
+ return ERR(INVALID_ENVIRONMENT);
+ }
+ jvmtiError ret = OK;
+ std::string location;
+ if ((ret = GetClassLocation(env, klass, &location)) != OK) {
+ // TODO Do something more here? Maybe give log statements?
+ return ret;
+ }
+ std::string error;
+ ret = Redefiner::RedefineClass(env,
+ art::Runtime::Current(),
+ art::Thread::Current(),
+ klass,
+ location,
+ dex_size,
+ reinterpret_cast<uint8_t*>(dex_file),
+ &error);
+ if (ret != OK) {
+ LOG(ERROR) << "FAILURE TO REDEFINE " << error;
+ }
+ return ret;
+ }
+
// TODO This will be called by the event handler for the art::ti Event Load Event
static jvmtiError RetransformClassesWithHook(ArtJvmTiEnv* env,
const std::vector<jclass>& classes,
@@ -1148,6 +1177,8 @@
if (!IsValidEnv(env)) {
return ERR(INVALID_ENVIRONMENT);
}
+ jvmtiError res = OK;
+ std::string error;
for (jclass klass : classes) {
JNIEnv* jni_env = nullptr;
jobject loader = nullptr;
@@ -1183,11 +1214,22 @@
/*out*/&new_dex_data);
// Check if anything actually changed.
if ((new_data_len != 0 || new_dex_data != nullptr) && new_dex_data != dex_data) {
- MoveTransformedFileIntoRuntime(klass, std::move(location), new_data_len, new_dex_data);
+ res = Redefiner::RedefineClass(env,
+ art::Runtime::Current(),
+ art::Thread::Current(),
+ klass,
+ location,
+ new_data_len,
+ new_dex_data,
+ &error);
env->Deallocate(new_dex_data);
}
// Deallocate the old dex data.
env->Deallocate(dex_data);
+ if (res != OK) {
+ LOG(ERROR) << "FAILURE TO REDEFINE " << error;
+ return res;
+ }
}
return OK;
}
@@ -1238,7 +1280,10 @@
reinterpret_cast<void*>(JvmtiFunctions::RetransformClassWithHook),
// nullptr, // reserved1
JvmtiFunctions::SetEventNotificationMode,
- nullptr, // reserved3
+ // SPECIAL FUNCTION: RedefineClassDirect Is normally reserved3
+ // TODO Remove once we have events working.
+ reinterpret_cast<void*>(JvmtiFunctions::RedefineClassDirect),
+ // nullptr, // reserved3
JvmtiFunctions::GetAllThreads,
JvmtiFunctions::SuspendThread,
JvmtiFunctions::ResumeThread,
diff --git a/runtime/openjdkjvmti/ti_heap.cc b/runtime/openjdkjvmti/ti_heap.cc
index 0eff469..7b2521d 100644
--- a/runtime/openjdkjvmti/ti_heap.cc
+++ b/runtime/openjdkjvmti/ti_heap.cc
@@ -174,10 +174,11 @@
class FollowReferencesHelper FINAL {
public:
FollowReferencesHelper(HeapUtil* h,
- art::ObjPtr<art::mirror::Object> initial_object ATTRIBUTE_UNUSED,
+ art::ObjPtr<art::mirror::Object> initial_object,
const jvmtiHeapCallbacks* callbacks,
const void* user_data)
: tag_table_(h->GetTags()),
+ initial_object_(initial_object),
callbacks_(callbacks),
user_data_(user_data),
start_(0),
@@ -187,13 +188,23 @@
void Init()
REQUIRES_SHARED(art::Locks::mutator_lock_)
REQUIRES(!*tag_table_->GetAllowDisallowLock()) {
- CollectAndReportRootsVisitor carrv(this, tag_table_, &worklist_, &visited_);
- art::Runtime::Current()->VisitRoots(&carrv);
- art::Runtime::Current()->VisitImageRoots(&carrv);
- stop_reports_ = carrv.IsStopReports();
+ if (initial_object_.IsNull()) {
+ CollectAndReportRootsVisitor carrv(this, tag_table_, &worklist_, &visited_);
- if (stop_reports_) {
- worklist_.clear();
+ // We need precise info (e.g., vregs).
+ constexpr art::VisitRootFlags kRootFlags = static_cast<art::VisitRootFlags>(
+ art::VisitRootFlags::kVisitRootFlagAllRoots | art::VisitRootFlags::kVisitRootFlagPrecise);
+ art::Runtime::Current()->VisitRoots(&carrv, kRootFlags);
+
+ art::Runtime::Current()->VisitImageRoots(&carrv);
+ stop_reports_ = carrv.IsStopReports();
+
+ if (stop_reports_) {
+ worklist_.clear();
+ }
+ } else {
+ visited_.insert(initial_object_.Ptr());
+ worklist_.push_back(initial_object_.Ptr());
}
}
@@ -269,6 +280,12 @@
ReportRoot(root_obj, info);
}
+ // Remove NO_THREAD_SAFETY_ANALYSIS once ASSERT_CAPABILITY works correctly.
+ art::Thread* FindThread(const art::RootInfo& info) NO_THREAD_SAFETY_ANALYSIS {
+ art::Locks::thread_list_lock_->AssertExclusiveHeld(art::Thread::Current());
+ return art::Runtime::Current()->GetThreadList()->FindThreadByThreadId(info.GetThreadId());
+ }
+
jvmtiHeapReferenceKind GetReferenceKind(const art::RootInfo& info,
jvmtiHeapReferenceInfo* ref_info)
REQUIRES_SHARED(art::Locks::mutator_lock_) {
@@ -280,10 +297,66 @@
return JVMTI_HEAP_REFERENCE_JNI_GLOBAL;
case art::RootType::kRootJNILocal:
+ {
+ uint32_t thread_id = info.GetThreadId();
+ ref_info->jni_local.thread_id = thread_id;
+
+ art::Thread* thread = FindThread(info);
+ if (thread != nullptr) {
+ art::mirror::Object* thread_obj = thread->GetPeer();
+ if (thread->IsStillStarting()) {
+ thread_obj = nullptr;
+ } else {
+ thread_obj = thread->GetPeer();
+ }
+ if (thread_obj != nullptr) {
+ ref_info->jni_local.thread_tag = tag_table_->GetTagOrZero(thread_obj);
+ }
+ }
+
+ // TODO: We don't have this info.
+ if (thread != nullptr) {
+ ref_info->jni_local.depth = 0;
+ art::ArtMethod* method = thread->GetCurrentMethod(nullptr, false /* abort_on_error */);
+ if (method != nullptr) {
+ ref_info->jni_local.method = art::jni::EncodeArtMethod(method);
+ }
+ }
+
return JVMTI_HEAP_REFERENCE_JNI_LOCAL;
+ }
case art::RootType::kRootJavaFrame:
+ {
+ uint32_t thread_id = info.GetThreadId();
+ ref_info->stack_local.thread_id = thread_id;
+
+ art::Thread* thread = FindThread(info);
+ if (thread != nullptr) {
+ art::mirror::Object* thread_obj = thread->GetPeer();
+ if (thread->IsStillStarting()) {
+ thread_obj = nullptr;
+ } else {
+ thread_obj = thread->GetPeer();
+ }
+ if (thread_obj != nullptr) {
+ ref_info->stack_local.thread_tag = tag_table_->GetTagOrZero(thread_obj);
+ }
+ }
+
+ auto& java_info = static_cast<const art::JavaFrameRootInfo&>(info);
+ ref_info->stack_local.slot = static_cast<jint>(java_info.GetVReg());
+ const art::StackVisitor* visitor = java_info.GetVisitor();
+ ref_info->stack_local.location =
+ static_cast<jlocation>(visitor->GetDexPc(false /* abort_on_failure */));
+ ref_info->stack_local.depth = static_cast<jint>(visitor->GetFrameDepth());
+ art::ArtMethod* method = visitor->GetMethod();
+ if (method != nullptr) {
+ ref_info->stack_local.method = art::jni::EncodeArtMethod(method);
+ }
+
return JVMTI_HEAP_REFERENCE_STACK_LOCAL;
+ }
case art::RootType::kRootNativeStack:
case art::RootType::kRootThreadBlock:
@@ -451,7 +524,7 @@
art::Handle<art::mirror::Class> h_klass(hs.NewHandle<art::mirror::Class>(klass));
for (size_t i = 0; i < h_klass->NumDirectInterfaces(); ++i) {
art::ObjPtr<art::mirror::Class> inf_klass =
- art::mirror::Class::GetDirectInterface(self, h_klass, i);
+ art::mirror::Class::ResolveDirectInterface(self, h_klass, i);
if (inf_klass == nullptr) {
// TODO: With a resolved class this should not happen...
self->ClearException();
@@ -583,6 +656,7 @@
}
ObjectTagTable* tag_table_;
+ art::ObjPtr<art::mirror::Object> initial_object_;
const jvmtiHeapCallbacks* callbacks_;
const void* user_data_;
@@ -613,20 +687,28 @@
}
art::Thread* self = art::Thread::Current();
- art::ScopedObjectAccess soa(self); // Now we know we have the shared lock.
- art::Runtime::Current()->GetHeap()->IncrementDisableMovingGC(self);
+ art::gc::Heap* heap = art::Runtime::Current()->GetHeap();
+ if (heap->IsGcConcurrentAndMoving()) {
+ // Need to take a heap dump while GC isn't running. See the
+ // comment in Heap::VisitObjects().
+ heap->IncrementDisableMovingGC(self);
+ }
{
- art::ObjPtr<art::mirror::Object> o_initial = soa.Decode<art::mirror::Object>(initial_object);
-
+ art::ScopedObjectAccess soa(self); // Now we know we have the shared lock.
art::ScopedThreadSuspension sts(self, art::kWaitingForVisitObjects);
art::ScopedSuspendAll ssa("FollowReferences");
- FollowReferencesHelper frh(this, o_initial, callbacks, user_data);
+ FollowReferencesHelper frh(this,
+ self->DecodeJObject(initial_object),
+ callbacks,
+ user_data);
frh.Init();
frh.Work();
}
- art::Runtime::Current()->GetHeap()->DecrementDisableMovingGC(self);
+ if (heap->IsGcConcurrentAndMoving()) {
+ heap->DecrementDisableMovingGC(self);
+ }
return ERR(NONE);
}
diff --git a/runtime/openjdkjvmti/ti_method.cc b/runtime/openjdkjvmti/ti_method.cc
index e391a9d..a0a0923 100644
--- a/runtime/openjdkjvmti/ti_method.cc
+++ b/runtime/openjdkjvmti/ti_method.cc
@@ -78,7 +78,9 @@
}
// TODO: Support generic signature.
- *generic_ptr = nullptr;
+ if (generic_ptr != nullptr) {
+ *generic_ptr = nullptr;
+ }
// Everything is fine, release the buffers.
name_copy.release();
@@ -128,4 +130,63 @@
return ERR(NONE);
}
+using LineNumberContext = std::vector<jvmtiLineNumberEntry>;
+
+static bool CollectLineNumbers(void* void_context, const art::DexFile::PositionInfo& entry) {
+ LineNumberContext* context = reinterpret_cast<LineNumberContext*>(void_context);
+ jvmtiLineNumberEntry jvmti_entry = { static_cast<jlocation>(entry.address_),
+ static_cast<jint>(entry.line_) };
+ context->push_back(jvmti_entry);
+ return false; // Collect all, no early exit.
+}
+
+jvmtiError MethodUtil::GetLineNumberTable(jvmtiEnv* env,
+ jmethodID method,
+ jint* entry_count_ptr,
+ jvmtiLineNumberEntry** table_ptr) {
+ if (method == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+ art::ArtMethod* art_method = art::jni::DecodeArtMethod(method);
+ DCHECK(!art_method->IsRuntimeMethod());
+
+ const art::DexFile::CodeItem* code_item;
+ const art::DexFile* dex_file;
+ {
+ art::ScopedObjectAccess soa(art::Thread::Current());
+
+ if (art_method->IsProxyMethod()) {
+ return ERR(ABSENT_INFORMATION);
+ }
+ if (art_method->IsNative()) {
+ return ERR(NATIVE_METHOD);
+ }
+ if (entry_count_ptr == nullptr || table_ptr == nullptr) {
+ return ERR(NULL_POINTER);
+ }
+
+ code_item = art_method->GetCodeItem();
+ dex_file = art_method->GetDexFile();
+ DCHECK(code_item != nullptr) << art_method->PrettyMethod() << " " << dex_file->GetLocation();
+ }
+
+ LineNumberContext context;
+ bool success = dex_file->DecodeDebugPositionInfo(code_item, CollectLineNumbers, &context);
+ if (!success) {
+ return ERR(ABSENT_INFORMATION);
+ }
+
+ unsigned char* data;
+ jlong mem_size = context.size() * sizeof(jvmtiLineNumberEntry);
+ jvmtiError alloc_error = env->Allocate(mem_size, &data);
+ if (alloc_error != ERR(NONE)) {
+ return alloc_error;
+ }
+ *table_ptr = reinterpret_cast<jvmtiLineNumberEntry*>(data);
+ memcpy(*table_ptr, context.data(), mem_size);
+ *entry_count_ptr = static_cast<jint>(context.size());
+
+ return ERR(NONE);
+}
+
} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_method.h b/runtime/openjdkjvmti/ti_method.h
index 43f11f9..fb2fbb2 100644
--- a/runtime/openjdkjvmti/ti_method.h
+++ b/runtime/openjdkjvmti/ti_method.h
@@ -52,6 +52,11 @@
static jvmtiError GetMethodModifiers(jvmtiEnv* env,
jmethodID method,
jint* modifiers_ptr);
+
+ static jvmtiError GetLineNumberTable(jvmtiEnv* env,
+ jmethodID method,
+ jint* entry_count_ptr,
+ jvmtiLineNumberEntry** table_ptr);
};
} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc
new file mode 100644
index 0000000..68815e7
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_redefine.cc
@@ -0,0 +1,550 @@
+/* Copyright (C) 2016 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_redefine.h"
+
+#include <limits>
+
+#include "android-base/stringprintf.h"
+
+#include "art_jvmti.h"
+#include "base/logging.h"
+#include "events-inl.h"
+#include "gc/allocation_listener.h"
+#include "instrumentation.h"
+#include "jni_env_ext-inl.h"
+#include "jvmti_allocator.h"
+#include "mirror/class.h"
+#include "mirror/class_ext.h"
+#include "mirror/object.h"
+#include "object_lock.h"
+#include "runtime.h"
+#include "ScopedLocalRef.h"
+
+namespace openjdkjvmti {
+
+using android::base::StringPrintf;
+
+// Moves dex data to an anonymous, read-only mmap'd region.
+std::unique_ptr<art::MemMap> Redefiner::MoveDataToMemMap(const std::string& original_location,
+ jint data_len,
+ unsigned char* dex_data,
+ std::string* error_msg) {
+ std::unique_ptr<art::MemMap> map(art::MemMap::MapAnonymous(
+ StringPrintf("%s-transformed", original_location.c_str()).c_str(),
+ nullptr,
+ data_len,
+ PROT_READ|PROT_WRITE,
+ /*low_4gb*/false,
+ /*reuse*/false,
+ error_msg));
+ if (map == nullptr) {
+ return map;
+ }
+ memcpy(map->Begin(), dex_data, data_len);
+ // Make the dex files mmap read only. This matches how other DexFiles are mmaped and prevents
+ // programs from corrupting it.
+ map->Protect(PROT_READ);
+ return map;
+}
+
+jvmtiError Redefiner::RedefineClass(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ jclass klass,
+ const std::string& original_dex_location,
+ jint data_len,
+ unsigned char* dex_data,
+ std::string* error_msg) {
+ std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location,
+ data_len,
+ dex_data,
+ error_msg));
+ std::ostringstream os;
+ char* generic_ptr_unused = nullptr;
+ char* signature_ptr = nullptr;
+ if (env->GetClassSignature(klass, &signature_ptr, &generic_ptr_unused) != OK) {
+ signature_ptr = const_cast<char*>("<UNKNOWN CLASS>");
+ }
+ if (map.get() == nullptr) {
+ os << "Failed to create anonymous mmap for modified dex file of class " << signature_ptr
+ << "in dex file " << original_dex_location << " because: " << *error_msg;
+ *error_msg = os.str();
+ return ERR(OUT_OF_MEMORY);
+ }
+ if (map->Size() < sizeof(art::DexFile::Header)) {
+ *error_msg = "Could not read dex file header because dex_data was too short";
+ return ERR(INVALID_CLASS_FORMAT);
+ }
+ uint32_t checksum = reinterpret_cast<const art::DexFile::Header*>(map->Begin())->checksum_;
+ std::unique_ptr<const art::DexFile> dex_file(art::DexFile::Open(map->GetName(),
+ checksum,
+ std::move(map),
+ /*verify*/true,
+ /*verify_checksum*/true,
+ error_msg));
+ if (dex_file.get() == nullptr) {
+ os << "Unable to load modified dex file for " << signature_ptr << ": " << *error_msg;
+ *error_msg = os.str();
+ return ERR(INVALID_CLASS_FORMAT);
+ }
+ // Get shared mutator lock.
+ art::ScopedObjectAccess soa(self);
+ art::StackHandleScope<1> hs(self);
+ Redefiner r(runtime, self, klass, signature_ptr, dex_file, error_msg);
+ // Lock around this class to avoid races.
+ art::ObjectLock<art::mirror::Class> lock(self, hs.NewHandle(r.GetMirrorClass()));
+ return r.Run();
+}
+
+// TODO *MAJOR* This should return the actual source java.lang.DexFile object for the klass.
+// TODO Make mirror of DexFile and associated types to make this less hellish.
+// TODO Make mirror of BaseDexClassLoader and associated types to make this less hellish.
+art::mirror::Object* Redefiner::FindSourceDexFileObject(
+ art::Handle<art::mirror::ClassLoader> loader) {
+ const char* dex_path_list_element_array_name = "[Ldalvik/system/DexPathList$Element;";
+ const char* dex_path_list_element_name = "Ldalvik/system/DexPathList$Element;";
+ const char* dex_file_name = "Ldalvik/system/DexFile;";
+ const char* dex_path_list_name = "Ldalvik/system/DexPathList;";
+ const char* dex_class_loader_name = "Ldalvik/system/BaseDexClassLoader;";
+
+ CHECK(!self_->IsExceptionPending());
+ art::StackHandleScope<11> hs(self_);
+ art::ClassLinker* class_linker = runtime_->GetClassLinker();
+
+ art::Handle<art::mirror::ClassLoader> null_loader(hs.NewHandle<art::mirror::ClassLoader>(
+ nullptr));
+ art::Handle<art::mirror::Class> base_dex_loader_class(hs.NewHandle(class_linker->FindClass(
+ self_, dex_class_loader_name, null_loader)));
+
+ // Get all the ArtFields so we can look in the BaseDexClassLoader
+ art::ArtField* path_list_field = base_dex_loader_class->FindDeclaredInstanceField(
+ "pathList", dex_path_list_name);
+ CHECK(path_list_field != nullptr);
+
+ art::ArtField* dex_path_list_element_field =
+ class_linker->FindClass(self_, dex_path_list_name, null_loader)
+ ->FindDeclaredInstanceField("dexElements", dex_path_list_element_array_name);
+ CHECK(dex_path_list_element_field != nullptr);
+
+ art::ArtField* element_dex_file_field =
+ class_linker->FindClass(self_, dex_path_list_element_name, null_loader)
+ ->FindDeclaredInstanceField("dexFile", dex_file_name);
+ CHECK(element_dex_file_field != nullptr);
+
+ // Check if loader is a BaseDexClassLoader
+ art::Handle<art::mirror::Class> loader_class(hs.NewHandle(loader->GetClass()));
+ if (!loader_class->IsSubClass(base_dex_loader_class.Get())) {
+ LOG(ERROR) << "The classloader is not a BaseDexClassLoader which is currently the only "
+ << "supported class loader type!";
+ return nullptr;
+ }
+ // Start navigating the fields of the loader (now known to be a BaseDexClassLoader derivative)
+ art::Handle<art::mirror::Object> path_list(
+ hs.NewHandle(path_list_field->GetObject(loader.Get())));
+ CHECK(path_list.Get() != nullptr);
+ CHECK(!self_->IsExceptionPending());
+ art::Handle<art::mirror::ObjectArray<art::mirror::Object>> dex_elements_list(hs.NewHandle(
+ dex_path_list_element_field->GetObject(path_list.Get())->
+ AsObjectArray<art::mirror::Object>()));
+ CHECK(!self_->IsExceptionPending());
+ CHECK(dex_elements_list.Get() != nullptr);
+ size_t num_elements = dex_elements_list->GetLength();
+ art::MutableHandle<art::mirror::Object> current_element(
+ hs.NewHandle<art::mirror::Object>(nullptr));
+ art::MutableHandle<art::mirror::Object> first_dex_file(
+ hs.NewHandle<art::mirror::Object>(nullptr));
+ // Iterate over the DexPathList$Element to find the right one
+ // TODO Or not ATM just return the first one.
+ for (size_t i = 0; i < num_elements; i++) {
+ current_element.Assign(dex_elements_list->Get(i));
+ CHECK(current_element.Get() != nullptr);
+ CHECK(!self_->IsExceptionPending());
+ CHECK(dex_elements_list.Get() != nullptr);
+ CHECK_EQ(current_element->GetClass(), class_linker->FindClass(self_,
+ dex_path_list_element_name,
+ null_loader));
+ // TODO It would be cleaner to put the art::DexFile into the dalvik.system.DexFile the class
+ // comes from but it is more annoying because we would need to find this class. It is not
+ // necessary for proper function since we just need to be in front of the classes old dex file
+ // in the path.
+ first_dex_file.Assign(element_dex_file_field->GetObject(current_element.Get()));
+ if (first_dex_file.Get() != nullptr) {
+ return first_dex_file.Get();
+ }
+ }
+ return nullptr;
+}
+
+art::mirror::Class* Redefiner::GetMirrorClass() {
+ return self_->DecodeJObject(klass_)->AsClass();
+}
+
+art::mirror::ClassLoader* Redefiner::GetClassLoader() {
+ return GetMirrorClass()->GetClassLoader();
+}
+
+art::mirror::DexCache* Redefiner::CreateNewDexCache(art::Handle<art::mirror::ClassLoader> loader) {
+ return runtime_->GetClassLinker()->RegisterDexFile(*dex_file_, loader.Get());
+}
+
+// TODO Really wishing I had that mirror of java.lang.DexFile now.
+art::mirror::LongArray* Redefiner::AllocateDexFileCookie(
+ art::Handle<art::mirror::Object> java_dex_file_obj) {
+ art::StackHandleScope<2> hs(self_);
+ // mCookie is nulled out if the DexFile has been closed but mInternalCookie sticks around until
+ // the object is finalized. Since they always point to the same array if mCookie is not null we
+ // just use the mInternalCookie field. We will update one or both of these fields later.
+ // TODO Should I get the class from the classloader or directly?
+ art::ArtField* internal_cookie_field = java_dex_file_obj->GetClass()->FindDeclaredInstanceField(
+ "mInternalCookie", "Ljava/lang/Object;");
+ // TODO Add check that mCookie is either null or same as mInternalCookie
+ CHECK(internal_cookie_field != nullptr);
+ art::Handle<art::mirror::LongArray> cookie(
+ hs.NewHandle(internal_cookie_field->GetObject(java_dex_file_obj.Get())->AsLongArray()));
+ // TODO Maybe make these non-fatal.
+ CHECK(cookie.Get() != nullptr);
+ CHECK_GE(cookie->GetLength(), 1);
+ art::Handle<art::mirror::LongArray> new_cookie(
+ hs.NewHandle(art::mirror::LongArray::Alloc(self_, cookie->GetLength() + 1)));
+ if (new_cookie.Get() == nullptr) {
+ self_->AssertPendingOOMException();
+ return nullptr;
+ }
+ // Copy the oat-dex field at the start.
+ // TODO Should I clear this field?
+ // TODO This is a really crappy thing here with the first element being different.
+ new_cookie->SetWithoutChecks<false>(0, cookie->GetWithoutChecks(0));
+ new_cookie->SetWithoutChecks<false>(
+ 1, static_cast<int64_t>(reinterpret_cast<intptr_t>(dex_file_.get())));
+ new_cookie->Memcpy(2, cookie.Get(), 1, cookie->GetLength() - 1);
+ return new_cookie.Get();
+}
+
+void Redefiner::RecordFailure(jvmtiError result, const std::string& error_msg) {
+ *error_msg_ = StringPrintf("Unable to perform redefinition of '%s': %s",
+ class_sig_,
+ error_msg.c_str());
+ result_ = result;
+}
+
+bool Redefiner::FinishRemainingAllocations(
+ /*out*/art::MutableHandle<art::mirror::ClassLoader>* source_class_loader,
+ /*out*/art::MutableHandle<art::mirror::Object>* java_dex_file_obj,
+ /*out*/art::MutableHandle<art::mirror::LongArray>* new_dex_file_cookie,
+ /*out*/art::MutableHandle<art::mirror::DexCache>* new_dex_cache) {
+ art::StackHandleScope<4> hs(self_);
+ // This shouldn't allocate
+ art::Handle<art::mirror::ClassLoader> loader(hs.NewHandle(GetClassLoader()));
+ if (loader.Get() == nullptr) {
+ // TODO Better error msg.
+ RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
+ return false;
+ }
+ art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(FindSourceDexFileObject(loader)));
+ if (dex_file_obj.Get() == nullptr) {
+ // TODO Better error msg.
+ RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
+ return false;
+ }
+ art::Handle<art::mirror::LongArray> new_cookie(hs.NewHandle(AllocateDexFileCookie(dex_file_obj)));
+ if (new_cookie.Get() == nullptr) {
+ self_->AssertPendingOOMException();
+ self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate dex file array for class loader");
+ return false;
+ }
+ art::Handle<art::mirror::DexCache> dex_cache(hs.NewHandle(CreateNewDexCache(loader)));
+ if (dex_cache.Get() == nullptr) {
+ self_->AssertPendingOOMException();
+ self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate DexCache");
+ return false;
+ }
+ source_class_loader->Assign(loader.Get());
+ java_dex_file_obj->Assign(dex_file_obj.Get());
+ new_dex_file_cookie->Assign(new_cookie.Get());
+ new_dex_cache->Assign(dex_cache.Get());
+ return true;
+}
+
+jvmtiError Redefiner::Run() {
+ art::StackHandleScope<5> hs(self_);
+ // TODO We might want to have a global lock (or one based on the class being redefined at least)
+ // in order to make cleanup easier. Not a huge deal though.
+ //
+ // First we just allocate the ClassExt and its fields that we need. These can be updated
+ // atomically without any issues (since we allocate the map arrays as empty) so we don't bother
+ // doing a try loop. The other allocations we need to ensure that nothing has changed in the time
+ // between allocating them and pausing all threads before we can update them so we need to do a
+ // try loop.
+ if (!EnsureRedefinitionIsValid() || !EnsureClassAllocationsFinished()) {
+ return result_;
+ }
+ art::MutableHandle<art::mirror::ClassLoader> source_class_loader(
+ hs.NewHandle<art::mirror::ClassLoader>(nullptr));
+ art::MutableHandle<art::mirror::Object> java_dex_file(
+ hs.NewHandle<art::mirror::Object>(nullptr));
+ art::MutableHandle<art::mirror::LongArray> new_dex_file_cookie(
+ hs.NewHandle<art::mirror::LongArray>(nullptr));
+ art::MutableHandle<art::mirror::DexCache> new_dex_cache(
+ hs.NewHandle<art::mirror::DexCache>(nullptr));
+ if (!FinishRemainingAllocations(&source_class_loader,
+ &java_dex_file,
+ &new_dex_file_cookie,
+ &new_dex_cache)) {
+ // TODO Null out the ClassExt fields we allocated (if possible, might be racing with another
+ // redefineclass call which made it even bigger. Leak shouldn't be huge (2x array of size
+ // declared_methods_.length) but would be good to get rid of.
+ // new_dex_file_cookie & new_dex_cache should be cleaned up by the GC.
+ return result_;
+ }
+ // Get the mirror class now that we aren't allocating anymore.
+ art::Handle<art::mirror::Class> art_class(hs.NewHandle(GetMirrorClass()));
+ // Enable assertion that this thread isn't interrupted during this installation.
+ // After this we will need to do real cleanup in case of failure. Prior to this we could simply
+ // return and would let everything get cleaned up or harmlessly leaked.
+ // Do transition to final suspension
+ // TODO We might want to give this its own suspended state!
+ // TODO This isn't right. We need to change state without any chance of suspend ideally!
+ self_->TransitionFromRunnableToSuspended(art::ThreadState::kNative);
+ runtime_->GetThreadList()->SuspendAll(
+ "Final installation of redefined Class!", /*long_suspend*/true);
+ // TODO Might want to move this into a different type.
+ // Now we reach the part where we must do active cleanup if something fails.
+ // TODO We should really Retry if this fails instead of simply aborting.
+ // Set the new DexFileCookie returns the original so we can fix it back up if redefinition fails
+ art::ObjPtr<art::mirror::LongArray> original_dex_file_cookie(nullptr);
+ if (!UpdateJavaDexFile(java_dex_file.Get(),
+ new_dex_file_cookie.Get(),
+ &original_dex_file_cookie)) {
+ // Release suspendAll
+ runtime_->GetThreadList()->ResumeAll();
+ // Get back shared mutator lock as expected for return.
+ self_->TransitionFromSuspendedToRunnable();
+ return result_;
+ }
+ if (!UpdateClass(art_class.Get(), new_dex_cache.Get())) {
+ // TODO Should have some form of scope to do this.
+ RestoreJavaDexFile(java_dex_file.Get(), original_dex_file_cookie);
+ // Release suspendAll
+ runtime_->GetThreadList()->ResumeAll();
+ // Get back shared mutator lock as expected for return.
+ self_->TransitionFromSuspendedToRunnable();
+ return result_;
+ }
+ // Update the ClassObjects Keep the old DexCache (and other stuff) around so we can restore
+ // functions/fields.
+ // Verify the new Class.
+ // Failure then undo updates to class
+ // Do stack walks and allocate obsolete methods
+ // Shrink the obsolete method maps if possible?
+ // TODO find appropriate class loader. Allocate new dex files array. Pause all java treads.
+ // Replace dex files array. Do stack scan + allocate obsoletes. Remove array if possible.
+ // TODO We might want to ensure that all threads are stopped for this!
+ // AddDexToClassPath();
+ // TODO
+ // Release suspendAll
+ // TODO Put this into a scoped thing.
+ runtime_->GetThreadList()->ResumeAll();
+ // Get back shared mutator lock as expected for return.
+ self_->TransitionFromSuspendedToRunnable();
+ // TODO Do this at a more reasonable place.
+ dex_file_.release();
+ return OK;
+}
+
+void Redefiner::RestoreJavaDexFile(art::ObjPtr<art::mirror::Object> java_dex_file,
+ art::ObjPtr<art::mirror::LongArray> orig_cookie) {
+ art::ArtField* internal_cookie_field = java_dex_file->GetClass()->FindDeclaredInstanceField(
+ "mInternalCookie", "Ljava/lang/Object;");
+ art::ArtField* cookie_field = java_dex_file->GetClass()->FindDeclaredInstanceField(
+ "mCookie", "Ljava/lang/Object;");
+ art::ObjPtr<art::mirror::LongArray> new_cookie(
+ cookie_field->GetObject(java_dex_file)->AsLongArray());
+ internal_cookie_field->SetObject<false>(java_dex_file, orig_cookie);
+ if (!new_cookie.IsNull()) {
+ cookie_field->SetObject<false>(java_dex_file, orig_cookie);
+ }
+}
+
+bool Redefiner::UpdateMethods(art::ObjPtr<art::mirror::Class> mclass,
+ art::ObjPtr<art::mirror::DexCache> new_dex_cache,
+ const art::DexFile::ClassDef& class_def) {
+ art::ClassLinker* linker = runtime_->GetClassLinker();
+ art::PointerSize image_pointer_size = linker->GetImagePointerSize();
+ const art::DexFile::TypeId& declaring_class_id = dex_file_->GetTypeId(class_def.class_idx_);
+ const art::DexFile& old_dex_file = mclass->GetDexFile();
+ // Update methods.
+ for (art::ArtMethod& method : mclass->GetMethods(image_pointer_size)) {
+ const art::DexFile::StringId* new_name_id = dex_file_->FindStringId(method.GetName());
+ art::dex::TypeIndex method_return_idx =
+ dex_file_->GetIndexForTypeId(*dex_file_->FindTypeId(method.GetReturnTypeDescriptor()));
+ const auto* old_type_list = method.GetParameterTypeList();
+ std::vector<art::dex::TypeIndex> new_type_list;
+ for (uint32_t i = 0; old_type_list != nullptr && i < old_type_list->Size(); i++) {
+ new_type_list.push_back(
+ dex_file_->GetIndexForTypeId(
+ *dex_file_->FindTypeId(
+ old_dex_file.GetTypeDescriptor(
+ old_dex_file.GetTypeId(
+ old_type_list->GetTypeItem(i).type_idx_)))));
+ }
+ const art::DexFile::ProtoId* proto_id = dex_file_->FindProtoId(method_return_idx,
+ new_type_list);
+ CHECK(proto_id != nullptr || old_type_list == nullptr);
+ // TODO Return false, cleanup.
+ const art::DexFile::MethodId* method_id = dex_file_->FindMethodId(declaring_class_id,
+ *new_name_id,
+ *proto_id);
+ CHECK(method_id != nullptr);
+ // TODO Return false, cleanup.
+ uint32_t dex_method_idx = dex_file_->GetIndexForMethodId(*method_id);
+ method.SetDexMethodIndex(dex_method_idx);
+ linker->SetEntryPointsToInterpreter(&method);
+ method.SetCodeItemOffset(dex_file_->FindCodeItemOffset(class_def, dex_method_idx));
+ method.SetDexCacheResolvedMethods(new_dex_cache->GetResolvedMethods(), image_pointer_size);
+ method.SetDexCacheResolvedTypes(new_dex_cache->GetResolvedTypes(), image_pointer_size);
+ }
+ return true;
+}
+
+bool Redefiner::UpdateFields(art::ObjPtr<art::mirror::Class> mclass) {
+ // TODO The IFields & SFields pointers should be combined like the methods_ arrays were.
+ for (auto fields_iter : {mclass->GetIFields(), mclass->GetSFields()}) {
+ for (art::ArtField& field : fields_iter) {
+ std::string declaring_class_name;
+ const art::DexFile::TypeId* new_declaring_id =
+ dex_file_->FindTypeId(field.GetDeclaringClass()->GetDescriptor(&declaring_class_name));
+ const art::DexFile::StringId* new_name_id = dex_file_->FindStringId(field.GetName());
+ const art::DexFile::TypeId* new_type_id = dex_file_->FindTypeId(field.GetTypeDescriptor());
+ // TODO Handle error, cleanup.
+ CHECK(new_name_id != nullptr && new_type_id != nullptr && new_declaring_id != nullptr);
+ const art::DexFile::FieldId* new_field_id =
+ dex_file_->FindFieldId(*new_declaring_id, *new_name_id, *new_type_id);
+ CHECK(new_field_id != nullptr);
+ // We only need to update the index since the other data in the ArtField cannot be updated.
+ field.SetDexFieldIndex(dex_file_->GetIndexForFieldId(*new_field_id));
+ }
+ }
+ return true;
+}
+
+// Performs updates to class that will allow us to verify it.
+bool Redefiner::UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
+ art::ObjPtr<art::mirror::DexCache> new_dex_cache) {
+ const art::DexFile::ClassDef* class_def = art::OatFile::OatDexFile::FindClassDef(
+ *dex_file_, class_sig_, art::ComputeModifiedUtf8Hash(class_sig_));
+ if (class_def == nullptr) {
+ RecordFailure(ERR(INVALID_CLASS_FORMAT), "Unable to find ClassDef!");
+ return false;
+ }
+ if (!UpdateMethods(mclass, new_dex_cache, *class_def)) {
+ // TODO Investigate appropriate error types.
+ RecordFailure(ERR(INTERNAL), "Unable to update class methods.");
+ return false;
+ }
+ if (!UpdateFields(mclass)) {
+ // TODO Investigate appropriate error types.
+ RecordFailure(ERR(INTERNAL), "Unable to update class fields.");
+ return false;
+ }
+
+ // Update the class fields.
+ // Need to update class last since the ArtMethod gets its DexFile from the class (which is needed
+ // to call GetReturnTypeDescriptor and GetParameterTypeList above).
+ mclass->SetDexCache(new_dex_cache.Ptr());
+ mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(*class_def));
+ mclass->SetDexTypeIndex(dex_file_->GetIndexForTypeId(*dex_file_->FindTypeId(class_sig_)));
+ return true;
+}
+
+bool Redefiner::UpdateJavaDexFile(art::ObjPtr<art::mirror::Object> java_dex_file,
+ art::ObjPtr<art::mirror::LongArray> new_cookie,
+ /*out*/art::ObjPtr<art::mirror::LongArray>* original_cookie) {
+ art::ArtField* internal_cookie_field = java_dex_file->GetClass()->FindDeclaredInstanceField(
+ "mInternalCookie", "Ljava/lang/Object;");
+ art::ArtField* cookie_field = java_dex_file->GetClass()->FindDeclaredInstanceField(
+ "mCookie", "Ljava/lang/Object;");
+ CHECK(internal_cookie_field != nullptr);
+ art::ObjPtr<art::mirror::LongArray> orig_internal_cookie(
+ internal_cookie_field->GetObject(java_dex_file)->AsLongArray());
+ art::ObjPtr<art::mirror::LongArray> orig_cookie(
+ cookie_field->GetObject(java_dex_file)->AsLongArray());
+ internal_cookie_field->SetObject<false>(java_dex_file, new_cookie);
+ *original_cookie = orig_internal_cookie;
+ if (!orig_cookie.IsNull()) {
+ cookie_field->SetObject<false>(java_dex_file, new_cookie);
+ }
+ return true;
+}
+
+// This function does all (java) allocations we need to do for the Class being redefined.
+// TODO Change this name maybe?
+bool Redefiner::EnsureClassAllocationsFinished() {
+ art::StackHandleScope<2> hs(self_);
+ art::Handle<art::mirror::Class> klass(hs.NewHandle(self_->DecodeJObject(klass_)->AsClass()));
+ if (klass.Get() == nullptr) {
+ RecordFailure(ERR(INVALID_CLASS), "Unable to decode class argument!");
+ return false;
+ }
+ // Allocate the classExt
+ art::Handle<art::mirror::ClassExt> ext(hs.NewHandle(klass->EnsureExtDataPresent(self_)));
+ if (ext.Get() == nullptr) {
+ // No memory. Clear exception (it's not useful) and return error.
+ // TODO This doesn't need to be fatal. We could just not support obsolete methods after hitting
+ // this case.
+ self_->AssertPendingOOMException();
+ self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Could not allocate ClassExt");
+ return false;
+ }
+ // Allocate the 2 arrays that make up the obsolete methods map. Since the contents of the arrays
+ // are only modified when all threads (other than the modifying one) are suspended we don't need
+ // to worry about missing the unsyncronized writes to the array. We do synchronize when setting it
+ // however, since that can happen at any time.
+ // TODO Clear these after we walk the stacks in order to free them in the (likely?) event there
+ // are no obsolete methods.
+ {
+ art::ObjectLock<art::mirror::ClassExt> lock(self_, ext);
+ if (!ext->ExtendObsoleteArrays(
+ self_, klass->GetDeclaredMethodsSlice(art::kRuntimePointerSize).size())) {
+ // OOM. Clear exception and return error.
+ self_->AssertPendingOOMException();
+ self_->ClearException();
+ RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate/extend obsolete methods map");
+ return false;
+ }
+ }
+ return true;
+}
+
+} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h
new file mode 100644
index 0000000..73cfc2b
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_redefine.h
@@ -0,0 +1,177 @@
+/* Copyright (C) 2016 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h. The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation. Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE. See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_REDEFINE_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_REDEFINE_H_
+
+#include <string>
+
+#include <jni.h>
+
+#include "art_jvmti.h"
+#include "art_method.h"
+#include "class_linker.h"
+#include "dex_file.h"
+#include "gc_root-inl.h"
+#include "globals.h"
+#include "jni_env_ext-inl.h"
+#include "jvmti.h"
+#include "linear_alloc.h"
+#include "mem_map.h"
+#include "mirror/array-inl.h"
+#include "mirror/array.h"
+#include "mirror/class-inl.h"
+#include "mirror/class.h"
+#include "mirror/class_loader-inl.h"
+#include "mirror/string-inl.h"
+#include "oat_file.h"
+#include "obj_ptr.h"
+#include "scoped_thread_state_change-inl.h"
+#include "stack.h"
+#include "thread_list.h"
+#include "transform.h"
+#include "utf.h"
+#include "utils/dex_cache_arrays_layout-inl.h"
+
+namespace openjdkjvmti {
+
+// Class that can redefine a single class's methods.
+class Redefiner {
+ public:
+ // Redefine the given class with the given dex data. Note this function does not take ownership of
+ // the dex_data pointer. It is not used after this call however and may be freed if desired.
+ // The caller is responsible for freeing it. The runtime makes its own copy of the data.
+ static jvmtiError RedefineClass(ArtJvmTiEnv* env,
+ art::Runtime* runtime,
+ art::Thread* self,
+ jclass klass,
+ const std::string& original_dex_location,
+ jint data_len,
+ unsigned char* dex_data,
+ std::string* error_msg);
+
+ private:
+ jvmtiError result_;
+ art::Runtime* runtime_;
+ art::Thread* self_;
+ // Kept as a jclass since we have weird run-state changes that make keeping it around as a
+ // mirror::Class difficult and confusing.
+ jclass klass_;
+ std::unique_ptr<const art::DexFile> dex_file_;
+ std::string* error_msg_;
+ char* class_sig_;
+
+ // TODO Maybe change jclass to a mirror::Class
+ Redefiner(art::Runtime* runtime,
+ art::Thread* self,
+ jclass klass,
+ char* class_sig,
+ std::unique_ptr<const art::DexFile>& redefined_dex_file,
+ std::string* error_msg)
+ : result_(ERR(INTERNAL)),
+ runtime_(runtime),
+ self_(self),
+ klass_(klass),
+ dex_file_(std::move(redefined_dex_file)),
+ error_msg_(error_msg),
+ class_sig_(class_sig) { }
+
+ static std::unique_ptr<art::MemMap> MoveDataToMemMap(const std::string& original_location,
+ jint data_len,
+ unsigned char* dex_data,
+ std::string* error_msg);
+
+ // TODO Put on all the lock qualifiers.
+ jvmtiError Run() REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ bool FinishRemainingAllocations(
+ /*out*/art::MutableHandle<art::mirror::ClassLoader>* source_class_loader,
+ /*out*/art::MutableHandle<art::mirror::Object>* source_dex_file_obj,
+ /*out*/art::MutableHandle<art::mirror::LongArray>* new_dex_file_cookie,
+ /*out*/art::MutableHandle<art::mirror::DexCache>* new_dex_cache)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ // Preallocates all needed allocations in klass so that we can pause execution safely.
+ // TODO We should be able to free the arrays if they end up not being used. Investigate doing this
+ // in the future. For now we will just take the memory hit.
+ bool EnsureClassAllocationsFinished() REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ art::mirror::ClassLoader* GetClassLoader() REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ // This finds the java.lang.DexFile we will add the native DexFile to as part of the classpath.
+ // TODO Make sure the DexFile object returned is the one that the klass_ actually comes from.
+ art::mirror::Object* FindSourceDexFileObject(art::Handle<art::mirror::ClassLoader> loader)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ art::mirror::Class* GetMirrorClass() REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ // Allocates and fills the new DexFileCookie
+ art::mirror::LongArray* AllocateDexFileCookie(art::Handle<art::mirror::Object> java_dex_file_obj)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ art::mirror::DexCache* CreateNewDexCache(art::Handle<art::mirror::ClassLoader> loader)
+ REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ void RecordFailure(jvmtiError result, const std::string& error_msg);
+
+ // TODO Actually write this.
+ // This will check that no constraints are violated (more than 1 class in dex file, any changes in
+ // number/declaration of methods & fields, changes in access flags, etc.)
+ bool EnsureRedefinitionIsValid() {
+ LOG(WARNING) << "Redefinition is not checked for validity currently";
+ return true;
+ }
+
+ bool UpdateJavaDexFile(art::ObjPtr<art::mirror::Object> java_dex_file,
+ art::ObjPtr<art::mirror::LongArray> new_cookie,
+ /*out*/art::ObjPtr<art::mirror::LongArray>* original_cookie)
+ REQUIRES(art::Locks::mutator_lock_);
+
+ void RestoreJavaDexFile(art::ObjPtr<art::mirror::Object> java_dex_file,
+ art::ObjPtr<art::mirror::LongArray> original_cookie)
+ REQUIRES(art::Locks::mutator_lock_);
+
+ bool UpdateFields(art::ObjPtr<art::mirror::Class> mclass)
+ REQUIRES(art::Locks::mutator_lock_);
+
+ bool UpdateMethods(art::ObjPtr<art::mirror::Class> mclass,
+ art::ObjPtr<art::mirror::DexCache> new_dex_cache,
+ const art::DexFile::ClassDef& class_def)
+ REQUIRES(art::Locks::mutator_lock_);
+
+ bool UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
+ art::ObjPtr<art::mirror::DexCache> new_dex_cache)
+ REQUIRES(art::Locks::mutator_lock_);
+};
+
+} // namespace openjdkjvmti
+
+#endif // ART_RUNTIME_OPENJDKJVMTI_TI_REDEFINE_H_
diff --git a/runtime/openjdkjvmti/ti_stack.cc b/runtime/openjdkjvmti/ti_stack.cc
index 6f8976f..579fb50 100644
--- a/runtime/openjdkjvmti/ti_stack.cc
+++ b/runtime/openjdkjvmti/ti_stack.cc
@@ -67,14 +67,10 @@
m = m->GetInterfaceMethodIfProxy(art::kRuntimePointerSize);
jmethodID id = art::jni::EncodeArtMethod(m);
- art::mirror::DexCache* dex_cache = m->GetDexCache();
- int32_t line_number = -1;
- if (dex_cache != nullptr) { // be tolerant of bad input
- const art::DexFile* dex_file = dex_cache->GetDexFile();
- line_number = art::annotations::GetLineNumFromPC(dex_file, m, GetDexPc(false));
- }
+ uint32_t dex_pc = GetDexPc(false);
+ jlong dex_location = (dex_pc == art::DexFile::kDexNoIndex) ? -1 : static_cast<jlong>(dex_pc);
- jvmtiFrameInfo info = { id, static_cast<jlong>(line_number) };
+ jvmtiFrameInfo info = { id, dex_location };
frames.push_back(info);
if (stop == 1) {
diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc
index fa2983c..f545125 100644
--- a/runtime/openjdkjvmti/transform.cc
+++ b/runtime/openjdkjvmti/transform.cc
@@ -29,10 +29,15 @@
* questions.
*/
+#include <unordered_map>
+#include <unordered_set>
+
#include "transform.h"
+#include "art_method.h"
#include "class_linker.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "gc_root-inl.h"
#include "globals.h"
#include "jni_env_ext-inl.h"
@@ -45,6 +50,7 @@
#include "mirror/string-inl.h"
#include "oat_file.h"
#include "scoped_thread_state_change-inl.h"
+#include "stack.h"
#include "thread_list.h"
#include "transform.h"
#include "utf.h"
@@ -52,196 +58,22 @@
namespace openjdkjvmti {
-static bool ReadChecksum(jint data_len, const unsigned char* dex, /*out*/uint32_t* res) {
- if (data_len < static_cast<jint>(sizeof(art::DexFile::Header))) {
- return false;
+jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location) {
+ JNIEnv* jni_env = nullptr;
+ jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(&jni_env), JNI_VERSION_1_1);
+ if (ret != JNI_OK) {
+ // TODO Different error might be better?
+ return ERR(INTERNAL);
}
- *res = reinterpret_cast<const art::DexFile::Header*>(dex)->checksum_;
- return true;
+ art::ScopedObjectAccess soa(jni_env);
+ art::StackHandleScope<1> hs(art::Thread::Current());
+ art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class>(klass)));
+ const art::DexFile& dex = hs_klass->GetDexFile();
+ *location = dex.GetLocation();
+ return OK;
}
-static std::unique_ptr<art::MemMap> MoveDataToMemMap(const std::string& original_location,
- jint data_len,
- unsigned char* dex_data) {
- std::string error_msg;
- std::unique_ptr<art::MemMap> map(art::MemMap::MapAnonymous(
- art::StringPrintf("%s-transformed", original_location.c_str()).c_str(),
- nullptr,
- data_len,
- PROT_READ|PROT_WRITE,
- /*low_4gb*/false,
- /*reuse*/false,
- &error_msg));
- if (map == nullptr) {
- return map;
- }
- memcpy(map->Begin(), dex_data, data_len);
- map->Protect(PROT_READ);
- return map;
-}
-
-static void InvalidateExistingMethods(art::Thread* self,
- art::Handle<art::mirror::Class> klass,
- art::Handle<art::mirror::DexCache> cache,
- const art::DexFile* dex_file)
- REQUIRES_SHARED(art::Locks::mutator_lock_) {
- // Create new DexCache with new DexFile.
- // reset dex_class_def_idx_
- // for each method reset entry_point_from_quick_compiled_code_ to bridge
- // for each method reset dex_code_item_offset_
- // for each method reset dex_method_index_
- // for each method set dex_cache_resolved_methods_ to new DexCache
- // for each method set dex_cache_resolved_types_ to new DexCache
- auto* runtime = art::Runtime::Current();
- art::ClassLinker* linker = runtime->GetClassLinker();
- art::PointerSize image_pointer_size = linker->GetImagePointerSize();
- std::string descriptor_storage;
- const char* descriptor = klass->GetDescriptor(&descriptor_storage);
- // Get the new class def
- const art::DexFile::ClassDef* class_def = art::OatFile::OatDexFile::FindClassDef(
- *dex_file, descriptor, art::ComputeModifiedUtf8Hash(descriptor));
- CHECK(class_def != nullptr);
- const art::DexFile::TypeId& declaring_class_id = dex_file->GetTypeId(class_def->class_idx_);
- art::StackHandleScope<6> hs(self);
- const art::DexFile& old_dex_file = klass->GetDexFile();
- for (art::ArtMethod& method : klass->GetMethods(image_pointer_size)) {
- // Find the code_item for the method then find the dex_method_index and dex_code_item_offset to
- // set.
- const art::DexFile::StringId* new_name_id = dex_file->FindStringId(method.GetName());
- uint16_t method_return_idx =
- dex_file->GetIndexForTypeId(*dex_file->FindTypeId(method.GetReturnTypeDescriptor()));
- const auto* old_type_list = method.GetParameterTypeList();
- std::vector<uint16_t> new_type_list;
- for (uint32_t i = 0; old_type_list != nullptr && i < old_type_list->Size(); i++) {
- new_type_list.push_back(
- dex_file->GetIndexForTypeId(
- *dex_file->FindTypeId(
- old_dex_file.GetTypeDescriptor(
- old_dex_file.GetTypeId(
- old_type_list->GetTypeItem(i).type_idx_)))));
- }
- const art::DexFile::ProtoId* proto_id = dex_file->FindProtoId(method_return_idx,
- new_type_list);
- CHECK(proto_id != nullptr || old_type_list == nullptr);
- const art::DexFile::MethodId* method_id = dex_file->FindMethodId(declaring_class_id,
- *new_name_id,
- *proto_id);
- CHECK(method_id != nullptr);
- uint32_t dex_method_idx = dex_file->GetIndexForMethodId(*method_id);
- method.SetDexMethodIndex(dex_method_idx);
- linker->SetEntryPointsToInterpreter(&method);
- method.SetCodeItemOffset(dex_file->FindCodeItemOffset(*class_def, dex_method_idx));
- method.SetDexCacheResolvedMethods(cache->GetResolvedMethods(), image_pointer_size);
- method.SetDexCacheResolvedTypes(cache->GetResolvedTypes(), image_pointer_size);
- }
-
- // Update the class fields.
- // Need to update class last since the ArtMethod gets its DexFile from the class (which is needed
- // to call GetReturnTypeDescriptor and GetParameterTypeList above).
- klass->SetDexCache(cache.Get());
- klass->SetDexCacheStrings(cache->GetStrings());
- klass->SetDexClassDefIndex(dex_file->GetIndexForClassDef(*class_def));
- klass->SetDexTypeIndex(dex_file->GetIndexForTypeId(*dex_file->FindTypeId(descriptor)));
-}
-
-// Adds the dex file.
-static art::mirror::LongArray* InsertDexFileIntoArray(art::Thread* self,
- const art::DexFile* dex,
- art::Handle<art::mirror::LongArray>& orig)
- REQUIRES_SHARED(art::Locks::mutator_lock_) {
- art::StackHandleScope<1> hs(self);
- CHECK_GE(orig->GetLength(), 1);
- art::Handle<art::mirror::LongArray> ret(
- hs.NewHandle(art::mirror::LongArray::Alloc(self, orig->GetLength() + 1)));
- CHECK(ret.Get() != nullptr);
- // Copy the oat-dex.
- // TODO Should I clear the oatdex element?
- ret->SetWithoutChecks<false>(0, orig->GetWithoutChecks(0));
- ret->SetWithoutChecks<false>(1, static_cast<int64_t>(reinterpret_cast<intptr_t>(dex)));
- ret->Memcpy(2, orig.Get(), 1, orig->GetLength() - 1);
- return ret.Get();
-}
-
-// TODO Handle all types of class loaders.
-static bool FindDalvikSystemDexFileAndLoaderForClass(
- art::Handle<art::mirror::Class> klass,
- /*out*/art::mirror::Object** dex_file,
- /*out*/art::mirror::ClassLoader** loader)
- REQUIRES_SHARED(art::Locks::mutator_lock_) {
- const char* dex_path_list_element_array_name = "[Ldalvik/system/DexPathList$Element;";
- const char* dex_path_list_element_name = "Ldalvik/system/DexPathList$Element;";
- const char* dex_file_name = "Ldalvik/system/DexFile;";
- const char* dex_path_list_name = "Ldalvik/system/DexPathList;";
- const char* dex_class_loader_name = "Ldalvik/system/BaseDexClassLoader;";
-
- art::Thread* self = art::Thread::Current();
- CHECK(!self->IsExceptionPending());
- art::StackHandleScope<11> hs(self);
- art::ClassLinker* class_linker = art::Runtime::Current()->GetClassLinker();
-
- art::Handle<art::mirror::ClassLoader> null_loader(hs.NewHandle<art::mirror::ClassLoader>(
- nullptr));
- art::Handle<art::mirror::Class> base_dex_loader_class(hs.NewHandle(class_linker->FindClass(
- self, dex_class_loader_name, null_loader)));
-
- art::ArtField* path_list_field = base_dex_loader_class->FindDeclaredInstanceField(
- "pathList", dex_path_list_name);
- CHECK(path_list_field != nullptr);
-
- art::ArtField* dex_path_list_element_field =
- class_linker->FindClass(self, dex_path_list_name, null_loader)
- ->FindDeclaredInstanceField("dexElements", dex_path_list_element_array_name);
- CHECK(dex_path_list_element_field != nullptr);
-
- art::ArtField* element_dex_file_field =
- class_linker->FindClass(self, dex_path_list_element_name, null_loader)
- ->FindDeclaredInstanceField("dexFile", dex_file_name);
- CHECK(element_dex_file_field != nullptr);
-
- art::Handle<art::mirror::ClassLoader> h_class_loader(hs.NewHandle(klass->GetClassLoader()));
- art::Handle<art::mirror::Class> loader_class(hs.NewHandle(h_class_loader->GetClass()));
- // Check if loader is a BaseDexClassLoader
- if (!loader_class->IsSubClass(base_dex_loader_class.Get())) {
- LOG(ERROR) << "The classloader is not a BaseDexClassLoader which is currently the only "
- << "supported class loader type!";
- return false;
- }
- art::Handle<art::mirror::Object> path_list(
- hs.NewHandle(path_list_field->GetObject(h_class_loader.Get())));
- CHECK(path_list.Get() != nullptr);
- CHECK(!self->IsExceptionPending());
- art::Handle<art::mirror::ObjectArray<art::mirror::Object>> dex_elements_list(hs.NewHandle(
- dex_path_list_element_field->GetObject(path_list.Get())->
- AsObjectArray<art::mirror::Object>()));
- CHECK(!self->IsExceptionPending());
- CHECK(dex_elements_list.Get() != nullptr);
- size_t num_elements = dex_elements_list->GetLength();
- art::MutableHandle<art::mirror::Object> current_element(
- hs.NewHandle<art::mirror::Object>(nullptr));
- art::MutableHandle<art::mirror::Object> first_dex_file(
- hs.NewHandle<art::mirror::Object>(nullptr));
- for (size_t i = 0; i < num_elements; i++) {
- current_element.Assign(dex_elements_list->Get(i));
- CHECK(current_element.Get() != nullptr);
- CHECK(!self->IsExceptionPending());
- CHECK(dex_elements_list.Get() != nullptr);
- CHECK_EQ(current_element->GetClass(), class_linker->FindClass(self,
- dex_path_list_element_name,
- null_loader));
- // TODO It would be cleaner to put the art::DexFile into the dalvik.system.DexFile the class
- // comes from but it is more annoying because we would need to find this class. It is not
- // necessary for proper function since we just need to be in front of the classes old dex file
- // in the path.
- first_dex_file.Assign(element_dex_file_field->GetObject(current_element.Get()));
- if (first_dex_file.Get() != nullptr) {
- *dex_file = first_dex_file.Get();
- *loader = h_class_loader.Get();
- return true;
- }
- }
- return false;
-}
-
+// TODO Move this function somewhere more appropriate.
// Gets the data surrounding the given class.
jvmtiError GetTransformationData(ArtJvmTiEnv* env,
jclass klass,
@@ -280,83 +112,4 @@
return OK;
}
-// Install the new dex file.
-// TODO do error checks for bad state (method in a stack, changes to number of methods/fields/etc).
-jvmtiError MoveTransformedFileIntoRuntime(jclass jklass,
- const std::string& original_location,
- jint data_len,
- unsigned char* dex_data) {
- const char* dex_file_name = "Ldalvik/system/DexFile;";
- art::Thread* self = art::Thread::Current();
- art::Runtime* runtime = art::Runtime::Current();
- art::ThreadList* threads = runtime->GetThreadList();
- art::ClassLinker* class_linker = runtime->GetClassLinker();
- uint32_t checksum = 0;
- if (!ReadChecksum(data_len, dex_data, &checksum)) {
- return ERR(INVALID_CLASS_FORMAT);
- }
-
- std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_location, data_len, dex_data));
- if (map.get() == nullptr) {
- return ERR(INTERNAL);
- }
- std::string error_msg;
- // Load the new dex_data in memory (mmap it, etc)
- std::unique_ptr<const art::DexFile> new_dex_file = art::DexFile::Open(map->GetName(),
- checksum,
- std::move(map),
- /*verify*/ true,
- /*verify_checksum*/ true,
- &error_msg);
- CHECK(new_dex_file.get() != nullptr) << "Unable to load dex file! " << error_msg;
-
- // Get mutator lock. We need the lifetimes of these variables (hs, the classes, etc.) to be longer
- // then current lock (since there isn't upgrading of the lock) so we don't use soa.
- art::ThreadState old_state = self->TransitionFromSuspendedToRunnable();
- // This scope is needed to make sure that the HandleScope dies with mutator_lock_ since we need to
- // upgrade the mutator_lock during the execution.
- {
- art::StackHandleScope<11> hs(self);
- art::Handle<art::mirror::ClassLoader> null_loader(
- hs.NewHandle<art::mirror::ClassLoader>(nullptr));
- CHECK(null_loader.Get() == nullptr);
- art::ArtField* dex_file_cookie_field = class_linker->
- FindClass(self, dex_file_name, null_loader)->
- FindDeclaredInstanceField("mCookie", "Ljava/lang/Object;");
- art::ArtField* dex_file_internal_cookie_field =
- class_linker->FindClass(self, dex_file_name, null_loader)
- ->FindDeclaredInstanceField("mInternalCookie", "Ljava/lang/Object;");
- CHECK(dex_file_cookie_field != nullptr);
- art::Handle<art::mirror::Class> klass(hs.NewHandle(self->DecodeJObject(jklass)->AsClass()));
- art::mirror::Object* dex_file_ptr = nullptr;
- art::mirror::ClassLoader* class_loader_ptr = nullptr;
- // Find dalvik.system.DexFile that represents the dex file we are changing.
- if (!FindDalvikSystemDexFileAndLoaderForClass(klass, &dex_file_ptr, &class_loader_ptr)) {
- self->TransitionFromRunnableToSuspended(old_state);
- LOG(ERROR) << "Could not find DexFile.";
- return ERR(INTERNAL);
- }
- art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(dex_file_ptr));
- art::Handle<art::mirror::ClassLoader> class_loader(hs.NewHandle(class_loader_ptr));
- art::Handle<art::mirror::LongArray> art_dex_array(
- hs.NewHandle<art::mirror::LongArray>(
- dex_file_cookie_field->GetObject(dex_file_obj.Get())->AsLongArray()));
- art::Handle<art::mirror::LongArray> new_art_dex_array(
- hs.NewHandle<art::mirror::LongArray>(
- InsertDexFileIntoArray(self, new_dex_file.get(), art_dex_array)));
- art::Handle<art::mirror::DexCache> cache(
- hs.NewHandle(class_linker->RegisterDexFile(*new_dex_file.get(), class_loader.Get())));
- self->TransitionFromRunnableToSuspended(old_state);
-
- threads->SuspendAll("moving dex file into runtime", /*long_suspend*/true);
- // Change the mCookie field. Old value will be GC'd as normal.
- dex_file_cookie_field->SetObject<false>(dex_file_obj.Get(), new_art_dex_array.Get());
- dex_file_internal_cookie_field->SetObject<false>(dex_file_obj.Get(), new_art_dex_array.Get());
- // Invalidate existing methods.
- InvalidateExistingMethods(self, klass, cache, new_dex_file.release());
- }
- threads->ResumeAll();
- return OK;
-}
-
} // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/transform.h b/runtime/openjdkjvmti/transform.h
index a76ed93..0ad5099 100644
--- a/runtime/openjdkjvmti/transform.h
+++ b/runtime/openjdkjvmti/transform.h
@@ -41,6 +41,8 @@
namespace openjdkjvmti {
+jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location);
+
// Gets the data surrounding the given class.
jvmtiError GetTransformationData(ArtJvmTiEnv* env,
jclass klass,
@@ -52,12 +54,6 @@
/*out*/jint* data_len,
/*out*/unsigned char** dex_data);
-// Install the new dex file.
-jvmtiError MoveTransformedFileIntoRuntime(jclass jklass,
- const std::string& original_location,
- jint data_len,
- unsigned char* dex_data);
-
} // namespace openjdkjvmti
#endif // ART_RUNTIME_OPENJDKJVMTI_TRANSFORM_H_
diff --git a/runtime/parsed_options_test.cc b/runtime/parsed_options_test.cc
index 5b90c6a..8948c71 100644
--- a/runtime/parsed_options_test.cc
+++ b/runtime/parsed_options_test.cc
@@ -19,7 +19,6 @@
#include <memory>
#include "arch/instruction_set.h"
-#include "base/stringprintf.h"
#include "common_runtime_test.h"
namespace art {
diff --git a/runtime/plugin.cc b/runtime/plugin.cc
index 481b1ca..731967c 100644
--- a/runtime/plugin.cc
+++ b/runtime/plugin.cc
@@ -17,11 +17,15 @@
#include "plugin.h"
#include <dlfcn.h>
-#include "base/stringprintf.h"
+
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
namespace art {
+using android::base::StringPrintf;
+
const char* PLUGIN_INITIALIZATION_FUNCTION_NAME = "ArtPlugin_Initialize";
const char* PLUGIN_DEINITIALIZATION_FUNCTION_NAME = "ArtPlugin_Deinitialize";
diff --git a/runtime/proxy_test.cc b/runtime/proxy_test.cc
index fd7e56d..1292a81 100644
--- a/runtime/proxy_test.cc
+++ b/runtime/proxy_test.cc
@@ -128,8 +128,8 @@
ASSERT_TRUE(proxy_class->IsInitialized());
EXPECT_EQ(2U, proxy_class->NumDirectInterfaces()); // Interfaces$I and Interfaces$J.
- EXPECT_OBJ_PTR_EQ(I.Get(), mirror::Class::GetDirectInterface(soa.Self(), proxy_class, 0));
- EXPECT_OBJ_PTR_EQ(J.Get(), mirror::Class::GetDirectInterface(soa.Self(), proxy_class, 1));
+ EXPECT_OBJ_PTR_EQ(I.Get(), mirror::Class::GetDirectInterface(soa.Self(), proxy_class.Get(), 0));
+ EXPECT_OBJ_PTR_EQ(J.Get(), mirror::Class::GetDirectInterface(soa.Self(), proxy_class.Get(), 1));
std::string temp;
const char* proxy_class_descriptor = proxy_class->GetDescriptor(&temp);
EXPECT_STREQ("L$Proxy1234;", proxy_class_descriptor);
diff --git a/runtime/reference_table.cc b/runtime/reference_table.cc
index 1c975a4..d8b9dcc 100644
--- a/runtime/reference_table.cc
+++ b/runtime/reference_table.cc
@@ -16,6 +16,8 @@
#include "reference_table.h"
+#include "android-base/stringprintf.h"
+
#include "base/mutex.h"
#include "indirect_reference_table.h"
#include "mirror/array.h"
@@ -30,6 +32,9 @@
namespace art {
+using android::base::StringAppendF;
+using android::base::StringPrintf;
+
ReferenceTable::ReferenceTable(const char* name, size_t initial_size, size_t max_size)
: name_(name), max_size_(max_size) {
CHECK_LE(initial_size, max_size);
diff --git a/runtime/reference_table_test.cc b/runtime/reference_table_test.cc
index d80a9b3..9523e92 100644
--- a/runtime/reference_table_test.cc
+++ b/runtime/reference_table_test.cc
@@ -16,6 +16,8 @@
#include "reference_table.h"
+#include "android-base/stringprintf.h"
+
#include "class_linker.h"
#include "common_runtime_test.h"
#include "handle_scope-inl.h"
@@ -30,6 +32,8 @@
namespace art {
+using android::base::StringPrintf;
+
class ReferenceTableTest : public CommonRuntimeTest {};
static mirror::Object* CreateWeakReference(mirror::Object* referent)
diff --git a/runtime/reflection-inl.h b/runtime/reflection-inl.h
index 68e7a10..62ce9e9 100644
--- a/runtime/reflection-inl.h
+++ b/runtime/reflection-inl.h
@@ -19,7 +19,8 @@
#include "reflection.h"
-#include "base/stringprintf.h"
+#include "android-base/stringprintf.h"
+
#include "common_throws.h"
#include "jvalue-inl.h"
#include "mirror/object-inl.h"
@@ -103,13 +104,14 @@
}
if (!unbox_for_result) {
- ThrowIllegalArgumentException(StringPrintf("Invalid primitive conversion from %s to %s",
- PrettyDescriptor(srcType).c_str(),
- PrettyDescriptor(dstType).c_str()).c_str());
+ ThrowIllegalArgumentException(
+ android::base::StringPrintf("Invalid primitive conversion from %s to %s",
+ PrettyDescriptor(srcType).c_str(),
+ PrettyDescriptor(dstType).c_str()).c_str());
} else {
- ThrowClassCastException(StringPrintf("Couldn't convert result of type %s to %s",
- PrettyDescriptor(srcType).c_str(),
- PrettyDescriptor(dstType).c_str()).c_str());
+ ThrowClassCastException(android::base::StringPrintf("Couldn't convert result of type %s to %s",
+ PrettyDescriptor(srcType).c_str(),
+ PrettyDescriptor(dstType).c_str()).c_str());
}
return false;
}
diff --git a/runtime/reflection.cc b/runtime/reflection.cc
index 3128380..4d24501 100644
--- a/runtime/reflection.cc
+++ b/runtime/reflection.cc
@@ -34,6 +34,8 @@
namespace art {
+using android::base::StringPrintf;
+
class ArgArray {
public:
ArgArray(const char* shorty, uint32_t shorty_len)
@@ -363,7 +365,7 @@
Thread* const self = Thread::Current();
PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
for (uint32_t i = 0; i < num_params; i++) {
- uint16_t type_idx = params->GetTypeItem(i).type_idx_;
+ dex::TypeIndex type_idx = params->GetTypeItem(i).type_idx_;
ObjPtr<mirror::Class> param_type(m->GetClassFromTypeIndex(type_idx,
true /* resolve*/,
pointer_size));
diff --git a/runtime/runtime.cc b/runtime/runtime.cc
index 09a0462..2086d70 100644
--- a/runtime/runtime.cc
+++ b/runtime/runtime.cc
@@ -37,6 +37,8 @@
#include <vector>
#include <fcntl.h>
+#include "android-base/strings.h"
+
#include "JniConstants.h"
#include "ScopedLocalRef.h"
#include "arch/arm/quick_method_frame_info_arm.h"
@@ -62,6 +64,7 @@
#include "base/stl_util.h"
#include "base/systrace.h"
#include "base/unix_file/fd_file.h"
+#include "cha.h"
#include "class_linker-inl.h"
#include "compiler_callbacks.h"
#include "debugger.h"
@@ -81,6 +84,7 @@
#include "intern_table.h"
#include "interpreter/interpreter.h"
#include "jit/jit.h"
+#include "jit/jit_code_cache.h"
#include "jni_internal.h"
#include "linear_alloc.h"
#include "mirror/array.h"
@@ -348,6 +352,7 @@
delete monitor_list_;
delete monitor_pool_;
delete class_linker_;
+ delete cha_;
delete heap_;
delete intern_table_;
delete oat_file_manager_;
@@ -372,6 +377,7 @@
void Dump(std::ostream& os) const {
if (gAborting > 1) {
os << "Runtime aborting --- recursively, so no thread-specific detail!\n";
+ DumpRecursiveAbort(os);
return;
}
gAborting++;
@@ -428,6 +434,21 @@
}
}
}
+
+ // For recursive aborts.
+ void DumpRecursiveAbort(std::ostream& os) const NO_THREAD_SAFETY_ANALYSIS {
+ // The only thing we'll attempt is dumping the native stack of the current thread. We will only
+ // try this if we haven't exceeded an arbitrary amount of recursions, to recover and actually
+ // die.
+ // Note: as we're using a global counter for the recursive abort detection, there is a potential
+ // race here and it is not OK to just print when the counter is "2" (one from
+ // Runtime::Abort(), one from previous Dump() call). Use a number that seems large enough.
+ static constexpr size_t kOnlyPrintWhenRecursionLessThan = 100u;
+ if (gAborting < kOnlyPrintWhenRecursionLessThan) {
+ gAborting++;
+ DumpNativeStack(os, GetTid());
+ }
+ }
};
void Runtime::Abort(const char* msg) {
@@ -442,8 +463,16 @@
// Many people have difficulty distinguish aborts from crashes,
// so be explicit.
+ // Note: use cerr on the host to print log lines immediately, so we get at least some output
+ // in case of recursive aborts. We lose annotation with the source file and line number
+ // here, which is a minor issue. The same is significantly more complicated on device,
+ // which is why we ignore the issue there.
AbortState state;
- LOG(FATAL_WITHOUT_ABORT) << Dumpable<AbortState>(state);
+ if (kIsTargetBuild) {
+ LOG(FATAL_WITHOUT_ABORT) << Dumpable<AbortState>(state);
+ } else {
+ std::cerr << Dumpable<AbortState>(state);
+ }
// Sometimes we dump long messages, and the Android abort message only retains the first line.
// In those cases, just log the message again, to avoid logcat limits.
@@ -492,6 +521,14 @@
GetMonitorList()->SweepMonitorList(visitor);
GetJavaVM()->SweepJniWeakGlobals(visitor);
GetHeap()->SweepAllocationRecords(visitor);
+ if (GetJit() != nullptr) {
+ // Visit JIT literal tables. Objects in these tables are classes and strings
+ // and only classes can be affected by class unloading. The strings always
+ // stay alive as they are strongly interned.
+ // TODO: Move this closer to CleanupClassLoaders, to avoid blocking weak accesses
+ // from mutators. See b/32167580.
+ GetJit()->GetCodeCache()->SweepRootTables(visitor);
+ }
// All other generic system-weak holders.
for (gc::AbstractSystemWeakHolder* holder : system_weak_holders_) {
@@ -834,7 +871,7 @@
ImageHeader::GetOatLocationFromImageLocation(image_locations[index].c_str());
// Note: in the multi-image case, the image location may end in ".jar," and not ".art." Handle
// that here.
- if (EndsWith(oat_location, ".jar")) {
+ if (android::base::EndsWith(oat_location, ".jar")) {
oat_location.replace(oat_location.length() - 3, 3, "oat");
}
std::string error_msg;
@@ -1162,6 +1199,8 @@
CHECK_EQ(self->GetThreadId(), ThreadList::kMainThreadId);
CHECK(self != nullptr);
+ self->SetCanCallIntoJava(!IsAotCompiler());
+
// Set us to runnable so tools using a runtime can allocate and GC by default
self->TransitionFromSuspendedToRunnable();
@@ -1170,6 +1209,7 @@
CHECK_GE(GetHeap()->GetContinuousSpaces().size(), 1U);
class_linker_ = new ClassLinker(intern_table_);
+ cha_ = new ClassHierarchyAnalysis;
if (GetHeap()->HasBootImageSpace()) {
bool result = class_linker_->InitFromBootImage(&error_msg);
if (!result) {
@@ -1189,7 +1229,7 @@
for (const DexFile* dex_file : boot_class_path) {
dex_locations.push_back(dex_file->GetLocation());
}
- boot_class_path_string_ = Join(dex_locations, ':');
+ boot_class_path_string_ = android::base::Join(dex_locations, ':');
}
{
ScopedTrace trace2("AddImageStringsToTable");
@@ -1457,11 +1497,6 @@
}
void Runtime::DumpForSigQuit(std::ostream& os) {
- // Dumping for SIGQIT may cause deadlocks if the the debugger is active. b/26118154
- if (Dbg::IsDebuggerActive()) {
- LOG(INFO) << "Skipping DumpForSigQuit due to active debugger";
- return;
- }
GetClassLinker()->DumpForSigQuit(os);
GetInternTable()->DumpForSigQuit(os);
GetJavaVM()->DumpForSigQuit(os);
@@ -1664,13 +1699,13 @@
VisitTransactionRoots(visitor);
}
-void Runtime::VisitNonConcurrentRoots(RootVisitor* visitor) {
- thread_list_->VisitRoots(visitor);
+void Runtime::VisitNonConcurrentRoots(RootVisitor* visitor, VisitRootFlags flags) {
+ VisitThreadRoots(visitor, flags);
VisitNonThreadRoots(visitor);
}
-void Runtime::VisitThreadRoots(RootVisitor* visitor) {
- thread_list_->VisitRoots(visitor);
+void Runtime::VisitThreadRoots(RootVisitor* visitor, VisitRootFlags flags) {
+ thread_list_->VisitRoots(visitor, flags);
}
size_t Runtime::FlipThreadRoots(Closure* thread_flip_visitor, Closure* flip_callback,
@@ -1679,7 +1714,7 @@
}
void Runtime::VisitRoots(RootVisitor* visitor, VisitRootFlags flags) {
- VisitNonConcurrentRoots(visitor);
+ VisitNonConcurrentRoots(visitor, flags);
VisitConcurrentRoots(visitor, flags);
}
@@ -1688,7 +1723,7 @@
if (space->IsImageSpace()) {
auto* image_space = space->AsImageSpace();
const auto& image_header = image_space->GetImageHeader();
- for (size_t i = 0; i < ImageHeader::kImageRootsMax; ++i) {
+ for (int32_t i = 0, size = image_header.GetImageRoots()->GetLength(); i != size; ++i) {
auto* obj = image_header.GetImageRoot(static_cast<ImageHeader::ImageRoot>(i));
if (obj != nullptr) {
auto* after_obj = obj;
@@ -1700,9 +1735,24 @@
}
}
+static ArtMethod* CreateRuntimeMethod(ClassLinker* class_linker, LinearAlloc* linear_alloc) {
+ const PointerSize image_pointer_size = class_linker->GetImagePointerSize();
+ const size_t method_alignment = ArtMethod::Alignment(image_pointer_size);
+ const size_t method_size = ArtMethod::Size(image_pointer_size);
+ LengthPrefixedArray<ArtMethod>* method_array = class_linker->AllocArtMethodArray(
+ Thread::Current(),
+ linear_alloc,
+ 1);
+ ArtMethod* method = &method_array->At(0, method_size, method_alignment);
+ CHECK(method != nullptr);
+ method->SetDexMethodIndex(DexFile::kDexNoIndex);
+ CHECK(method->IsRuntimeMethod());
+ return method;
+}
+
ArtMethod* Runtime::CreateImtConflictMethod(LinearAlloc* linear_alloc) {
ClassLinker* const class_linker = GetClassLinker();
- ArtMethod* method = class_linker->CreateRuntimeMethod(linear_alloc);
+ ArtMethod* method = CreateRuntimeMethod(class_linker, linear_alloc);
// When compiling, the code pointer will get set later when the image is loaded.
const PointerSize pointer_size = GetInstructionSetPointerSize(instruction_set_);
if (IsAotCompiler()) {
@@ -1723,7 +1773,7 @@
}
ArtMethod* Runtime::CreateResolutionMethod() {
- auto* method = GetClassLinker()->CreateRuntimeMethod(GetLinearAlloc());
+ auto* method = CreateRuntimeMethod(GetClassLinker(), GetLinearAlloc());
// When compiling, the code pointer will get set later when the image is loaded.
if (IsAotCompiler()) {
PointerSize pointer_size = GetInstructionSetPointerSize(instruction_set_);
@@ -1735,7 +1785,7 @@
}
ArtMethod* Runtime::CreateCalleeSaveMethod() {
- auto* method = GetClassLinker()->CreateRuntimeMethod(GetLinearAlloc());
+ auto* method = CreateRuntimeMethod(GetClassLinker(), GetLinearAlloc());
PointerSize pointer_size = GetInstructionSetPointerSize(instruction_set_);
method->SetEntryPointFromQuickCompiledCodePtrSize(nullptr, pointer_size);
DCHECK_NE(instruction_set_, kNone);
@@ -1749,6 +1799,9 @@
intern_table_->ChangeWeakRootState(gc::kWeakRootStateNoReadsOrWrites);
java_vm_->DisallowNewWeakGlobals();
heap_->DisallowNewAllocationRecords();
+ if (GetJit() != nullptr) {
+ GetJit()->GetCodeCache()->DisallowInlineCacheAccess();
+ }
// All other generic system-weak holders.
for (gc::AbstractSystemWeakHolder* holder : system_weak_holders_) {
@@ -1762,6 +1815,9 @@
intern_table_->ChangeWeakRootState(gc::kWeakRootStateNormal); // TODO: Do this in the sweeping.
java_vm_->AllowNewWeakGlobals();
heap_->AllowNewAllocationRecords();
+ if (GetJit() != nullptr) {
+ GetJit()->GetCodeCache()->AllowInlineCacheAccess();
+ }
// All other generic system-weak holders.
for (gc::AbstractSystemWeakHolder* holder : system_weak_holders_) {
@@ -1777,6 +1833,9 @@
intern_table_->BroadcastForNewInterns();
java_vm_->BroadcastForNewWeakGlobals();
heap_->BroadcastForNewAllocationRecords();
+ if (GetJit() != nullptr) {
+ GetJit()->GetCodeCache()->BroadcastForInlineCacheAccess();
+ }
// All other generic system-weak holders.
for (gc::AbstractSystemWeakHolder* holder : system_weak_holders_) {
@@ -1837,7 +1896,7 @@
}
VLOG(profiler) << "Register app with " << profile_output_filename
- << " " << Join(code_paths, ':');
+ << " " << android::base::Join(code_paths, ':');
if (profile_output_filename.empty()) {
LOG(WARNING) << "JIT profile information will not be recorded: profile filename is empty.";
@@ -1990,7 +2049,8 @@
preinitialization_transaction_->RecordWeakStringRemoval(s);
}
-void Runtime::RecordResolveString(ObjPtr<mirror::DexCache> dex_cache, uint32_t string_idx) const {
+void Runtime::RecordResolveString(ObjPtr<mirror::DexCache> dex_cache,
+ dex::StringIndex string_idx) const {
DCHECK(IsAotCompiler());
DCHECK(IsActiveTransaction());
preinitialization_transaction_->RecordResolveString(dex_cache, string_idx);
@@ -2150,7 +2210,7 @@
NO_RETURN
void Runtime::Aborter(const char* abort_message) {
-#ifdef __ANDROID__
+#ifdef ART_TARGET_ANDROID
android_set_abort_message(abort_message);
#endif
Runtime::Abort(abort_message);
diff --git a/runtime/runtime.h b/runtime/runtime.h
index de5a356..d40c631 100644
--- a/runtime/runtime.h
+++ b/runtime/runtime.h
@@ -28,6 +28,7 @@
#include "arch/instruction_set.h"
#include "base/macros.h"
+#include "dex_file_types.h"
#include "experimental_flags.h"
#include "gc_root.h"
#include "instrumentation.h"
@@ -75,6 +76,7 @@
} // namespace verifier
class ArenaPool;
class ArtMethod;
+class ClassHierarchyAnalysis;
class ClassLinker;
class Closure;
class CompilerCallbacks;
@@ -98,18 +100,6 @@
typedef std::vector<std::pair<std::string, const void*>> RuntimeOptions;
-// Not all combinations of flags are valid. You may not visit all roots as well as the new roots
-// (no logical reason to do this). You also may not start logging new roots and stop logging new
-// roots (also no logical reason to do this).
-enum VisitRootFlags : uint8_t {
- kVisitRootFlagAllRoots = 0x1,
- kVisitRootFlagNewRoots = 0x2,
- kVisitRootFlagStartLoggingNewRoots = 0x4,
- kVisitRootFlagStopLoggingNewRoots = 0x8,
- kVisitRootFlagClearRootLog = 0x10,
- kVisitRootFlagClassLoader = 0x20,
-};
-
class Runtime {
public:
// Parse raw runtime options.
@@ -347,28 +337,16 @@
void VisitTransactionRoots(RootVisitor* visitor)
REQUIRES_SHARED(Locks::mutator_lock_);
- // Visit all of the thread roots.
- void VisitThreadRoots(RootVisitor* visitor) REQUIRES_SHARED(Locks::mutator_lock_);
-
// Flip thread roots from from-space refs to to-space refs.
size_t FlipThreadRoots(Closure* thread_flip_visitor, Closure* flip_callback,
gc::collector::GarbageCollector* collector)
REQUIRES(!Locks::mutator_lock_);
- // Visit all other roots which must be done with mutators suspended.
- void VisitNonConcurrentRoots(RootVisitor* visitor)
- REQUIRES_SHARED(Locks::mutator_lock_);
-
// Sweep system weaks, the system weak is deleted if the visitor return null. Otherwise, the
// system weak is updated to be the visitor's returned value.
void SweepSystemWeaks(IsMarkedVisitor* visitor)
REQUIRES_SHARED(Locks::mutator_lock_);
- // Constant roots are the roots which never change after the runtime is initialized, they only
- // need to be visited once per GC cycle.
- void VisitConstantRoots(RootVisitor* visitor)
- REQUIRES_SHARED(Locks::mutator_lock_);
-
// Returns a special method that calls into a trampoline for runtime method resolution
ArtMethod* GetResolutionMethod();
@@ -520,7 +498,7 @@
REQUIRES(Locks::intern_table_lock_);
void RecordWeakStringRemoval(ObjPtr<mirror::String> s) const
REQUIRES(Locks::intern_table_lock_);
- void RecordResolveString(ObjPtr<mirror::DexCache> dex_cache, uint32_t string_idx) const
+ void RecordResolveString(ObjPtr<mirror::DexCache> dex_cache, dex::StringIndex string_idx) const
REQUIRES_SHARED(Locks::mutator_lock_);
void SetFaultMessage(const std::string& message) REQUIRES(!fault_message_lock_);
@@ -673,6 +651,10 @@
void AddSystemWeakHolder(gc::AbstractSystemWeakHolder* holder);
void RemoveSystemWeakHolder(gc::AbstractSystemWeakHolder* holder);
+ ClassHierarchyAnalysis* GetClassHierarchyAnalysis() {
+ return cha_;
+ }
+
NO_RETURN
static void Aborter(const char* abort_message);
@@ -696,6 +678,19 @@
void MaybeSaveJitProfilingInfo();
+ // Visit all of the thread roots.
+ void VisitThreadRoots(RootVisitor* visitor, VisitRootFlags flags)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // Visit all other roots which must be done with mutators suspended.
+ void VisitNonConcurrentRoots(RootVisitor* visitor, VisitRootFlags flags)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // Constant roots are the roots which never change after the runtime is initialized, they only
+ // need to be visited once per GC cycle.
+ void VisitConstantRoots(RootVisitor* visitor)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
// A pointer to the active runtime or null.
static Runtime* instance_;
@@ -920,6 +915,8 @@
// Generic system-weak holders.
std::vector<gc::AbstractSystemWeakHolder*> system_weak_holders_;
+ ClassHierarchyAnalysis* cha_;
+
DISALLOW_COPY_AND_ASSIGN(Runtime);
};
std::ostream& operator<<(std::ostream& os, const Runtime::CalleeSaveType& rhs);
diff --git a/runtime/runtime_android.cc b/runtime/runtime_android.cc
index be97860..0a996a9 100644
--- a/runtime/runtime_android.cc
+++ b/runtime/runtime_android.cc
@@ -21,7 +21,6 @@
#include "base/logging.h"
#include "base/mutex.h"
-#include "base/stringprintf.h"
#include "thread-inl.h"
#include "utils.h"
diff --git a/runtime/runtime_linux.cc b/runtime/runtime_linux.cc
index 93704a9..b8894d2 100644
--- a/runtime/runtime_linux.cc
+++ b/runtime/runtime_linux.cc
@@ -24,11 +24,12 @@
#include <iostream>
#include <sstream>
+#include "android-base/stringprintf.h"
+
#include "base/dumpable.h"
#include "base/logging.h"
#include "base/macros.h"
#include "base/mutex.h"
-#include "base/stringprintf.h"
#include "native_stack_dump.h"
#include "thread-inl.h"
#include "thread_list.h"
@@ -36,6 +37,8 @@
namespace art {
+using android::base::StringPrintf;
+
static constexpr bool kUseSigRTTimeout = true;
static constexpr bool kDumpNativeStackOnTimeout = true;
diff --git a/runtime/stack.cc b/runtime/stack.cc
index 167a30b..3fed7c9 100644
--- a/runtime/stack.cc
+++ b/runtime/stack.cc
@@ -16,6 +16,8 @@
#include "stack.h"
+#include "android-base/stringprintf.h"
+
#include "arch/context.h"
#include "art_method-inl.h"
#include "base/enums.h"
@@ -39,6 +41,8 @@
namespace art {
+using android::base::StringPrintf;
+
static constexpr bool kDebugStackWalk = false;
mirror::Object* ShadowFrame::GetThisObject() const {
@@ -614,12 +618,6 @@
return result;
}
-static instrumentation::InstrumentationStackFrame& GetInstrumentationStackFrame(Thread* thread,
- uint32_t depth) {
- CHECK_LT(depth, thread->GetInstrumentationStack()->size());
- return thread->GetInstrumentationStack()->at(depth);
-}
-
static void AssertPcIsWithinQuickCode(ArtMethod* method, uintptr_t pc)
REQUIRES_SHARED(Locks::mutator_lock_) {
if (method->IsNative() || method->IsRuntimeMethod() || method->IsProxyMethod()) {
@@ -648,7 +646,7 @@
return;
}
- uint32_t code_size = OatQuickMethodHeader::FromEntryPoint(code)->code_size_;
+ uint32_t code_size = OatQuickMethodHeader::FromEntryPoint(code)->GetCodeSize();
uintptr_t code_start = reinterpret_cast<uintptr_t>(code);
CHECK(code_start <= pc && pc <= (code_start + code_size))
<< method->PrettyMethod()
@@ -777,6 +775,7 @@
return QuickMethodFrameInfo(frame_size, callee_info.CoreSpillMask(), callee_info.FpSpillMask());
}
+template <StackVisitor::CountTransitions kCount>
void StackVisitor::WalkStack(bool include_transitions) {
DCHECK(thread_ == Thread::Current() || thread_->IsSuspended());
CHECK_EQ(cur_depth_, 0U);
@@ -842,8 +841,9 @@
// While profiling, the return pc is restored from the side stack, except when walking
// the stack for an exception where the side stack will be unwound in VisitFrame.
if (reinterpret_cast<uintptr_t>(GetQuickInstrumentationExitPc()) == return_pc) {
+ CHECK_LT(instrumentation_stack_depth, thread_->GetInstrumentationStack()->size());
const instrumentation::InstrumentationStackFrame& instrumentation_frame =
- GetInstrumentationStackFrame(thread_, instrumentation_stack_depth);
+ thread_->GetInstrumentationStack()->at(instrumentation_stack_depth);
instrumentation_stack_depth++;
if (GetMethod() ==
Runtime::Current()->GetCalleeSaveMethod(Runtime::kSaveAllCalleeSaves)) {
@@ -907,13 +907,18 @@
return;
}
}
- cur_depth_++;
+ if (kCount == CountTransitions::kYes) {
+ cur_depth_++;
+ }
}
if (num_frames_ != 0) {
CHECK_EQ(cur_depth_, num_frames_);
}
}
+template void StackVisitor::WalkStack<StackVisitor::CountTransitions::kYes>(bool);
+template void StackVisitor::WalkStack<StackVisitor::CountTransitions::kNo>(bool);
+
void JavaFrameRootInfo::Describe(std::ostream& os) const {
const StackVisitor* visitor = stack_visitor_;
CHECK(visitor != nullptr);
diff --git a/runtime/stack.h b/runtime/stack.h
index 992bda5..b1e99e5 100644
--- a/runtime/stack.h
+++ b/runtime/stack.h
@@ -66,6 +66,11 @@
struct ShadowFrameDeleter;
using ShadowFrameAllocaUniquePtr = std::unique_ptr<ShadowFrame, ShadowFrameDeleter>;
+// Size in bytes of the should_deoptimize flag on stack.
+// We just need 4 bytes for our purpose regardless of the architecture. Frame size
+// calculation will automatically do alignment for the final frame size.
+static constexpr size_t kShouldDeoptimizeFlagSize = 4;
+
// Counting locks by storing object pointers into a vector. Duplicate entries mark recursive locks.
// The vector will be visited with the ShadowFrame during GC (so all the locked-on objects are
// thread roots).
@@ -590,6 +595,12 @@
// Return 'true' if we should continue to visit more frames, 'false' to stop.
virtual bool VisitFrame() REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+ enum class CountTransitions {
+ kYes,
+ kNo,
+ };
+
+ template <CountTransitions kCount = CountTransitions::kYes>
void WalkStack(bool include_transitions = false)
REQUIRES_SHARED(Locks::mutator_lock_);
@@ -755,10 +766,6 @@
return cur_shadow_frame_;
}
- bool IsCurrentFrameInInterpreter() const {
- return cur_shadow_frame_ != nullptr;
- }
-
HandleScope* GetCurrentHandleScope(size_t pointer_size) const {
ArtMethod** sp = GetCurrentQuickFrame();
// Skip ArtMethod*; handle scope comes next;
diff --git a/runtime/string_reference.h b/runtime/string_reference.h
index c75c218..0fc06e6 100644
--- a/runtime/string_reference.h
+++ b/runtime/string_reference.h
@@ -21,20 +21,22 @@
#include "base/logging.h"
#include "dex_file-inl.h"
+#include "dex_file_types.h"
#include "utf-inl.h"
namespace art {
// A string is located by its DexFile and the string_ids_ table index into that DexFile.
struct StringReference {
- StringReference(const DexFile* file, uint32_t index) : dex_file(file), string_index(index) { }
+ StringReference(const DexFile* file, dex::StringIndex index)
+ : dex_file(file), string_index(index) { }
const char* GetStringData() const {
return dex_file->GetStringData(dex_file->GetStringId(string_index));
}
const DexFile* dex_file;
- uint32_t string_index;
+ dex::StringIndex string_index;
};
// Compare only the reference and not the string contents.
diff --git a/runtime/thread.cc b/runtime/thread.cc
index b99df26..aff12ff 100644
--- a/runtime/thread.cc
+++ b/runtime/thread.cc
@@ -28,6 +28,8 @@
#include <list>
#include <sstream>
+#include "android-base/stringprintf.h"
+
#include "arch/context.h"
#include "art_field-inl.h"
#include "art_method-inl.h"
@@ -88,6 +90,9 @@
namespace art {
+using android::base::StringAppendV;
+using android::base::StringPrintf;
+
extern "C" NO_RETURN void artDeoptimize(Thread* self);
bool Thread::is_started_ = false;
@@ -122,21 +127,26 @@
CHECK(kUseReadBarrier);
tls32_.is_gc_marking = is_marking;
UpdateReadBarrierEntrypoints(&tlsPtr_.quick_entrypoints, is_marking);
+ ResetQuickAllocEntryPointsForThread(is_marking);
}
void Thread::InitTlsEntryPoints() {
// Insert a placeholder so we can easily tell if we call an unimplemented entry point.
uintptr_t* begin = reinterpret_cast<uintptr_t*>(&tlsPtr_.jni_entrypoints);
- uintptr_t* end = reinterpret_cast<uintptr_t*>(reinterpret_cast<uint8_t*>(&tlsPtr_.quick_entrypoints) +
- sizeof(tlsPtr_.quick_entrypoints));
+ uintptr_t* end = reinterpret_cast<uintptr_t*>(
+ reinterpret_cast<uint8_t*>(&tlsPtr_.quick_entrypoints) + sizeof(tlsPtr_.quick_entrypoints));
for (uintptr_t* it = begin; it != end; ++it) {
*it = reinterpret_cast<uintptr_t>(UnimplementedEntryPoint);
}
InitEntryPoints(&tlsPtr_.jni_entrypoints, &tlsPtr_.quick_entrypoints);
}
-void Thread::ResetQuickAllocEntryPointsForThread() {
- ResetQuickAllocEntryPoints(&tlsPtr_.quick_entrypoints);
+void Thread::ResetQuickAllocEntryPointsForThread(bool is_marking) {
+ if (kUseReadBarrier && kRuntimeISA != kX86_64) {
+ // Allocation entrypoint switching is currently only implemented for X86_64.
+ is_marking = true;
+ }
+ ResetQuickAllocEntryPoints(&tlsPtr_.quick_entrypoints, is_marking);
}
class DeoptimizationContextRecord {
@@ -868,6 +878,62 @@
Dbg::DdmSendThreadNotification(this, CHUNK_TYPE("THNM"));
}
+static void GetThreadStack(pthread_t thread,
+ void** stack_base,
+ size_t* stack_size,
+ size_t* guard_size) {
+#if defined(__APPLE__)
+ *stack_size = pthread_get_stacksize_np(thread);
+ void* stack_addr = pthread_get_stackaddr_np(thread);
+
+ // Check whether stack_addr is the base or end of the stack.
+ // (On Mac OS 10.7, it's the end.)
+ int stack_variable;
+ if (stack_addr > &stack_variable) {
+ *stack_base = reinterpret_cast<uint8_t*>(stack_addr) - *stack_size;
+ } else {
+ *stack_base = stack_addr;
+ }
+
+ // This is wrong, but there doesn't seem to be a way to get the actual value on the Mac.
+ pthread_attr_t attributes;
+ CHECK_PTHREAD_CALL(pthread_attr_init, (&attributes), __FUNCTION__);
+ CHECK_PTHREAD_CALL(pthread_attr_getguardsize, (&attributes, guard_size), __FUNCTION__);
+ CHECK_PTHREAD_CALL(pthread_attr_destroy, (&attributes), __FUNCTION__);
+#else
+ pthread_attr_t attributes;
+ CHECK_PTHREAD_CALL(pthread_getattr_np, (thread, &attributes), __FUNCTION__);
+ CHECK_PTHREAD_CALL(pthread_attr_getstack, (&attributes, stack_base, stack_size), __FUNCTION__);
+ CHECK_PTHREAD_CALL(pthread_attr_getguardsize, (&attributes, guard_size), __FUNCTION__);
+ CHECK_PTHREAD_CALL(pthread_attr_destroy, (&attributes), __FUNCTION__);
+
+#if defined(__GLIBC__)
+ // If we're the main thread, check whether we were run with an unlimited stack. In that case,
+ // glibc will have reported a 2GB stack for our 32-bit process, and our stack overflow detection
+ // will be broken because we'll die long before we get close to 2GB.
+ bool is_main_thread = (::art::GetTid() == getpid());
+ if (is_main_thread) {
+ rlimit stack_limit;
+ if (getrlimit(RLIMIT_STACK, &stack_limit) == -1) {
+ PLOG(FATAL) << "getrlimit(RLIMIT_STACK) failed";
+ }
+ if (stack_limit.rlim_cur == RLIM_INFINITY) {
+ size_t old_stack_size = *stack_size;
+
+ // Use the kernel default limit as our size, and adjust the base to match.
+ *stack_size = 8 * MB;
+ *stack_base = reinterpret_cast<uint8_t*>(*stack_base) + (old_stack_size - *stack_size);
+
+ VLOG(threads) << "Limiting unlimited stack (reported as " << PrettySize(old_stack_size) << ")"
+ << " to " << PrettySize(*stack_size)
+ << " with base " << *stack_base;
+ }
+ }
+#endif
+
+#endif
+}
+
bool Thread::InitStackHwm() {
void* read_stack_base;
size_t read_stack_size;
@@ -1317,6 +1383,32 @@
VLOG(threads) << this << " self-reviving";
}
+static std::string GetSchedulerGroupName(pid_t tid) {
+ // /proc/<pid>/cgroup looks like this:
+ // 2:devices:/
+ // 1:cpuacct,cpu:/
+ // We want the third field from the line whose second field contains the "cpu" token.
+ std::string cgroup_file;
+ if (!ReadFileToString(StringPrintf("/proc/self/task/%d/cgroup", tid), &cgroup_file)) {
+ return "";
+ }
+ std::vector<std::string> cgroup_lines;
+ Split(cgroup_file, '\n', &cgroup_lines);
+ for (size_t i = 0; i < cgroup_lines.size(); ++i) {
+ std::vector<std::string> cgroup_fields;
+ Split(cgroup_lines[i], ':', &cgroup_fields);
+ std::vector<std::string> cgroups;
+ Split(cgroup_fields[1], ',', &cgroups);
+ for (size_t j = 0; j < cgroups.size(); ++j) {
+ if (cgroups[j] == "cpu") {
+ return cgroup_fields[2].substr(1); // Skip the leading slash.
+ }
+ }
+ }
+ return "";
+}
+
+
void Thread::DumpState(std::ostream& os, const Thread* thread, pid_t tid) {
std::string group_name;
int priority;
@@ -1389,6 +1481,7 @@
os << " | group=\"" << group_name << "\""
<< " sCount=" << thread->tls32_.suspend_count
<< " dsCount=" << thread->tls32_.debug_suspend_count
+ << " flags=" << thread->tls32_.state_and_flags.as_struct.flags
<< " obj=" << reinterpret_cast<void*>(thread->tlsPtr_.opeer)
<< " self=" << reinterpret_cast<const void*>(thread) << "\n";
}
@@ -1714,7 +1807,11 @@
}
}
-Thread::Thread(bool daemon) : tls32_(daemon), wait_monitor_(nullptr), interrupted_(false) {
+Thread::Thread(bool daemon)
+ : tls32_(daemon),
+ wait_monitor_(nullptr),
+ interrupted_(false),
+ can_call_into_java_(true) {
wait_mutex_ = new Mutex("a thread wait mutex");
wait_cond_ = new ConditionVariable("a thread wait condition variable", *wait_mutex_);
tlsPtr_.instrumentation_stack = new std::deque<instrumentation::InstrumentationStackFrame>;
@@ -1900,7 +1997,7 @@
}
delete tlsPtr_.instrumentation_stack;
delete tlsPtr_.name;
- delete tlsPtr_.stack_trace_sample;
+ delete tlsPtr_.deps_or_stack_trace_sample.stack_trace_sample;
free(tlsPtr_.nested_signal_state);
Runtime::Current()->GetHeap()->AssertThreadLocalBuffersAreRevoked(this);
@@ -2796,7 +2893,7 @@
}
// RootVisitor parameters are: (const Object* obj, size_t vreg, const StackVisitor* visitor).
-template <typename RootVisitor>
+template <typename RootVisitor, bool kPrecise = false>
class ReferenceMapVisitor : public StackVisitor {
public:
ReferenceMapVisitor(Thread* thread, Context* context, RootVisitor& visitor)
@@ -2883,7 +2980,9 @@
}
}
- void VisitQuickFrame() REQUIRES_SHARED(Locks::mutator_lock_) {
+ template <typename T>
+ ALWAYS_INLINE
+ inline void VisitQuickFrameWithVregCallback() REQUIRES_SHARED(Locks::mutator_lock_) {
ArtMethod** cur_quick_frame = GetCurrentQuickFrame();
DCHECK(cur_quick_frame != nullptr);
ArtMethod* m = *cur_quick_frame;
@@ -2900,6 +2999,9 @@
CodeInfoEncoding encoding = code_info.ExtractEncoding();
StackMap map = code_info.GetStackMapForNativePcOffset(native_pc_offset, encoding);
DCHECK(map.IsValid());
+
+ T vreg_info(m, code_info, encoding, map, visitor_);
+
// Visit stack entries that hold pointers.
size_t number_of_bits = map.GetNumberOfStackMaskBits(encoding.stack_map_encoding);
for (size_t i = 0; i < number_of_bits; ++i) {
@@ -2908,7 +3010,7 @@
mirror::Object* ref = ref_addr->AsMirrorPtr();
if (ref != nullptr) {
mirror::Object* new_ref = ref;
- visitor_(&new_ref, -1, this);
+ vreg_info.VisitStack(&new_ref, i, this);
if (ref != new_ref) {
ref_addr->Assign(new_ref);
}
@@ -2929,13 +3031,119 @@
<< "set in register_mask=" << register_mask << " at " << DescribeLocation();
}
if (*ref_addr != nullptr) {
- visitor_(ref_addr, -1, this);
+ vreg_info.VisitRegister(ref_addr, i, this);
}
}
}
}
}
+ void VisitQuickFrame() REQUIRES_SHARED(Locks::mutator_lock_) {
+ if (kPrecise) {
+ VisitQuickFramePrecise();
+ } else {
+ VisitQuickFrameNonPrecise();
+ }
+ }
+
+ void VisitQuickFrameNonPrecise() REQUIRES_SHARED(Locks::mutator_lock_) {
+ struct UndefinedVRegInfo {
+ UndefinedVRegInfo(ArtMethod* method ATTRIBUTE_UNUSED,
+ const CodeInfo& code_info ATTRIBUTE_UNUSED,
+ const CodeInfoEncoding& encoding ATTRIBUTE_UNUSED,
+ const StackMap& map ATTRIBUTE_UNUSED,
+ RootVisitor& _visitor)
+ : visitor(_visitor) {
+ }
+
+ ALWAYS_INLINE
+ void VisitStack(mirror::Object** ref,
+ size_t stack_index ATTRIBUTE_UNUSED,
+ const StackVisitor* stack_visitor)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ visitor(ref, -1, stack_visitor);
+ }
+
+ ALWAYS_INLINE
+ void VisitRegister(mirror::Object** ref,
+ size_t register_index ATTRIBUTE_UNUSED,
+ const StackVisitor* stack_visitor)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ visitor(ref, -1, stack_visitor);
+ }
+
+ RootVisitor& visitor;
+ };
+ VisitQuickFrameWithVregCallback<UndefinedVRegInfo>();
+ }
+
+ void VisitQuickFramePrecise() REQUIRES_SHARED(Locks::mutator_lock_) {
+ struct StackMapVRegInfo {
+ StackMapVRegInfo(ArtMethod* method,
+ const CodeInfo& _code_info,
+ const CodeInfoEncoding& _encoding,
+ const StackMap& map,
+ RootVisitor& _visitor)
+ : number_of_dex_registers(method->GetCodeItem()->registers_size_),
+ code_info(_code_info),
+ encoding(_encoding),
+ dex_register_map(code_info.GetDexRegisterMapOf(map,
+ encoding,
+ number_of_dex_registers)),
+ visitor(_visitor) {
+ }
+
+ // TODO: If necessary, we should consider caching a reverse map instead of the linear
+ // lookups for each location.
+ void FindWithType(const size_t index,
+ const DexRegisterLocation::Kind kind,
+ mirror::Object** ref,
+ const StackVisitor* stack_visitor)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ bool found = false;
+ for (size_t dex_reg = 0; dex_reg != number_of_dex_registers; ++dex_reg) {
+ DexRegisterLocation location = dex_register_map.GetDexRegisterLocation(
+ dex_reg, number_of_dex_registers, code_info, encoding);
+ if (location.GetKind() == kind && static_cast<size_t>(location.GetValue()) == index) {
+ visitor(ref, dex_reg, stack_visitor);
+ found = true;
+ }
+ }
+
+ if (!found) {
+ // If nothing found, report with -1.
+ visitor(ref, -1, stack_visitor);
+ }
+ }
+
+ void VisitStack(mirror::Object** ref, size_t stack_index, const StackVisitor* stack_visitor)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ const size_t stack_offset = stack_index * kFrameSlotSize;
+ FindWithType(stack_offset,
+ DexRegisterLocation::Kind::kInStack,
+ ref,
+ stack_visitor);
+ }
+
+ void VisitRegister(mirror::Object** ref,
+ size_t register_index,
+ const StackVisitor* stack_visitor)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ FindWithType(register_index,
+ DexRegisterLocation::Kind::kInRegister,
+ ref,
+ stack_visitor);
+ }
+
+ size_t number_of_dex_registers;
+ const CodeInfo& code_info;
+ const CodeInfoEncoding& encoding;
+ DexRegisterMap dex_register_map;
+ RootVisitor& visitor;
+ };
+ VisitQuickFrameWithVregCallback<StackMapVRegInfo>();
+ }
+
// Visitor for when we visit a root.
RootVisitor& visitor_;
};
@@ -2954,6 +3162,7 @@
const uint32_t tid_;
};
+template <bool kPrecise>
void Thread::VisitRoots(RootVisitor* visitor) {
const uint32_t thread_id = GetThreadId();
visitor->VisitRootIfNonNull(&tlsPtr_.opeer, RootInfo(kRootThreadObject, thread_id));
@@ -2971,7 +3180,7 @@
// Visit roots for deoptimization.
if (tlsPtr_.stacked_shadow_frame_record != nullptr) {
RootCallbackVisitor visitor_to_callback(visitor, thread_id);
- ReferenceMapVisitor<RootCallbackVisitor> mapper(this, nullptr, visitor_to_callback);
+ ReferenceMapVisitor<RootCallbackVisitor, kPrecise> mapper(this, nullptr, visitor_to_callback);
for (StackedShadowFrameRecord* record = tlsPtr_.stacked_shadow_frame_record;
record != nullptr;
record = record->GetLink()) {
@@ -2994,7 +3203,7 @@
}
if (tlsPtr_.frame_id_to_shadow_frame != nullptr) {
RootCallbackVisitor visitor_to_callback(visitor, thread_id);
- ReferenceMapVisitor<RootCallbackVisitor> mapper(this, nullptr, visitor_to_callback);
+ ReferenceMapVisitor<RootCallbackVisitor, kPrecise> mapper(this, nullptr, visitor_to_callback);
for (FrameIdToShadowFrame* record = tlsPtr_.frame_id_to_shadow_frame;
record != nullptr;
record = record->GetNext()) {
@@ -3007,14 +3216,22 @@
// Visit roots on this thread's stack
Context* context = GetLongJumpContext();
RootCallbackVisitor visitor_to_callback(visitor, thread_id);
- ReferenceMapVisitor<RootCallbackVisitor> mapper(this, context, visitor_to_callback);
- mapper.WalkStack();
+ ReferenceMapVisitor<RootCallbackVisitor, kPrecise> mapper(this, context, visitor_to_callback);
+ mapper.template WalkStack<StackVisitor::CountTransitions::kNo>(false);
ReleaseLongJumpContext(context);
for (instrumentation::InstrumentationStackFrame& frame : *GetInstrumentationStack()) {
visitor->VisitRootIfNonNull(&frame.this_object_, RootInfo(kRootVMInternal, thread_id));
}
}
+void Thread::VisitRoots(RootVisitor* visitor, VisitRootFlags flags) {
+ if ((flags & VisitRootFlags::kVisitRootFlagPrecise) != 0) {
+ VisitRoots<true>(visitor);
+ } else {
+ VisitRoots<false>(visitor);
+ }
+}
+
class VerifyRootVisitor : public SingleRootVisitor {
public:
void VisitRoot(mirror::Object* root, const RootInfo& info ATTRIBUTE_UNUSED)
@@ -3170,4 +3387,8 @@
tlsPtr_.exception = new_exception.Ptr();
}
+bool Thread::IsAotCompiler() {
+ return Runtime::Current()->IsAotCompiler();
+}
+
} // namespace art
diff --git a/runtime/thread.h b/runtime/thread.h
index b2983cc..411d85f 100644
--- a/runtime/thread.h
+++ b/runtime/thread.h
@@ -33,6 +33,7 @@
#include "base/mutex.h"
#include "entrypoints/jni/jni_entrypoints.h"
#include "entrypoints/quick/quick_entrypoints.h"
+#include "gc_root.h"
#include "globals.h"
#include "handle_scope.h"
#include "instrumentation.h"
@@ -70,7 +71,8 @@
} // namespace mirror
namespace verifier {
-class MethodVerifier;
+ class MethodVerifier;
+ class VerifierDeps;
} // namespace verifier
class ArtMethod;
@@ -85,7 +87,6 @@
class JavaVMExt;
struct JNIEnvExt;
class Monitor;
-class Runtime;
class ScopedObjectAccessAlreadyRunnable;
class ShadowFrame;
class SingleStepControl;
@@ -548,7 +549,8 @@
return tlsPtr_.frame_id_to_shadow_frame != nullptr;
}
- void VisitRoots(RootVisitor* visitor) REQUIRES_SHARED(Locks::mutator_lock_);
+ void VisitRoots(RootVisitor* visitor, VisitRootFlags flags = kVisitRootFlagAllRoots)
+ REQUIRES_SHARED(Locks::mutator_lock_);
ALWAYS_INLINE void VerifyStack() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -879,6 +881,15 @@
--tls32_.disable_thread_flip_count;
}
+ // Returns true if the thread is allowed to call into java.
+ bool CanCallIntoJava() const {
+ return can_call_into_java_;
+ }
+
+ void SetCanCallIntoJava(bool can_call_into_java) {
+ can_call_into_java_ = can_call_into_java;
+ }
+
// Activates single step control for debugging. The thread takes the
// ownership of the given SingleStepControl*. It is deleted by a call
// to DeactivateSingleStepControl or upon thread destruction.
@@ -947,11 +958,27 @@
}
std::vector<ArtMethod*>* GetStackTraceSample() const {
- return tlsPtr_.stack_trace_sample;
+ DCHECK(!IsAotCompiler());
+ return tlsPtr_.deps_or_stack_trace_sample.stack_trace_sample;
}
void SetStackTraceSample(std::vector<ArtMethod*>* sample) {
- tlsPtr_.stack_trace_sample = sample;
+ DCHECK(!IsAotCompiler());
+ tlsPtr_.deps_or_stack_trace_sample.stack_trace_sample = sample;
+ }
+
+ verifier::VerifierDeps* GetVerifierDeps() const {
+ DCHECK(IsAotCompiler());
+ return tlsPtr_.deps_or_stack_trace_sample.verifier_deps;
+ }
+
+ // It is the responsability of the caller to make sure the verifier_deps
+ // entry in the thread is cleared before destruction of the actual VerifierDeps
+ // object, or the thread.
+ void SetVerifierDeps(verifier::VerifierDeps* verifier_deps) {
+ DCHECK(IsAotCompiler());
+ DCHECK(verifier_deps == nullptr || tlsPtr_.deps_or_stack_trace_sample.verifier_deps == nullptr);
+ tlsPtr_.deps_or_stack_trace_sample.verifier_deps = verifier_deps;
}
uint64_t GetTraceClockBase() const {
@@ -989,7 +1016,7 @@
tls32_.state_and_flags.as_atomic_int.FetchAndAndSequentiallyConsistent(-1 ^ flag);
}
- void ResetQuickAllocEntryPointsForThread();
+ void ResetQuickAllocEntryPointsForThread(bool is_marking);
// Returns the remaining space in the TLAB.
size_t TlabSize() const;
@@ -1228,6 +1255,11 @@
// Install the protected region for implicit stack checks.
void InstallImplicitProtection();
+ template <bool kPrecise>
+ void VisitRoots(RootVisitor* visitor) REQUIRES_SHARED(Locks::mutator_lock_);
+
+ static bool IsAotCompiler();
+
// 32 bits of atomically changed state and flags. Keeping as 32 bits allows and atomic CAS to
// change from being Suspended to Runnable without a suspend request occurring.
union PACKED(4) StateAndFlags {
@@ -1378,7 +1410,7 @@
tls_ptr_sized_values() : card_table(nullptr), exception(nullptr), stack_end(nullptr),
managed_stack(), suspend_trigger(nullptr), jni_env(nullptr), tmp_jni_env(nullptr),
self(nullptr), opeer(nullptr), jpeer(nullptr), stack_begin(nullptr), stack_size(0),
- stack_trace_sample(nullptr), wait_next(nullptr), monitor_enter_object(nullptr),
+ deps_or_stack_trace_sample(), wait_next(nullptr), monitor_enter_object(nullptr),
top_handle_scope(nullptr), class_loader_override(nullptr), long_jump_context(nullptr),
instrumentation_stack(nullptr), debug_invoke_req(nullptr), single_step_control(nullptr),
stacked_shadow_frame_record(nullptr), deoptimization_context_stack(nullptr),
@@ -1432,8 +1464,18 @@
// Size of the stack.
size_t stack_size;
- // Pointer to previous stack trace captured by sampling profiler.
- std::vector<ArtMethod*>* stack_trace_sample;
+ // Sampling profiler and AOT verification cannot happen on the same run, so we share
+ // the same entry for the stack trace and the verifier deps.
+ union DepsOrStackTraceSample {
+ DepsOrStackTraceSample() {
+ verifier_deps = nullptr;
+ stack_trace_sample = nullptr;
+ }
+ // Pointer to previous stack trace captured by sampling profiler.
+ std::vector<ArtMethod*>* stack_trace_sample;
+ // When doing AOT verification, per-thread VerifierDeps.
+ verifier::VerifierDeps* verifier_deps;
+ } deps_or_stack_trace_sample;
// The next thread in the wait set this thread is part of or null if not waiting.
Thread* wait_next;
@@ -1555,6 +1597,10 @@
// Pending extra checkpoints if checkpoint_function_ is already used.
std::list<Closure*> checkpoint_overflow_ GUARDED_BY(Locks::thread_suspend_count_lock_);
+ // True if the thread is allowed to call back into java (for e.g. during class resolution).
+ // By default this is true.
+ bool can_call_into_java_;
+
friend class Dbg; // For SetStateUnsafe.
friend class gc::collector::SemiSpace; // For getting stack traces.
friend class Runtime; // For CreatePeer.
diff --git a/runtime/thread_list.cc b/runtime/thread_list.cc
index 27fb37a..bf9eef8 100644
--- a/runtime/thread_list.cc
+++ b/runtime/thread_list.cc
@@ -25,6 +25,8 @@
#include <sstream>
+#include "android-base/stringprintf.h"
+
#include "base/histogram-inl.h"
#include "base/mutex-inl.h"
#include "base/systrace.h"
@@ -52,6 +54,8 @@
namespace art {
+using android::base::StringPrintf;
+
static constexpr uint64_t kLongThreadSuspendThreshold = MsToNs(5);
static constexpr uint64_t kThreadSuspendTimeoutMs = 30 * 1000; // 30s.
// Use 0 since we want to yield to prevent blocking for an unpredictable amount of time.
@@ -375,7 +379,7 @@
return count;
}
-size_t ThreadList::RunEmptyCheckpoint() {
+size_t ThreadList::RunEmptyCheckpoint(std::vector<uint32_t>& runnable_thread_ids) {
Thread* self = Thread::Current();
Locks::mutator_lock_->AssertNotExclusiveHeld(self);
Locks::thread_list_lock_->AssertNotHeld(self);
@@ -392,6 +396,9 @@
// This thread will run an empty checkpoint (decrement the empty checkpoint barrier)
// some time in the near future.
++count;
+ if (kIsDebugBuild) {
+ runnable_thread_ids.push_back(thread->GetThreadId());
+ }
break;
}
if (thread->GetState() != kRunnable) {
@@ -1392,10 +1399,10 @@
}
}
-void ThreadList::VisitRoots(RootVisitor* visitor) const {
+void ThreadList::VisitRoots(RootVisitor* visitor, VisitRootFlags flags) const {
MutexLock mu(Thread::Current(), *Locks::thread_list_lock_);
for (const auto& thread : list_) {
- thread->VisitRoots(visitor);
+ thread->VisitRoots(visitor, flags);
}
}
diff --git a/runtime/thread_list.h b/runtime/thread_list.h
index 133d430..658db00 100644
--- a/runtime/thread_list.h
+++ b/runtime/thread_list.h
@@ -27,6 +27,7 @@
#include <bitset>
#include <list>
+#include <vector>
namespace art {
namespace gc {
@@ -106,7 +107,9 @@
// in-flight mutator heap access (eg. a read barrier.) Runnable threads will respond by
// decrementing the empty checkpoint barrier count. This works even when the weak ref access is
// disabled. Only one concurrent use is currently supported.
- size_t RunEmptyCheckpoint()
+ // In debug build, runnable_thread_ids will be populated with the thread IDS of the runnable
+ // thread to wait for.
+ size_t RunEmptyCheckpoint(std::vector<uint32_t>& runnable_thread_ids)
REQUIRES(!Locks::thread_list_lock_, !Locks::thread_suspend_count_lock_);
size_t RunCheckpointOnRunnableThreads(Closure* checkpoint_function)
@@ -152,7 +155,7 @@
!Locks::thread_list_lock_,
!Locks::thread_suspend_count_lock_);
- void VisitRoots(RootVisitor* visitor) const
+ void VisitRoots(RootVisitor* visitor, VisitRootFlags flags) const
REQUIRES_SHARED(Locks::mutator_lock_);
void VisitRootsForSuspendedThreads(RootVisitor* visitor)
diff --git a/runtime/thread_pool.cc b/runtime/thread_pool.cc
index 65fd999..d9179c3 100644
--- a/runtime/thread_pool.cc
+++ b/runtime/thread_pool.cc
@@ -21,6 +21,8 @@
#include <sys/time.h>
#include <sys/resource.h>
+#include "android-base/stringprintf.h"
+
#include "base/bit_utils.h"
#include "base/casts.h"
#include "base/logging.h"
@@ -31,6 +33,8 @@
namespace art {
+using android::base::StringPrintf;
+
static constexpr bool kMeasureWaitTime = false;
ThreadPoolWorker::ThreadPoolWorker(ThreadPool* thread_pool, const std::string& name,
@@ -85,6 +89,9 @@
ThreadPoolWorker* worker = reinterpret_cast<ThreadPoolWorker*>(arg);
Runtime* runtime = Runtime::Current();
CHECK(runtime->AttachCurrentThread(worker->name_.c_str(), true, nullptr, false));
+ worker->thread_ = Thread::Current();
+ // Thread pool workers cannot call into java.
+ worker->thread_->SetCanCallIntoJava(false);
// Do work until its time to shut down.
worker->Run();
runtime->DetachCurrentThread();
diff --git a/runtime/thread_pool.h b/runtime/thread_pool.h
index 2ff33a6..7ecfcd1 100644
--- a/runtime/thread_pool.h
+++ b/runtime/thread_pool.h
@@ -62,6 +62,8 @@
// Set the "nice" priorty for this worker.
void SetPthreadPriority(int priority);
+ Thread* GetThread() const { return thread_; }
+
protected:
ThreadPoolWorker(ThreadPool* thread_pool, const std::string& name, size_t stack_size);
static void* Callback(void* arg) REQUIRES(!Locks::mutator_lock_);
@@ -71,12 +73,14 @@
const std::string name_;
std::unique_ptr<MemMap> stack_;
pthread_t pthread_;
+ Thread* thread_;
private:
friend class ThreadPool;
DISALLOW_COPY_AND_ASSIGN(ThreadPoolWorker);
};
+// Note that thread pool workers will set Thread#setCanCallIntoJava to false.
class ThreadPool {
public:
// Returns the number of threads in the thread pool.
@@ -84,6 +88,10 @@
return threads_.size();
}
+ const std::vector<ThreadPoolWorker*>& GetWorkers() const {
+ return threads_;
+ }
+
// Broadcast to the workers and tell them to empty out the work queue.
void StartWorkers(Thread* self) REQUIRES(!task_queue_lock_);
diff --git a/runtime/thread_pool_test.cc b/runtime/thread_pool_test.cc
index 89e9005..14c2c3b 100644
--- a/runtime/thread_pool_test.cc
+++ b/runtime/thread_pool_test.cc
@@ -114,8 +114,11 @@
thread_pool.StopWorkers(self);
thread_pool.Wait(self, false, false); // We should not deadlock here.
- // Drain the task list.
- thread_pool.Wait(self, /* do_work */ true, false); // We should not deadlock here.
+
+ // Drain the task list. Note: we have to restart here, as no tasks will be finished when
+ // the pool is stopped.
+ thread_pool.StartWorkers(self);
+ thread_pool.Wait(self, /* do_work */ true, false);
}
class TreeTask : public Task {
diff --git a/runtime/ti/agent.cc b/runtime/ti/agent.cc
index d21ff77..0bba44c 100644
--- a/runtime/ti/agent.cc
+++ b/runtime/ti/agent.cc
@@ -15,12 +15,17 @@
*/
#include "agent.h"
+
+#include "android-base/stringprintf.h"
+
#include "java_vm_ext.h"
#include "runtime.h"
namespace art {
namespace ti {
+using android::base::StringPrintf;
+
const char* AGENT_ON_LOAD_FUNCTION_NAME = "Agent_OnLoad";
const char* AGENT_ON_ATTACH_FUNCTION_NAME = "Agent_OnAttach";
const char* AGENT_ON_UNLOAD_FUNCTION_NAME = "Agent_OnUnload";
diff --git a/runtime/ti/agent.h b/runtime/ti/agent.h
index 6561756..7408aee 100644
--- a/runtime/ti/agent.h
+++ b/runtime/ti/agent.h
@@ -20,7 +20,6 @@
#include <dlfcn.h>
#include <jni.h> // for jint, JavaVM* etc declarations
-#include "base/stringprintf.h"
#include "runtime.h"
#include "utils.h"
diff --git a/runtime/trace.cc b/runtime/trace.cc
index f564de4..9d9360e 100644
--- a/runtime/trace.cc
+++ b/runtime/trace.cc
@@ -19,6 +19,8 @@
#include <sys/uio.h>
#include <unistd.h>
+#include "android-base/stringprintf.h"
+
#include "art_method-inl.h"
#include "base/casts.h"
#include "base/enums.h"
@@ -46,6 +48,8 @@
namespace art {
+using android::base::StringPrintf;
+
static constexpr size_t TraceActionBits = MinimumBitsToStore(
static_cast<size_t>(kTraceMethodActionMask));
static constexpr uint8_t kOpNewMethod = 1U;
diff --git a/runtime/transaction.cc b/runtime/transaction.cc
index c5da5d2..2536968 100644
--- a/runtime/transaction.cc
+++ b/runtime/transaction.cc
@@ -167,9 +167,10 @@
array_log.LogValue(index, value);
}
-void Transaction::RecordResolveString(ObjPtr<mirror::DexCache> dex_cache, uint32_t string_idx) {
+void Transaction::RecordResolveString(ObjPtr<mirror::DexCache> dex_cache,
+ dex::StringIndex string_idx) {
DCHECK(dex_cache != nullptr);
- DCHECK_LT(string_idx, dex_cache->GetDexFile()->NumStringIds());
+ DCHECK_LT(string_idx.index_, dex_cache->GetDexFile()->NumStringIds());
MutexLock mu(Thread::Current(), log_lock_);
resolve_string_logs_.push_back(ResolveStringLog(dex_cache, string_idx));
}
@@ -510,11 +511,11 @@
}
Transaction::ResolveStringLog::ResolveStringLog(ObjPtr<mirror::DexCache> dex_cache,
- uint32_t string_idx)
+ dex::StringIndex string_idx)
: dex_cache_(dex_cache),
string_idx_(string_idx) {
DCHECK(dex_cache != nullptr);
- DCHECK_LT(string_idx_, dex_cache->GetDexFile()->NumStringIds());
+ DCHECK_LT(string_idx_.index_, dex_cache->GetDexFile()->NumStringIds());
}
void Transaction::ResolveStringLog::VisitRoots(RootVisitor* visitor) {
diff --git a/runtime/transaction.h b/runtime/transaction.h
index 2ec2f50..1774657 100644
--- a/runtime/transaction.h
+++ b/runtime/transaction.h
@@ -20,6 +20,7 @@
#include "base/macros.h"
#include "base/mutex.h"
#include "base/value_object.h"
+#include "dex_file_types.h"
#include "gc_root.h"
#include "object_callbacks.h"
#include "offsets.h"
@@ -97,7 +98,7 @@
REQUIRES(!log_lock_);
// Record resolve string.
- void RecordResolveString(ObjPtr<mirror::DexCache> dex_cache, uint32_t string_idx)
+ void RecordResolveString(ObjPtr<mirror::DexCache> dex_cache, dex::StringIndex string_idx)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!log_lock_);
@@ -197,7 +198,7 @@
class ResolveStringLog : public ValueObject {
public:
- ResolveStringLog(ObjPtr<mirror::DexCache> dex_cache, uint32_t string_idx);
+ ResolveStringLog(ObjPtr<mirror::DexCache> dex_cache, dex::StringIndex string_idx);
void Undo() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -205,7 +206,7 @@
private:
GcRoot<mirror::DexCache> dex_cache_;
- const uint32_t string_idx_;
+ const dex::StringIndex string_idx_;
};
void LogInternedString(const InternStringLog& log)
diff --git a/runtime/transaction_test.cc b/runtime/transaction_test.cc
index 77c2b76..a43c967 100644
--- a/runtime/transaction_test.cc
+++ b/runtime/transaction_test.cc
@@ -26,8 +26,6 @@
namespace art {
-static const size_t kDexNoIndex = DexFile::kDexNoIndex; // Make copy to prevent linking errors.
-
class TransactionTest : public CommonRuntimeTest {
public:
// Tests failing class initialization due to native call with transaction rollback.
@@ -507,8 +505,8 @@
static const char* kResolvedString = "ResolvedString";
const DexFile::StringId* string_id = dex_file->FindStringId(kResolvedString);
ASSERT_TRUE(string_id != nullptr);
- uint32_t string_idx = dex_file->GetIndexForStringId(*string_id);
- ASSERT_NE(string_idx, kDexNoIndex);
+ dex::StringIndex string_idx = dex_file->GetIndexForStringId(*string_id);
+ ASSERT_TRUE(string_idx.IsValid());
// String should only get resolved by the initializer.
EXPECT_TRUE(class_linker_->LookupString(*dex_file, string_idx, h_dex_cache) == nullptr);
EXPECT_TRUE(h_dex_cache->GetResolvedString(string_idx) == nullptr);
diff --git a/runtime/type_lookup_table.cc b/runtime/type_lookup_table.cc
index 56e9262..16cd722 100644
--- a/runtime/type_lookup_table.cc
+++ b/runtime/type_lookup_table.cc
@@ -50,17 +50,19 @@
return num_class_defs != 0u && num_class_defs <= std::numeric_limits<uint16_t>::max();
}
-TypeLookupTable* TypeLookupTable::Create(const DexFile& dex_file, uint8_t* storage) {
+std::unique_ptr<TypeLookupTable> TypeLookupTable::Create(const DexFile& dex_file,
+ uint8_t* storage) {
const uint32_t num_class_defs = dex_file.NumClassDefs();
- return SupportedSize(num_class_defs)
+ return std::unique_ptr<TypeLookupTable>(SupportedSize(num_class_defs)
? new TypeLookupTable(dex_file, storage)
- : nullptr;
+ : nullptr);
}
-TypeLookupTable* TypeLookupTable::Open(const uint8_t* dex_file_pointer,
- const uint8_t* raw_data,
- uint32_t num_class_defs) {
- return new TypeLookupTable(dex_file_pointer, raw_data, num_class_defs);
+std::unique_ptr<TypeLookupTable> TypeLookupTable::Open(const uint8_t* dex_file_pointer,
+ const uint8_t* raw_data,
+ uint32_t num_class_defs) {
+ return std::unique_ptr<TypeLookupTable>(
+ new TypeLookupTable(dex_file_pointer, raw_data, num_class_defs));
}
TypeLookupTable::TypeLookupTable(const DexFile& dex_file, uint8_t* storage)
diff --git a/runtime/type_lookup_table.h b/runtime/type_lookup_table.h
index 9595743..3f6f76f 100644
--- a/runtime/type_lookup_table.h
+++ b/runtime/type_lookup_table.h
@@ -60,13 +60,14 @@
}
// Method creates lookup table for dex file
- static TypeLookupTable* Create(const DexFile& dex_file, uint8_t* storage = nullptr);
+ static std::unique_ptr<TypeLookupTable> Create(const DexFile& dex_file,
+ uint8_t* storage = nullptr);
// Method opens lookup table from binary data. Lookups will traverse strings and other
// data contained in dex_file as well. Lookup table does not own raw_data or dex_file.
- static TypeLookupTable* Open(const uint8_t* dex_file_pointer,
- const uint8_t* raw_data,
- uint32_t num_class_defs);
+ static std::unique_ptr<TypeLookupTable> Open(const uint8_t* dex_file_pointer,
+ const uint8_t* raw_data,
+ uint32_t num_class_defs);
// Method returns pointer to binary data of lookup table. Used by the oat writer.
const uint8_t* RawData() const {
diff --git a/runtime/utils.cc b/runtime/utils.cc
index 6ed54f7..8867743 100644
--- a/runtime/utils.cc
+++ b/runtime/utils.cc
@@ -25,6 +25,9 @@
#include <unistd.h>
#include <memory>
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+
#include "base/stl_util.h"
#include "base/unix_file/fd_file.h"
#include "dex_file-inl.h"
@@ -37,6 +40,7 @@
#if defined(__APPLE__)
#include "AvailabilityMacros.h" // For MAC_OS_X_VERSION_MAX_ALLOWED
#include <sys/syscall.h>
+#include <crt_externs.h>
#endif
#if defined(__linux__)
@@ -45,6 +49,9 @@
namespace art {
+using android::base::StringAppendF;
+using android::base::StringPrintf;
+
static const uint8_t kBase64Map[256] = {
255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255, 255,
@@ -138,59 +145,6 @@
return result;
}
-void GetThreadStack(pthread_t thread, void** stack_base, size_t* stack_size, size_t* guard_size) {
-#if defined(__APPLE__)
- *stack_size = pthread_get_stacksize_np(thread);
- void* stack_addr = pthread_get_stackaddr_np(thread);
-
- // Check whether stack_addr is the base or end of the stack.
- // (On Mac OS 10.7, it's the end.)
- int stack_variable;
- if (stack_addr > &stack_variable) {
- *stack_base = reinterpret_cast<uint8_t*>(stack_addr) - *stack_size;
- } else {
- *stack_base = stack_addr;
- }
-
- // This is wrong, but there doesn't seem to be a way to get the actual value on the Mac.
- pthread_attr_t attributes;
- CHECK_PTHREAD_CALL(pthread_attr_init, (&attributes), __FUNCTION__);
- CHECK_PTHREAD_CALL(pthread_attr_getguardsize, (&attributes, guard_size), __FUNCTION__);
- CHECK_PTHREAD_CALL(pthread_attr_destroy, (&attributes), __FUNCTION__);
-#else
- pthread_attr_t attributes;
- CHECK_PTHREAD_CALL(pthread_getattr_np, (thread, &attributes), __FUNCTION__);
- CHECK_PTHREAD_CALL(pthread_attr_getstack, (&attributes, stack_base, stack_size), __FUNCTION__);
- CHECK_PTHREAD_CALL(pthread_attr_getguardsize, (&attributes, guard_size), __FUNCTION__);
- CHECK_PTHREAD_CALL(pthread_attr_destroy, (&attributes), __FUNCTION__);
-
-#if defined(__GLIBC__)
- // If we're the main thread, check whether we were run with an unlimited stack. In that case,
- // glibc will have reported a 2GB stack for our 32-bit process, and our stack overflow detection
- // will be broken because we'll die long before we get close to 2GB.
- bool is_main_thread = (::art::GetTid() == getpid());
- if (is_main_thread) {
- rlimit stack_limit;
- if (getrlimit(RLIMIT_STACK, &stack_limit) == -1) {
- PLOG(FATAL) << "getrlimit(RLIMIT_STACK) failed";
- }
- if (stack_limit.rlim_cur == RLIM_INFINITY) {
- size_t old_stack_size = *stack_size;
-
- // Use the kernel default limit as our size, and adjust the base to match.
- *stack_size = 8 * MB;
- *stack_base = reinterpret_cast<uint8_t*>(*stack_base) + (old_stack_size - *stack_size);
-
- VLOG(threads) << "Limiting unlimited stack (reported as " << PrettySize(old_stack_size) << ")"
- << " to " << PrettySize(*stack_size)
- << " with base " << *stack_base;
- }
- }
-#endif
-
-#endif
-}
-
bool ReadFileToString(const std::string& file_name, std::string* result) {
File file(file_name, O_RDONLY, false);
if (!file.IsOpened()) {
@@ -410,6 +364,10 @@
negative_str, byte_count / kBytesPerUnit[i], kUnitStrings[i]);
}
+static inline constexpr bool NeedsEscaping(uint16_t ch) {
+ return (ch < ' ' || ch > '~');
+}
+
std::string PrintableChar(uint16_t ch) {
std::string result;
result += '\'';
@@ -781,67 +739,6 @@
}
}
-std::string Trim(const std::string& s) {
- std::string result;
- unsigned int start_index = 0;
- unsigned int end_index = s.size() - 1;
-
- // Skip initial whitespace.
- while (start_index < s.size()) {
- if (!isspace(s[start_index])) {
- break;
- }
- start_index++;
- }
-
- // Skip terminating whitespace.
- while (end_index >= start_index) {
- if (!isspace(s[end_index])) {
- break;
- }
- end_index--;
- }
-
- // All spaces, no beef.
- if (end_index < start_index) {
- return "";
- }
- // Start_index is the first non-space, end_index is the last one.
- return s.substr(start_index, end_index - start_index + 1);
-}
-
-template <typename StringT>
-std::string Join(const std::vector<StringT>& strings, char separator) {
- if (strings.empty()) {
- return "";
- }
-
- std::string result(strings[0]);
- for (size_t i = 1; i < strings.size(); ++i) {
- result += separator;
- result += strings[i];
- }
- return result;
-}
-
-// Explicit instantiations.
-template std::string Join<std::string>(const std::vector<std::string>& strings, char separator);
-template std::string Join<const char*>(const std::vector<const char*>& strings, char separator);
-
-bool StartsWith(const std::string& s, const char* prefix) {
- return s.compare(0, strlen(prefix), prefix) == 0;
-}
-
-bool EndsWith(const std::string& s, const char* suffix) {
- size_t suffix_length = strlen(suffix);
- size_t string_length = s.size();
- if (suffix_length > string_length) {
- return false;
- }
- size_t offset = string_length - suffix_length;
- return s.compare(offset, suffix_length, suffix) == 0;
-}
-
void SetThreadName(const char* thread_name) {
int hasAt = 0;
int hasDot = 0;
@@ -891,31 +788,6 @@
*task_cpu = strtoull(fields[36].c_str(), nullptr, 10);
}
-std::string GetSchedulerGroupName(pid_t tid) {
- // /proc/<pid>/cgroup looks like this:
- // 2:devices:/
- // 1:cpuacct,cpu:/
- // We want the third field from the line whose second field contains the "cpu" token.
- std::string cgroup_file;
- if (!ReadFileToString(StringPrintf("/proc/self/task/%d/cgroup", tid), &cgroup_file)) {
- return "";
- }
- std::vector<std::string> cgroup_lines;
- Split(cgroup_file, '\n', &cgroup_lines);
- for (size_t i = 0; i < cgroup_lines.size(); ++i) {
- std::vector<std::string> cgroup_fields;
- Split(cgroup_lines[i], ':', &cgroup_fields);
- std::vector<std::string> cgroups;
- Split(cgroup_fields[1], ',', &cgroups);
- for (size_t j = 0; j < cgroups.size(); ++j) {
- if (cgroups[j] == "cpu") {
- return cgroup_fields[2].substr(1); // Skip the leading slash.
- }
- }
- }
- return "";
-}
-
const char* GetAndroidRoot() {
const char* android_root = getenv("ANDROID_ROOT");
if (android_root == nullptr) {
@@ -1004,7 +876,9 @@
return false;
}
std::string cache_file(&location[1]); // skip leading slash
- if (!EndsWith(location, ".dex") && !EndsWith(location, ".art") && !EndsWith(location, ".oat")) {
+ if (!android::base::EndsWith(location, ".dex") &&
+ !android::base::EndsWith(location, ".art") &&
+ !android::base::EndsWith(location, ".oat")) {
cache_file += "/";
cache_file += DexFile::kClassesDex;
}
@@ -1031,7 +905,7 @@
}
int ExecAndReturnCode(std::vector<std::string>& arg_vector, std::string* error_msg) {
- const std::string command_line(Join(arg_vector, ' '));
+ const std::string command_line(android::base::Join(arg_vector, ' '));
CHECK_GE(arg_vector.size(), 1U) << command_line;
// Convert the args to char pointers.
@@ -1090,7 +964,7 @@
bool Exec(std::vector<std::string>& arg_vector, std::string* error_msg) {
int status = ExecAndReturnCode(arg_vector, error_msg);
if (status != 0) {
- const std::string command_line(Join(arg_vector, ' '));
+ const std::string command_line(android::base::Join(arg_vector, ' '));
*error_msg = StringPrintf("Failed execv(%s) because non-0 exit status",
command_line.c_str());
return false;
diff --git a/runtime/utils.h b/runtime/utils.h
index 1e98057..16ef706 100644
--- a/runtime/utils.h
+++ b/runtime/utils.h
@@ -64,45 +64,12 @@
return true;
}
-// Return whether x / divisor == x * (1.0f / divisor), for every float x.
-static constexpr bool CanDivideByReciprocalMultiplyFloat(int32_t divisor) {
- // True, if the most significant bits of divisor are 0.
- return ((divisor & 0x7fffff) == 0);
-}
-
-// Return whether x / divisor == x * (1.0 / divisor), for every double x.
-static constexpr bool CanDivideByReciprocalMultiplyDouble(int64_t divisor) {
- // True, if the most significant bits of divisor are 0.
- return ((divisor & ((UINT64_C(1) << 52) - 1)) == 0);
-}
-
static inline uint32_t PointerToLowMemUInt32(const void* p) {
uintptr_t intp = reinterpret_cast<uintptr_t>(p);
DCHECK_LE(intp, 0xFFFFFFFFU);
return intp & 0xFFFFFFFFU;
}
-static inline bool NeedsEscaping(uint16_t ch) {
- return (ch < ' ' || ch > '~');
-}
-
-template <typename T> T SafeAbs(T value) {
- // std::abs has undefined behavior on min limits.
- DCHECK_NE(value, std::numeric_limits<T>::min());
- return std::abs(value);
-}
-
-template <typename T> T AbsOrMin(T value) {
- return (value == std::numeric_limits<T>::min())
- ? value
- : std::abs(value);
-}
-
-template <typename T>
-inline typename std::make_unsigned<T>::type MakeUnsigned(T x) {
- return static_cast<typename std::make_unsigned<T>::type>(x);
-}
-
uint8_t* DecodeBase64(const char* src, size_t* dst_size);
std::string PrintableChar(uint16_t ch);
@@ -111,12 +78,6 @@
// Java escapes are used for non-ASCII characters.
std::string PrintableString(const char* utf8);
-// Tests whether 's' starts with 'prefix'.
-bool StartsWith(const std::string& s, const char* prefix);
-
-// Tests whether 's' ends with 'suffix'.
-bool EndsWith(const std::string& s, const char* suffix);
-
// Used to implement PrettyClass, PrettyField, PrettyMethod, and PrettyTypeOf,
// one of which is probably more useful to you.
// Returns a human-readable equivalent of 'descriptor'. So "I" would be "int",
@@ -167,27 +128,15 @@
// strings. Empty strings will be omitted.
void Split(const std::string& s, char separator, std::vector<std::string>* result);
-// Trims whitespace off both ends of the given string.
-std::string Trim(const std::string& s);
-
-// Joins a vector of strings into a single string, using the given separator.
-template <typename StringT> std::string Join(const std::vector<StringT>& strings, char separator);
-
// Returns the calling thread's tid. (The C libraries don't expose this.)
pid_t GetTid();
// Returns the given thread's name.
std::string GetThreadName(pid_t tid);
-// Returns details of the given thread's stack.
-void GetThreadStack(pthread_t thread, void** stack_base, size_t* stack_size, size_t* guard_size);
-
// Reads data from "/proc/self/task/${tid}/stat".
void GetTaskStats(pid_t tid, char* state, int* utime, int* stime, int* task_cpu);
-// Returns the name of the scheduler group for the given thread the current process, or the empty string.
-std::string GetSchedulerGroupName(pid_t tid);
-
// Sets the name of the current thread. The name may be truncated to an
// implementation-defined limit.
void SetThreadName(const char* thread_name);
@@ -251,15 +200,6 @@
}
};
-template <typename Vector>
-void Push32(Vector* buf, int32_t data) {
- static_assert(std::is_same<typename Vector::value_type, uint8_t>::value, "Invalid value type");
- buf->push_back(data & 0xff);
- buf->push_back((data >> 8) & 0xff);
- buf->push_back((data >> 16) & 0xff);
- buf->push_back((data >> 24) & 0xff);
-}
-
inline bool TestBitmap(size_t idx, const uint8_t* bitmap) {
return ((bitmap[idx / kBitsPerByte] >> (idx % kBitsPerByte)) & 0x01) != 0;
}
@@ -334,12 +274,6 @@
return dist(rng);
}
-// All of the elements from one container to another.
-template <typename Dest, typename Src>
-static void AddAll(Dest& dest, const Src& src) {
- dest.insert(src.begin(), src.end());
-}
-
// Return the file size in bytes or -1 if the file does not exists.
int64_t GetFileSizeBytes(const std::string& filename);
@@ -350,6 +284,12 @@
__builtin___clear_cache(begin, end);
}
+inline void FlushDataCache(char* begin, char* end) {
+ // Same as FlushInstructionCache for lack of other builtin. __builtin___clear_cache
+ // flushes both caches.
+ __builtin___clear_cache(begin, end);
+}
+
template <typename T>
constexpr PointerSize ConvertToPointerSize(T any) {
if (any == 4 || any == 8) {
diff --git a/runtime/utils/dex_cache_arrays_layout-inl.h b/runtime/utils/dex_cache_arrays_layout-inl.h
index c7875b5..bd1b044 100644
--- a/runtime/utils/dex_cache_arrays_layout-inl.h
+++ b/runtime/utils/dex_cache_arrays_layout-inl.h
@@ -65,8 +65,8 @@
return PointerSize::k32;
}
-inline size_t DexCacheArraysLayout::TypeOffset(uint32_t type_idx) const {
- return types_offset_ + ElementOffset(GcRootAsPointerSize<mirror::Class>(), type_idx);
+inline size_t DexCacheArraysLayout::TypeOffset(dex::TypeIndex type_idx) const {
+ return types_offset_ + ElementOffset(GcRootAsPointerSize<mirror::Class>(), type_idx.index_);
}
inline size_t DexCacheArraysLayout::TypesSize(size_t num_elements) const {
diff --git a/runtime/utils/dex_cache_arrays_layout.h b/runtime/utils/dex_cache_arrays_layout.h
index ae3bfab..7d4b23a 100644
--- a/runtime/utils/dex_cache_arrays_layout.h
+++ b/runtime/utils/dex_cache_arrays_layout.h
@@ -18,6 +18,7 @@
#define ART_RUNTIME_UTILS_DEX_CACHE_ARRAYS_LAYOUT_H_
#include "dex_file.h"
+#include "dex_file_types.h"
namespace art {
@@ -59,7 +60,7 @@
return types_offset_;
}
- size_t TypeOffset(uint32_t type_idx) const;
+ size_t TypeOffset(dex::TypeIndex type_idx) const;
size_t TypesSize(size_t num_elements) const;
diff --git a/runtime/utils_test.cc b/runtime/utils_test.cc
index be4d394..82d92fc 100644
--- a/runtime/utils_test.cc
+++ b/runtime/utils_test.cc
@@ -273,58 +273,6 @@
EXPECT_EQ(expected, actual);
}
-TEST_F(UtilsTest, Join) {
- std::vector<std::string> strings;
-
- strings.clear();
- EXPECT_EQ("", Join(strings, ':'));
-
- strings.clear();
- strings.push_back("foo");
- EXPECT_EQ("foo", Join(strings, ':'));
-
- strings.clear();
- strings.push_back("");
- strings.push_back("foo");
- EXPECT_EQ(":foo", Join(strings, ':'));
-
- strings.clear();
- strings.push_back("foo");
- strings.push_back("");
- EXPECT_EQ("foo:", Join(strings, ':'));
-
- strings.clear();
- strings.push_back("");
- strings.push_back("foo");
- strings.push_back("");
- EXPECT_EQ(":foo:", Join(strings, ':'));
-
- strings.clear();
- strings.push_back("foo");
- strings.push_back("bar");
- EXPECT_EQ("foo:bar", Join(strings, ':'));
-
- strings.clear();
- strings.push_back("foo");
- strings.push_back("bar");
- strings.push_back("baz");
- EXPECT_EQ("foo:bar:baz", Join(strings, ':'));
-}
-
-TEST_F(UtilsTest, StartsWith) {
- EXPECT_FALSE(StartsWith("foo", "bar"));
- EXPECT_TRUE(StartsWith("foo", "foo"));
- EXPECT_TRUE(StartsWith("food", "foo"));
- EXPECT_FALSE(StartsWith("fo", "foo"));
-}
-
-TEST_F(UtilsTest, EndsWith) {
- EXPECT_FALSE(EndsWith("foo", "bar"));
- EXPECT_TRUE(EndsWith("foo", "foo"));
- EXPECT_TRUE(EndsWith("foofoo", "foo"));
- EXPECT_FALSE(EndsWith("oo", "foo"));
-}
-
TEST_F(UtilsTest, GetDalvikCacheFilename) {
std::string name;
std::string error;
diff --git a/runtime/vdex_file.cc b/runtime/vdex_file.cc
index b3dab58..dabf8c8 100644
--- a/runtime/vdex_file.cc
+++ b/runtime/vdex_file.cc
@@ -20,6 +20,7 @@
#include "base/logging.h"
#include "base/unix_file/fd_file.h"
+#include "dex_file.h"
namespace art {
@@ -34,10 +35,12 @@
return (memcmp(version_, kVdexVersion, sizeof(kVdexVersion)) == 0);
}
-VdexFile::Header::Header(uint32_t dex_size,
+VdexFile::Header::Header(uint32_t number_of_dex_files,
+ uint32_t dex_size,
uint32_t verifier_deps_size,
uint32_t quickening_info_size)
- : dex_size_(dex_size),
+ : number_of_dex_files_(number_of_dex_files),
+ dex_size_(dex_size),
verifier_deps_size_(verifier_deps_size),
quickening_info_size_(quickening_info_size) {
memcpy(magic_, kVdexMagic, sizeof(kVdexMagic));
@@ -73,10 +76,19 @@
return nullptr;
}
+ return Open(vdex_file->Fd(), vdex_length, vdex_filename, writable, low_4gb, error_msg);
+}
+
+VdexFile* VdexFile::Open(int file_fd,
+ size_t vdex_length,
+ const std::string& vdex_filename,
+ bool writable,
+ bool low_4gb,
+ std::string* error_msg) {
std::unique_ptr<MemMap> mmap(MemMap::MapFile(vdex_length,
writable ? PROT_READ | PROT_WRITE : PROT_READ,
MAP_SHARED,
- vdex_file->Fd(),
+ file_fd,
0 /* start offset */,
low_4gb,
vdex_filename.c_str(),
@@ -90,4 +102,16 @@
return new VdexFile(mmap.release());
}
+const uint8_t* VdexFile::GetNextDexFileData(const uint8_t* cursor) const {
+ DCHECK(cursor == nullptr || (cursor > Begin() && cursor <= End()));
+ if (cursor == nullptr) {
+ // Beginning of the iteration, return the first dex file if there is one.
+ return HasDexSection() ? DexBegin() : nullptr;
+ } else {
+ // Fetch the next dex file. Return null if there is none.
+ const uint8_t* data = cursor + reinterpret_cast<const DexFile::Header*>(cursor)->file_size_;
+ return (data == DexEnd()) ? nullptr : data;
+ }
+}
+
} // namespace art
diff --git a/runtime/vdex_file.h b/runtime/vdex_file.h
index edd6ffe..3b114a9 100644
--- a/runtime/vdex_file.h
+++ b/runtime/vdex_file.h
@@ -43,7 +43,10 @@
public:
struct Header {
public:
- Header(uint32_t dex_size, uint32_t verifier_deps_size, uint32_t quickening_info_size);
+ Header(uint32_t number_of_dex_files_,
+ uint32_t dex_size,
+ uint32_t verifier_deps_size,
+ uint32_t quickening_info_size);
const char* GetMagic() const { return reinterpret_cast<const char*>(magic_); }
const char* GetVersion() const { return reinterpret_cast<const char*>(version_); }
@@ -54,23 +57,34 @@
uint32_t GetDexSize() const { return dex_size_; }
uint32_t GetVerifierDepsSize() const { return verifier_deps_size_; }
uint32_t GetQuickeningInfoSize() const { return quickening_info_size_; }
+ uint32_t GetNumberOfDexFiles() const { return number_of_dex_files_; }
private:
static constexpr uint8_t kVdexMagic[] = { 'v', 'd', 'e', 'x' };
- static constexpr uint8_t kVdexVersion[] = { '0', '0', '0', '\0' };
+ static constexpr uint8_t kVdexVersion[] = { '0', '0', '1', '\0' };
uint8_t magic_[4];
uint8_t version_[4];
+ uint32_t number_of_dex_files_;
uint32_t dex_size_;
uint32_t verifier_deps_size_;
uint32_t quickening_info_size_;
};
+ typedef uint32_t VdexChecksum;
+
static VdexFile* Open(const std::string& vdex_filename,
bool writable,
bool low_4gb,
std::string* error_msg);
+ static VdexFile* Open(int file_fd,
+ size_t vdex_length,
+ const std::string& vdex_filename,
+ bool writable,
+ bool low_4gb,
+ std::string* error_msg);
+
const uint8_t* Begin() const { return mmap_->Begin(); }
const uint8_t* End() const { return mmap_->End(); }
size_t Size() const { return mmap_->Size(); }
@@ -81,12 +95,50 @@
ArrayRef<const uint8_t> GetVerifierDepsData() const {
return ArrayRef<const uint8_t>(
- Begin() + sizeof(Header) + GetHeader().GetDexSize(), GetHeader().GetVerifierDepsSize());
+ DexBegin() + GetHeader().GetDexSize(), GetHeader().GetVerifierDepsSize());
+ }
+
+ ArrayRef<const uint8_t> GetQuickeningInfo() const {
+ return ArrayRef<const uint8_t>(
+ GetVerifierDepsData().data() + GetHeader().GetVerifierDepsSize(),
+ GetHeader().GetQuickeningInfoSize());
+ }
+
+ bool IsValid() const {
+ return mmap_->Size() >= sizeof(Header) && GetHeader().IsValid();
+ }
+
+ // This method is for iterating over the dex files in the vdex. If `cursor` is null,
+ // the first dex file is returned. If `cursor` is not null, it must point to a dex
+ // file and this method returns the next dex file if there is one, or null if there
+ // is none.
+ const uint8_t* GetNextDexFileData(const uint8_t* cursor) const;
+
+ // Get the location checksum of the dex file number `dex_file_index`.
+ uint32_t GetLocationChecksum(uint32_t dex_file_index) const {
+ DCHECK_LT(dex_file_index, GetHeader().GetNumberOfDexFiles());
+ return reinterpret_cast<const uint32_t*>(Begin() + sizeof(Header))[dex_file_index];
}
private:
explicit VdexFile(MemMap* mmap) : mmap_(mmap) {}
+ bool HasDexSection() const {
+ return GetHeader().GetDexSize() != 0;
+ }
+
+ const uint8_t* DexBegin() const {
+ return Begin() + sizeof(Header) + GetSizeOfChecksumsSection();
+ }
+
+ const uint8_t* DexEnd() const {
+ return DexBegin() + GetHeader().GetDexSize();
+ }
+
+ size_t GetSizeOfChecksumsSection() const {
+ return sizeof(VdexChecksum) * GetHeader().GetNumberOfDexFiles();
+ }
+
std::unique_ptr<MemMap> mmap_;
DISALLOW_COPY_AND_ASSIGN(VdexFile);
diff --git a/runtime/verifier/method_verifier-inl.h b/runtime/verifier/method_verifier-inl.h
index def61db..363bd8f 100644
--- a/runtime/verifier/method_verifier-inl.h
+++ b/runtime/verifier/method_verifier-inl.h
@@ -74,7 +74,7 @@
return !failure_messages_.empty();
}
-inline const RegType& MethodVerifier::ResolveCheckedClass(uint32_t class_idx) {
+inline const RegType& MethodVerifier::ResolveCheckedClass(dex::TypeIndex class_idx) {
DCHECK(!HasFailures());
const RegType& result = ResolveClassAndCheckAccess(class_idx);
DCHECK(!HasFailures());
diff --git a/runtime/verifier/method_verifier.cc b/runtime/verifier/method_verifier.cc
index d9e3ea7..7e23c8b 100644
--- a/runtime/verifier/method_verifier.cc
+++ b/runtime/verifier/method_verifier.cc
@@ -18,6 +18,8 @@
#include <iostream>
+#include "android-base/stringprintf.h"
+
#include "art_field-inl.h"
#include "art_method-inl.h"
#include "base/enums.h"
@@ -41,6 +43,7 @@
#include "mirror/class.h"
#include "mirror/class-inl.h"
#include "mirror/dex_cache-inl.h"
+#include "mirror/method_handle_impl.h"
#include "mirror/object-inl.h"
#include "mirror/object_array-inl.h"
#include "reg_type-inl.h"
@@ -54,6 +57,8 @@
namespace art {
namespace verifier {
+using android::base::StringPrintf;
+
static constexpr bool kTimeVerifyMethod = !kIsDebugBuild;
static constexpr bool kDebugVerify = false;
// TODO: Add a constant to method_verifier to turn on verbose logging?
@@ -100,8 +105,18 @@
ALWAYS_INLINE static inline bool FailOrAbort(MethodVerifier* verifier, bool condition,
const char* error_msg, uint32_t work_insn_idx) {
if (kIsDebugBuild) {
- // In a debug build, abort if the error condition is wrong.
- DCHECK(condition) << error_msg << work_insn_idx;
+ // In a debug build, abort if the error condition is wrong. Only warn if
+ // we are already aborting (as this verification is likely run to print
+ // lock information).
+ if (LIKELY(gAborting == 0)) {
+ DCHECK(condition) << error_msg << work_insn_idx;
+ } else {
+ if (!condition) {
+ LOG(ERROR) << error_msg << work_insn_idx;
+ verifier->Fail(VERIFY_ERROR_BAD_CLASS_HARD) << error_msg << work_insn_idx;
+ return true;
+ }
+ }
} else {
// In a non-debug build, just fail the class.
if (!condition) {
@@ -400,15 +415,15 @@
result.kind = kSoftFailure;
if (method != nullptr &&
!CanCompilerHandleVerificationFailure(verifier.encountered_failure_types_)) {
- method->SetAccessFlags(method->GetAccessFlags() | kAccCompileDontBother);
+ method->AddAccessFlags(kAccCompileDontBother);
}
}
if (method != nullptr) {
if (verifier.HasInstructionThatWillThrow()) {
- method->SetAccessFlags(method->GetAccessFlags() | kAccCompileDontBother);
+ method->AddAccessFlags(kAccCompileDontBother);
}
if ((verifier.encountered_failure_types_ & VerifyError::VERIFY_ERROR_LOCKING) != 0) {
- method->SetAccessFlags(method->GetAccessFlags() | kAccMustCountLocks);
+ method->AddAccessFlags(kAccMustCountLocks);
}
}
} else {
@@ -1062,7 +1077,7 @@
GetInstructionFlags(dex_pc).SetBranchTarget();
// Ensure exception types are resolved so that they don't need resolution to be delivered,
// unresolved exception types will be ignored by exception delivery
- if (iterator.GetHandlerTypeIndex() != DexFile::kDexNoIndex16) {
+ if (iterator.GetHandlerTypeIndex().IsValid()) {
mirror::Class* exception_type = linker->ResolveType(*dex_file_,
iterator.GetHandlerTypeIndex(),
dex_cache_, class_loader_);
@@ -1145,13 +1160,13 @@
result = result && CheckMethodIndex(inst->VRegB());
break;
case Instruction::kVerifyRegBNewInstance:
- result = result && CheckNewInstance(inst->VRegB());
+ result = result && CheckNewInstance(dex::TypeIndex(inst->VRegB()));
break;
case Instruction::kVerifyRegBString:
result = result && CheckStringIndex(inst->VRegB());
break;
case Instruction::kVerifyRegBType:
- result = result && CheckTypeIndex(inst->VRegB());
+ result = result && CheckTypeIndex(dex::TypeIndex(inst->VRegB()));
break;
case Instruction::kVerifyRegBWide:
result = result && CheckWideRegisterIndex(inst->VRegB());
@@ -1165,15 +1180,20 @@
result = result && CheckFieldIndex(inst->VRegC());
break;
case Instruction::kVerifyRegCNewArray:
- result = result && CheckNewArray(inst->VRegC());
+ result = result && CheckNewArray(dex::TypeIndex(inst->VRegC()));
break;
case Instruction::kVerifyRegCType:
- result = result && CheckTypeIndex(inst->VRegC());
+ result = result && CheckTypeIndex(dex::TypeIndex(inst->VRegC()));
break;
case Instruction::kVerifyRegCWide:
result = result && CheckWideRegisterIndex(inst->VRegC());
break;
}
+ switch (inst->GetVerifyTypeArgumentH()) {
+ case Instruction::kVerifyRegHPrototype:
+ result = result && CheckPrototypeIndex(inst->VRegH());
+ break;
+ }
switch (inst->GetVerifyExtraFlags()) {
case Instruction::kVerifyArrayData:
result = result && CheckArrayData(code_offset);
@@ -1260,9 +1280,9 @@
return true;
}
-inline bool MethodVerifier::CheckNewInstance(uint32_t idx) {
- if (idx >= dex_file_->GetHeader().type_ids_size_) {
- Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "bad type index " << idx << " (max "
+inline bool MethodVerifier::CheckNewInstance(dex::TypeIndex idx) {
+ if (idx.index_ >= dex_file_->GetHeader().type_ids_size_) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "bad type index " << idx.index_ << " (max "
<< dex_file_->GetHeader().type_ids_size_ << ")";
return false;
}
@@ -1279,6 +1299,15 @@
return true;
}
+inline bool MethodVerifier::CheckPrototypeIndex(uint32_t idx) {
+ if (idx >= dex_file_->GetHeader().proto_ids_size_) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "bad prototype index " << idx << " (max "
+ << dex_file_->GetHeader().proto_ids_size_ << ")";
+ return false;
+ }
+ return true;
+}
+
inline bool MethodVerifier::CheckStringIndex(uint32_t idx) {
if (idx >= dex_file_->GetHeader().string_ids_size_) {
Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "bad string index " << idx << " (max "
@@ -1288,18 +1317,18 @@
return true;
}
-inline bool MethodVerifier::CheckTypeIndex(uint32_t idx) {
- if (idx >= dex_file_->GetHeader().type_ids_size_) {
- Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "bad type index " << idx << " (max "
+inline bool MethodVerifier::CheckTypeIndex(dex::TypeIndex idx) {
+ if (idx.index_ >= dex_file_->GetHeader().type_ids_size_) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "bad type index " << idx.index_ << " (max "
<< dex_file_->GetHeader().type_ids_size_ << ")";
return false;
}
return true;
}
-bool MethodVerifier::CheckNewArray(uint32_t idx) {
- if (idx >= dex_file_->GetHeader().type_ids_size_) {
- Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "bad type index " << idx << " (max "
+bool MethodVerifier::CheckNewArray(dex::TypeIndex idx) {
+ if (idx.index_ >= dex_file_->GetHeader().type_ids_size_) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "bad type index " << idx.index_ << " (max "
<< dex_file_->GetHeader().type_ids_size_ << ")";
return false;
}
@@ -1935,7 +1964,7 @@
// Returns the index of the first final instance field of the given class, or kDexNoIndex if there
// is no such field.
-static uint32_t GetFirstFinalInstanceFieldIndex(const DexFile& dex_file, uint16_t type_idx) {
+static uint32_t GetFirstFinalInstanceFieldIndex(const DexFile& dex_file, dex::TypeIndex type_idx) {
const DexFile::ClassDef* class_def = dex_file.FindClassDef(type_idx);
DCHECK(class_def != nullptr);
const uint8_t* class_data = dex_file.GetClassData(*class_def);
@@ -2283,7 +2312,7 @@
case Instruction::CONST_CLASS: {
// Get type from instruction if unresolved then we need an access check
// TODO: check Compiler::CanAccessTypeWithoutChecks returns false when res_type is unresolved
- const RegType& res_type = ResolveClassAndCheckAccess(inst->VRegB_21c());
+ const RegType& res_type = ResolveClassAndCheckAccess(dex::TypeIndex(inst->VRegB_21c()));
// Register holds class, ie its type is class, on error it will hold Conflict.
work_line_->SetRegisterType<LockOp::kClear>(
this, inst->VRegA_21c(), res_type.IsConflict() ? res_type
@@ -2353,7 +2382,7 @@
* dec_insn.vA when branching to a handler.
*/
const bool is_checkcast = (inst->Opcode() == Instruction::CHECK_CAST);
- const uint32_t type_idx = (is_checkcast) ? inst->VRegB_21c() : inst->VRegC_22c();
+ const dex::TypeIndex type_idx((is_checkcast) ? inst->VRegB_21c() : inst->VRegC_22c());
const RegType& res_type = ResolveClassAndCheckAccess(type_idx);
if (res_type.IsConflict()) {
// If this is a primitive type, fail HARD.
@@ -2423,7 +2452,7 @@
break;
}
case Instruction::NEW_INSTANCE: {
- const RegType& res_type = ResolveClassAndCheckAccess(inst->VRegB_21c());
+ const RegType& res_type = ResolveClassAndCheckAccess(dex::TypeIndex(inst->VRegB_21c()));
if (res_type.IsConflict()) {
DCHECK_NE(failures_.size(), 0U);
break; // bad class
@@ -2635,7 +2664,8 @@
// ensure that subsequent merges don't lose type information - such as becoming an
// interface from a class that would lose information relevant to field checks.
const RegType& orig_type = work_line_->GetRegisterType(this, instance_of_inst->VRegB_22c());
- const RegType& cast_type = ResolveClassAndCheckAccess(instance_of_inst->VRegC_22c());
+ const RegType& cast_type = ResolveClassAndCheckAccess(
+ dex::TypeIndex(instance_of_inst->VRegC_22c()));
if (!orig_type.Equals(cast_type) &&
!cast_type.IsUnresolvedTypes() && !orig_type.IsUnresolvedTypes() &&
@@ -2873,7 +2903,8 @@
if (return_type == nullptr) {
uint32_t method_idx = (is_range) ? inst->VRegB_3rc() : inst->VRegB_35c();
const DexFile::MethodId& method_id = dex_file_->GetMethodId(method_idx);
- uint32_t return_type_idx = dex_file_->GetProtoId(method_id.proto_idx_).return_type_idx_;
+ dex::TypeIndex return_type_idx =
+ dex_file_->GetProtoId(method_id.proto_idx_).return_type_idx_;
const char* descriptor = dex_file_->StringByTypeIdx(return_type_idx);
return_type = ®_types_.FromDescriptor(GetClassLoader(), descriptor, false);
}
@@ -2896,7 +2927,8 @@
uint32_t method_idx = (is_range) ? inst->VRegB_3rc() : inst->VRegB_35c();
const DexFile::MethodId& method_id = dex_file_->GetMethodId(method_idx);
is_constructor = strcmp("<init>", dex_file_->StringDataByIdx(method_id.name_idx_)) == 0;
- uint32_t return_type_idx = dex_file_->GetProtoId(method_id.proto_idx_).return_type_idx_;
+ dex::TypeIndex return_type_idx =
+ dex_file_->GetProtoId(method_id.proto_idx_).return_type_idx_;
return_type_descriptor = dex_file_->StringByTypeIdx(return_type_idx);
} else {
is_constructor = called_method->IsConstructor();
@@ -2921,7 +2953,7 @@
* allowing the latter only if the "this" argument is the same as the "this" argument to
* this method (which implies that we're in a constructor ourselves).
*/
- const RegType& this_type = work_line_->GetInvocationThis(this, inst, is_range);
+ const RegType& this_type = work_line_->GetInvocationThis(this, inst);
if (this_type.IsConflict()) // failure.
break;
@@ -2972,7 +3004,8 @@
if (called_method == nullptr) {
uint32_t method_idx = (is_range) ? inst->VRegB_3rc() : inst->VRegB_35c();
const DexFile::MethodId& method_id = dex_file_->GetMethodId(method_idx);
- uint32_t return_type_idx = dex_file_->GetProtoId(method_id.proto_idx_).return_type_idx_;
+ dex::TypeIndex return_type_idx =
+ dex_file_->GetProtoId(method_id.proto_idx_).return_type_idx_;
descriptor = dex_file_->StringByTypeIdx(return_type_idx);
} else {
descriptor = called_method->GetReturnTypeDescriptor();
@@ -3001,7 +3034,7 @@
/* Get the type of the "this" arg, which should either be a sub-interface of called
* interface or Object (see comments in RegType::JoinClass).
*/
- const RegType& this_type = work_line_->GetInvocationThis(this, inst, is_range);
+ const RegType& this_type = work_line_->GetInvocationThis(this, inst);
if (this_type.IsZero()) {
/* null pointer always passes (and always fails at runtime) */
} else {
@@ -3026,7 +3059,8 @@
if (abs_method == nullptr) {
uint32_t method_idx = (is_range) ? inst->VRegB_3rc() : inst->VRegB_35c();
const DexFile::MethodId& method_id = dex_file_->GetMethodId(method_idx);
- uint32_t return_type_idx = dex_file_->GetProtoId(method_id.proto_idx_).return_type_idx_;
+ dex::TypeIndex return_type_idx =
+ dex_file_->GetProtoId(method_id.proto_idx_).return_type_idx_;
descriptor = dex_file_->StringByTypeIdx(return_type_idx);
} else {
descriptor = abs_method->GetReturnTypeDescriptor();
@@ -3042,10 +3076,37 @@
}
case Instruction::INVOKE_POLYMORPHIC:
case Instruction::INVOKE_POLYMORPHIC_RANGE: {
+ bool is_range = (inst->Opcode() == Instruction::INVOKE_POLYMORPHIC_RANGE);
+ ArtMethod* called_method = VerifyInvocationArgs(inst, METHOD_POLYMORPHIC, is_range);
+ if (called_method == nullptr) {
+ // Convert potential soft failures in VerifyInvocationArgs() to hard errors.
+ if (failure_messages_.size() > 0) {
+ std::string message = failure_messages_.back()->str();
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << message;
+ } else {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "invoke-polymorphic verification failure.";
+ }
+ break;
+ }
+ if (!CheckSignaturePolymorphicMethod(called_method) ||
+ !CheckSignaturePolymorphicReceiver(inst)) {
+ break;
+ }
+ const uint32_t proto_idx = (is_range) ? inst->VRegH_4rcc() : inst->VRegH_45cc();
+ const char* descriptor =
+ dex_file_->GetReturnTypeDescriptor(dex_file_->GetProtoId(proto_idx));
+ const RegType& return_type =
+ reg_types_.FromDescriptor(GetClassLoader(), descriptor, false);
+ if (!return_type.IsLowHalf()) {
+ work_line_->SetResultRegisterType(this, return_type);
+ } else {
+ work_line_->SetResultRegisterTypeWide(return_type, return_type.HighHalf(®_types_));
+ }
+ // TODO(oth): remove when compiler support is available.
Fail(VERIFY_ERROR_FORCE_INTERPRETER)
- << "instruction is not supported by verifier; skipping verification";
+ << "invoke-polymorphic is not supported by compiler";
have_pending_experimental_failure_ = true;
- return false;
+ break;
}
case Instruction::NEG_INT:
case Instruction::NOT_INT:
@@ -3401,8 +3462,6 @@
work_line_->SetResultTypeToUnknown(this);
}
-
-
/*
* Handle "branch". Tag the branch target.
*
@@ -3490,8 +3549,8 @@
ClassLinker* linker = Runtime::Current()->GetClassLinker();
for (; iterator.HasNext(); iterator.Next()) {
- uint16_t handler_type_idx = iterator.GetHandlerTypeIndex();
- if (handler_type_idx == DexFile::kDexNoIndex16) {
+ dex::TypeIndex handler_type_idx = iterator.GetHandlerTypeIndex();
+ if (!handler_type_idx.IsValid()) {
has_catch_all_handler = true;
} else {
// It is also a catch-all if it is java.lang.Throwable.
@@ -3618,7 +3677,7 @@
return klass->IsInstantiable() || klass->IsPrimitive();
}
-const RegType& MethodVerifier::ResolveClassAndCheckAccess(uint32_t class_idx) {
+const RegType& MethodVerifier::ResolveClassAndCheckAccess(dex::TypeIndex class_idx) {
mirror::Class* klass = dex_cache_->GetResolvedType(class_idx);
const RegType* result = nullptr;
if (klass != nullptr) {
@@ -3674,7 +3733,7 @@
CatchHandlerIterator iterator(handlers_ptr);
for (; iterator.HasNext(); iterator.Next()) {
if (iterator.GetHandlerAddress() == (uint32_t) work_insn_idx_) {
- if (iterator.GetHandlerTypeIndex() == DexFile::kDexNoIndex16) {
+ if (!iterator.GetHandlerTypeIndex().IsValid()) {
common_super = ®_types_.JavaLangThrowable(false);
} else {
const RegType& exception = ResolveClassAndCheckAccess(iterator.GetHandlerTypeIndex());
@@ -3725,7 +3784,8 @@
} else if (method_type == METHOD_SUPER && is_interface) {
return kInterfaceMethodResolution;
} else {
- DCHECK(method_type == METHOD_VIRTUAL || method_type == METHOD_SUPER);
+ DCHECK(method_type == METHOD_VIRTUAL || method_type == METHOD_SUPER
+ || method_type == METHOD_POLYMORPHIC);
return kVirtualMethodResolution;
}
}
@@ -3853,15 +3913,18 @@
return nullptr;
}
// See if the method type implied by the invoke instruction matches the access flags for the
- // target method.
+ // target method. The flags for METHOD_POLYMORPHIC are based on there being precisely two
+ // signature polymorphic methods supported by the run-time which are native methods with variable
+ // arguments.
if ((method_type == METHOD_DIRECT && (!res_method->IsDirect() || res_method->IsStatic())) ||
(method_type == METHOD_STATIC && !res_method->IsStatic()) ||
((method_type == METHOD_SUPER ||
method_type == METHOD_VIRTUAL ||
- method_type == METHOD_INTERFACE) && res_method->IsDirect())
- ) {
+ method_type == METHOD_INTERFACE) && res_method->IsDirect()) ||
+ ((method_type == METHOD_POLYMORPHIC) &&
+ (!res_method->IsNative() || !res_method->IsVarargs()))) {
Fail(VERIFY_ERROR_CLASS_CHANGE) << "invoke type (" << method_type << ") does not match method "
- " type of " << res_method->PrettyMethod();
+ "type of " << res_method->PrettyMethod();
return nullptr;
}
return res_method;
@@ -3873,20 +3936,18 @@
// We use vAA as our expected arg count, rather than res_method->insSize, because we need to
// match the call to the signature. Also, we might be calling through an abstract method
// definition (which doesn't have register count values).
- const size_t expected_args = (is_range) ? inst->VRegA_3rc() : inst->VRegA_35c();
+ const size_t expected_args = inst->VRegA();
/* caught by static verifier */
DCHECK(is_range || expected_args <= 5);
- if (expected_args > code_item_->outs_size_) {
- Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "invalid argument count (" << expected_args
- << ") exceeds outsSize (" << code_item_->outs_size_ << ")";
- return nullptr;
- }
- uint32_t arg[5];
- if (!is_range) {
- inst->GetVarArgs(arg);
+ // TODO(oth): Enable this path for invoke-polymorphic when b/33099829 is resolved.
+ if (method_type != METHOD_POLYMORPHIC) {
+ if (expected_args > code_item_->outs_size_) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "invalid argument count (" << expected_args
+ << ") exceeds outsSize (" << code_item_->outs_size_ << ")";
+ return nullptr;
+ }
}
- uint32_t sig_registers = 0;
/*
* Check the "this" argument, which must be an instance of the class that declared the method.
@@ -3894,7 +3955,7 @@
* rigorous check here (which is okay since we have to do it at runtime).
*/
if (method_type != METHOD_STATIC) {
- const RegType& actual_arg_type = work_line_->GetInvocationThis(this, inst, is_range);
+ const RegType& actual_arg_type = work_line_->GetInvocationThis(this, inst);
if (actual_arg_type.IsConflict()) { // GetInvocationThis failed.
CHECK(have_pending_hard_failure_);
return nullptr;
@@ -3930,8 +3991,8 @@
res_method_class = &FromClass(klass->GetDescriptor(&temp), klass,
klass->CannotBeAssignedFromOtherTypes());
} else {
- const uint32_t method_idx = (is_range) ? inst->VRegB_3rc() : inst->VRegB_35c();
- const uint16_t class_idx = dex_file_->GetMethodId(method_idx).class_idx_;
+ const uint32_t method_idx = inst->VRegB();
+ const dex::TypeIndex class_idx = dex_file_->GetMethodId(method_idx).class_idx_;
res_method_class = ®_types_.FromDescriptor(
GetClassLoader(),
dex_file_->StringByTypeIdx(class_idx),
@@ -3950,13 +4011,17 @@
}
}
}
- sig_registers = 1;
}
+ uint32_t arg[5];
+ if (!is_range) {
+ inst->GetVarArgs(arg);
+ }
+ uint32_t sig_registers = (method_type == METHOD_STATIC) ? 0 : 1;
for ( ; it->HasNext(); it->Next()) {
if (sig_registers >= expected_args) {
Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Rejecting invocation, expected " << inst->VRegA() <<
- " arguments, found " << sig_registers << " or more.";
+ " argument registers, method signature has " << sig_registers + 1 << " or more";
return nullptr;
}
@@ -3969,7 +4034,7 @@
}
const RegType& reg_type = reg_types_.FromDescriptor(GetClassLoader(), param_descriptor, false);
- uint32_t get_reg = is_range ? inst->VRegC_3rc() + static_cast<uint32_t>(sig_registers) :
+ uint32_t get_reg = is_range ? inst->VRegC() + static_cast<uint32_t>(sig_registers) :
arg[sig_registers];
if (reg_type.IsIntegralTypes()) {
const RegType& src_type = work_line_->GetRegisterType(this, get_reg);
@@ -4005,7 +4070,7 @@
}
if (expected_args != sig_registers) {
Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "Rejecting invocation, expected " << expected_args <<
- " arguments, found " << sig_registers;
+ " argument registers, method signature has " << sig_registers;
return nullptr;
}
return res_method;
@@ -4017,11 +4082,10 @@
// As the method may not have been resolved, make this static check against what we expect.
// The main reason for this code block is to fail hard when we find an illegal use, e.g.,
// wrong number of arguments or wrong primitive types, even if the method could not be resolved.
- const uint32_t method_idx = (is_range) ? inst->VRegB_3rc() : inst->VRegB_35c();
+ const uint32_t method_idx = inst->VRegB();
DexFileParameterIterator it(*dex_file_,
dex_file_->GetProtoId(dex_file_->GetMethodId(method_idx).proto_idx_));
- VerifyInvocationArgsFromIterator<DexFileParameterIterator>(&it, inst, method_type, is_range,
- nullptr);
+ VerifyInvocationArgsFromIterator(&it, inst, method_type, is_range, nullptr);
}
class MethodParamListDescriptorIterator {
@@ -4054,8 +4118,7 @@
const Instruction* inst, MethodType method_type, bool is_range) {
// Resolve the method. This could be an abstract or concrete method depending on what sort of call
// we're making.
- const uint32_t method_idx = (is_range) ? inst->VRegB_3rc() : inst->VRegB_35c();
-
+ const uint32_t method_idx = inst->VRegB();
ArtMethod* res_method = ResolveMethodAndCheckAccess(method_idx, method_type);
if (res_method == nullptr) { // error or class is unresolved
// Check what we can statically.
@@ -4068,7 +4131,7 @@
// If we're using invoke-super(method), make sure that the executing method's class' superclass
// has a vtable entry for the target method. Or the target is on a interface.
if (method_type == METHOD_SUPER) {
- uint16_t class_idx = dex_file_->GetMethodId(method_idx).class_idx_;
+ dex::TypeIndex class_idx = dex_file_->GetMethodId(method_idx).class_idx_;
const RegType& reference_type = reg_types_.FromDescriptor(
GetClassLoader(),
dex_file_->StringByTypeIdx(class_idx),
@@ -4118,10 +4181,84 @@
}
}
- // Process the target method's signature. This signature may or may not
- MethodParamListDescriptorIterator it(res_method);
- return VerifyInvocationArgsFromIterator<MethodParamListDescriptorIterator>(&it, inst, method_type,
- is_range, res_method);
+ if (method_type == METHOD_POLYMORPHIC) {
+ // Process the signature of the calling site that is invoking the method handle.
+ DexFileParameterIterator it(*dex_file_, dex_file_->GetProtoId(inst->VRegH()));
+ return VerifyInvocationArgsFromIterator(&it, inst, method_type, is_range, res_method);
+ } else {
+ // Process the target method's signature.
+ MethodParamListDescriptorIterator it(res_method);
+ return VerifyInvocationArgsFromIterator(&it, inst, method_type, is_range, res_method);
+ }
+}
+
+bool MethodVerifier::CheckSignaturePolymorphicMethod(ArtMethod* method) {
+ mirror::Class* klass = method->GetDeclaringClass();
+ if (klass != mirror::MethodHandle::StaticClass()) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD)
+ << "Signature polymorphic method must be declared in java.lang.invoke.MethodClass";
+ return false;
+ }
+
+ const char* method_name = method->GetName();
+ if (strcmp(method_name, "invoke") != 0 && strcmp(method_name, "invokeExact") != 0) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD)
+ << "Signature polymorphic method name invalid: " << method_name;
+ return false;
+ }
+
+ const DexFile::TypeList* types = method->GetParameterTypeList();
+ if (types->Size() != 1) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD)
+ << "Signature polymorphic method has too many arguments " << types->Size() << " != 1";
+ return false;
+ }
+
+ const dex::TypeIndex argument_type_index = types->GetTypeItem(0).type_idx_;
+ const char* argument_descriptor = method->GetTypeDescriptorFromTypeIdx(argument_type_index);
+ if (strcmp(argument_descriptor, "[Ljava/lang/Object;") != 0) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD)
+ << "Signature polymorphic method has unexpected argument type: " << argument_descriptor;
+ return false;
+ }
+
+ const char* return_descriptor = method->GetReturnTypeDescriptor();
+ if (strcmp(return_descriptor, "Ljava/lang/Object;") != 0) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD)
+ << "Signature polymorphic method has unexpected return type: " << return_descriptor;
+ return false;
+ }
+
+ return true;
+}
+
+bool MethodVerifier::CheckSignaturePolymorphicReceiver(const Instruction* inst) {
+ const RegType& this_type = work_line_->GetInvocationThis(this, inst);
+ if (this_type.IsZero()) {
+ /* null pointer always passes (and always fails at run time) */
+ return true;
+ } else if (!this_type.IsNonZeroReferenceTypes()) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD)
+ << "invoke-polymorphic receiver is not a reference: "
+ << this_type;
+ return false;
+ } else if (this_type.IsUninitializedReference()) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD)
+ << "invoke-polymorphic receiver is uninitialized: "
+ << this_type;
+ return false;
+ } else if (!this_type.HasClass()) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD)
+ << "invoke-polymorphic receiver has no class: "
+ << this_type;
+ return false;
+ } else if (!this_type.GetClass()->IsSubClass(mirror::MethodHandle::StaticClass())) {
+ Fail(VERIFY_ERROR_BAD_CLASS_HARD)
+ << "invoke-polymorphic receiver is not a subclass of MethodHandle: "
+ << this_type;
+ return false;
+ }
+ return true;
}
ArtMethod* MethodVerifier::GetQuickInvokedMethod(const Instruction* inst, RegisterLine* reg_line,
@@ -4131,7 +4268,7 @@
} else {
DCHECK_EQ(inst->Opcode(), Instruction::INVOKE_VIRTUAL_QUICK);
}
- const RegType& actual_arg_type = reg_line->GetInvocationThis(this, inst, is_range, allow_failure);
+ const RegType& actual_arg_type = reg_line->GetInvocationThis(this, inst, allow_failure);
if (!actual_arg_type.HasClass()) {
VLOG(verifier) << "Failed to get mirror::Class* from '" << actual_arg_type << "'";
return nullptr;
@@ -4193,7 +4330,7 @@
// We use vAA as our expected arg count, rather than res_method->insSize, because we need to
// match the call to the signature. Also, we might be calling through an abstract method
// definition (which doesn't have register count values).
- const RegType& actual_arg_type = work_line_->GetInvocationThis(this, inst, is_range);
+ const RegType& actual_arg_type = work_line_->GetInvocationThis(this, inst);
if (actual_arg_type.IsConflict()) { // GetInvocationThis failed.
return nullptr;
}
@@ -4277,16 +4414,16 @@
}
void MethodVerifier::VerifyNewArray(const Instruction* inst, bool is_filled, bool is_range) {
- uint32_t type_idx;
+ dex::TypeIndex type_idx;
if (!is_filled) {
DCHECK_EQ(inst->Opcode(), Instruction::NEW_ARRAY);
- type_idx = inst->VRegC_22c();
+ type_idx = dex::TypeIndex(inst->VRegC_22c());
} else if (!is_range) {
DCHECK_EQ(inst->Opcode(), Instruction::FILLED_NEW_ARRAY);
- type_idx = inst->VRegB_35c();
+ type_idx = dex::TypeIndex(inst->VRegB_35c());
} else {
DCHECK_EQ(inst->Opcode(), Instruction::FILLED_NEW_ARRAY_RANGE);
- type_idx = inst->VRegB_3rc();
+ type_idx = dex::TypeIndex(inst->VRegB_3rc());
}
const RegType& res_type = ResolveClassAndCheckAccess(type_idx);
if (res_type.IsConflict()) { // bad class
@@ -5001,7 +5138,7 @@
if (return_type_ == nullptr) {
const DexFile::MethodId& method_id = dex_file_->GetMethodId(dex_method_idx_);
const DexFile::ProtoId& proto_id = dex_file_->GetMethodPrototype(method_id);
- uint16_t return_type_idx = proto_id.return_type_idx_;
+ dex::TypeIndex return_type_idx = proto_id.return_type_idx_;
const char* descriptor = dex_file_->GetTypeDescriptor(dex_file_->GetTypeId(return_type_idx));
return_type_ = ®_types_.FromDescriptor(GetClassLoader(), descriptor, false);
}
diff --git a/runtime/verifier/method_verifier.h b/runtime/verifier/method_verifier.h
index c6ce583..fa5a698 100644
--- a/runtime/verifier/method_verifier.h
+++ b/runtime/verifier/method_verifier.h
@@ -27,6 +27,7 @@
#include "base/stl_util.h"
#include "base/value_object.h"
#include "dex_file.h"
+#include "dex_file_types.h"
#include "handle.h"
#include "instruction_flags.h"
#include "method_reference.h"
@@ -62,7 +63,8 @@
METHOD_STATIC, // static
METHOD_VIRTUAL, // virtual
METHOD_SUPER, // super
- METHOD_INTERFACE // interface
+ METHOD_INTERFACE, // interface
+ METHOD_POLYMORPHIC // polymorphic
};
std::ostream& operator<<(std::ostream& os, const MethodType& rhs);
@@ -261,7 +263,7 @@
return have_any_pending_runtime_throw_failure_;
}
- const RegType& ResolveCheckedClass(uint32_t class_idx)
+ const RegType& ResolveCheckedClass(dex::TypeIndex class_idx)
REQUIRES_SHARED(Locks::mutator_lock_);
// Returns the method of a quick invoke or null if it cannot be found.
ArtMethod* GetQuickInvokedMethod(const Instruction* inst, RegisterLine* reg_line,
@@ -471,18 +473,22 @@
// Perform static checks on a "new-instance" instruction. Specifically, make sure the class
// reference isn't for an array class.
- bool CheckNewInstance(uint32_t idx);
+ bool CheckNewInstance(dex::TypeIndex idx);
+
+ // Perform static checks on a prototype indexing instruction. All we do here is ensure that the
+ // prototype index is in the valid range.
+ bool CheckPrototypeIndex(uint32_t idx);
/* Ensure that the string index is in the valid range. */
bool CheckStringIndex(uint32_t idx);
// Perform static checks on an instruction that takes a class constant. Ensure that the class
// index is in the valid range.
- bool CheckTypeIndex(uint32_t idx);
+ bool CheckTypeIndex(dex::TypeIndex idx);
// Perform static checks on a "new-array" instruction. Specifically, make sure they aren't
// creating an array of arrays that causes the number of dimensions to exceed 255.
- bool CheckNewArray(uint32_t idx);
+ bool CheckNewArray(dex::TypeIndex idx);
// Verify an array data table. "cur_offset" is the offset of the fill-array-data instruction.
bool CheckArrayData(uint32_t cur_offset);
@@ -511,6 +517,12 @@
// - vA holds word count, vC holds index of first reg.
bool CheckVarArgRangeRegs(uint32_t vA, uint32_t vC);
+ // Checks the method matches the expectations required to be signature polymorphic.
+ bool CheckSignaturePolymorphicMethod(ArtMethod* method) REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // Checks the invoked receiver matches the expectations for signature polymorphic methods.
+ bool CheckSignaturePolymorphicReceiver(const Instruction* inst) REQUIRES_SHARED(Locks::mutator_lock_);
+
// Extract the relative offset from a branch instruction.
// Returns "false" on failure (e.g. this isn't a branch instruction).
bool GetBranchOffset(uint32_t cur_offset, int32_t* pOffset, bool* pConditional,
@@ -625,7 +637,7 @@
// Resolves a class based on an index and performs access checks to ensure the referrer can
// access the resolved class.
- const RegType& ResolveClassAndCheckAccess(uint32_t class_idx)
+ const RegType& ResolveClassAndCheckAccess(dex::TypeIndex class_idx)
REQUIRES_SHARED(Locks::mutator_lock_);
/*
diff --git a/runtime/verifier/method_verifier_test.cc b/runtime/verifier/method_verifier_test.cc
index 52be2df..be5c18b 100644
--- a/runtime/verifier/method_verifier_test.cc
+++ b/runtime/verifier/method_verifier_test.cc
@@ -19,6 +19,8 @@
#include <stdio.h>
#include <memory>
+#include "android-base/strings.h"
+
#include "class_linker-inl.h"
#include "common_runtime_test.h"
#include "dex_file.h"
@@ -42,7 +44,7 @@
MethodVerifier::FailureKind failure = MethodVerifier::VerifyClass(
self, klass, nullptr, true, HardFailLogMode::kLogWarning, &error_msg);
- if (StartsWith(descriptor, "Ljava/lang/invoke")) {
+ if (android::base::StartsWith(descriptor, "Ljava/lang/invoke")) {
ASSERT_TRUE(failure == MethodVerifier::kSoftFailure ||
failure == MethodVerifier::kNoFailure) << error_msg;
diff --git a/runtime/verifier/reg_type.cc b/runtime/verifier/reg_type.cc
index ab23773..52f7e34 100644
--- a/runtime/verifier/reg_type.cc
+++ b/runtime/verifier/reg_type.cc
@@ -16,6 +16,8 @@
#include "reg_type-inl.h"
+#include "android-base/stringprintf.h"
+
#include "base/arena_bit_vector.h"
#include "base/bit_vector-inl.h"
#include "base/casts.h"
@@ -35,6 +37,8 @@
namespace art {
namespace verifier {
+using android::base::StringPrintf;
+
const UndefinedType* UndefinedType::instance_ = nullptr;
const ConflictType* ConflictType::instance_ = nullptr;
const BooleanType* BooleanType::instance_ = nullptr;
diff --git a/runtime/verifier/register_line.cc b/runtime/verifier/register_line.cc
index da3d946..383d890 100644
--- a/runtime/verifier/register_line.cc
+++ b/runtime/verifier/register_line.cc
@@ -16,7 +16,8 @@
#include "register_line.h"
-#include "base/stringprintf.h"
+#include "android-base/stringprintf.h"
+
#include "dex_instruction-inl.h"
#include "method_verifier-inl.h"
#include "register_line-inl.h"
@@ -25,6 +26,8 @@
namespace art {
namespace verifier {
+using android::base::StringPrintf;
+
bool RegisterLine::CheckConstructorReturn(MethodVerifier* verifier) const {
if (kIsDebugBuild && this_initialized_) {
// Ensure that there is no UninitializedThisReference type anymore if this_initialized_ is true.
@@ -44,8 +47,9 @@
}
const RegType& RegisterLine::GetInvocationThis(MethodVerifier* verifier, const Instruction* inst,
- bool is_range, bool allow_failure) {
- const size_t args_count = is_range ? inst->VRegA_3rc() : inst->VRegA_35c();
+ bool allow_failure) {
+ DCHECK(inst->IsInvoke());
+ const size_t args_count = inst->VRegA();
if (args_count < 1) {
if (!allow_failure) {
verifier->Fail(VERIFY_ERROR_BAD_CLASS_HARD) << "invoke lacks 'this'";
@@ -53,7 +57,7 @@
return verifier->GetRegTypeCache()->Conflict();
}
/* Get the element type of the array held in vsrc */
- const uint32_t this_reg = (is_range) ? inst->VRegC_3rc() : inst->VRegC_35c();
+ const uint32_t this_reg = inst->VRegC();
const RegType& this_type = GetRegisterType(verifier, this_reg);
if (!this_type.IsReferenceTypes()) {
if (!allow_failure) {
diff --git a/runtime/verifier/register_line.h b/runtime/verifier/register_line.h
index 7603a79..221aa80 100644
--- a/runtime/verifier/register_line.h
+++ b/runtime/verifier/register_line.h
@@ -217,7 +217,6 @@
*/
const RegType& GetInvocationThis(MethodVerifier* verifier,
const Instruction* inst,
- bool is_range,
bool allow_failure = false)
REQUIRES_SHARED(Locks::mutator_lock_);
diff --git a/runtime/verifier/verifier_deps.cc b/runtime/verifier/verifier_deps.cc
index c395612..3af7c01 100644
--- a/runtime/verifier/verifier_deps.cc
+++ b/runtime/verifier/verifier_deps.cc
@@ -16,6 +16,9 @@
#include "verifier_deps.h"
+#include <cstring>
+
+#include "base/stl_util.h"
#include "compiler_callbacks.h"
#include "leb128.h"
#include "mirror/class-inl.h"
@@ -26,7 +29,6 @@
namespace verifier {
VerifierDeps::VerifierDeps(const std::vector<const DexFile*>& dex_files) {
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
for (const DexFile* dex_file : dex_files) {
DCHECK(GetDexFileDeps(*dex_file) == nullptr);
std::unique_ptr<DexFileDeps> deps(new DexFileDeps());
@@ -34,6 +36,28 @@
}
}
+void VerifierDeps::MergeWith(const VerifierDeps& other,
+ const std::vector<const DexFile*>& dex_files) {
+ DCHECK(dex_deps_.size() == other.dex_deps_.size());
+ for (const DexFile* dex_file : dex_files) {
+ DexFileDeps* my_deps = GetDexFileDeps(*dex_file);
+ const DexFileDeps& other_deps = *other.GetDexFileDeps(*dex_file);
+ // We currently collect extra strings only on the main `VerifierDeps`,
+ // which should be the one passed as `this` in this method.
+ DCHECK(other_deps.strings_.empty());
+ MergeSets(my_deps->assignable_types_, other_deps.assignable_types_);
+ MergeSets(my_deps->unassignable_types_, other_deps.unassignable_types_);
+ MergeSets(my_deps->classes_, other_deps.classes_);
+ MergeSets(my_deps->fields_, other_deps.fields_);
+ MergeSets(my_deps->direct_methods_, other_deps.direct_methods_);
+ MergeSets(my_deps->virtual_methods_, other_deps.virtual_methods_);
+ MergeSets(my_deps->interface_methods_, other_deps.interface_methods_);
+ for (dex::TypeIndex entry : other_deps.unverified_classes_) {
+ my_deps->unverified_classes_.push_back(entry);
+ }
+ }
+}
+
VerifierDeps::DexFileDeps* VerifierDeps::GetDexFileDeps(const DexFile& dex_file) {
auto it = dex_deps_.find(&dex_file);
return (it == dex_deps_.end()) ? nullptr : it->second.get();
@@ -56,20 +80,117 @@
}
}
-template <typename T>
-uint32_t VerifierDeps::GetDeclaringClassStringId(const DexFile& dex_file, T* element) {
- static_assert(kAccJavaFlagsMask == 0xFFFF, "Unexpected value of a constant");
- if (element == nullptr) {
- return VerifierDeps::kUnresolvedMarker;
- } else {
- std::string temp;
- uint32_t string_id = GetIdFromString(
- dex_file, element->GetDeclaringClass()->GetDescriptor(&temp));
- return string_id;
+dex::StringIndex VerifierDeps::GetClassDescriptorStringId(const DexFile& dex_file,
+ ObjPtr<mirror::Class> klass) {
+ DCHECK(klass != nullptr);
+ ObjPtr<mirror::DexCache> dex_cache = klass->GetDexCache();
+ // Array and proxy classes do not have a dex cache.
+ if (!klass->IsArrayClass() && !klass->IsProxyClass()) {
+ DCHECK(dex_cache != nullptr) << klass->PrettyClass();
+ if (dex_cache->GetDexFile() == &dex_file) {
+ // FindStringId is slow, try to go through the class def if we have one.
+ const DexFile::ClassDef* class_def = klass->GetClassDef();
+ DCHECK(class_def != nullptr) << klass->PrettyClass();
+ const DexFile::TypeId& type_id = dex_file.GetTypeId(class_def->class_idx_);
+ if (kIsDebugBuild) {
+ std::string temp;
+ CHECK_EQ(GetIdFromString(dex_file, klass->GetDescriptor(&temp)), type_id.descriptor_idx_);
+ }
+ return type_id.descriptor_idx_;
+ }
}
+ std::string temp;
+ return GetIdFromString(dex_file, klass->GetDescriptor(&temp));
}
-uint32_t VerifierDeps::GetIdFromString(const DexFile& dex_file, const std::string& str) {
+// Try to find the string descriptor of the class. type_idx is a best guess of a matching string id.
+static dex::StringIndex TryGetClassDescriptorStringId(const DexFile& dex_file,
+ dex::TypeIndex type_idx,
+ ObjPtr<mirror::Class> klass)
+ REQUIRES_SHARED(Locks::mutator_lock_) {
+ if (!klass->IsArrayClass()) {
+ const DexFile::TypeId& type_id = dex_file.GetTypeId(type_idx);
+ const DexFile& klass_dex = klass->GetDexFile();
+ const DexFile::TypeId& klass_type_id = klass_dex.GetTypeId(klass->GetClassDef()->class_idx_);
+ if (strcmp(dex_file.GetTypeDescriptor(type_id),
+ klass_dex.GetTypeDescriptor(klass_type_id)) == 0) {
+ return type_id.descriptor_idx_;
+ }
+ }
+ return dex::StringIndex::Invalid();
+}
+
+dex::StringIndex VerifierDeps::GetMethodDeclaringClassStringId(const DexFile& dex_file,
+ uint32_t dex_method_index,
+ ArtMethod* method) {
+ static_assert(kAccJavaFlagsMask == 0xFFFF, "Unexpected value of a constant");
+ if (method == nullptr) {
+ return dex::StringIndex(VerifierDeps::kUnresolvedMarker);
+ }
+ const dex::StringIndex string_id = TryGetClassDescriptorStringId(
+ dex_file,
+ dex_file.GetMethodId(dex_method_index).class_idx_,
+ method->GetDeclaringClass());
+ if (string_id.IsValid()) {
+ // Got lucky using the original dex file, return based on the input dex file.
+ DCHECK_EQ(GetClassDescriptorStringId(dex_file, method->GetDeclaringClass()), string_id);
+ return string_id;
+ }
+ return GetClassDescriptorStringId(dex_file, method->GetDeclaringClass());
+}
+
+dex::StringIndex VerifierDeps::GetFieldDeclaringClassStringId(const DexFile& dex_file,
+ uint32_t dex_field_idx,
+ ArtField* field) {
+ static_assert(kAccJavaFlagsMask == 0xFFFF, "Unexpected value of a constant");
+ if (field == nullptr) {
+ return dex::StringIndex(VerifierDeps::kUnresolvedMarker);
+ }
+ const dex::StringIndex string_id = TryGetClassDescriptorStringId(
+ dex_file,
+ dex_file.GetFieldId(dex_field_idx).class_idx_,
+ field->GetDeclaringClass());
+ if (string_id.IsValid()) {
+ // Got lucky using the original dex file, return based on the input dex file.
+ DCHECK_EQ(GetClassDescriptorStringId(dex_file, field->GetDeclaringClass()), string_id);
+ return string_id;
+ }
+ return GetClassDescriptorStringId(dex_file, field->GetDeclaringClass());
+}
+
+static inline VerifierDeps* GetMainVerifierDeps() {
+ // The main VerifierDeps is the one set in the compiler callbacks, which at the
+ // end of verification will have all the per-thread VerifierDeps merged into it.
+ CompilerCallbacks* callbacks = Runtime::Current()->GetCompilerCallbacks();
+ if (callbacks == nullptr) {
+ return nullptr;
+ }
+ return callbacks->GetVerifierDeps();
+}
+
+static inline VerifierDeps* GetThreadLocalVerifierDeps() {
+ // During AOT, each thread has its own VerifierDeps, to avoid lock contention. At the end
+ // of full verification, these VerifierDeps will be merged into the main one.
+ if (!Runtime::Current()->IsAotCompiler()) {
+ return nullptr;
+ }
+ return Thread::Current()->GetVerifierDeps();
+}
+
+static bool FindExistingStringId(const std::vector<std::string>& strings,
+ const std::string& str,
+ uint32_t* found_id) {
+ uint32_t num_extra_ids = strings.size();
+ for (size_t i = 0; i < num_extra_ids; ++i) {
+ if (strings[i] == str) {
+ *found_id = i;
+ return true;
+ }
+ }
+ return false;
+}
+
+dex::StringIndex VerifierDeps::GetIdFromString(const DexFile& dex_file, const std::string& str) {
const DexFile::StringId* string_id = dex_file.FindStringId(str.c_str());
if (string_id != nullptr) {
// String is in the DEX file. Return its ID.
@@ -79,37 +200,45 @@
// String is not in the DEX file. Assign a new ID to it which is higher than
// the number of strings in the DEX file.
- DexFileDeps* deps = GetDexFileDeps(dex_file);
+ // We use the main `VerifierDeps` for adding new strings to simplify
+ // synchronization/merging of these entries between threads.
+ VerifierDeps* singleton = GetMainVerifierDeps();
+ DexFileDeps* deps = singleton->GetDexFileDeps(dex_file);
DCHECK(deps != nullptr);
uint32_t num_ids_in_dex = dex_file.NumStringIds();
- uint32_t num_extra_ids = deps->strings_.size();
+ uint32_t found_id;
- for (size_t i = 0; i < num_extra_ids; ++i) {
- if (deps->strings_[i] == str) {
- return num_ids_in_dex + i;
+ {
+ ReaderMutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
+ if (FindExistingStringId(deps->strings_, str, &found_id)) {
+ return dex::StringIndex(num_ids_in_dex + found_id);
}
}
-
- deps->strings_.push_back(str);
-
- uint32_t new_id = num_ids_in_dex + num_extra_ids;
- CHECK_GE(new_id, num_ids_in_dex); // check for overflows
- DCHECK_EQ(str, GetStringFromId(dex_file, new_id));
-
- return new_id;
+ {
+ WriterMutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
+ if (FindExistingStringId(deps->strings_, str, &found_id)) {
+ return dex::StringIndex(num_ids_in_dex + found_id);
+ }
+ deps->strings_.push_back(str);
+ dex::StringIndex new_id(num_ids_in_dex + deps->strings_.size() - 1);
+ CHECK_GE(new_id.index_, num_ids_in_dex); // check for overflows
+ DCHECK_EQ(str, singleton->GetStringFromId(dex_file, new_id));
+ return new_id;
+ }
}
-std::string VerifierDeps::GetStringFromId(const DexFile& dex_file, uint32_t string_id) const {
+std::string VerifierDeps::GetStringFromId(const DexFile& dex_file, dex::StringIndex string_id)
+ const {
uint32_t num_ids_in_dex = dex_file.NumStringIds();
- if (string_id < num_ids_in_dex) {
+ if (string_id.index_ < num_ids_in_dex) {
return std::string(dex_file.StringDataByIdx(string_id));
} else {
const DexFileDeps* deps = GetDexFileDeps(dex_file);
DCHECK(deps != nullptr);
- string_id -= num_ids_in_dex;
- CHECK_LT(string_id, deps->strings_.size());
- return deps->strings_[string_id];
+ string_id.index_ -= num_ids_in_dex;
+ CHECK_LT(string_id.index_, deps->strings_.size());
+ return deps->strings_[string_id.index_];
}
}
@@ -137,7 +266,7 @@
}
void VerifierDeps::AddClassResolution(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
mirror::Class* klass) {
DexFileDeps* dex_deps = GetDexFileDeps(dex_file);
if (dex_deps == nullptr) {
@@ -151,7 +280,6 @@
return;
}
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
dex_deps->classes_.emplace(ClassResolution(type_idx, GetAccessFlags(klass)));
}
@@ -170,9 +298,11 @@
return;
}
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
- dex_deps->fields_.emplace(FieldResolution(
- field_idx, GetAccessFlags(field), GetDeclaringClassStringId(dex_file, field)));
+ dex_deps->fields_.emplace(FieldResolution(field_idx,
+ GetAccessFlags(field),
+ GetFieldDeclaringClassStringId(dex_file,
+ field_idx,
+ field)));
}
void VerifierDeps::AddMethodResolution(const DexFile& dex_file,
@@ -191,10 +321,9 @@
return;
}
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
MethodResolution method_tuple(method_idx,
GetAccessFlags(method),
- GetDeclaringClassStringId(dex_file, method));
+ GetMethodDeclaringClassStringId(dex_file, method_idx, method));
if (resolution_kind == kDirectMethodResolution) {
dex_deps->direct_methods_.emplace(method_tuple);
} else if (resolution_kind == kVirtualMethodResolution) {
@@ -216,8 +345,15 @@
// merely on no issues with linking (valid access flags, superclass and
// implemented interfaces). If the class at any point reached the IsResolved
// status, the requirement holds. This is guaranteed by RegTypeCache::ResolveClass.
- DCHECK(destination != nullptr && !destination->IsPrimitive());
- DCHECK(source != nullptr && !source->IsPrimitive());
+ DCHECK(destination != nullptr);
+ DCHECK(source != nullptr);
+
+ if (destination->IsPrimitive() || source->IsPrimitive()) {
+ // Primitive types are trivially non-assignable to anything else.
+ // We do not need to record trivial assignability, as it will
+ // not change across releases.
+ return;
+ }
if (destination == source ||
destination->IsObjectClass() ||
@@ -260,15 +396,9 @@
return;
}
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
-
// Get string IDs for both descriptors and store in the appropriate set.
-
- std::string temp1, temp2;
- std::string destination_desc(destination->GetDescriptor(&temp1));
- std::string source_desc(source->GetDescriptor(&temp2));
- uint32_t destination_id = GetIdFromString(dex_file, destination_desc);
- uint32_t source_id = GetIdFromString(dex_file, source_desc);
+ dex::StringIndex destination_id = GetClassDescriptorStringId(dex_file, destination);
+ dex::StringIndex source_id = GetClassDescriptorStringId(dex_file, source);
if (is_assignable) {
dex_deps->assignable_types_.emplace(TypeAssignability(destination_id, source_id));
@@ -277,45 +407,36 @@
}
}
-static inline VerifierDeps* GetVerifierDepsSingleton() {
- CompilerCallbacks* callbacks = Runtime::Current()->GetCompilerCallbacks();
- if (callbacks == nullptr) {
- return nullptr;
- }
- return callbacks->GetVerifierDeps();
-}
-
void VerifierDeps::MaybeRecordVerificationStatus(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
MethodVerifier::FailureKind failure_kind) {
if (failure_kind == MethodVerifier::kNoFailure) {
// We only record classes that did not fully verify at compile time.
return;
}
- VerifierDeps* singleton = GetVerifierDepsSingleton();
- if (singleton != nullptr) {
- DexFileDeps* dex_deps = singleton->GetDexFileDeps(dex_file);
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
+ VerifierDeps* thread_deps = GetThreadLocalVerifierDeps();
+ if (thread_deps != nullptr) {
+ DexFileDeps* dex_deps = thread_deps->GetDexFileDeps(dex_file);
dex_deps->unverified_classes_.push_back(type_idx);
}
}
void VerifierDeps::MaybeRecordClassResolution(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
mirror::Class* klass) {
- VerifierDeps* singleton = GetVerifierDepsSingleton();
- if (singleton != nullptr) {
- singleton->AddClassResolution(dex_file, type_idx, klass);
+ VerifierDeps* thread_deps = GetThreadLocalVerifierDeps();
+ if (thread_deps != nullptr) {
+ thread_deps->AddClassResolution(dex_file, type_idx, klass);
}
}
void VerifierDeps::MaybeRecordFieldResolution(const DexFile& dex_file,
uint32_t field_idx,
ArtField* field) {
- VerifierDeps* singleton = GetVerifierDepsSingleton();
- if (singleton != nullptr) {
- singleton->AddFieldResolution(dex_file, field_idx, field);
+ VerifierDeps* thread_deps = GetThreadLocalVerifierDeps();
+ if (thread_deps != nullptr) {
+ thread_deps->AddFieldResolution(dex_file, field_idx, field);
}
}
@@ -323,9 +444,9 @@
uint32_t method_idx,
MethodResolutionKind resolution_kind,
ArtMethod* method) {
- VerifierDeps* singleton = GetVerifierDepsSingleton();
- if (singleton != nullptr) {
- singleton->AddMethodResolution(dex_file, method_idx, resolution_kind, method);
+ VerifierDeps* thread_deps = GetThreadLocalVerifierDeps();
+ if (thread_deps != nullptr) {
+ thread_deps->AddMethodResolution(dex_file, method_idx, resolution_kind, method);
}
}
@@ -334,42 +455,74 @@
mirror::Class* source,
bool is_strict,
bool is_assignable) {
- VerifierDeps* singleton = GetVerifierDepsSingleton();
- if (singleton != nullptr) {
- singleton->AddAssignability(dex_file, destination, source, is_strict, is_assignable);
+ VerifierDeps* thread_deps = GetThreadLocalVerifierDeps();
+ if (thread_deps != nullptr) {
+ thread_deps->AddAssignability(dex_file, destination, source, is_strict, is_assignable);
}
}
+namespace {
+
static inline uint32_t DecodeUint32WithOverflowCheck(const uint8_t** in, const uint8_t* end) {
CHECK_LT(*in, end);
return DecodeUnsignedLeb128(in);
}
+template<typename T> inline uint32_t Encode(T in);
+
+template<> inline uint32_t Encode<uint16_t>(uint16_t in) {
+ return in;
+}
+template<> inline uint32_t Encode<uint32_t>(uint32_t in) {
+ return in;
+}
+template<> inline uint32_t Encode<dex::TypeIndex>(dex::TypeIndex in) {
+ return in.index_;
+}
+template<> inline uint32_t Encode<dex::StringIndex>(dex::StringIndex in) {
+ return in.index_;
+}
+
+template<typename T> inline T Decode(uint32_t in);
+
+template<> inline uint16_t Decode<uint16_t>(uint32_t in) {
+ return dchecked_integral_cast<uint16_t>(in);
+}
+template<> inline uint32_t Decode<uint32_t>(uint32_t in) {
+ return in;
+}
+template<> inline dex::TypeIndex Decode<dex::TypeIndex>(uint32_t in) {
+ return dex::TypeIndex(in);
+}
+template<> inline dex::StringIndex Decode<dex::StringIndex>(uint32_t in) {
+ return dex::StringIndex(in);
+}
+
template<typename T1, typename T2>
static inline void EncodeTuple(std::vector<uint8_t>* out, const std::tuple<T1, T2>& t) {
- EncodeUnsignedLeb128(out, std::get<0>(t));
- EncodeUnsignedLeb128(out, std::get<1>(t));
+ EncodeUnsignedLeb128(out, Encode(std::get<0>(t)));
+ EncodeUnsignedLeb128(out, Encode(std::get<1>(t)));
}
template<typename T1, typename T2>
static inline void DecodeTuple(const uint8_t** in, const uint8_t* end, std::tuple<T1, T2>* t) {
- T1 v1 = static_cast<T1>(DecodeUint32WithOverflowCheck(in, end));
- T2 v2 = static_cast<T2>(DecodeUint32WithOverflowCheck(in, end));
+ T1 v1 = Decode<T1>(DecodeUint32WithOverflowCheck(in, end));
+ T2 v2 = Decode<T2>(DecodeUint32WithOverflowCheck(in, end));
*t = std::make_tuple(v1, v2);
}
template<typename T1, typename T2, typename T3>
static inline void EncodeTuple(std::vector<uint8_t>* out, const std::tuple<T1, T2, T3>& t) {
- EncodeUnsignedLeb128(out, std::get<0>(t));
- EncodeUnsignedLeb128(out, std::get<1>(t));
- EncodeUnsignedLeb128(out, std::get<2>(t));
+ EncodeUnsignedLeb128(out, Encode(std::get<0>(t)));
+ EncodeUnsignedLeb128(out, Encode(std::get<1>(t)));
+ EncodeUnsignedLeb128(out, Encode(std::get<2>(t)));
}
template<typename T1, typename T2, typename T3>
static inline void DecodeTuple(const uint8_t** in, const uint8_t* end, std::tuple<T1, T2, T3>* t) {
- T1 v1 = static_cast<T1>(DecodeUint32WithOverflowCheck(in, end));
- T2 v2 = static_cast<T2>(DecodeUint32WithOverflowCheck(in, end));
- T3 v3 = static_cast<T2>(DecodeUint32WithOverflowCheck(in, end));
+ T1 v1 = Decode<T1>(DecodeUint32WithOverflowCheck(in, end));
+ T2 v2 = Decode<T2>(DecodeUint32WithOverflowCheck(in, end));
+ T3 v3 = Decode<T3>(DecodeUint32WithOverflowCheck(in, end));
*t = std::make_tuple(v1, v2, v3);
}
@@ -381,11 +534,12 @@
}
}
+template <typename T>
static inline void EncodeUint16Vector(std::vector<uint8_t>* out,
- const std::vector<uint16_t>& vector) {
+ const std::vector<T>& vector) {
EncodeUnsignedLeb128(out, vector.size());
- for (uint16_t entry : vector) {
- EncodeUnsignedLeb128(out, entry);
+ for (const T& entry : vector) {
+ EncodeUnsignedLeb128(out, Encode(entry));
}
}
@@ -400,14 +554,16 @@
}
}
+template<typename T>
static inline void DecodeUint16Vector(const uint8_t** in,
const uint8_t* end,
- std::vector<uint16_t>* vector) {
+ std::vector<T>* vector) {
DCHECK(vector->empty());
size_t num_entries = DecodeUint32WithOverflowCheck(in, end);
vector->reserve(num_entries);
for (size_t i = 0; i < num_entries; ++i) {
- vector->push_back(dchecked_integral_cast<uint16_t>(DecodeUint32WithOverflowCheck(in, end)));
+ vector->push_back(
+ Decode<T>(dchecked_integral_cast<uint16_t>(DecodeUint32WithOverflowCheck(in, end))));
}
}
@@ -436,9 +592,10 @@
}
}
+} // namespace
+
void VerifierDeps::Encode(const std::vector<const DexFile*>& dex_files,
std::vector<uint8_t>* buffer) const {
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
for (const DexFile* dex_file : dex_files) {
const DexFileDeps& deps = *GetDexFileDeps(*dex_file);
EncodeStringVector(buffer, deps.strings_);
@@ -480,8 +637,6 @@
}
bool VerifierDeps::Equals(const VerifierDeps& rhs) const {
- MutexLock mu(Thread::Current(), *Locks::verifier_deps_lock_);
-
if (dex_deps_.size() != rhs.dex_deps_.size()) {
return false;
}
@@ -599,7 +754,7 @@
}
}
- for (uint16_t type_index : dep.second->unverified_classes_) {
+ for (dex::TypeIndex type_index : dep.second->unverified_classes_) {
vios->Stream()
<< dex_file.StringByTypeIdx(type_index)
<< " is expected to be verified at runtime\n";
diff --git a/runtime/verifier/verifier_deps.h b/runtime/verifier/verifier_deps.h
index 7b419d4..4b8206f 100644
--- a/runtime/verifier/verifier_deps.h
+++ b/runtime/verifier/verifier_deps.h
@@ -42,29 +42,30 @@
// which are being compiled. Classes defined in DEX files outside of this set
// (or synthesized classes without associated DEX files) are considered being
// in the classpath.
-// During code-flow verification, the MethodVerifier informs the VerifierDeps
-// singleton about the outcome of every resolution and assignability test, and
-// the singleton records them if their outcome may change with changes in the
-// classpath.
+// During code-flow verification, the MethodVerifier informs VerifierDeps
+// about the outcome of every resolution and assignability test, and
+// the VerifierDeps object records them if their outcome may change with
+// changes in the classpath.
class VerifierDeps {
public:
- explicit VerifierDeps(const std::vector<const DexFile*>& dex_files)
- REQUIRES(!Locks::verifier_deps_lock_);
+ explicit VerifierDeps(const std::vector<const DexFile*>& dex_files);
- VerifierDeps(const std::vector<const DexFile*>& dex_files,
- ArrayRef<const uint8_t> data)
- REQUIRES(!Locks::verifier_deps_lock_);
+ VerifierDeps(const std::vector<const DexFile*>& dex_files, ArrayRef<const uint8_t> data);
+
+ // Merge `other` into this `VerifierDeps`'. `other` and `this` must be for the
+ // same set of dex files.
+ void MergeWith(const VerifierDeps& other, const std::vector<const DexFile*>& dex_files);
// Record the verification status of the class at `type_idx`.
static void MaybeRecordVerificationStatus(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
MethodVerifier::FailureKind failure_kind)
REQUIRES(!Locks::verifier_deps_lock_);
// Record the outcome `klass` of resolving type `type_idx` from `dex_file`.
// If `klass` is null, the class is assumed unresolved.
static void MaybeRecordClassResolution(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
mirror::Class* klass)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Locks::verifier_deps_lock_);
@@ -101,76 +102,70 @@
// Serialize the recorded dependencies and store the data into `buffer`.
// `dex_files` provides the order of the dex files in which the dependencies
// should be emitted.
- void Encode(const std::vector<const DexFile*>& dex_files, std::vector<uint8_t>* buffer) const
- REQUIRES(!Locks::verifier_deps_lock_);
+ void Encode(const std::vector<const DexFile*>& dex_files, std::vector<uint8_t>* buffer) const;
- // NO_THREAD_SAFETY_ANALYSIS as Dump iterates over dex_deps_, which is guarded by
- // verifier_deps_lock_, but we expect Dump to be called once the deps collection is done.
- void Dump(VariableIndentationOutputStream* vios) const
- NO_THREAD_SAFETY_ANALYSIS;
+ void Dump(VariableIndentationOutputStream* vios) const;
// Verify the encoded dependencies of this `VerifierDeps` are still valid.
- // NO_THREAD_SAFETY_ANALYSIS, as this must be called on a read-only `VerifierDeps`.
bool ValidateDependencies(Handle<mirror::ClassLoader> class_loader, Thread* self) const
- NO_THREAD_SAFETY_ANALYSIS;
+ REQUIRES_SHARED(Locks::mutator_lock_);
- // NO_THREAD_SAFETY_ANALSYS, as this is queried when the VerifierDeps are
- // fully created.
- const std::vector<uint16_t>& GetUnverifiedClasses(const DexFile& dex_file) const
- NO_THREAD_SAFETY_ANALYSIS {
+ const std::vector<dex::TypeIndex>& GetUnverifiedClasses(const DexFile& dex_file) const {
return GetDexFileDeps(dex_file)->unverified_classes_;
}
private:
static constexpr uint16_t kUnresolvedMarker = static_cast<uint16_t>(-1);
- using ClassResolutionBase = std::tuple<uint32_t, uint16_t>;
+ using ClassResolutionBase = std::tuple<dex::TypeIndex, uint16_t>;
struct ClassResolution : public ClassResolutionBase {
ClassResolution() = default;
ClassResolution(const ClassResolution&) = default;
- ClassResolution(uint32_t type_idx, uint16_t access_flags)
+ ClassResolution(dex::TypeIndex type_idx, uint16_t access_flags)
: ClassResolutionBase(type_idx, access_flags) {}
bool IsResolved() const { return GetAccessFlags() != kUnresolvedMarker; }
- uint32_t GetDexTypeIndex() const { return std::get<0>(*this); }
+ dex::TypeIndex GetDexTypeIndex() const { return std::get<0>(*this); }
uint16_t GetAccessFlags() const { return std::get<1>(*this); }
};
- using FieldResolutionBase = std::tuple<uint32_t, uint16_t, uint32_t>;
+ using FieldResolutionBase = std::tuple<uint32_t, uint16_t, dex::StringIndex>;
struct FieldResolution : public FieldResolutionBase {
FieldResolution() = default;
FieldResolution(const FieldResolution&) = default;
- FieldResolution(uint32_t field_idx, uint16_t access_flags, uint32_t declaring_class_idx)
+ FieldResolution(uint32_t field_idx, uint16_t access_flags, dex::StringIndex declaring_class_idx)
: FieldResolutionBase(field_idx, access_flags, declaring_class_idx) {}
bool IsResolved() const { return GetAccessFlags() != kUnresolvedMarker; }
uint32_t GetDexFieldIndex() const { return std::get<0>(*this); }
uint16_t GetAccessFlags() const { return std::get<1>(*this); }
- uint32_t GetDeclaringClassIndex() const { return std::get<2>(*this); }
+ dex::StringIndex GetDeclaringClassIndex() const { return std::get<2>(*this); }
};
- using MethodResolutionBase = std::tuple<uint32_t, uint16_t, uint32_t>;
+ using MethodResolutionBase = std::tuple<uint32_t, uint16_t, dex::StringIndex>;
struct MethodResolution : public MethodResolutionBase {
MethodResolution() = default;
MethodResolution(const MethodResolution&) = default;
- MethodResolution(uint32_t method_idx, uint16_t access_flags, uint32_t declaring_class_idx)
+ MethodResolution(uint32_t method_idx,
+ uint16_t access_flags,
+ dex::StringIndex declaring_class_idx)
: MethodResolutionBase(method_idx, access_flags, declaring_class_idx) {}
bool IsResolved() const { return GetAccessFlags() != kUnresolvedMarker; }
uint32_t GetDexMethodIndex() const { return std::get<0>(*this); }
uint16_t GetAccessFlags() const { return std::get<1>(*this); }
- uint32_t GetDeclaringClassIndex() const { return std::get<2>(*this); }
+ dex::StringIndex GetDeclaringClassIndex() const { return std::get<2>(*this); }
};
- using TypeAssignabilityBase = std::tuple<uint32_t, uint32_t>;
+ using TypeAssignabilityBase = std::tuple<dex::StringIndex, dex::StringIndex>;
struct TypeAssignability : public TypeAssignabilityBase {
TypeAssignability() = default;
TypeAssignability(const TypeAssignability&) = default;
- TypeAssignability(uint32_t destination_idx, uint32_t source_idx)
+ TypeAssignability(dex::StringIndex destination_idx, dex::StringIndex source_idx)
: TypeAssignabilityBase(destination_idx, source_idx) {}
- uint32_t GetDestination() const { return std::get<0>(*this); }
- uint32_t GetSource() const { return std::get<1>(*this); }
+ dex::StringIndex GetDestination() const { return std::get<0>(*this); }
+ dex::StringIndex GetSource() const { return std::get<1>(*this); }
};
// Data structure representing dependencies collected during verification of
@@ -193,20 +188,16 @@
std::set<MethodResolution> interface_methods_;
// List of classes that were not fully verified in that dex file.
- std::vector<uint16_t> unverified_classes_;
+ std::vector<dex::TypeIndex> unverified_classes_;
bool Equals(const DexFileDeps& rhs) const;
};
// Finds the DexFileDep instance associated with `dex_file`, or nullptr if
// `dex_file` is not reported as being compiled.
- // We disable thread safety analysis. The method only reads the key set of
- // `dex_deps_` which stays constant after initialization.
- DexFileDeps* GetDexFileDeps(const DexFile& dex_file)
- NO_THREAD_SAFETY_ANALYSIS;
+ DexFileDeps* GetDexFileDeps(const DexFile& dex_file);
- const DexFileDeps* GetDexFileDeps(const DexFile& dex_file) const
- NO_THREAD_SAFETY_ANALYSIS;
+ const DexFileDeps* GetDexFileDeps(const DexFile& dex_file) const;
// Returns true if `klass` is null or not defined in any of dex files which
// were reported as being compiled.
@@ -217,12 +208,11 @@
// string ID. If not, an ID is assigned to the string and cached in `strings_`
// of the corresponding DexFileDeps structure (either provided or inferred from
// `dex_file`).
- uint32_t GetIdFromString(const DexFile& dex_file, const std::string& str)
- REQUIRES(Locks::verifier_deps_lock_);
+ dex::StringIndex GetIdFromString(const DexFile& dex_file, const std::string& str)
+ REQUIRES(!Locks::verifier_deps_lock_);
// Returns the string represented by `id`.
- std::string GetStringFromId(const DexFile& dex_file, uint32_t string_id) const
- REQUIRES(Locks::verifier_deps_lock_);
+ std::string GetStringFromId(const DexFile& dex_file, dex::StringIndex string_id) const;
// Returns the bytecode access flags of `element` (bottom 16 bits), or
// `kUnresolvedMarker` if `element` is null.
@@ -232,13 +222,22 @@
// Returns a string ID of the descriptor of the declaring class of `element`,
// or `kUnresolvedMarker` if `element` is null.
- template <typename T>
- uint32_t GetDeclaringClassStringId(const DexFile& dex_file, T* element)
+ dex::StringIndex GetMethodDeclaringClassStringId(const DexFile& dex_file,
+ uint32_t dex_method_idx,
+ ArtMethod* method)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+ dex::StringIndex GetFieldDeclaringClassStringId(const DexFile& dex_file,
+ uint32_t dex_field_idx,
+ ArtField* field)
+ REQUIRES_SHARED(Locks::mutator_lock_);
+
+ // Returns a string ID of the descriptor of the class.
+ dex::StringIndex GetClassDescriptorStringId(const DexFile& dex_file, ObjPtr<mirror::Class> klass)
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(Locks::verifier_deps_lock_);
+ REQUIRES(!Locks::verifier_deps_lock_);
void AddClassResolution(const DexFile& dex_file,
- uint16_t type_idx,
+ dex::TypeIndex type_idx,
mirror::Class* klass)
REQUIRES_SHARED(Locks::mutator_lock_)
REQUIRES(!Locks::verifier_deps_lock_);
@@ -261,11 +260,9 @@
mirror::Class* source,
bool is_strict,
bool is_assignable)
- REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(!Locks::verifier_deps_lock_);
+ REQUIRES_SHARED(Locks::mutator_lock_);
- bool Equals(const VerifierDeps& rhs) const
- REQUIRES(!Locks::verifier_deps_lock_);
+ bool Equals(const VerifierDeps& rhs) const;
// Verify `dex_file` according to the `deps`, that is going over each
// `DexFileDeps` field, and checking that the recorded information still
@@ -274,16 +271,14 @@
const DexFile& dex_file,
const DexFileDeps& deps,
Thread* self) const
- REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(Locks::verifier_deps_lock_);
+ REQUIRES_SHARED(Locks::mutator_lock_);
bool VerifyAssignability(Handle<mirror::ClassLoader> class_loader,
const DexFile& dex_file,
const std::set<TypeAssignability>& assignables,
bool expected_assignability,
Thread* self) const
- REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(Locks::verifier_deps_lock_);
+ REQUIRES_SHARED(Locks::mutator_lock_);
// Verify that the set of resolved classes at the point of creation
// of this `VerifierDeps` is still the same.
@@ -291,8 +286,7 @@
const DexFile& dex_file,
const std::set<ClassResolution>& classes,
Thread* self) const
- REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(Locks::verifier_deps_lock_);
+ REQUIRES_SHARED(Locks::mutator_lock_);
// Verify that the set of resolved fields at the point of creation
// of this `VerifierDeps` is still the same, and each field resolves to the
@@ -302,7 +296,7 @@
const std::set<FieldResolution>& classes,
Thread* self) const
REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(Locks::verifier_deps_lock_);
+ REQUIRES(!Locks::verifier_deps_lock_);
// Verify that the set of resolved methods at the point of creation
// of this `VerifierDeps` is still the same, and each method resolves to the
@@ -312,12 +306,10 @@
const std::set<MethodResolution>& methods,
MethodResolutionKind kind,
Thread* self) const
- REQUIRES_SHARED(Locks::mutator_lock_)
- REQUIRES(Locks::verifier_deps_lock_);
+ REQUIRES_SHARED(Locks::mutator_lock_);
// Map from DexFiles into dependencies collected from verification of their methods.
- std::map<const DexFile*, std::unique_ptr<DexFileDeps>> dex_deps_
- GUARDED_BY(Locks::verifier_deps_lock_);
+ std::map<const DexFile*, std::unique_ptr<DexFileDeps>> dex_deps_;
friend class VerifierDepsTest;
ART_FRIEND_TEST(VerifierDepsTest, StringToId);
diff --git a/runtime/well_known_classes.cc b/runtime/well_known_classes.cc
index 3549586..009170c 100644
--- a/runtime/well_known_classes.cc
+++ b/runtime/well_known_classes.cc
@@ -20,6 +20,8 @@
#include <sstream>
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
#include "entrypoints/quick/quick_entrypoints_enum.h"
#include "jni_internal.h"
@@ -189,7 +191,7 @@
static jmethodID CachePrimitiveBoxingMethod(JNIEnv* env, char prim_name, const char* boxed_name) {
ScopedLocalRef<jclass> boxed_class(env, env->FindClass(boxed_name));
return CacheMethod(env, boxed_class.get(), true, "valueOf",
- StringPrintf("(%c)L%s;", prim_name, boxed_name).c_str());
+ android::base::StringPrintf("(%c)L%s;", prim_name, boxed_name).c_str());
}
#define STRING_INIT_LIST(V) \
diff --git a/runtime/zip_archive.cc b/runtime/zip_archive.cc
index d96fb42..cd79bb6 100644
--- a/runtime/zip_archive.cc
+++ b/runtime/zip_archive.cc
@@ -23,7 +23,6 @@
#include <unistd.h>
#include <vector>
-#include "base/stringprintf.h"
#include "base/unix_file/fd_file.h"
namespace art {
diff --git a/test/021-string2/expected.txt b/test/021-string2/expected.txt
index a9c6eb8..f269c7c 100644
--- a/test/021-string2/expected.txt
+++ b/test/021-string2/expected.txt
@@ -1,2 +1,6 @@
Got expected npe
OK
+ true true true true
+ true true true true
+ true true true true
+ true true true true
diff --git a/test/021-string2/src/Main.java b/test/021-string2/src/Main.java
index 51351e1..df0a3dd 100644
--- a/test/021-string2/src/Main.java
+++ b/test/021-string2/src/Main.java
@@ -92,6 +92,31 @@
testCompareToAndEquals();
testIndexOf();
+
+ String s0_0 = "\u0000";
+ String s0_1 = new String(s0_0);
+ String s0_2 = new String(new char[] { '\u0000' });
+ String s0_3 = s0_0 + "";
+ System.out.println(
+ " " + $noinline$equals(s0_0, s0_0) +
+ " " + $noinline$equals(s0_0, s0_1) +
+ " " + $noinline$equals(s0_0, s0_2) +
+ " " + $noinline$equals(s0_0, s0_3));
+ System.out.println(
+ " " + $noinline$equals(s0_1, s0_0) +
+ " " + $noinline$equals(s0_1, s0_1) +
+ " " + $noinline$equals(s0_1, s0_2) +
+ " " + $noinline$equals(s0_1, s0_3));
+ System.out.println(
+ " " + $noinline$equals(s0_2, s0_0) +
+ " " + $noinline$equals(s0_2, s0_1) +
+ " " + $noinline$equals(s0_2, s0_2) +
+ " " + $noinline$equals(s0_2, s0_3));
+ System.out.println(
+ " " + $noinline$equals(s0_3, s0_0) +
+ " " + $noinline$equals(s0_3, s0_1) +
+ " " + $noinline$equals(s0_3, s0_2) +
+ " " + $noinline$equals(s0_3, s0_3));
}
public static void testCompareToAndEquals() {
diff --git a/test/080-oom-fragmentation/expected.txt b/test/080-oom-fragmentation/expected.txt
new file mode 100644
index 0000000..e69de29
--- /dev/null
+++ b/test/080-oom-fragmentation/expected.txt
diff --git a/test/080-oom-fragmentation/info.txt b/test/080-oom-fragmentation/info.txt
new file mode 100644
index 0000000..5bcc425
--- /dev/null
+++ b/test/080-oom-fragmentation/info.txt
@@ -0,0 +1,2 @@
+Test that the allocator can go from a full heap to an empty one and is able to allocate a large
+object array.
diff --git a/test/080-oom-fragmentation/src/Main.java b/test/080-oom-fragmentation/src/Main.java
new file mode 100644
index 0000000..cf21139
--- /dev/null
+++ b/test/080-oom-fragmentation/src/Main.java
@@ -0,0 +1,35 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Main {
+ public static void main(String[] args) {
+ // Reserve around 1/4 of the RAM for keeping objects live.
+ long maxMem = Runtime.getRuntime().maxMemory();
+ Object[] holder = new Object[(int)maxMem / 16];
+ int count = 0;
+ try {
+ while (true) {
+ holder[count++] = new Object[1025]; // A bit over one page.
+ }
+ } catch (OutOfMemoryError e) {}
+ for (int i = 0; i < count; ++i) {
+ holder[i] = null;
+ }
+ // Make sure the heap can handle allocating large object array. This makes sure that free
+ // pages are correctly coalesced together by the allocator.
+ holder[0] = new Object[(int)maxMem / 8];
+ }
+}
diff --git a/test/137-cfi/cfi.cc b/test/137-cfi/cfi.cc
index 113b35f..3b237f4 100644
--- a/test/137-cfi/cfi.cc
+++ b/test/137-cfi/cfi.cc
@@ -25,11 +25,11 @@
#include "jni.h"
+#include "android-base/stringprintf.h"
#include <backtrace/Backtrace.h>
#include "base/logging.h"
#include "base/macros.h"
-#include "base/stringprintf.h"
#include "gc/heap.h"
#include "gc/space/image_space.h"
#include "oat_file.h"
@@ -91,7 +91,7 @@
static void MoreErrorInfo(pid_t pid, bool sig_quit_on_fail) {
printf("Secondary pid is %d\n", pid);
- PrintFileToLog(StringPrintf("/proc/%d/maps", pid), ::android::base::ERROR);
+ PrintFileToLog(android::base::StringPrintf("/proc/%d/maps", pid), ::android::base::ERROR);
if (sig_quit_on_fail) {
int res = kill(pid, SIGQUIT);
diff --git a/test/153-reference-stress/expected.txt b/test/153-reference-stress/expected.txt
new file mode 100644
index 0000000..7ef22e9
--- /dev/null
+++ b/test/153-reference-stress/expected.txt
@@ -0,0 +1 @@
+PASS
diff --git a/test/153-reference-stress/info.txt b/test/153-reference-stress/info.txt
new file mode 100644
index 0000000..6bc0040
--- /dev/null
+++ b/test/153-reference-stress/info.txt
@@ -0,0 +1 @@
+Tests java.lang.ref.Reference.get() and GC running in parallel.
diff --git a/test/153-reference-stress/src/Main.java b/test/153-reference-stress/src/Main.java
new file mode 100644
index 0000000..fc6f9cc
--- /dev/null
+++ b/test/153-reference-stress/src/Main.java
@@ -0,0 +1,73 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.ref.WeakReference;
+
+public class Main {
+ static final int numWeakReferences = 16 * 1024;
+ static WeakReference[] weakReferences = new WeakReference[numWeakReferences];
+ static volatile boolean done = false;
+ static Object keepAlive;
+
+ public static void main(String[] args) throws Exception {
+ // Try to call Reference.get repeatedly while the GC is running.
+ Thread gcThread = new GcThread();
+ Thread[] readerThread = new ReaderThread[4];
+ for (int i = 0; i < readerThread.length; ++i) {
+ readerThread[i] = new ReaderThread();
+ }
+ gcThread.start();
+ for (int i = 0; i < readerThread.length; ++i) {
+ readerThread[i].start();
+ }
+ gcThread.join();
+ for (int i = 0; i < readerThread.length; ++i) {
+ readerThread[i].join();
+ }
+ System.out.println("PASS");
+ }
+
+ static class GcThread extends Thread {
+ GcThread() {
+ Object temp = new Object();
+ for (int j = 0; j < weakReferences.length; ++j) {
+ weakReferences[j] = new WeakReference(temp);
+ }
+ }
+ public void run() {
+ for (int i = 0; i < 1000; ++i) {
+ Object o = new Object();
+ for (int j = 0; j < weakReferences.length; ++j) {
+ weakReferences[j] = new WeakReference(o);
+ }
+ }
+ done = true;
+ }
+ }
+
+ static class ReaderThread extends Thread {
+ public void run() {
+ while (!done) {
+ for (int j = 0; j < weakReferences.length; ++j) {
+ keepAlive = weakReferences[j].get();
+ }
+ for (int j = 0; j < weakReferences.length; ++j) {
+ weakReferences[j].clear();
+ }
+ }
+ }
+ }
+}
diff --git a/test/422-type-conversion/src/Main.java b/test/422-type-conversion/src/Main.java
index 146f309..7754b75 100644
--- a/test/422-type-conversion/src/Main.java
+++ b/test/422-type-conversion/src/Main.java
@@ -390,6 +390,8 @@
assertLongEquals(9223372036854775807L, $opt$noinline$FloatToLong(9223372036854775807F)); // 2^63 - 1
assertLongEquals(-9223372036854775808L, $opt$noinline$FloatToLong(-9223372036854775807F)); // -(2^63 - 1)
assertLongEquals(-9223372036854775808L, $opt$noinline$FloatToLong(-9223372036854775808F)); // -(2^63)
+ assertLongEquals(9223371487098961920L, $opt$noinline$FloatToLong(9223371487098961920F)); // Math.nextAfter(2F^63, 0)
+ assertLongEquals(-9223371487098961920L, $opt$noinline$FloatToLong(-9223371487098961920F)); // Math.nextAfter(-2F^63, 0)
assertLongEquals(0L, $opt$noinline$FloatToLong(Float.NaN));
assertLongEquals(9223372036854775807L, $opt$noinline$FloatToLong(Float.POSITIVE_INFINITY));
assertLongEquals(-9223372036854775808L, $opt$noinline$FloatToLong(Float.NEGATIVE_INFINITY));
@@ -469,6 +471,8 @@
assertLongEquals(-9223372036854775808L, $opt$noinline$DoubleToLong(-9223372036854775807D)); // -(2^63 - 1)
assertLongEquals(-9223372036854775808L, $opt$noinline$DoubleToLong(-9223372036854775808D)); // -(2^63)
assertLongEquals(0L, $opt$noinline$DoubleToLong(Double.NaN));
+ assertLongEquals(9223372036854774784L, $opt$noinline$DoubleToLong(9223372036854774784D)); // Math.nextAfter(2D^63, 0)
+ assertLongEquals(-9223372036854774784L, $opt$noinline$DoubleToLong(-9223372036854774784D)); // Math.nextAfter(-2D^63, 0)
assertLongEquals(9223372036854775807L, $opt$noinline$DoubleToLong(Double.POSITIVE_INFINITY));
assertLongEquals(-9223372036854775808L, $opt$noinline$DoubleToLong(Double.NEGATIVE_INFINITY));
}
diff --git a/test/454-get-vreg/get_vreg_jni.cc b/test/454-get-vreg/get_vreg_jni.cc
index 0360eda..5fc5464 100644
--- a/test/454-get-vreg/get_vreg_jni.cc
+++ b/test/454-get-vreg/get_vreg_jni.cc
@@ -46,12 +46,12 @@
CHECK_EQ(value, 42u);
bool success = GetVReg(m, 1, kIntVReg, &value);
- if (!IsCurrentFrameInInterpreter() && GetCurrentOatQuickMethodHeader()->IsOptimized()) {
+ if (!IsShadowFrame() && GetCurrentOatQuickMethodHeader()->IsOptimized()) {
CHECK(!success);
}
success = GetVReg(m, 2, kIntVReg, &value);
- if (!IsCurrentFrameInInterpreter() && GetCurrentOatQuickMethodHeader()->IsOptimized()) {
+ if (!IsShadowFrame() && GetCurrentOatQuickMethodHeader()->IsOptimized()) {
CHECK(!success);
}
@@ -83,12 +83,12 @@
CHECK_EQ(value, 42u);
bool success = GetVRegPair(m, 2, kLongLoVReg, kLongHiVReg, &value);
- if (!IsCurrentFrameInInterpreter() && GetCurrentOatQuickMethodHeader()->IsOptimized()) {
+ if (!IsShadowFrame() && GetCurrentOatQuickMethodHeader()->IsOptimized()) {
CHECK(!success);
}
success = GetVRegPair(m, 4, kLongLoVReg, kLongHiVReg, &value);
- if (!IsCurrentFrameInInterpreter() && GetCurrentOatQuickMethodHeader()->IsOptimized()) {
+ if (!IsShadowFrame() && GetCurrentOatQuickMethodHeader()->IsOptimized()) {
CHECK(!success);
}
diff --git a/test/457-regs/regs_jni.cc b/test/457-regs/regs_jni.cc
index f62a77d..f867bdf 100644
--- a/test/457-regs/regs_jni.cc
+++ b/test/457-regs/regs_jni.cc
@@ -64,7 +64,7 @@
CHECK_EQ(value, 1u);
bool success = GetVReg(m, 2, kIntVReg, &value);
- if (!IsCurrentFrameInInterpreter() && GetCurrentOatQuickMethodHeader()->IsOptimized()) {
+ if (!IsShadowFrame() && GetCurrentOatQuickMethodHeader()->IsOptimized()) {
CHECK(!success);
}
diff --git a/test/522-checker-regression-monitor-exit/src/Main.java b/test/522-checker-regression-monitor-exit/src/Main.java
index a5e9512..c4f80fc 100644
--- a/test/522-checker-regression-monitor-exit/src/Main.java
+++ b/test/522-checker-regression-monitor-exit/src/Main.java
@@ -66,7 +66,7 @@
}
try {
- List<Future<Integer>> results = pool.invokeAll(queries, 5, TimeUnit.SECONDS);
+ List<Future<Integer>> results = pool.invokeAll(queries);
int hash = obj.hashCode();
for (int i = 0; i < numThreads; ++i) {
diff --git a/test/530-checker-loops1/info.txt b/test/530-checker-loops1/info.txt
index f5d334d..ecefa7e 100644
--- a/test/530-checker-loops1/info.txt
+++ b/test/530-checker-loops1/info.txt
@@ -1 +1 @@
-Test on loop optimizations.
+Test on loop optimizations, in particular around common induction.
diff --git a/test/530-checker-loops1/src/Main.java b/test/530-checker-loops1/src/Main.java
index dde4d62..383c28f 100644
--- a/test/530-checker-loops1/src/Main.java
+++ b/test/530-checker-loops1/src/Main.java
@@ -15,7 +15,7 @@
*/
//
-// Test on loop optimizations.
+// Test on loop optimizations, in particular around common induction.
//
public class Main {
diff --git a/test/530-checker-loops2/info.txt b/test/530-checker-loops2/info.txt
index f5d334d..3b5a7ad 100644
--- a/test/530-checker-loops2/info.txt
+++ b/test/530-checker-loops2/info.txt
@@ -1 +1 @@
-Test on loop optimizations.
+Test on loop optimizations, in particular around less common induction.
diff --git a/test/530-checker-loops2/src/Main.java b/test/530-checker-loops2/src/Main.java
index 47b6475..a94d69b 100644
--- a/test/530-checker-loops2/src/Main.java
+++ b/test/530-checker-loops2/src/Main.java
@@ -15,7 +15,7 @@
*/
//
-// Test on loop optimizations.
+// Test on loop optimizations, in particular around less common induction.
//
public class Main {
diff --git a/test/530-checker-loops3/info.txt b/test/530-checker-loops3/info.txt
index 07d99a3..e262f8e 100644
--- a/test/530-checker-loops3/info.txt
+++ b/test/530-checker-loops3/info.txt
@@ -1 +1 @@
-Test on loop optimizations, in particular loop-based dynamic bce.
+Test on loop optimizations, in particular around loop-based dynamic bce.
diff --git a/test/530-checker-loops4/expected.txt b/test/530-checker-loops4/expected.txt
new file mode 100644
index 0000000..b0aad4d
--- /dev/null
+++ b/test/530-checker-loops4/expected.txt
@@ -0,0 +1 @@
+passed
diff --git a/test/530-checker-loops4/info.txt b/test/530-checker-loops4/info.txt
new file mode 100644
index 0000000..10cf3b1
--- /dev/null
+++ b/test/530-checker-loops4/info.txt
@@ -0,0 +1 @@
+Test on loop optimizations, in particular with geometric induction.
diff --git a/test/530-checker-loops4/src/Main.java b/test/530-checker-loops4/src/Main.java
new file mode 100644
index 0000000..91af1f4
--- /dev/null
+++ b/test/530-checker-loops4/src/Main.java
@@ -0,0 +1,371 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+//
+// Test on loop optimizations, in particular around geometric induction.
+//
+public class Main {
+
+ /// CHECK-START: int Main.geo1(int) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Mul loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.geo1(int) loop_optimization (after)
+ /// CHECK-DAG: <<Par:i\d+>> ParameterValue loop:none
+ /// CHECK-DAG: <<Zer:i\d+>> IntConstant 0 loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 1410065408 loop:none
+ /// CHECK-DAG: <<Mul:i\d+>> Mul [<<Par>>,<<Int>>] loop:none
+ /// CHECK-DAG: <<Add:i\d+>> Add [<<Mul>>,<<Zer>>] loop:none
+ /// CHECK-DAG: Return [<<Add>>] loop:none
+ //
+ /// CHECK-START: int Main.geo1(int) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static int geo1(int a) {
+ for (int i = 0; i < 10; i++) {
+ a *= 10;
+ }
+ return a;
+ }
+
+ /// CHECK-START: int Main.geo2(int) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Shl loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.geo2(int) loop_optimization (after)
+ /// CHECK-DAG: <<Par:i\d+>> ParameterValue loop:none
+ /// CHECK-DAG: <<Zer:i\d+>> IntConstant 0 loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 1024 loop:none
+ /// CHECK-DAG: <<Mul:i\d+>> Mul [<<Par>>,<<Int>>] loop:none
+ /// CHECK-DAG: <<Add:i\d+>> Add [<<Mul>>,<<Zer>>] loop:none
+ /// CHECK-DAG: Return [<<Add>>] loop:none
+ //
+ /// CHECK-START: int Main.geo2(int) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static int geo2(int a) {
+ for (int i = 0; i < 10; i++) {
+ a <<= 1;
+ }
+ return a;
+ }
+
+ /// CHECK-START: int Main.geo3(int) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Div loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.geo3(int) loop_optimization (after)
+ /// CHECK-DAG: <<Par:i\d+>> ParameterValue loop:none
+ /// CHECK-DAG: <<Zer:i\d+>> IntConstant 0 loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 59049 loop:none
+ /// CHECK-DAG: <<Div:i\d+>> Div [<<Par>>,<<Int>>] loop:none
+ /// CHECK-DAG: <<Add:i\d+>> Add [<<Div>>,<<Zer>>] loop:none
+ /// CHECK-DAG: Return [<<Add>>] loop:none
+ //
+ /// CHECK-START: int Main.geo3(int) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static int geo3(int a) {
+ for (int i = 0; i < 10; i++) {
+ a /= 3;
+ }
+ return a;
+ }
+
+ /// CHECK-START: int Main.geo4(int) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Rem loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.geo4(int) loop_optimization (after)
+ /// CHECK-DAG: <<Par:i\d+>> ParameterValue loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 7 loop:none
+ /// CHECK-DAG: <<Rem:i\d+>> Rem [<<Par>>,<<Int>>] loop:none
+ /// CHECK-DAG: Return [<<Rem>>] loop:none
+ //
+ /// CHECK-START: int Main.geo4(int) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static int geo4(int a) {
+ for (int i = 0; i < 10; i++) {
+ a %= 7; // a wrap-around induction
+ }
+ return a;
+ }
+
+ /// CHECK-START: int Main.geo5() loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Shr loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.geo5() loop_optimization (after)
+ /// CHECK-DAG: <<Zero:i\d+>> IntConstant 0 loop:none
+ /// CHECK-DAG: <<Int1:i\d+>> IntConstant 2147483647 loop:none
+ /// CHECK-DAG: <<Int2:i\d+>> IntConstant 1024 loop:none
+ /// CHECK-DAG: <<Div:i\d+>> Div [<<Int1>>,<<Int2>>] loop:none
+ /// CHECK-DAG: <<Add:i\d+>> Add [<<Div>>,<<Zero>>] loop:none
+ /// CHECK-DAG: Return [<<Add>>] loop:none
+ //
+ /// CHECK-START: int Main.geo5() loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static int geo5() {
+ int a = 0x7fffffff;
+ for (int i = 0; i < 10; i++) {
+ a >>= 1;
+ }
+ return a;
+ }
+
+ // TODO: someday?
+ //
+ /// CHECK-START: int Main.geo1BCE() BCE (before)
+ /// CHECK-DAG: BoundsCheck loop:none
+ /// CHECK-DAG: BoundsCheck loop:{{B\d+}}
+ //
+ /// CHECK-START: int Main.geo1BCE() BCE (after)
+ /// CHECK-DAG: BoundsCheck loop:{{B\d+}}
+ //
+ /// CHECK-START: int Main.geo1BCE() BCE (after)
+ /// CHECK-NOT: BoundsCheck loop:none
+ /// CHECK-NOT: Deoptimize
+ public static int geo1BCE() {
+ int[] x = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
+ 11, 12, 13, 14, 15, 16, 17, 19, 19, 20,
+ 21, 22, 23, 24, 25, 26 };
+ int a = 1;
+ int r = 0;
+ for (int i = 0; i < 3; i++) {
+ r += x[a];
+ a *= 5;
+ }
+ return r;
+ }
+
+ // TODO: someday?
+ //
+ /// CHECK-START: int Main.geo2BCE() BCE (before)
+ /// CHECK-DAG: BoundsCheck loop:none
+ /// CHECK-DAG: BoundsCheck loop:{{B\d+}}
+ //
+ /// CHECK-START: int Main.geo2BCE() BCE (after)
+ /// CHECK-DAG: BoundsCheck loop:{{B\d+}}
+ //
+ /// CHECK-START: int Main.geo2BCE() BCE (after)
+ /// CHECK-NOT: BoundsCheck loop:none
+ /// CHECK-NOT: Deoptimize
+ public static int geo2BCE() {
+ int[] x = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
+ 11, 12, 13, 14, 15, 16, 17, 19, 19, 20,
+ 21, 22, 23, 24, 25, 26 };
+ int a = 1;
+ int r = 0;
+ for (int i = 0; i < 5; i++) {
+ r += x[a];
+ a <<= 1;
+ }
+ return r;
+ }
+
+ /// CHECK-START: int Main.geo3BCE() BCE (before)
+ /// CHECK-DAG: BoundsCheck loop:none
+ /// CHECK-DAG: BoundsCheck loop:{{B\d+}}
+ //
+ /// CHECK-START: int Main.geo3BCE() BCE (after)
+ /// CHECK-NOT: BoundsCheck
+ /// CHECK-NOT: Deoptimize
+ public static int geo3BCE() {
+ int[] x = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
+ 11, 12, 13, 14, 15, 16, 17, 19, 19, 20,
+ 21, 22, 23, 24, 25, 26 };
+ int a = 25;
+ int r = 0;
+ for (int i = 0; i < 100; i++) { // a converges to 0
+ r += x[a];
+ a /= 5;
+ }
+ return r;
+ }
+
+ /// CHECK-START: int Main.geo4BCE() BCE (before)
+ /// CHECK-DAG: BoundsCheck loop:none
+ /// CHECK-DAG: BoundsCheck loop:{{B\d+}}
+ //
+ /// CHECK-START: int Main.geo4BCE() BCE (after)
+ /// CHECK-NOT: BoundsCheck
+ /// CHECK-NOT: Deoptimize
+ public static int geo4BCE() {
+ int[] x = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
+ 11, 12, 13, 14, 15, 16, 17, 19, 19, 20,
+ 21, 22, 23, 24, 25, 26 };
+ int a = 25;
+ int r = 0;
+ for (int i = 0; i < 100; i++) { // a converges to 0
+ r += x[a];
+ a %= 5; // a wrap-around induction
+ }
+ return r;
+ }
+
+ /// CHECK-START: int Main.geoMulBlackHole(int) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Mul loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.geoMulBlackHole(int) loop_optimization (after)
+ /// CHECK-DAG: <<Zero:i\d+>> IntConstant 0
+ /// CHECK-DAG: Return [<<Zero>>]
+ //
+ /// CHECK-START: int Main.geoMulBlackHole(int) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ /// CHECK-NOT: Mul
+ public static int geoMulBlackHole(int a) {
+ for (int i = 0; i < 100; i++) {
+ a *= 10;
+ }
+ return a;
+ }
+
+ /// CHECK-START: int Main.geoShlBlackHole(int) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Shl loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.geoShlBlackHole(int) loop_optimization (after)
+ /// CHECK-DAG: <<Zero:i\d+>> IntConstant 0
+ /// CHECK-DAG: Return [<<Zero>>]
+ //
+ /// CHECK-START: int Main.geoShlBlackHole(int) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ /// CHECK-NOT: Shl
+ public static int geoShlBlackHole(int a) {
+ for (int i = 0; i < 100; i++) {
+ a <<= 1;
+ }
+ return a;
+ }
+
+ /// CHECK-START: int Main.geoDivBlackHole(int) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Div loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.geoDivBlackHole(int) loop_optimization (after)
+ /// CHECK-DAG: <<Zero:i\d+>> IntConstant 0
+ /// CHECK-DAG: Return [<<Zero>>]
+ //
+ /// CHECK-START: int Main.geoDivBlackHole(int) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ /// CHECK-NOT: Div
+ public static int geoDivBlackHole(int a) {
+ for (int i = 0; i < 100; i++) {
+ a /= 10;
+ }
+ return a;
+ }
+
+ // Even though Rem is already optimized away by the time induction analysis
+ // and the loop optimizer run, the loop is optimized with a trivial
+ // wrap-around induction just as the wrap-around for REM would.
+ //
+ /// CHECK-START: int Main.geoRemBlackHole(int) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Phi loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.geoRemBlackHole(int) loop_optimization (after)
+ /// CHECK-DAG: <<Zero:i\d+>> IntConstant 0
+ /// CHECK-DAG: Return [<<Zero>>]
+ //
+ /// CHECK-START: int Main.geoRemBlackHole(int) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static int geoRemBlackHole(int a) {
+ for (int i = 0; i < 100; i++) {
+ a %= 1;
+ }
+ return a;
+ }
+
+ //
+ // Verifier.
+ //
+
+ public static void main(String[] args) {
+ int m = 1410065408;
+ for (int i = -100; i <= 100; i++) {
+ expectEquals(m * i, geo1(i));
+ }
+ for (int i = 1; i <= 1000000000; i *= 10) {
+ expectEquals( m * i, geo1( i));
+ expectEquals(-m * i, geo1(-i));
+ }
+
+ for (int i = -100; i <= 100; i++) {
+ expectEquals(i << 10, geo2(i));
+ }
+ for (int i = 0; i < 22; i++) {
+ expectEquals(1 << (i + 10), geo2(1 << i));
+ }
+ expectEquals(0x80000400, geo2(0x00200001));
+ expectEquals(0x00000000, geo2(0x00400000));
+ expectEquals(0x00000400, geo2(0x00400001));
+
+ int d = 59049;
+ for (int i = -100; i <= 100; i++) {
+ expectEquals(0, geo3(i));
+ }
+ for (int i = 1; i <= 100; i++) {
+ expectEquals( i, geo3( i * d));
+ expectEquals( i, geo3( i * d + 1));
+ expectEquals(-i, geo3(-i * d));
+ expectEquals(-i, geo3(-i * d - 1));
+ }
+
+ for (int i = -100; i <= 100; i++) {
+ expectEquals(i % 7, geo4(i));
+ }
+
+ expectEquals(0x1fffff, geo5());
+
+ expectEquals(34, geo1BCE());
+ expectEquals(36, geo2BCE());
+ expectEquals(131, geo3BCE());
+ expectEquals(125, geo4BCE());
+
+ // Nothing escapes!
+ expectEquals(0, geoMulBlackHole(0));
+ expectEquals(0, geoShlBlackHole(0));
+ expectEquals(0, geoDivBlackHole(0));
+ expectEquals(0, geoRemBlackHole(0));
+ for (int i = -100; i <= 100; i++) {
+ expectEquals(0, geoMulBlackHole(i));
+ expectEquals(0, geoShlBlackHole(i));
+ expectEquals(0, geoDivBlackHole(i));
+ expectEquals(0, geoRemBlackHole(i));
+ }
+ for (int i = 0; i < 31; i++) {
+ expectEquals(0, geoMulBlackHole(1 << i));
+ expectEquals(0, geoShlBlackHole(1 << i));
+ expectEquals(0, geoDivBlackHole(1 << i));
+ expectEquals(0, geoRemBlackHole(1 << i));
+ }
+ expectEquals(0, geoMulBlackHole(0x7fffffff));
+ expectEquals(0, geoShlBlackHole(0x7fffffff));
+ expectEquals(0, geoDivBlackHole(0x7fffffff));
+ expectEquals(0, geoRemBlackHole(0x7fffffff));
+ expectEquals(0, geoMulBlackHole(0x80000000));
+ expectEquals(0, geoShlBlackHole(0x80000000));
+ expectEquals(0, geoDivBlackHole(0x80000000));
+ expectEquals(0, geoRemBlackHole(0x80000000));
+
+ System.out.println("passed");
+ }
+
+ private static void expectEquals(int expected, int result) {
+ if (expected != result) {
+ throw new Error("Expected: " + expected + ", found: " + result);
+ }
+ }
+}
diff --git a/test/530-checker-loops5/expected.txt b/test/530-checker-loops5/expected.txt
new file mode 100644
index 0000000..b0aad4d
--- /dev/null
+++ b/test/530-checker-loops5/expected.txt
@@ -0,0 +1 @@
+passed
diff --git a/test/530-checker-loops5/info.txt b/test/530-checker-loops5/info.txt
new file mode 100644
index 0000000..15dbf37
--- /dev/null
+++ b/test/530-checker-loops5/info.txt
@@ -0,0 +1 @@
+Test on loop optimizations, in particular with polynomial induction.
diff --git a/test/530-checker-loops5/src/Main.java b/test/530-checker-loops5/src/Main.java
new file mode 100644
index 0000000..54b54d0
--- /dev/null
+++ b/test/530-checker-loops5/src/Main.java
@@ -0,0 +1,186 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+//
+// Test on loop optimizations, in particular around polynomial induction.
+//
+public class Main {
+
+ /// CHECK-START: int Main.poly1() loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Add loop:<<Loop>>
+ /// CHECK-DAG: Add loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.poly1() loop_optimization (after)
+ /// CHECK-DAG: <<Zer:i\d+>> IntConstant 0 loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 55 loop:none
+ /// CHECK-DAG: <<Add:i\d+>> Add [<<Int>>,<<Zer>>] loop:none
+ /// CHECK-DAG: Return [<<Add>>] loop:none
+ //
+ /// CHECK-START: int Main.poly1() instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 55 loop:none
+ /// CHECK-DAG: Return [<<Int>>] loop:none
+ //
+ /// CHECK-START: int Main.poly1() loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static int poly1() {
+ int a = 0;
+ for (int i = 0; i <= 10; i++) {
+ a += i;
+ }
+ return a;
+ }
+
+ // Multiplication in linear induction has been optimized earlier,
+ // but that does not stop the induction variable recognition
+ // and loop optimizer.
+ //
+ /// CHECK-START: int Main.poly2(int) loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Shl loop:<<Loop>>
+ /// CHECK-DAG: Add loop:<<Loop>>
+ /// CHECK-DAG: Add loop:<<Loop>>
+ /// CHECK-DAG: Add loop:<<Loop>>
+ /// CHECK-DAG: Add loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.poly2(int) loop_optimization (after)
+ /// CHECK-DAG: <<Par:i\d+>> ParameterValue loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 185 loop:none
+ /// CHECK-DAG: <<Add:i\d+>> Add [<<Int>>,<<Par>>] loop:none
+ /// CHECK-DAG: Return [<<Add>>] loop:none
+ //
+ /// CHECK-START: int Main.poly2(int) loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static int poly2(int a) {
+ for (int i = 0; i < 10; i++) {
+ int k = 3 * i + 5;
+ a += k;
+ }
+ return a;
+ }
+
+ /// CHECK-START: int Main.poly3() loop_optimization (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: Add loop:<<Loop>>
+ /// CHECK-DAG: Add loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.poly3() loop_optimization (after)
+ /// CHECK-DAG: <<Ini:i\d+>> IntConstant 12345 loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant -2146736968 loop:none
+ /// CHECK-DAG: <<Add:i\d+>> Add [<<Int>>,<<Ini>>] loop:none
+ /// CHECK-DAG: Return [<<Add>>] loop:none
+ //
+ /// CHECK-START: int Main.poly3() instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant -2146724623 loop:none
+ /// CHECK-DAG: Return [<<Int>>] loop:none
+ //
+ /// CHECK-START: int Main.poly3() loop_optimization (after)
+ /// CHECK-NOT: Phi
+ public static int poly3() {
+ int a = 12345;
+ for (int i = 0; i <= 10; i++) {
+ a += (2147483646 * i + 67890);
+ }
+ return a;
+ }
+
+ /// CHECK-START: int Main.polyBCE1() BCE (before)
+ /// CHECK-DAG: BoundsCheck loop:none
+ /// CHECK-DAG: BoundsCheck loop:{{B\d+}}
+ //
+ /// CHECK-START: int Main.polyBCE1() BCE (after)
+ /// CHECK-NOT: BoundsCheck
+ /// CHECK-NOT: Deoptimize
+ public static int polyBCE1() {
+ int[] x = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
+ 11, 12, 13, 14, 15, 16, 17, 19, 19, 20,
+ 21, 22 };
+ int a = 0;
+ int r = 0;
+ for (int i = 0; i < 8; i++) {
+ r += x[a];
+ a += i;
+ }
+ return r;
+ }
+
+ /// CHECK-START: int Main.polyBCE2() BCE (before)
+ /// CHECK-DAG: BoundsCheck loop:none
+ /// CHECK-DAG: BoundsCheck loop:{{B\d+}}
+ //
+ /// CHECK-START: int Main.polyBCE2() BCE (after)
+ /// CHECK-NOT: BoundsCheck
+ /// CHECK-NOT: Deoptimize
+ public static int polyBCE2() {
+ int[] x = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
+ 11, 12, 13, 14, 15, 16, 17, 19, 19, 20,
+ 21, 22, 23, 24, 25, 26, 27 };
+ int a = 1;
+ int r = 0;
+ for (int i = 0; i < 6; i++) {
+ int k = 2 * i + 1;
+ r -= x[a];
+ a += k;
+ }
+ return r;
+ }
+
+ /// CHECK-START: int Main.polyBCE3() BCE (before)
+ /// CHECK-DAG: BoundsCheck loop:none
+ /// CHECK-DAG: BoundsCheck loop:{{B\d+}}
+ //
+ /// CHECK-START: int Main.polyBCE3() BCE (after)
+ /// CHECK-NOT: BoundsCheck
+ /// CHECK-NOT: Deoptimize
+ public static int polyBCE3() {
+ int[] x = { 1, 2, 3, 4, 5, 6, 7, 8, 9, 10,
+ 11, 12, 13, 14, 15, 16, 17, 19, 19, 20,
+ 21, 22, 23, 24, 25, 26, 27, 28, 29, 30,
+ 31, 32, 33, 34, 35, 36, 37, 38 };
+ int r = 0;
+ int a1 = 1;
+ int a2 = 2;
+ for (int i = 0; i < 5; i++) {
+ int t = a1 + a2; // two polynomials combined into new polynomial
+ r -= x[t];
+ a1 += (3 * i + 1);
+ a2 += (2 * i);
+ }
+ return r;
+ }
+
+ //
+ // Verifier.
+ //
+
+ public static void main(String[] args) {
+ expectEquals(55, poly1());
+ expectEquals(185, poly2(0));
+ expectEquals(192, poly2(7));
+ expectEquals(-2146724623, poly3());
+ expectEquals(64, polyBCE1());
+ expectEquals(-68, polyBCE2());
+ expectEquals(-80, polyBCE3());
+
+ System.out.println("passed");
+ }
+
+ private static void expectEquals(int expected, int result) {
+ if (expected != result) {
+ throw new Error("Expected: " + expected + ", found: " + result);
+ }
+ }
+}
diff --git a/test/538-checker-embed-constants/src/Main.java b/test/538-checker-embed-constants/src/Main.java
index 02c609e..4f34ec9 100644
--- a/test/538-checker-embed-constants/src/Main.java
+++ b/test/538-checker-embed-constants/src/Main.java
@@ -30,7 +30,7 @@
/// CHECK-START-ARM: int Main.and255(int) disassembly (after)
/// CHECK-NOT: movs {{r\d+}}, #255
- /// CHECK: and {{r\d+}}, {{r\d+}}, #255
+ /// CHECK: and {{r\d+}}, {{r\d+}}, #0xff
public static int and255(int arg) {
return arg & 255;
@@ -46,7 +46,7 @@
/// CHECK-START-ARM: int Main.andNot15(int) disassembly (after)
/// CHECK-NOT: mvn {{r\d+}}, #15
- /// CHECK: bic {{r\d+}}, {{r\d+}}, #15
+ /// CHECK: bic {{r\d+}}, {{r\d+}}, #0xf
public static int andNot15(int arg) {
return arg & ~15;
@@ -54,7 +54,7 @@
/// CHECK-START-ARM: int Main.or255(int) disassembly (after)
/// CHECK-NOT: movs {{r\d+}}, #255
- /// CHECK: orr {{r\d+}}, {{r\d+}}, #255
+ /// CHECK: orr {{r\d+}}, {{r\d+}}, #0xff
public static int or255(int arg) {
return arg | 255;
@@ -70,7 +70,7 @@
/// CHECK-START-ARM: int Main.orNot15(int) disassembly (after)
/// CHECK-NOT: mvn {{r\d+}}, #15
- /// CHECK: orn {{r\d+}}, {{r\d+}}, #15
+ /// CHECK: orn {{r\d+}}, {{r\d+}}, #0xf
public static int orNot15(int arg) {
return arg | ~15;
@@ -78,7 +78,7 @@
/// CHECK-START-ARM: int Main.xor255(int) disassembly (after)
/// CHECK-NOT: movs {{r\d+}}, #255
- /// CHECK: eor {{r\d+}}, {{r\d+}}, #255
+ /// CHECK: eor {{r\d+}}, {{r\d+}}, #0xff
public static int xor255(int arg) {
return arg ^ 255;
@@ -104,8 +104,8 @@
/// CHECK-NOT: movs {{r\d+}}, #255
/// CHECK-NOT: and{{(\.w)?}}
/// CHECK-NOT: bic{{(\.w)?}}
- /// CHECK-DAG: and {{r\d+}}, {{r\d+}}, #255
- /// CHECK-DAG: movs {{r\d+}}, #0
+ /// CHECK-DAG: and {{r\d+}}, {{r\d+}}, #0xff
+ /// CHECK-DAG: mov{{s?}} {{r\d+}}, #0
/// CHECK-NOT: and{{(\.w)?}}
/// CHECK-NOT: bic{{(\.w)?}}
@@ -115,7 +115,7 @@
/// CHECK-START-ARM: long Main.and511(long) disassembly (after)
/// CHECK: mov {{r\d+}}, #511
- /// CHECK-NEXT: movs {{r\d+}}, #0
+ /// CHECK-NEXT: mov{{s?}} {{r\d+}}, #0
/// CHECK-NOT: and{{(\.w)?}}
/// CHECK-NOT: bic{{(\.w)?}}
/// CHECK: and{{(\.w)?}} {{r\d+}}, {{r\d+}}, {{r\d+}}
@@ -131,7 +131,7 @@
/// CHECK-NOT: mvn {{r\d+}}, #15
/// CHECK-NOT: and{{(\.w)?}}
/// CHECK-NOT: bic{{(\.w)?}}
- /// CHECK: bic {{r\d+}}, {{r\d+}}, #15
+ /// CHECK: bic {{r\d+}}, {{r\d+}}, #0xf
/// CHECK-NOT: and{{(\.w)?}}
/// CHECK-NOT: bic{{(\.w)?}}
@@ -144,8 +144,8 @@
/// CHECK-NOT: mvn {{r\d+}}, #15
/// CHECK-NOT: and{{(\.w)?}}
/// CHECK-NOT: bic{{(\.w)?}}
- /// CHECK-DAG: and {{r\d+}}, {{r\d+}}, #15
- /// CHECK-DAG: bic {{r\d+}}, {{r\d+}}, #15
+ /// CHECK-DAG: and {{r\d+}}, {{r\d+}}, #0xf
+ /// CHECK-DAG: bic {{r\d+}}, {{r\d+}}, #0xf
/// CHECK-NOT: and{{(\.w)?}}
/// CHECK-NOT: bic{{(\.w)?}}
@@ -157,7 +157,7 @@
/// CHECK-NOT: movs {{r\d+}}, #255
/// CHECK-NOT: orr{{(\.w)?}}
/// CHECK-NOT: orn
- /// CHECK: orr {{r\d+}}, {{r\d+}}, #255
+ /// CHECK: orr {{r\d+}}, {{r\d+}}, #0xff
/// CHECK-NOT: orr{{(\.w)?}}
/// CHECK-NOT: orn
@@ -167,7 +167,7 @@
/// CHECK-START-ARM: long Main.or511(long) disassembly (after)
/// CHECK: mov {{r\d+}}, #511
- /// CHECK-NEXT: movs {{r\d+}}, #0
+ /// CHECK-NEXT: mov{{s?}} {{r\d+}}, #0
/// CHECK-NOT: orr{{(\.w)?}}
/// CHECK-NOT: orn
/// CHECK: orr{{(\.w)?}} {{r\d+}}, {{r\d+}}, {{r\d+}}
@@ -183,7 +183,7 @@
/// CHECK-NOT: mvn {{r\d+}}, #15
/// CHECK-NOT: orr{{(\.w)?}}
/// CHECK-NOT: orn
- /// CHECK-DAG: orn {{r\d+}}, {{r\d+}}, #15
+ /// CHECK-DAG: orn {{r\d+}}, {{r\d+}}, #0xf
/// CHECK-DAG: mvn {{r\d+}}, #0
/// CHECK-NOT: orr{{(\.w)?}}
/// CHECK-NOT: orn
@@ -197,8 +197,8 @@
/// CHECK-NOT: mvn {{r\d+}}, #15
/// CHECK-NOT: orr{{(\.w)?}}
/// CHECK-NOT: orn
- /// CHECK-DAG: orr {{r\d+}}, {{r\d+}}, #15
- /// CHECK-DAG: orn {{r\d+}}, {{r\d+}}, #15
+ /// CHECK-DAG: orr {{r\d+}}, {{r\d+}}, #0xf
+ /// CHECK-DAG: orn {{r\d+}}, {{r\d+}}, #0xf
/// CHECK-NOT: orr{{(\.w)?}}
/// CHECK-NOT: orn
@@ -209,7 +209,7 @@
/// CHECK-START-ARM: long Main.xor255(long) disassembly (after)
/// CHECK-NOT: movs {{r\d+}}, #255
/// CHECK-NOT: eor{{(\.w)?}}
- /// CHECK: eor {{r\d+}}, {{r\d+}}, #255
+ /// CHECK: eor {{r\d+}}, {{r\d+}}, #0xff
/// CHECK-NOT: eor{{(\.w)?}}
public static long xor255(long arg) {
@@ -218,7 +218,7 @@
/// CHECK-START-ARM: long Main.xor511(long) disassembly (after)
/// CHECK: mov {{r\d+}}, #511
- /// CHECK-NEXT: movs {{r\d+}}, #0
+ /// CHECK-NEXT: mov{{s?}} {{r\d+}}, #0
/// CHECK-NOT: eor{{(\.w)?}}
/// CHECK: eor{{(\.w)?}} {{r\d+}}, {{r\d+}}, {{r\d+}}
/// CHECK-NEXT: eor{{(\.w)?}} {{r\d+}}, {{r\d+}}, {{r\d+}}
@@ -242,7 +242,7 @@
// Note: No support for partial long constant embedding.
/// CHECK-START-ARM: long Main.xor0xfffffff00000000f(long) disassembly (after)
- /// CHECK-DAG: movs {{r\d+}}, #15
+ /// CHECK-DAG: mov{{s?}} {{r\d+}}, #15
/// CHECK-DAG: mvn {{r\d+}}, #15
/// CHECK-NOT: eor{{(\.w)?}}
/// CHECK-DAG: eor{{(\.w)?}} {{r\d+}}, {{r\d+}}, {{r\d+}}
@@ -257,8 +257,8 @@
/// CHECK-NOT: movs {{r\d+}}, #15
/// CHECK-NOT: mov.w {{r\d+}}, #-268435456
/// CHECK-NOT: eor{{(\.w)?}}
- /// CHECK-DAG: eor {{r\d+}}, {{r\d+}}, #15
- /// CHECK-DAG: eor {{r\d+}}, {{r\d+}}, #4026531840
+ /// CHECK-DAG: eor {{r\d+}}, {{r\d+}}, #0xf
+ /// CHECK-DAG: eor {{r\d+}}, {{r\d+}}, #0xf0000000
/// CHECK-NOT: eor{{(\.w)?}}
public static long xor0xf00000000000000f(long arg) {
@@ -308,7 +308,7 @@
}
/// CHECK-START-ARM: long Main.shl32(long) disassembly (after)
- /// CHECK-DAG: mov {{r\d+}}, {{r\d+}}
+ /// CHECK-DAG: mov{{s?}} {{r\d+}}, {{r\d+}}
/// CHECK-DAG: mov{{s?|\.w}} {{r\d+}}, #0
/// CHECK-START-ARM: long Main.shl32(long) disassembly (after)
@@ -377,7 +377,7 @@
/// CHECK-START-ARM: long Main.shr32(long) disassembly (after)
/// CHECK-DAG: asr{{s?|\.w}} {{r\d+}}, <<high:r\d+>>, #31
- /// CHECK-DAG: mov {{r\d+}}, <<high>>
+ /// CHECK-DAG: mov{{s?}} {{r\d+}}, <<high>>
/// CHECK-START-ARM: long Main.shr32(long) disassembly (after)
/// CHECK-NOT: asr{{s?|\.w}} {{r\d+}}, {{r\d+}}, {{r\d+}}
@@ -445,7 +445,7 @@
}
/// CHECK-START-ARM: long Main.ushr32(long) disassembly (after)
- /// CHECK-DAG: mov {{r\d+}}, {{r\d+}}
+ /// CHECK-DAG: mov{{s?}} {{r\d+}}, {{r\d+}}
/// CHECK-DAG: mov{{s?|\.w}} {{r\d+}}, #0
/// CHECK-START-ARM: long Main.ushr32(long) disassembly (after)
@@ -507,7 +507,7 @@
/// CHECK: <<Arg:j\d+>> ParameterValue
/// CHECK: <<ConstM1:j\d+>> LongConstant -1
/// CHECK: Add [<<Arg>>,<<ConstM1>>]
- /// CHECK-NEXT: subs r{{\d+}}, #1
+ /// CHECK-NEXT: {{adds|subs}} r{{\d+}}, #{{4294967295|1}}
/// CHECK-NEXT: adc r{{\d+}}, r{{\d+}}, #4294967295
/// CHECK: Sub [<<Arg>>,<<ConstM1>>]
/// CHECK-NEXT: adds r{{\d+}}, #1
diff --git a/test/570-checker-osr/osr.cc b/test/570-checker-osr/osr.cc
index 50e8382..8eca6b2 100644
--- a/test/570-checker-osr/osr.cc
+++ b/test/570-checker-osr/osr.cc
@@ -43,7 +43,7 @@
Runtime::Current()->GetJit()->GetCodeCache()->LookupOsrMethodHeader(m);
if (header != nullptr && header == GetCurrentOatQuickMethodHeader()) {
in_osr_method_ = true;
- } else if (IsCurrentFrameInInterpreter()) {
+ } else if (IsShadowFrame()) {
in_interpreter_ = true;
}
return false;
diff --git a/test/616-cha-regression-proxy-method/expected.txt b/test/616-cha-regression-proxy-method/expected.txt
new file mode 100644
index 0000000..6a5618e
--- /dev/null
+++ b/test/616-cha-regression-proxy-method/expected.txt
@@ -0,0 +1 @@
+JNI_OnLoad called
diff --git a/test/616-cha-regression-proxy-method/info.txt b/test/616-cha-regression-proxy-method/info.txt
new file mode 100644
index 0000000..386a07f
--- /dev/null
+++ b/test/616-cha-regression-proxy-method/info.txt
@@ -0,0 +1 @@
+Regression test for Class Hierarchy Analysis (CHA) on visiting proxy method frame.
diff --git a/test/616-cha-regression-proxy-method/src/Main.java b/test/616-cha-regression-proxy-method/src/Main.java
new file mode 100644
index 0000000..19c92be
--- /dev/null
+++ b/test/616-cha-regression-proxy-method/src/Main.java
@@ -0,0 +1,131 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.reflect.InvocationHandler;
+import java.lang.reflect.Method;
+import java.lang.reflect.Proxy;
+
+class Main1 {
+ void foo(int i) {
+ if (i != 1) {
+ printError("error1");
+ }
+ }
+
+ void printError(String msg) {
+ System.out.println(msg);
+ }
+}
+
+class Main2 extends Main1 {
+ void foo(int i) {
+ if (i != 2) {
+ printError("error2");
+ }
+ }
+}
+
+class Proxied implements Runnable {
+ public void run() {
+ synchronized(Main.class) {
+ Main.sOtherThreadStarted = true;
+ // Wait for Main2 to be linked and deoptimization is triggered.
+ try {
+ Main.class.wait();
+ } catch (Exception e) {
+ }
+ }
+ }
+}
+
+class MyInvocationHandler implements InvocationHandler {
+ private final Proxied proxied;
+
+ public MyInvocationHandler(Proxied proxied) {
+ this.proxied = proxied;
+ }
+
+ public Object invoke(Object proxy, Method method, Object[] args) throws Throwable {
+ return method.invoke(proxied, args);
+ }
+}
+
+public class Main {
+ static Main1 sMain1;
+ static Main1 sMain2;
+ static volatile boolean sOtherThreadStarted;
+
+ // sMain1.foo() will be always be Main1.foo() before Main2 is loaded/linked.
+ // So sMain1.foo() can be devirtualized to Main1.foo() and be inlined.
+ // After Dummy.createMain2() which links in Main2, live testOverride() on stack
+ // should be deoptimized.
+ static void testOverride() {
+ sMain1.foo(sMain1.getClass() == Main1.class ? 1 : 2);
+
+ // Wait for the other thread to start.
+ while (!sOtherThreadStarted);
+ // Create an Main2 instance and assign it to sMain2.
+ // sMain1 is kept the same.
+ sMain2 = Dummy.createMain2();
+ // Wake up the other thread.
+ synchronized(Main.class) {
+ Main.class.notify();
+ }
+
+ // There should be a deoptimization here right after Main2 is linked by
+ // calling Dummy.createMain2(), even though sMain1 didn't change.
+ // The behavior here would be different if inline-cache is used, which
+ // doesn't deoptimize since sMain1 still hits the type cache.
+ sMain1.foo(sMain1.getClass() == Main1.class ? 1 : 2);
+ if (sMain2 != null) {
+ sMain2.foo(sMain2.getClass() == Main1.class ? 1 : 2);
+ }
+ }
+
+ // Test scenarios under which CHA-based devirtualization happens,
+ // and class loading that overrides a method can invalidate compiled code.
+ // Also create a proxy method such that a proxy method's frame is visited
+ // during stack walking.
+ public static void main(String[] args) {
+ System.loadLibrary(args[0]);
+ // sMain1 is an instance of Main1. Main2 hasn't bee loaded yet.
+ sMain1 = new Main1();
+
+ // Create another thread that calls a proxy method.
+ new Thread() {
+ public void run() {
+ Runnable proxy = (Runnable)Proxy.newProxyInstance(
+ Proxied.class.getClassLoader(),
+ new Class[] { Runnable.class },
+ new MyInvocationHandler(new Proxied()));
+ proxy.run();
+ }
+ }.start();
+
+ ensureJitCompiled(Main.class, "testOverride");
+ // This will create Main2 instance in the middle of testOverride().
+ testOverride();
+ }
+
+ private static native void ensureJitCompiled(Class<?> itf, String method_name);
+}
+
+// Put createMain2() in another class to avoid class loading due to verifier.
+class Dummy {
+ static Main1 createMain2() {
+ return new Main2();
+ }
+}
diff --git a/test/616-cha/expected.txt b/test/616-cha/expected.txt
new file mode 100644
index 0000000..6a5618e
--- /dev/null
+++ b/test/616-cha/expected.txt
@@ -0,0 +1 @@
+JNI_OnLoad called
diff --git a/test/616-cha/info.txt b/test/616-cha/info.txt
new file mode 100644
index 0000000..50e3b0d
--- /dev/null
+++ b/test/616-cha/info.txt
@@ -0,0 +1 @@
+Test for Class Hierarchy Analysis (CHA).
diff --git a/test/616-cha/src/Main.java b/test/616-cha/src/Main.java
new file mode 100644
index 0000000..b617944
--- /dev/null
+++ b/test/616-cha/src/Main.java
@@ -0,0 +1,250 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Main1 {
+ String getName() {
+ return "Main1";
+ }
+
+ void printError(String msg) {
+ System.out.println(msg);
+ }
+
+ void foo(int i) {
+ if (i != 1) {
+ printError("error1");
+ }
+ }
+
+ int getValue1() {
+ return 1;
+ }
+ int getValue2() {
+ return 2;
+ }
+ int getValue3() {
+ return 3;
+ }
+ int getValue4() {
+ return 4;
+ }
+ int getValue5() {
+ return 5;
+ }
+ int getValue6() {
+ return 6;
+ }
+}
+
+class Main2 extends Main1 {
+ String getName() {
+ return "Main2";
+ }
+
+ void foo(int i) {
+ if (i != 2) {
+ printError("error2");
+ }
+ }
+}
+
+class Main3 extends Main1 {
+ String getName() {
+ return "Main3";
+ }
+}
+
+public class Main {
+ static Main1 sMain1;
+ static Main1 sMain2;
+
+ static boolean sIsOptimizing = true;
+ static boolean sHasJIT = true;
+ static volatile boolean sOtherThreadStarted;
+
+ // sMain1.foo() will be always be Main1.foo() before Main2 is loaded/linked.
+ // So sMain1.foo() can be devirtualized to Main1.foo() and be inlined.
+ // After Dummy.createMain2() which links in Main2, live testOverride() on stack
+ // should be deoptimized.
+ static void testOverride(boolean createMain2, boolean wait, boolean setHasJIT) {
+ if (setHasJIT) {
+ if (isInterpreted()) {
+ sHasJIT = false;
+ }
+ return;
+ }
+
+ if (createMain2 && (sIsOptimizing || sHasJIT)) {
+ assertIsManaged();
+ }
+
+ sMain1.foo(sMain1.getClass() == Main1.class ? 1 : 2);
+
+ if (createMain2) {
+ // Wait for the other thread to start.
+ while (!sOtherThreadStarted);
+ // Create an Main2 instance and assign it to sMain2.
+ // sMain1 is kept the same.
+ sMain2 = Dummy.createMain2();
+ // Wake up the other thread.
+ synchronized(Main.class) {
+ Main.class.notify();
+ }
+ } else if (wait) {
+ // This is the other thread.
+ synchronized(Main.class) {
+ sOtherThreadStarted = true;
+ // Wait for Main2 to be linked and deoptimization is triggered.
+ try {
+ Main.class.wait();
+ } catch (Exception e) {
+ }
+ }
+ }
+
+ // There should be a deoptimization here right after Main2 is linked by
+ // calling Dummy.createMain2(), even though sMain1 didn't change.
+ // The behavior here would be different if inline-cache is used, which
+ // doesn't deoptimize since sMain1 still hits the type cache.
+ sMain1.foo(sMain1.getClass() == Main1.class ? 1 : 2);
+ if ((createMain2 || wait) && sHasJIT && !sIsOptimizing) {
+ // This method should be deoptimized right after Main2 is created.
+ assertIsInterpreted();
+ }
+
+ if (sMain2 != null) {
+ sMain2.foo(sMain2.getClass() == Main1.class ? 1 : 2);
+ }
+ }
+
+ static Main1[] sArray;
+
+ static long calcValue(Main1 m) {
+ return m.getValue1()
+ + m.getValue2() * 2
+ + m.getValue3() * 3
+ + m.getValue4() * 4
+ + m.getValue5() * 5
+ + m.getValue6() * 6;
+ }
+
+ static long testNoOverrideLoop(int count) {
+ long sum = 0;
+ for (int i=0; i<count; i++) {
+ sum += calcValue(sArray[0]);
+ sum += calcValue(sArray[1]);
+ sum += calcValue(sArray[2]);
+ }
+ return sum;
+ }
+
+ static void testNoOverride() {
+ sArray = new Main1[3];
+ sArray[0] = new Main1();
+ sArray[1] = Dummy.createMain2();
+ sArray[2] = Dummy.createMain3();
+ long sum = 0;
+ // Loop enough to get methods JITed.
+ for (int i=0; i<100; i++) {
+ testNoOverrideLoop(1);
+ }
+ ensureJitCompiled(Main.class, "testNoOverrideLoop");
+ ensureJitCompiled(Main.class, "calcValue");
+
+ long t1 = System.currentTimeMillis();
+ sum = testNoOverrideLoop(100000);
+ long t2 = System.currentTimeMillis();
+ if (sum != 27300000L) {
+ System.out.println("Unexpected result.");
+ }
+ }
+
+ private static void assertSingleImplementation(Class<?> clazz, String method_name, boolean b) {
+ if (hasSingleImplementation(clazz, method_name) != b) {
+ System.out.println(clazz + "." + method_name +
+ " doesn't have single implementation value of " + b);
+ }
+ }
+
+ // Test scenarios under which CHA-based devirtualization happens,
+ // and class loading that overrides a method can invalidate compiled code.
+ // Also test pure non-overriding case, which is more for checking generated
+ // code form.
+ public static void main(String[] args) {
+ System.loadLibrary(args[0]);
+
+ // CHeck some boot-image methods.
+ assertSingleImplementation(java.util.ArrayList.class, "size", true);
+ // java.util.LinkedHashMap overrides get().
+ assertSingleImplementation(java.util.HashMap.class, "get", false);
+
+ // We don't set single-implementation modifier bit for final classes or methods
+ // since we can devirtualize without CHA for those cases. However hasSingleImplementation()
+ // should return true for those cases.
+ assertSingleImplementation(java.lang.String.class, "charAt", true);
+ assertSingleImplementation(java.lang.Thread.class, "join", true);
+ // We don't set single-implementation modifier bit for native methods.
+ assertSingleImplementation(java.lang.Thread.class, "isInterrupted", false);
+
+ if (isInterpreted()) {
+ sIsOptimizing = false;
+ }
+
+ // sMain1 is an instance of Main1. Main2 hasn't bee loaded yet.
+ sMain1 = new Main1();
+
+ ensureJitCompiled(Main.class, "testOverride");
+ testOverride(false, false, true);
+
+ if (sHasJIT && !sIsOptimizing) {
+ assertSingleImplementation(Main1.class, "foo", true);
+ } else {
+ // Main2 is verified ahead-of-time so it's linked in already.
+ }
+ assertSingleImplementation(Main1.class, "getValue1", true);
+
+ // Create another thread that also calls sMain1.foo().
+ // Try to test suspend and deopt another thread.
+ new Thread() {
+ public void run() {
+ testOverride(false, true, false);
+ }
+ }.start();
+
+ // This will create Main2 instance in the middle of testOverride().
+ testOverride(true, false, false);
+ assertSingleImplementation(Main1.class, "foo", false);
+ assertSingleImplementation(Main1.class, "getValue1", true);
+
+ testNoOverride();
+ }
+
+ private static native void ensureJitCompiled(Class<?> itf, String method_name);
+ private static native void assertIsInterpreted();
+ private static native void assertIsManaged();
+ private static native boolean isInterpreted();
+ private static native boolean hasSingleImplementation(Class<?> clazz, String method_name);
+}
+
+// Put createMain2() in another class to avoid class loading due to verifier.
+class Dummy {
+ static Main1 createMain2() {
+ return new Main2();
+ }
+ static Main1 createMain3() {
+ return new Main3();
+ }
+}
diff --git a/test/618-checker-induction/src/Main.java b/test/618-checker-induction/src/Main.java
index f85479a..ecc129a 100644
--- a/test/618-checker-induction/src/Main.java
+++ b/test/618-checker-induction/src/Main.java
@@ -25,7 +25,7 @@
/// CHECK-DAG: Phi loop:{{B\d+}} outer_loop:none
//
/// CHECK-START: void Main.deadSingleLoop() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
+ /// CHECK-NOT: Phi
static void deadSingleLoop() {
for (int i = 0; i < 4; i++) {
}
@@ -35,7 +35,7 @@
/// CHECK-DAG: Phi loop:{{B\d+}} outer_loop:none
//
/// CHECK-START: void Main.deadSingleLoop() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
+ /// CHECK-NOT: Phi
static void deadSingleLoopN(int n) {
for (int i = 0; i < n; i++) {
}
@@ -56,7 +56,7 @@
/// CHECK-DAG: Phi loop:{{B\d+}} outer_loop:<<Loop>>
//
/// CHECK-START: void Main.deadNestedLoops() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}}
+ /// CHECK-NOT: Phi
static void deadNestedLoops() {
for (int i = 0; i < 4; i++) {
for (int j = 0; j < 4; j++) {
@@ -74,7 +74,7 @@
/// CHECK-DAG: Phi loop:{{B\d+}} outer_loop:none
//
/// CHECK-START: void Main.deadNestedAndFollowingLoops() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}}
+ /// CHECK-NOT: Phi
static void deadNestedAndFollowingLoops() {
for (int i = 0; i < 4; i++) {
for (int j = 0; j < 4; j++) {
@@ -96,7 +96,7 @@
/// CHECK-DAG: Phi loop:{{B\d+}} outer_loop:none
//
/// CHECK-START: void Main.deadConditional(int) loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}}
+ /// CHECK-NOT: Phi
public static void deadConditional(int n) {
int k = 0;
int m = 0;
@@ -116,7 +116,7 @@
/// CHECK-DAG: Phi loop:<<Loop>> outer_loop:none
//
/// CHECK-START: void Main.deadConditionalCycle(int) loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}}
+ /// CHECK-NOT: Phi
public static void deadConditionalCycle(int n) {
int k = 0;
int m = 0;
@@ -215,12 +215,11 @@
/// CHECK-DAG: Return [<<Phi1>>] loop:none
//
/// CHECK-START: int Main.closedFormInductionUp() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: int Main.closedFormInductionUp() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 12395
- /// CHECK-DAG: Return [<<Int>>] loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 12395 loop:none
+ /// CHECK-DAG: Return [<<Int>>] loop:none
static int closedFormInductionUp() {
int closed = 12345;
for (int i = 0; i < 10; i++) {
@@ -235,8 +234,13 @@
/// CHECK-DAG: Return [<<Phi2>>] loop:none
//
/// CHECK-START: int Main.closedFormInductionInAndDown(int) loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
+ //
+ /// CHECK-START: int Main.closedFormInductionInAndDown(int) instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Par:i\d+>> ParameterValue loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant -50 loop:none
+ /// CHECK-DAG: <<Add:i\d+>> Add [<<Int>>,<<Par>>] loop:none
+ /// CHECK-DAG: Return [<<Add>>] loop:none
static int closedFormInductionInAndDown(int closed) {
for (int i = 0; i < 10; i++) {
closed -= 5;
@@ -244,6 +248,33 @@
return closed; // only needs last value
}
+ /// CHECK-START: int Main.closedFormInductionTrivialIf() loop_optimization (before)
+ /// CHECK-DAG: <<Phi1:i\d+>> Phi loop:<<Loop:B\d+>> outer_loop:none
+ /// CHECK-DAG: <<Phi2:i\d+>> Phi loop:<<Loop>> outer_loop:none
+ /// CHECK-DAG: Select loop:<<Loop>> outer_loop:none
+ /// CHECK-DAG: Return [<<Phi1>>] loop:none
+ //
+ /// CHECK-START: int Main.closedFormInductionTrivialIf() loop_optimization (after)
+ /// CHECK-NOT: Phi
+ /// CHECK-NOT: Select
+ //
+ /// CHECK-START: int Main.closedFormInductionTrivialIf() instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 81 loop:none
+ /// CHECK-DAG: Return [<<Int>>] loop:none
+ static int closedFormInductionTrivialIf() {
+ int closed = 11;
+ for (int i = 0; i < 10; i++) {
+ // Trivial if becomes trivial select at HIR level.
+ // Make sure this is still recognized as induction.
+ if (i < 5) {
+ closed += 7;
+ } else {
+ closed += 7;
+ }
+ }
+ return closed; // only needs last value
+ }
+
/// CHECK-START: int Main.closedFormNested() loop_optimization (before)
/// CHECK-DAG: <<Phi1:i\d+>> Phi loop:<<Loop1:B\d+>> outer_loop:none
/// CHECK-DAG: <<Phi2:i\d+>> Phi loop:<<Loop1>> outer_loop:none
@@ -252,12 +283,10 @@
/// CHECK-DAG: Return [<<Phi1>>] loop:none
//
/// CHECK-START: int Main.closedFormNested() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:loop{{B\d+}}
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: int Main.closedFormNested() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 100
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 100 loop:none
/// CHECK-DAG: Return [<<Int>>] loop:none
static int closedFormNested() {
int closed = 0;
@@ -277,13 +306,11 @@
/// CHECK-DAG: Return [<<Phi1>>] loop:none
//
/// CHECK-START: int Main.closedFormNestedAlt() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:loop{{B\d+}}
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: int Main.closedFormNestedAlt() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 15082
- /// CHECK-DAG: Return [<<Int>>] loop:none
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 15082 loop:none
+ /// CHECK-DAG: Return [<<Int>>] loop:none
static int closedFormNestedAlt() {
int closed = 12345;
for (int i = 0; i < 17; i++) {
@@ -360,11 +387,10 @@
/// CHECK-DAG: Return [<<Phi>>] loop:none
//
/// CHECK-START: int Main.mainIndexReturned() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: int Main.mainIndexReturned() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 10
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 10 loop:none
/// CHECK-DAG: Return [<<Int>>] loop:none
static int mainIndexReturned() {
int i;
@@ -378,11 +404,10 @@
/// CHECK-DAG: Return [<<Phi2>>] loop:none
//
/// CHECK-START: int Main.periodicReturned9() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: int Main.periodicReturned9() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 1
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 1 loop:none
/// CHECK-DAG: Return [<<Int>>] loop:none
static int periodicReturned9() {
int k = 0;
@@ -398,11 +423,10 @@
/// CHECK-DAG: Return [<<Phi2>>] loop:none
//
/// CHECK-START: int Main.periodicReturned10() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: int Main.periodicReturned10() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 0
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 0 loop:none
/// CHECK-DAG: Return [<<Int>>] loop:none
static int periodicReturned10() {
int k = 0;
@@ -412,7 +436,18 @@
return k;
}
- // If ever replaced by closed form, last value should be correct!
+ /// CHECK-START: int Main.getSum21() loop_optimization (before)
+ /// CHECK-DAG: <<Phi1:i\d+>> Phi loop:<<Loop:B\d+>> outer_loop:none
+ /// CHECK-DAG: <<Phi2:i\d+>> Phi loop:<<Loop>> outer_loop:none
+ /// CHECK-DAG: <<Phi3:i\d+>> Phi loop:<<Loop>> outer_loop:none
+ /// CHECK-DAG: Return [<<Phi3>>] loop:none
+ //
+ /// CHECK-START: int Main.getSum21() loop_optimization (after)
+ /// CHECK-NOT: Phi
+ //
+ /// CHECK-START: int Main.getSum21() instruction_simplifier$after_bce (after)
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 21 loop:none
+ /// CHECK-DAG: Return [<<Int>>] loop:none
private static int getSum21() {
int k = 0;
int sum = 0;
@@ -436,8 +471,7 @@
/// CHECK-DAG: Return [<<Phi2>>] loop:none
//
/// CHECK-START: int Main.periodicReturnedN(int) loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
static int periodicReturnedN(int n) {
int k = 0;
for (int i = 0; i < n; i++) {
@@ -480,11 +514,10 @@
/// CHECK-EVAL: "<<Loop1>>" != "<<Loop2>>"
//
/// CHECK-START: int Main.closedFeed() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: int Main.closedFeed() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 20
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 20 loop:none
/// CHECK-DAG: Return [<<Int>>] loop:none
private static int closedFeed() {
int closed = 0;
@@ -505,11 +538,10 @@
/// CHECK-DAG: Return [<<Phi1>>] loop:none
//
/// CHECK-START: int Main.closedLargeUp() loop_optimization (after)
- /// CHECK-NOT: Phi loop:B\d+ outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: int Main.closedLargeUp() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant -10
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant -10 loop:none
/// CHECK-DAG: Return [<<Int>>] loop:none
private static int closedLargeUp() {
int closed = 0;
@@ -525,11 +557,10 @@
/// CHECK-DAG: Return [<<Phi1>>] loop:none
//
/// CHECK-START: int Main.closedLargeDown() loop_optimization (after)
- /// CHECK-NOT: Phi loop:B\d+ outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: int Main.closedLargeDown() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 10
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 10 loop:none
/// CHECK-DAG: Return [<<Int>>] loop:none
private static int closedLargeDown() {
int closed = 0;
@@ -548,11 +579,10 @@
/// CHECK-DAG: Return [<<Phi5>>] loop:none
//
/// CHECK-START: int Main.waterFall() loop_optimization (after)
- /// CHECK-NOT: Phi loop:B\d+ outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: int Main.waterFall() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 50
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 50 loop:none
/// CHECK-DAG: Return [<<Int>>] loop:none
private static int waterFall() {
int i = 0;
@@ -570,11 +600,10 @@
/// CHECK-DAG: Return [<<Phi2>>] loop:none
//
/// CHECK-START: boolean Main.periodicBoolIdiom1() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: boolean Main.periodicBoolIdiom1() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 0
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 0 loop:none
/// CHECK-DAG: Return [<<Int>>] loop:none
private static boolean periodicBoolIdiom1() {
boolean x = true;
@@ -590,11 +619,10 @@
/// CHECK-DAG: Return [<<Phi2>>] loop:none
//
/// CHECK-START: boolean Main.periodicBoolIdiom2() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: boolean Main.periodicBoolIdiom2() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 0
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 0 loop:none
/// CHECK-DAG: Return [<<Int>>] loop:none
private static boolean periodicBoolIdiom2() {
boolean x = true;
@@ -610,11 +638,10 @@
/// CHECK-DAG: Return [<<Phi2>>] loop:none
//
/// CHECK-START: boolean Main.periodicBoolIdiom3() loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
//
/// CHECK-START: boolean Main.periodicBoolIdiom3() instruction_simplifier$after_bce (after)
- /// CHECK-DAG: <<Int:i\d+>> IntConstant 0
+ /// CHECK-DAG: <<Int:i\d+>> IntConstant 0 loop:none
/// CHECK-DAG: Return [<<Int>>] loop:none
private static boolean periodicBoolIdiom3() {
boolean x = true;
@@ -630,8 +657,7 @@
/// CHECK-DAG: Return [<<Phi2>>] loop:none
//
/// CHECK-START: boolean Main.periodicBoolIdiom1N(boolean, int) loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
private static boolean periodicBoolIdiom1N(boolean x, int n) {
for (int i = 0; i < n; i++) {
x = !x;
@@ -645,8 +671,7 @@
/// CHECK-DAG: Return [<<Phi2>>] loop:none
//
/// CHECK-START: boolean Main.periodicBoolIdiom2N(boolean, int) loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
private static boolean periodicBoolIdiom2N(boolean x, int n) {
for (int i = 0; i < n; i++) {
x = (x != true);
@@ -660,8 +685,7 @@
/// CHECK-DAG: Return [<<Phi2>>] loop:none
//
/// CHECK-START: boolean Main.periodicBoolIdiom3N(boolean, int) loop_optimization (after)
- /// CHECK-NOT: Phi loop:{{B\d+}} outer_loop:none
- /// CHECK-DAG: Return loop:none
+ /// CHECK-NOT: Phi
private static boolean periodicBoolIdiom3N(boolean x, int n) {
for (int i = 0; i < n; i++) {
x = (x == false);
@@ -735,6 +759,7 @@
expectEquals(12395, closedFormInductionUp());
expectEquals(12295, closedFormInductionInAndDown(12345));
+ expectEquals(81, closedFormInductionTrivialIf());
expectEquals(10 * 10, closedFormNested());
expectEquals(12345 + 17 * 23 * 7, closedFormNestedAlt());
for (int n = -4; n < 10; n++) {
diff --git a/test/624-checker-stringops/src/Main.java b/test/624-checker-stringops/src/Main.java
index 34e8283..75b782e 100644
--- a/test/624-checker-stringops/src/Main.java
+++ b/test/624-checker-stringops/src/Main.java
@@ -98,9 +98,184 @@
return k;
}
+ //
+ // Allows combining of returned "this". Also ensures that similar looking append() calls
+ // are not combined somehow through returned result.
+ //
+ /// CHECK-START: int Main.bufferLen2() instruction_simplifier (before)
+ /// CHECK-DAG: <<New:l\d+>> NewInstance
+ /// CHECK-DAG: <<String1:l\d+>> LoadString
+ /// CHECK-DAG: <<Append1:l\d+>> InvokeVirtual [<<New>>,<<String1>>] intrinsic:StringBufferAppend
+ /// CHECK-DAG: <<String2:l\d+>> LoadString
+ /// CHECK-DAG: <<Null1:l\d+>> NullCheck [<<Append1>>]
+ /// CHECK-DAG: <<Append2:l\d+>> InvokeVirtual [<<Null1>>,<<String2>>] intrinsic:StringBufferAppend
+ /// CHECK-DAG: <<Null2:l\d+>> NullCheck [<<Append2>>]
+ /// CHECK-DAG: InvokeVirtual [<<Null2>>] intrinsic:StringBufferLength
+ //
+ /// CHECK-START: int Main.bufferLen2() instruction_simplifier (after)
+ /// CHECK-DAG: <<New:l\d+>> NewInstance
+ /// CHECK-DAG: <<String1:l\d+>> LoadString
+ /// CHECK-DAG: <<Append1:l\d+>> InvokeVirtual [<<New>>,<<String1>>] intrinsic:StringBufferAppend
+ /// CHECK-DAG: <<String2:l\d+>> LoadString
+ /// CHECK-DAG: <<Append2:l\d+>> InvokeVirtual [<<New>>,<<String2>>] intrinsic:StringBufferAppend
+ /// CHECK-DAG: InvokeVirtual [<<New>>] intrinsic:StringBufferLength
+ static int bufferLen2() {
+ StringBuffer s = new StringBuffer();
+ return s.append("x").append("x").length();
+ }
+
+ //
+ // Allows combining of returned "this". Also ensures that similar looking append() calls
+ // are not combined somehow through returned result.
+ //
+ /// CHECK-START: int Main.builderLen2() instruction_simplifier (before)
+ /// CHECK-DAG: <<New:l\d+>> NewInstance
+ /// CHECK-DAG: <<String1:l\d+>> LoadString
+ /// CHECK-DAG: <<Append1:l\d+>> InvokeVirtual [<<New>>,<<String1>>] intrinsic:StringBuilderAppend
+ /// CHECK-DAG: <<String2:l\d+>> LoadString
+ /// CHECK-DAG: <<Null2:l\d+>> NullCheck [<<Append1>>]
+ /// CHECK-DAG: <<Append2:l\d+>> InvokeVirtual [<<Null2>>,<<String2>>] intrinsic:StringBuilderAppend
+ /// CHECK-DAG: <<Null3:l\d+>> NullCheck [<<Append2>>]
+ /// CHECK-DAG: InvokeVirtual [<<Null3>>] intrinsic:StringBuilderLength
+ //
+ /// CHECK-START: int Main.builderLen2() instruction_simplifier (after)
+ /// CHECK-DAG: <<New:l\d+>> NewInstance
+ /// CHECK-DAG: <<String1:l\d+>> LoadString
+ /// CHECK-DAG: <<Append1:l\d+>> InvokeVirtual [<<New>>,<<String1>>] intrinsic:StringBuilderAppend
+ /// CHECK-DAG: <<String2:l\d+>> LoadString
+ /// CHECK-DAG: <<Append2:l\d+>> InvokeVirtual [<<New>>,<<String2>>] intrinsic:StringBuilderAppend
+ /// CHECK-DAG: InvokeVirtual [<<New>>] intrinsic:StringBuilderLength
+ static int builderLen2() {
+ StringBuilder s = new StringBuilder();
+ return s.append("x").append("x").length();
+ }
+
+ //
+ // Similar situation in a loop.
+ //
+ /// CHECK-START: int Main.bufferLoopAppender() instruction_simplifier (before)
+ /// CHECK-DAG: <<New:l\d+>> NewInstance loop:none
+ /// CHECK-DAG: <<String1:l\d+>> LoadString loop:<<Loop:B\d+>>
+ /// CHECK-DAG: <<Null1:l\d+>> NullCheck [<<New>>] loop:<<Loop>>
+ /// CHECK-DAG: <<Append1:l\d+>> InvokeVirtual [<<Null1>>,<<String1>>] intrinsic:StringBufferAppend loop:<<Loop>>
+ /// CHECK-DAG: <<String2:l\d+>> LoadString loop:<<Loop>>
+ /// CHECK-DAG: <<Null2:l\d+>> NullCheck [<<Append1>>] loop:<<Loop>>
+ /// CHECK-DAG: <<Append2:l\d+>> InvokeVirtual [<<Null2>>,<<String2>>] intrinsic:StringBufferAppend loop:<<Loop>>
+ /// CHECK-DAG: <<String3:l\d+>> LoadString loop:<<Loop>>
+ /// CHECK-DAG: <<Null3:l\d+>> NullCheck [<<Append2>>] loop:<<Loop>>
+ /// CHECK-DAG: <<Append3:l\d+>> InvokeVirtual [<<Null3>>,<<String3>>] intrinsic:StringBufferAppend loop:<<Loop>>
+ /// CHECK-DAG: <<Null4:l\d+>> NullCheck [<<New>>] loop:none
+ /// CHECK-DAG: InvokeVirtual [<<Null4>>] intrinsic:StringBufferLength loop:none
+ //
+ /// CHECK-START: int Main.bufferLoopAppender() instruction_simplifier (after)
+ /// CHECK-DAG: <<New:l\d+>> NewInstance loop:none
+ /// CHECK-DAG: <<String1:l\d+>> LoadString loop:<<Loop:B\d+>>
+ /// CHECK-DAG: <<Append1:l\d+>> InvokeVirtual [<<New>>,<<String1>>] intrinsic:StringBufferAppend loop:<<Loop>>
+ /// CHECK-DAG: <<String2:l\d+>> LoadString loop:<<Loop>>
+ /// CHECK-DAG: <<Append2:l\d+>> InvokeVirtual [<<New>>,<<String2>>] intrinsic:StringBufferAppend loop:<<Loop>>
+ /// CHECK-DAG: <<String3:l\d+>> LoadString loop:<<Loop>>
+ /// CHECK-DAG: <<Append3:l\d+>> InvokeVirtual [<<New>>,<<String3>>] intrinsic:StringBufferAppend loop:<<Loop>>
+ /// CHECK-DAG: InvokeVirtual [<<New>>] intrinsic:StringBufferLength loop:none
+ static int bufferLoopAppender() {
+ StringBuffer b = new StringBuffer();
+ for (int i = 0; i < 10; i++) {
+ b.append("x").append("y").append("z");
+ }
+ return b.length();
+ }
+
+ //
+ // Similar situation in a loop.
+ //
+ /// CHECK-START: int Main.builderLoopAppender() instruction_simplifier (before)
+ /// CHECK-DAG: <<New:l\d+>> NewInstance loop:none
+ /// CHECK-DAG: <<String1:l\d+>> LoadString loop:<<Loop:B\d+>>
+ /// CHECK-DAG: <<Null1:l\d+>> NullCheck [<<New>>] loop:<<Loop>>
+ /// CHECK-DAG: <<Append1:l\d+>> InvokeVirtual [<<Null1>>,<<String1>>] intrinsic:StringBuilderAppend loop:<<Loop>>
+ /// CHECK-DAG: <<String2:l\d+>> LoadString loop:<<Loop>>
+ /// CHECK-DAG: <<Null2:l\d+>> NullCheck [<<Append1>>] loop:<<Loop>>
+ /// CHECK-DAG: <<Append2:l\d+>> InvokeVirtual [<<Null2>>,<<String2>>] intrinsic:StringBuilderAppend loop:<<Loop>>
+ /// CHECK-DAG: <<String3:l\d+>> LoadString loop:<<Loop>>
+ /// CHECK-DAG: <<Null3:l\d+>> NullCheck [<<Append2>>] loop:<<Loop>>
+ /// CHECK-DAG: <<Append3:l\d+>> InvokeVirtual [<<Null3>>,<<String3>>] intrinsic:StringBuilderAppend loop:<<Loop>>
+ /// CHECK-DAG: <<Null4:l\d+>> NullCheck [<<New>>] loop:none
+ /// CHECK-DAG: InvokeVirtual [<<Null4>>] intrinsic:StringBuilderLength loop:none
+ //
+ /// CHECK-START: int Main.builderLoopAppender() instruction_simplifier (after)
+ /// CHECK-DAG: <<New:l\d+>> NewInstance loop:none
+ /// CHECK-DAG: <<String1:l\d+>> LoadString loop:<<Loop:B\d+>>
+ /// CHECK-DAG: <<Append1:l\d+>> InvokeVirtual [<<New>>,<<String1>>] intrinsic:StringBuilderAppend loop:<<Loop>>
+ /// CHECK-DAG: <<String2:l\d+>> LoadString loop:<<Loop>>
+ /// CHECK-DAG: <<Append2:l\d+>> InvokeVirtual [<<New>>,<<String2>>] intrinsic:StringBuilderAppend loop:<<Loop>>
+ /// CHECK-DAG: <<String3:l\d+>> LoadString loop:<<Loop>>
+ /// CHECK-DAG: <<Append3:l\d+>> InvokeVirtual [<<New>>,<<String3>>] intrinsic:StringBuilderAppend loop:<<Loop>>
+ /// CHECK-DAG: InvokeVirtual [<<New>>] intrinsic:StringBuilderLength loop:none
+ static int builderLoopAppender() {
+ StringBuilder b = new StringBuilder();
+ for (int i = 0; i < 10; i++) {
+ b.append("x").append("y").append("z");
+ }
+ return b.length();
+ }
+
+ //
+ // All calls in the loop-body and thus loop can be eliminated.
+ //
+ /// CHECK-START: int Main.bufferDeadLoop() instruction_simplifier (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: InvokeVirtual intrinsic:StringBufferToString loop:<<Loop>>
+ /// CHECK-DAG: InvokeVirtual intrinsic:StringStringIndexOfAfter loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.bufferDeadLoop() loop_optimization (after)
+ /// CHECK-NOT: Phi
+ /// CHECK-NOT: InvokeVirtual intrinsic:StringBufferToString
+ /// CHECK-NOT: InvokeVirtual intrinsic:StringStringIndexOfAfter
+ static int bufferDeadLoop() {
+ StringBuffer b = new StringBuffer();
+ for (int i = 0; i < 10; i++) {
+ int d = b.toString().indexOf("x", 1);
+ }
+ return b.length();
+ }
+
+ //
+ // All calls in the loop-body and thus loop can be eliminated.
+ //
+ /// CHECK-START: int Main.builderDeadLoop() instruction_simplifier (before)
+ /// CHECK-DAG: Phi loop:<<Loop:B\d+>>
+ /// CHECK-DAG: InvokeVirtual intrinsic:StringBuilderToString loop:<<Loop>>
+ /// CHECK-DAG: InvokeVirtual intrinsic:StringStringIndexOfAfter loop:<<Loop>>
+ //
+ /// CHECK-START: int Main.builderDeadLoop() loop_optimization (after)
+ /// CHECK-NOT: Phi
+ /// CHECK-NOT: InvokeVirtual intrinsic:StringBuilderToString
+ /// CHECK-NOT: InvokeVirtual intrinsic:StringStringIndexOfAfter
+ static int builderDeadLoop() {
+ StringBuilder b = new StringBuilder();
+ for (int i = 0; i < 10; i++) {
+ int d = b.toString().indexOf("x", 1);
+ }
+ return b.length();
+ }
+
+ // Regression b/33656359: StringBuffer x is passed to constructor of String
+ // (this caused old code to crash due to missing nullptr check).
+ //
+ /// CHECK-START: void Main.doesNothing() instruction_simplifier (before)
+ /// CHECK-DAG: InvokeVirtual intrinsic:StringBufferToString
+ //
+ /// CHECK-START: void Main.doesNothing() instruction_simplifier (after)
+ /// CHECK-DAG: InvokeVirtual intrinsic:StringBufferToString
+ static void doesNothing() {
+ StringBuffer x = new StringBuffer();
+ String y = new String(x);
+ x.toString();
+ }
+
public static void main(String[] args) {
expectEquals(1865, liveIndexOf());
expectEquals(29, deadIndexOf());
+
try {
indexOfExceptions(null, XYZ);
throw new Error("Expected: NPE");
@@ -113,6 +288,15 @@
}
expectEquals(598, indexOfExceptions(ABC, XYZ));
+ expectEquals(2, bufferLen2());
+ expectEquals(2, builderLen2());
+ expectEquals(30, bufferLoopAppender());
+ expectEquals(30, builderLoopAppender());
+ expectEquals(0, bufferDeadLoop());
+ expectEquals(0, builderDeadLoop());
+
+ doesNothing();
+
System.out.println("passed");
}
diff --git a/test/626-const-class-linking/clear_dex_cache_types.cc b/test/626-const-class-linking/clear_dex_cache_types.cc
new file mode 100644
index 0000000..b035896
--- /dev/null
+++ b/test/626-const-class-linking/clear_dex_cache_types.cc
@@ -0,0 +1,65 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "jni.h"
+#include "object_lock.h"
+#include "scoped_thread_state_change-inl.h"
+
+namespace art {
+
+extern "C" JNIEXPORT void JNICALL Java_Main_nativeClearResolvedTypes(JNIEnv*, jclass, jclass cls) {
+ ScopedObjectAccess soa(Thread::Current());
+ mirror::DexCache* dex_cache = soa.Decode<mirror::Class>(cls)->GetDexCache();
+ for (size_t i = 0, num_types = dex_cache->NumResolvedTypes(); i != num_types; ++i) {
+ dex_cache->SetResolvedType(dex::TypeIndex(i), ObjPtr<mirror::Class>(nullptr));
+ }
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_nativeSkipVerification(JNIEnv*, jclass, jclass cls) {
+ ScopedObjectAccess soa(Thread::Current());
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::Class> klass = hs.NewHandle(soa.Decode<mirror::Class>(cls));
+ mirror::Class::Status status = klass->GetStatus();
+ if (status == mirror::Class::kStatusResolved) {
+ ObjectLock<mirror::Class> lock(soa.Self(), klass);
+ klass->SetStatus(klass, mirror::Class::kStatusVerified, soa.Self());
+ } else {
+ LOG(ERROR) << klass->PrettyClass() << " has unexpected status: " << status;
+ }
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_nativeDumpClasses(JNIEnv*, jclass, jobjectArray array) {
+ ScopedObjectAccess soa(Thread::Current());
+ StackHandleScope<1> hs(soa.Self());
+ Handle<mirror::ObjectArray<mirror::Object>> classes =
+ hs.NewHandle(soa.Decode<mirror::ObjectArray<mirror::Object>>(array));
+ CHECK(classes.Get() != nullptr);
+ for (size_t i = 0, length = classes->GetLength(); i != length; ++i) {
+ CHECK(classes->Get(i) != nullptr) << i;
+ CHECK(classes->Get(i)->IsClass())
+ << i << " " << classes->Get(i)->GetClass()->PrettyDescriptor();
+ mirror::Class* as_class = classes->Get(i)->AsClass();
+ mirror::ClassLoader* loader = as_class->GetClassLoader();
+ LOG(ERROR) << "Class #" << i << ": " << as_class->PrettyDescriptor()
+ << " @" << static_cast<const void*>(as_class)
+ << " status:" << as_class->GetStatus()
+ << " definingLoader:" << static_cast<const void*>(loader)
+ << " definingLoaderClass:"
+ << (loader != nullptr ? loader->GetClass()->PrettyDescriptor() : "N/A");
+ }
+}
+
+} // namespace art
diff --git a/test/626-const-class-linking/expected.txt b/test/626-const-class-linking/expected.txt
new file mode 100644
index 0000000..de1b815
--- /dev/null
+++ b/test/626-const-class-linking/expected.txt
@@ -0,0 +1,61 @@
+JNI_OnLoad called
+first: Helper1 class loader: DelegatingLoader
+second: Test class loader: DefiningLoader
+first: Helper1 class loader: DelegatingLoader
+second: Test class loader: DefiningLoader
+testClearDexCache done
+first: Helper1 class loader: DelegatingLoader
+second: Test class loader: DefiningLoader
+first: Helper2 class loader: DelegatingLoader
+second: Test class loader: DefiningLoader
+testMultiDex done
+first: Helper1 class loader: RacyLoader
+second: Test class loader: DefiningLoader
+first: Helper1 class loader: RacyLoader
+second: Test class loader: DefiningLoader
+first: Helper1 class loader: RacyLoader
+second: Test class loader: DefiningLoader
+first: Helper1 class loader: RacyLoader
+second: Test class loader: DefiningLoader
+total: 4
+ throwables: 0
+ classes: 4 (1 unique)
+testRacyLoader done
+first: Helper1 class loader: RacyLoader
+second: Test class loader: DefiningLoader
+first: Helper1 class loader: RacyLoader
+second: Test class loader: DefiningLoader
+first: Helper3 class loader: RacyLoader
+second: Test3 class loader: DefiningLoader
+first: Helper3 class loader: RacyLoader
+second: Test3 class loader: DefiningLoader
+total: 4
+ throwables: 0
+ classes: 4 (2 unique)
+testRacyLoader2 done
+java.lang.NoClassDefFoundError: Initiating class loader of type MisbehavingLoader returned class Helper2 instead of Test.
+testMisbehavingLoader done
+first: Helper1 class loader: RacyMisbehavingLoader
+second: Test class loader: DefiningLoader
+first: Helper1 class loader: RacyMisbehavingLoader
+second: Test class loader: DefiningLoader
+first: Helper1 class loader: RacyMisbehavingLoader
+second: Test class loader: DefiningLoader
+first: Helper1 class loader: RacyMisbehavingLoader
+second: Test class loader: DefiningLoader
+total: 4
+ throwables: 0
+ classes: 4 (1 unique)
+testRacyMisbehavingLoader done
+first: Helper1 class loader: RacyMisbehavingLoader
+second: Test class loader: DefiningLoader
+first: Helper1 class loader: RacyMisbehavingLoader
+second: Test class loader: DefiningLoader
+first: Helper1 class loader: RacyMisbehavingLoader
+second: Test class loader: DefiningLoader
+first: Helper1 class loader: RacyMisbehavingLoader
+second: Test class loader: DefiningLoader
+total: 4
+ throwables: 0
+ classes: 4 (1 unique)
+testRacyMisbehavingLoader2 done
diff --git a/test/626-const-class-linking/info.txt b/test/626-const-class-linking/info.txt
new file mode 100644
index 0000000..9c19a46
--- /dev/null
+++ b/test/626-const-class-linking/info.txt
@@ -0,0 +1,3 @@
+Test that once a const-class instruction is linked, it will keep referring
+to the same class even in the presence of custom class loaders even after
+clearing the dex cache type array.
diff --git a/test/626-const-class-linking/multidex.jpp b/test/626-const-class-linking/multidex.jpp
new file mode 100644
index 0000000..c7a6648
--- /dev/null
+++ b/test/626-const-class-linking/multidex.jpp
@@ -0,0 +1,27 @@
+ClassPair:
+ @@com.android.jack.annotations.ForceInMainDex
+ class ClassPair
+DefiningLoader:
+ @@com.android.jack.annotations.ForceInMainDex
+ class DefiningLoader
+DelegatingLoader:
+ @@com.android.jack.annotations.ForceInMainDex
+ class DelegatingLoader
+Helper1:
+ @@com.android.jack.annotations.ForceInMainDex
+ class Helper1
+Main:
+ @@com.android.jack.annotations.ForceInMainDex
+ class Main
+MisbehavingLoader:
+ @@com.android.jack.annotations.ForceInMainDex
+ class MisbehavingLoader
+RacyLoader:
+ @@com.android.jack.annotations.ForceInMainDex
+ class RacyLoader
+RacyMisbehavingHelper:
+ @@com.android.jack.annotations.ForceInMainDex
+ class RacyMisbehavingHelper
+RacyMisbehavingLoader:
+ @@com.android.jack.annotations.ForceInMainDex
+ class RacyMisbehavingLoader
diff --git a/test/902-hello-transformation/transform.h b/test/626-const-class-linking/src-multidex/Helper2.java
similarity index 62%
copy from test/902-hello-transformation/transform.h
copy to test/626-const-class-linking/src-multidex/Helper2.java
index 661058d..5bb31ee 100644
--- a/test/902-hello-transformation/transform.h
+++ b/test/626-const-class-linking/src-multidex/Helper2.java
@@ -14,17 +14,10 @@
* limitations under the License.
*/
-#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-
-#include <jni.h>
-
-namespace art {
-namespace Test902HelloTransformation {
-
-jint OnLoad(JavaVM* vm, char* options, void* reserved);
-
-} // namespace Test902HelloTransformation
-} // namespace art
-
-#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
+public class Helper2 {
+ public static ClassPair get() {
+ Class<?> helper2_class = Helper2.class;
+ Class<?> test_class = Test.class;
+ return new ClassPair(helper2_class, test_class);
+ }
+}
diff --git a/test/902-hello-transformation/transform.h b/test/626-const-class-linking/src-multidex/Helper3.java
similarity index 62%
copy from test/902-hello-transformation/transform.h
copy to test/626-const-class-linking/src-multidex/Helper3.java
index 661058d..af996de 100644
--- a/test/902-hello-transformation/transform.h
+++ b/test/626-const-class-linking/src-multidex/Helper3.java
@@ -14,17 +14,10 @@
* limitations under the License.
*/
-#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-
-#include <jni.h>
-
-namespace art {
-namespace Test902HelloTransformation {
-
-jint OnLoad(JavaVM* vm, char* options, void* reserved);
-
-} // namespace Test902HelloTransformation
-} // namespace art
-
-#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
+public class Helper3 {
+ public static ClassPair get() {
+ Class<?> helper3_class = Helper3.class;
+ Class<?> test3_class = Test3.class;
+ return new ClassPair(helper3_class, test3_class);
+ }
+}
diff --git a/test/902-hello-transformation/transform.h b/test/626-const-class-linking/src-multidex/Test.java
similarity index 62%
copy from test/902-hello-transformation/transform.h
copy to test/626-const-class-linking/src-multidex/Test.java
index 661058d..1b0cc2a 100644
--- a/test/902-hello-transformation/transform.h
+++ b/test/626-const-class-linking/src-multidex/Test.java
@@ -14,17 +14,5 @@
* limitations under the License.
*/
-#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-
-#include <jni.h>
-
-namespace art {
-namespace Test902HelloTransformation {
-
-jint OnLoad(JavaVM* vm, char* options, void* reserved);
-
-} // namespace Test902HelloTransformation
-} // namespace art
-
-#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
+public class Test {
+}
diff --git a/test/902-hello-transformation/transform.h b/test/626-const-class-linking/src-multidex/Test3.java
similarity index 62%
copy from test/902-hello-transformation/transform.h
copy to test/626-const-class-linking/src-multidex/Test3.java
index 661058d..c4b134d 100644
--- a/test/902-hello-transformation/transform.h
+++ b/test/626-const-class-linking/src-multidex/Test3.java
@@ -14,17 +14,5 @@
* limitations under the License.
*/
-#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-
-#include <jni.h>
-
-namespace art {
-namespace Test902HelloTransformation {
-
-jint OnLoad(JavaVM* vm, char* options, void* reserved);
-
-} // namespace Test902HelloTransformation
-} // namespace art
-
-#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
+public class Test3 {
+}
diff --git a/test/626-const-class-linking/src/ClassPair.java b/test/626-const-class-linking/src/ClassPair.java
new file mode 100644
index 0000000..b07036c
--- /dev/null
+++ b/test/626-const-class-linking/src/ClassPair.java
@@ -0,0 +1,32 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class ClassPair {
+ public Class<?> first;
+ public Class<?> second;
+
+ public ClassPair(Class<?> first, Class<?> second) {
+ this.first = first;
+ this.second = second;
+ }
+
+ public void print() {
+ String first_loader_name = first.getClassLoader().getClass().getName();
+ System.out.println("first: " + first.getName() + " class loader: " + first_loader_name);
+ String second_loader_name = second.getClassLoader().getClass().getName();
+ System.out.println("second: " + second.getName() + " class loader: " + second_loader_name);
+ }
+}
diff --git a/test/626-const-class-linking/src/DefiningLoader.java b/test/626-const-class-linking/src/DefiningLoader.java
new file mode 100644
index 0000000..b17ab77
--- /dev/null
+++ b/test/626-const-class-linking/src/DefiningLoader.java
@@ -0,0 +1,239 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.io.File;
+import java.io.FileNotFoundException;
+import java.io.IOException;
+import java.io.RandomAccessFile;
+import java.lang.reflect.Constructor;
+import java.lang.reflect.Method;
+import java.lang.reflect.InvocationTargetException;
+
+/**
+ * A class loader with atypical behavior: we try to load a private
+ * class implementation before asking the system or boot loader. This
+ * is used to create multiple classes with identical names in a single VM.
+ *
+ * If DexFile is available, we use that; if not, we assume we're not in
+ * Dalvik and instantiate the class with defineClass().
+ *
+ * The location of the DEX files and class data is dependent upon the
+ * test framework.
+ */
+public class DefiningLoader extends ClassLoader {
+ static {
+ // For JVM, register as parallel capable.
+ // Android treats all class loaders as parallel capable and makes this a no-op.
+ registerAsParallelCapable();
+ }
+
+ /* this is where the .class files live */
+ static final String CLASS_PATH1 = "classes/";
+ static final String CLASS_PATH2 = "classes2/";
+
+ /* this is the DEX/Jar file */
+ static final String DEX_FILE = System.getenv("DEX_LOCATION") + "/626-const-class-linking.jar";
+
+ /* on Dalvik, this is a DexFile; otherwise, it's null */
+ private Class<?> mDexClass;
+
+ private Object mDexFile;
+
+ /**
+ * Construct DefiningLoader, grabbing a reference to the DexFile class
+ * if we're running under Dalvik.
+ */
+ public DefiningLoader(ClassLoader parent) {
+ super(parent);
+
+ try {
+ mDexClass = parent.loadClass("dalvik.system.DexFile");
+ } catch (ClassNotFoundException cnfe) {
+ // ignore -- not running Dalvik
+ }
+ }
+
+ /**
+ * Finds the class with the specified binary name.
+ *
+ * We search for a file in CLASS_PATH or pull an entry from DEX_FILE.
+ * If we don't find a match, we throw an exception.
+ */
+ protected Class<?> findClass(String name) throws ClassNotFoundException
+ {
+ if (mDexClass != null) {
+ return findClassDalvik(name);
+ } else {
+ return findClassNonDalvik(name);
+ }
+ }
+
+ /**
+ * Finds the class with the specified binary name, from a DEX file.
+ */
+ private Class<?> findClassDalvik(String name)
+ throws ClassNotFoundException {
+
+ if (mDexFile == null) {
+ synchronized (DefiningLoader.class) {
+ Constructor<?> ctor;
+ /*
+ * Construct a DexFile object through reflection.
+ */
+ try {
+ ctor = mDexClass.getConstructor(String.class);
+ } catch (NoSuchMethodException nsme) {
+ throw new ClassNotFoundException("getConstructor failed",
+ nsme);
+ }
+
+ try {
+ mDexFile = ctor.newInstance(DEX_FILE);
+ } catch (InstantiationException ie) {
+ throw new ClassNotFoundException("newInstance failed", ie);
+ } catch (IllegalAccessException iae) {
+ throw new ClassNotFoundException("newInstance failed", iae);
+ } catch (InvocationTargetException ite) {
+ throw new ClassNotFoundException("newInstance failed", ite);
+ }
+ }
+ }
+
+ /*
+ * Call DexFile.loadClass(String, ClassLoader).
+ */
+ Method meth;
+
+ try {
+ meth = mDexClass.getMethod("loadClass", String.class, ClassLoader.class);
+ } catch (NoSuchMethodException nsme) {
+ throw new ClassNotFoundException("getMethod failed", nsme);
+ }
+
+ try {
+ meth.invoke(mDexFile, name, this);
+ } catch (IllegalAccessException iae) {
+ throw new ClassNotFoundException("loadClass failed", iae);
+ } catch (InvocationTargetException ite) {
+ throw new ClassNotFoundException("loadClass failed",
+ ite.getCause());
+ }
+
+ return null;
+ }
+
+ /**
+ * Finds the class with the specified binary name, from .class files.
+ */
+ private Class<?> findClassNonDalvik(String name)
+ throws ClassNotFoundException {
+
+ String[] pathNames = { CLASS_PATH1 + name + ".class", CLASS_PATH2 + name + ".class" };
+
+ String pathName = null;
+ RandomAccessFile raf = null;
+
+ for (String pn : pathNames) {
+ pathName = pn;
+ try {
+ //System.out.println("--- Defining: looking for " + pathName);
+ raf = new RandomAccessFile(new File(pathName), "r");
+ break;
+ } catch (FileNotFoundException fnfe) {
+ }
+ }
+ if (raf == null) {
+ throw new ClassNotFoundException("Not found: " + pathNames[0] + ":" + pathNames[1]);
+ }
+
+ /* read the entire file in */
+ byte[] fileData;
+ try {
+ fileData = new byte[(int) raf.length()];
+ raf.readFully(fileData);
+ } catch (IOException ioe) {
+ throw new ClassNotFoundException("Read error: " + pathName);
+ } finally {
+ try {
+ raf.close();
+ } catch (IOException ioe) {
+ // drop
+ }
+ }
+
+ /* create the class */
+ //System.out.println("--- Defining: defining " + name);
+ try {
+ return defineClass(name, fileData, 0, fileData.length);
+ } catch (Throwable th) {
+ throw new ClassNotFoundException("defineClass failed", th);
+ }
+ }
+
+ /**
+ * Load a class.
+ *
+ * Normally a class loader wouldn't override this, but we want our
+ * version of the class to take precedence over an already-loaded
+ * version.
+ *
+ * We still want the system classes (e.g. java.lang.Object) from the
+ * bootstrap class loader.
+ */
+ synchronized protected Class<?> loadClass(String name, boolean resolve)
+ throws ClassNotFoundException
+ {
+ Class<?> res;
+
+ /*
+ * 1. Invoke findLoadedClass(String) to check if the class has
+ * already been loaded.
+ *
+ * This doesn't change.
+ */
+ res = findLoadedClass(name);
+ if (res != null) {
+ // System.out.println("FancyLoader.loadClass: " + name + " already loaded");
+ if (resolve)
+ resolveClass(res);
+ return res;
+ }
+
+ /*
+ * 3. Invoke the findClass(String) method to find the class.
+ */
+ try {
+ res = findClass(name);
+ if (resolve)
+ resolveClass(res);
+ }
+ catch (ClassNotFoundException e) {
+ // we couldn't find it, so eat the exception and keep going
+ }
+
+ /*
+ * 2. Invoke the loadClass method on the parent class loader. If
+ * the parent loader is null the class loader built-in to the
+ * virtual machine is used, instead.
+ *
+ * (Since we're not in java.lang, we can't actually invoke the
+ * parent's loadClass() method, but we passed our parent to the
+ * super-class which can take care of it for us.)
+ */
+ res = super.loadClass(name, resolve); // returns class or throws
+ return res;
+ }
+}
diff --git a/test/626-const-class-linking/src/DelegatingLoader.java b/test/626-const-class-linking/src/DelegatingLoader.java
new file mode 100644
index 0000000..49955d4
--- /dev/null
+++ b/test/626-const-class-linking/src/DelegatingLoader.java
@@ -0,0 +1,45 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class DelegatingLoader extends DefiningLoader {
+ private DefiningLoader defining_loader;
+
+ public DelegatingLoader(ClassLoader parent, DefiningLoader defining_loader) {
+ super(parent);
+ this.defining_loader = defining_loader;
+ }
+
+ public void resetDefiningLoader(DefiningLoader defining_loader) {
+ this.defining_loader = defining_loader;
+ }
+
+ protected Class<?> findClass(String name) throws ClassNotFoundException
+ {
+ if (name.equals("Test")) {
+ throw new Error("Unexpected DelegatingLoader.findClass(\"Test\")");
+ }
+ return super.findClass(name);
+ }
+
+ protected Class<?> loadClass(String name, boolean resolve)
+ throws ClassNotFoundException
+ {
+ if (name.equals("Test")) {
+ return defining_loader.loadClass(name, resolve);
+ }
+ return super.loadClass(name, resolve);
+ }
+}
diff --git a/test/902-hello-transformation/transform.h b/test/626-const-class-linking/src/Helper1.java
similarity index 62%
copy from test/902-hello-transformation/transform.h
copy to test/626-const-class-linking/src/Helper1.java
index 661058d..ff9cd1a 100644
--- a/test/902-hello-transformation/transform.h
+++ b/test/626-const-class-linking/src/Helper1.java
@@ -14,17 +14,10 @@
* limitations under the License.
*/
-#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-
-#include <jni.h>
-
-namespace art {
-namespace Test902HelloTransformation {
-
-jint OnLoad(JavaVM* vm, char* options, void* reserved);
-
-} // namespace Test902HelloTransformation
-} // namespace art
-
-#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
+public class Helper1 {
+ public static ClassPair get() {
+ Class<?> helper1_class = Helper1.class;
+ Class<?> test_class = Test.class;
+ return new ClassPair(helper1_class, test_class);
+ }
+}
diff --git a/test/626-const-class-linking/src/Main.java b/test/626-const-class-linking/src/Main.java
new file mode 100644
index 0000000..0029428
--- /dev/null
+++ b/test/626-const-class-linking/src/Main.java
@@ -0,0 +1,354 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.ref.WeakReference;
+import java.lang.reflect.Field;
+import java.lang.reflect.InvocationTargetException;
+import java.lang.reflect.Method;
+import java.util.ArrayList;
+
+public class Main {
+ public static void main(String[] args) throws Exception {
+ try {
+ System.loadLibrary(args[0]);
+ } catch (UnsatisfiedLinkError ule) {
+ usingRI = true;
+ // Add expected JNI_OnLoad log line to match expected.txt.
+ System.out.println("JNI_OnLoad called");
+ }
+
+ testClearDexCache();
+ testMultiDex();
+ testRacyLoader();
+ testRacyLoader2();
+ testMisbehavingLoader();
+ testRacyMisbehavingLoader();
+ testRacyMisbehavingLoader2();
+ }
+
+ private static void testClearDexCache() throws Exception {
+ DelegatingLoader delegating_loader = createDelegatingLoader();
+ Class<?> helper = delegating_loader.loadClass("Helper1");
+
+ WeakReference<Class<?>> weak_test1 = wrapHelperGet(helper);
+ changeInner(delegating_loader);
+ clearResolvedTypes(helper);
+ Runtime.getRuntime().gc();
+ WeakReference<Class<?>> weak_test2 = wrapHelperGet(helper);
+ Runtime.getRuntime().gc();
+
+ Class<?> test1 = weak_test1.get();
+ if (test1 == null) {
+ System.out.println("test1 disappeared");
+ }
+ Class<?> test2 = weak_test2.get();
+ if (test2 == null) {
+ System.out.println("test2 disappeared");
+ }
+ if (test1 != test2) {
+ System.out.println("test1 != test2");
+ }
+
+ System.out.println("testClearDexCache done");
+ }
+
+ private static void testMultiDex() throws Exception {
+ DelegatingLoader delegating_loader = createDelegatingLoader();
+
+ Class<?> helper1 = delegating_loader.loadClass("Helper1");
+ WeakReference<Class<?>> weak_test1 = wrapHelperGet(helper1);
+
+ changeInner(delegating_loader);
+
+ Class<?> helper2 = delegating_loader.loadClass("Helper2");
+ WeakReference<Class<?>> weak_test2 = wrapHelperGet(helper2);
+
+ Runtime.getRuntime().gc();
+
+ Class<?> test1 = weak_test1.get();
+ if (test1 == null) {
+ System.out.println("test1 disappeared");
+ }
+ Class<?> test2 = weak_test2.get();
+ if (test2 == null) {
+ System.out.println("test2 disappeared");
+ }
+ if (test1 != test2) {
+ System.out.println("test1 != test2");
+ }
+
+ System.out.println("testMultiDex done");
+ }
+
+ private static void testMisbehavingLoader() throws Exception {
+ ClassLoader system_loader = ClassLoader.getSystemClassLoader();
+ DefiningLoader defining_loader = new DefiningLoader(system_loader);
+ MisbehavingLoader misbehaving_loader =
+ new MisbehavingLoader(system_loader, defining_loader);
+ Class<?> helper = misbehaving_loader.loadClass("Helper1");
+
+ try {
+ WeakReference<Class<?>> weak_test = wrapHelperGet(helper);
+ } catch (InvocationTargetException ite) {
+ String message = ite.getCause().getMessage();
+ if (usingRI && "Test".equals(message)) {
+ // Replace RI message with dalvik message to match expected.txt.
+ message = "Initiating class loader of type " +
+ misbehaving_loader.getClass().getName() +
+ " returned class Helper2 instead of Test.";
+ }
+ System.out.println(ite.getCause().getClass().getName() + ": " + message);
+ }
+ System.out.println("testMisbehavingLoader done");
+ }
+
+ private static void testRacyLoader() throws Exception {
+ final ClassLoader system_loader = ClassLoader.getSystemClassLoader();
+
+ final Thread[] threads = new Thread[4];
+ final Object[] results = new Object[threads.length];
+
+ final RacyLoader racy_loader = new RacyLoader(system_loader, threads.length);
+ final Class<?> helper1 = racy_loader.loadClass("Helper1");
+ skipVerification(helper1); // Avoid class loading during verification.
+
+ for (int i = 0; i != threads.length; ++i) {
+ final int my_index = i;
+ Thread t = new Thread() {
+ public void run() {
+ try {
+ Method get = helper1.getDeclaredMethod("get");
+ results[my_index] = get.invoke(null);
+ } catch (InvocationTargetException ite) {
+ results[my_index] = ite.getCause();
+ } catch (Throwable t) {
+ results[my_index] = t;
+ }
+ }
+ };
+ t.start();
+ threads[i] = t;
+ }
+ for (Thread t : threads) {
+ t.join();
+ }
+ dumpResultStats(results, 1);
+ System.out.println("testRacyLoader done");
+ }
+
+ private static void testRacyLoader2() throws Exception {
+ final ClassLoader system_loader = ClassLoader.getSystemClassLoader();
+
+ final Thread[] threads = new Thread[4];
+ final Object[] results = new Object[threads.length];
+
+ final RacyLoader racy_loader = new RacyLoader(system_loader, threads.length);
+ final Class<?> helper1 = racy_loader.loadClass("Helper1");
+ skipVerification(helper1); // Avoid class loading during verification.
+ final Class<?> helper3 = racy_loader.loadClass("Helper3");
+ skipVerification(helper3); // Avoid class loading during verification.
+
+ for (int i = 0; i != threads.length; ++i) {
+ final int my_index = i;
+ Thread t = new Thread() {
+ public void run() {
+ try {
+ Class<?> helper = (my_index < threads.length / 2) ? helper1 : helper3;
+ Method get = helper.getDeclaredMethod("get");
+ results[my_index] = get.invoke(null);
+ } catch (InvocationTargetException ite) {
+ results[my_index] = ite.getCause();
+ } catch (Throwable t) {
+ results[my_index] = t;
+ }
+ }
+ };
+ t.start();
+ threads[i] = t;
+ }
+ for (Thread t : threads) {
+ t.join();
+ }
+ dumpResultStats(results, 2);
+ System.out.println("testRacyLoader2 done");
+ }
+
+ private static void testRacyMisbehavingLoader() throws Exception {
+ final ClassLoader system_loader = ClassLoader.getSystemClassLoader();
+
+ final Thread[] threads = new Thread[4];
+ final Object[] results = new Object[threads.length];
+
+ final RacyMisbehavingLoader racy_loader =
+ new RacyMisbehavingLoader(system_loader, threads.length, false);
+ final Class<?> helper1 = racy_loader.loadClass("RacyMisbehavingHelper");
+ skipVerification(helper1); // Avoid class loading during verification.
+
+ for (int i = 0; i != threads.length; ++i) {
+ final int my_index = i;
+ Thread t = new Thread() {
+ public void run() {
+ try {
+ Method get = helper1.getDeclaredMethod("get");
+ results[my_index] = get.invoke(null);
+ } catch (InvocationTargetException ite) {
+ results[my_index] = ite.getCause();
+ } catch (Throwable t) {
+ results[my_index] = t;
+ }
+ }
+ };
+ t.start();
+ threads[i] = t;
+ }
+ for (Thread t : threads) {
+ t.join();
+ }
+ dumpResultStats(results, 1);
+ System.out.println("testRacyMisbehavingLoader done");
+ }
+
+ private static void testRacyMisbehavingLoader2() throws Exception {
+ final ClassLoader system_loader = ClassLoader.getSystemClassLoader();
+
+ final Thread[] threads = new Thread[4];
+ final Object[] results = new Object[threads.length];
+
+ final RacyMisbehavingLoader racy_loader =
+ new RacyMisbehavingLoader(system_loader, threads.length, true);
+ final Class<?> helper1 = racy_loader.loadClass("RacyMisbehavingHelper");
+ skipVerification(helper1); // Avoid class loading during verification.
+
+ for (int i = 0; i != threads.length; ++i) {
+ final int my_index = i;
+ Thread t = new Thread() {
+ public void run() {
+ try {
+ Method get = helper1.getDeclaredMethod("get");
+ results[my_index] = get.invoke(null);
+ } catch (InvocationTargetException ite) {
+ results[my_index] = ite.getCause();
+ } catch (Throwable t) {
+ results[my_index] = t;
+ }
+ }
+ };
+ t.start();
+ threads[i] = t;
+ }
+ for (Thread t : threads) {
+ t.join();
+ }
+ dumpResultStats(results, 1);
+ System.out.println("testRacyMisbehavingLoader2 done");
+ }
+
+ private static void dumpResultStats(Object[] results, int expected_unique) throws Exception {
+ int throwables = 0;
+ int classes = 0;
+ int unique_classes = 0;
+ for (int i = 0; i != results.length; ++i) {
+ Object r = results[i];
+ if (r instanceof Throwable) {
+ ++throwables;
+ System.out.println(((Throwable) r).getMessage());
+ } else if (isClassPair(r)) {
+ printPair(r);
+ Object ref = getSecond(r);
+ ++classes;
+ ++unique_classes;
+ for (int j = 0; j != i; ++j) {
+ Object rj = results[j];
+ if (isClassPair(results[j]) && getSecond(results[j]) == ref) {
+ --unique_classes;
+ break;
+ }
+ }
+ }
+ }
+ System.out.println("total: " + results.length);
+ System.out.println(" throwables: " + throwables);
+ System.out.println(" classes: " + classes
+ + " (" + unique_classes + " unique)");
+ if (expected_unique != unique_classes) {
+ System.out.println("MISMATCH with expected_unique: " + expected_unique);
+ ArrayList<Class<?>> list = new ArrayList<Class<?>>();
+ for (int i = 0; i != results.length; ++i) {
+ Object r = results[i];
+ if (isClassPair(r)) {
+ list.add(getSecond(r));
+ }
+ }
+ nativeDumpClasses(list.toArray());
+ }
+ }
+
+ private static DelegatingLoader createDelegatingLoader() {
+ ClassLoader system_loader = ClassLoader.getSystemClassLoader();
+ DefiningLoader defining_loader = new DefiningLoader(system_loader);
+ return new DelegatingLoader(system_loader, defining_loader);
+ }
+
+ private static void changeInner(DelegatingLoader delegating_loader) {
+ ClassLoader system_loader = ClassLoader.getSystemClassLoader();
+ DefiningLoader defining_loader = new DefiningLoader(system_loader);
+ delegating_loader.resetDefiningLoader(defining_loader);
+ }
+
+ private static WeakReference<Class<?>> wrapHelperGet(Class<?> helper) throws Exception {
+ Method get = helper.getDeclaredMethod("get");
+ Object pair = get.invoke(null);
+ printPair(pair);
+ return new WeakReference<Class<?>>(getSecond(pair));
+ }
+
+ private static void printPair(Object pair) throws Exception {
+ Method print = pair.getClass().getDeclaredMethod("print");
+ print.invoke(pair);
+ }
+
+ private static Class<?> getSecond(Object pair) throws Exception {
+ Field second = pair.getClass().getDeclaredField("second");
+ return (Class<?>) second.get(pair);
+ }
+
+ private static boolean isClassPair(Object r) {
+ return r != null && r.getClass().getName().equals("ClassPair");
+ }
+
+ public static void clearResolvedTypes(Class<?> c) {
+ if (!usingRI) {
+ nativeClearResolvedTypes(c);
+ }
+ }
+
+ // Skip verification of a class on ART. Verification can cause classes to be loaded
+ // while holding a lock on the class being verified and holding that lock can interfere
+ // with the intent of the "racy" tests. In these tests we're waiting in the loadClass()
+ // for all the tested threads to synchronize and they cannot reach that point if they
+ // are waiting for the class lock on ClassLinker::InitializeClass(Helper1/Helper3).
+ public static void skipVerification(Class<?> c) {
+ if (!usingRI) {
+ nativeSkipVerification(c);
+ }
+ }
+
+ public static native void nativeClearResolvedTypes(Class<?> c);
+ public static native void nativeSkipVerification(Class<?> c);
+ public static native void nativeDumpClasses(Object[] array);
+
+ static boolean usingRI = false;
+}
diff --git a/test/626-const-class-linking/src/MisbehavingLoader.java b/test/626-const-class-linking/src/MisbehavingLoader.java
new file mode 100644
index 0000000..ca9783e
--- /dev/null
+++ b/test/626-const-class-linking/src/MisbehavingLoader.java
@@ -0,0 +1,47 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+// Class loader that returns Helper2.class when asked to load "Test".
+public class MisbehavingLoader extends DefiningLoader {
+ private DefiningLoader defining_loader;
+
+ public MisbehavingLoader(ClassLoader parent, DefiningLoader defining_loader) {
+ super(parent);
+ this.defining_loader = defining_loader;
+ }
+
+ protected Class<?> findClass(String name) throws ClassNotFoundException
+ {
+ if (name.equals("Helper1") || name.equals("Helper2")) {
+ return super.findClass(name);
+ } else if (name.equals("Test")) {
+ throw new Error("Unexpected MisbehavingLoader.findClass(\"Test\")");
+ }
+ return super.findClass(name);
+ }
+
+ protected Class<?> loadClass(String name, boolean resolve)
+ throws ClassNotFoundException
+ {
+ if (name.equals("Helper1") || name.equals("Helper2")) {
+ return super.loadClass(name, resolve);
+ } else if (name.equals("Test")) {
+ // Ask for a different class.
+ return defining_loader.loadClass("Helper2", resolve);
+ }
+ return super.loadClass(name, resolve);
+ }
+}
diff --git a/test/626-const-class-linking/src/RacyLoader.java b/test/626-const-class-linking/src/RacyLoader.java
new file mode 100644
index 0000000..9c164a3
--- /dev/null
+++ b/test/626-const-class-linking/src/RacyLoader.java
@@ -0,0 +1,78 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class RacyLoader extends DefiningLoader {
+ static {
+ // For JVM, register as parallel capable.
+ // Android treats all class loaders as parallel capable and makes this a no-op.
+ registerAsParallelCapable();
+ }
+
+ private Object lock = new Object();
+ private int index = 0;
+ private int count;
+
+ private DefiningLoader[] defining_loaders;
+
+ public RacyLoader(ClassLoader parent, int count) {
+ super(parent);
+ this.count = count;
+ defining_loaders = new DefiningLoader[2];
+ for (int i = 0; i != defining_loaders.length; ++i) {
+ defining_loaders[i] = new DefiningLoader(parent);
+ }
+ }
+
+ protected Class<?> findClass(String name) throws ClassNotFoundException
+ {
+ if (name.equals("Test") || name.equals("Test3")) {
+ throw new Error("Unexpected RacyLoader.findClass(\"" + name + "\")");
+ }
+ return super.findClass(name);
+ }
+
+ protected Class<?> loadClass(String name, boolean resolve)
+ throws ClassNotFoundException
+ {
+ if (name.equals("Test") || name.equals("Test3")) {
+ int my_index = syncWithOtherInstances(count);
+ Class<?> result = defining_loaders[my_index & 1].loadClass(name, resolve);
+ syncWithOtherInstances(2 * count);
+ return result;
+ }
+ return super.loadClass(name, resolve);
+ }
+
+ private int syncWithOtherInstances(int limit) {
+ int my_index;
+ synchronized (lock) {
+ my_index = index;
+ ++index;
+ if (index != limit) {
+ do {
+ try {
+ lock.wait();
+ } catch (InterruptedException ie) {
+ throw new Error(ie);
+ }
+ } while (index < limit);
+ } else {
+ lock.notifyAll();
+ }
+ }
+ return my_index;
+ }
+}
diff --git a/test/626-const-class-linking/src/RacyMisbehavingHelper.java b/test/626-const-class-linking/src/RacyMisbehavingHelper.java
new file mode 100644
index 0000000..4525278
--- /dev/null
+++ b/test/626-const-class-linking/src/RacyMisbehavingHelper.java
@@ -0,0 +1,33 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.reflect.Method;
+
+public class RacyMisbehavingHelper {
+ public static ClassPair get() {
+ Class<?> helper1_class = Helper1.class;
+ Class<?> test_class = Test.class;
+ try {
+ // After loading the correct class, allow loading the incorrect class.
+ ClassLoader loader = helper1_class.getClassLoader();
+ Method reportAfterLoading = loader.getClass().getDeclaredMethod("reportAfterLoading");
+ reportAfterLoading.invoke(loader);
+ } catch (Throwable t) {
+ t.printStackTrace();
+ }
+ return new ClassPair(helper1_class, test_class);
+ }
+}
diff --git a/test/626-const-class-linking/src/RacyMisbehavingLoader.java b/test/626-const-class-linking/src/RacyMisbehavingLoader.java
new file mode 100644
index 0000000..f5bcb4c
--- /dev/null
+++ b/test/626-const-class-linking/src/RacyMisbehavingLoader.java
@@ -0,0 +1,99 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class RacyMisbehavingLoader extends DefiningLoader {
+ static {
+ // For JVM, register as parallel capable.
+ // Android treats all class loaders as parallel capable and makes this a no-op.
+ registerAsParallelCapable();
+ }
+
+ private Object lock = new Object();
+ private int index = 0;
+ private int count;
+ private boolean throw_error;
+
+ private DefiningLoader[] defining_loaders;
+
+ public RacyMisbehavingLoader(ClassLoader parent, int count, boolean throw_error) {
+ super(parent);
+ this.count = count;
+ this.throw_error = throw_error;
+ defining_loaders = new DefiningLoader[2];
+ for (int i = 0; i != defining_loaders.length; ++i) {
+ defining_loaders[i] = new DefiningLoader(parent);
+ }
+ }
+
+ public void reportAfterLoading() {
+ synchronized (lock) {
+ ++index;
+ if (index == 2 * count) {
+ lock.notifyAll();
+ }
+ }
+ }
+
+ protected Class<?> findClass(String name) throws ClassNotFoundException
+ {
+ if (name.equals("Test")) {
+ throw new Error("Unexpected RacyLoader.findClass(\"" + name + "\")");
+ }
+ return super.findClass(name);
+ }
+
+ protected Class<?> loadClass(String name, boolean resolve)
+ throws ClassNotFoundException
+ {
+ if (name.equals("Test")) {
+ int my_index = syncWithOtherInstances(count);
+ Class<?> result;
+ if ((my_index & 1) == 0) {
+ // Do not delay loading the correct class.
+ result = defining_loaders[my_index & 1].loadClass(name, resolve);
+ } else {
+ // Delay loading the wrong class.
+ syncWithOtherInstances(2 * count);
+ if (throw_error) {
+ throw new Error("RacyMisbehavingLoader throw_error=true");
+ }
+ result = defining_loaders[my_index & 1].loadClass("Test3", resolve);
+ }
+ return result;
+ }
+ return super.loadClass(name, resolve);
+ }
+
+ private int syncWithOtherInstances(int limit) {
+ int my_index;
+ synchronized (lock) {
+ my_index = index;
+ ++index;
+ if (index != limit) {
+ do {
+ try {
+ lock.wait();
+ } catch (InterruptedException ie) {
+ throw new Error(ie);
+ }
+ } while (index < limit);
+ } else {
+ lock.notifyAll();
+ }
+ }
+ return my_index;
+ }
+}
diff --git a/test/626-set-resolved-string/expected.txt b/test/626-set-resolved-string/expected.txt
new file mode 100644
index 0000000..f4983b5
--- /dev/null
+++ b/test/626-set-resolved-string/expected.txt
@@ -0,0 +1,2 @@
+JNI_OnLoad called
+foo
diff --git a/test/626-set-resolved-string/info.txt b/test/626-set-resolved-string/info.txt
new file mode 100644
index 0000000..e3a512f
--- /dev/null
+++ b/test/626-set-resolved-string/info.txt
@@ -0,0 +1,3 @@
+Test that even if Java code calls DexCache.setResolvedString and does
+not strongly intern the given string, the JIT will ensure that the
+strings it references are strongly interned.
diff --git a/test/626-set-resolved-string/src/Main.java b/test/626-set-resolved-string/src/Main.java
new file mode 100644
index 0000000..868b9d1
--- /dev/null
+++ b/test/626-set-resolved-string/src/Main.java
@@ -0,0 +1,48 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.reflect.Method;
+
+public class Main {
+ public static void main(String[] args) {
+ System.loadLibrary(args[0]);
+
+ // Get all methods. We cannot call getDeclaredMethod("foo") as
+ // that would make "foo" a strong root.
+ Method[] methods = Main.class.getDeclaredMethods();
+
+ // Call getName on the methods, which is implemented by using the dex
+ // cache and calling setResolvedString.
+ for (int i = 0; i < methods.length; i++) {
+ methods[i].getName();
+ }
+
+ // Compile Main.foo. "foo" needs to be a strong root for JIT compilation.
+ // We stress test this:
+ // - avoid strongly interning "foo" by doing "f" + "oo"
+ // - call GC so that weaks can be collected.
+ // - invoke foo() to make sure "foo" hasn't been collected.
+ ensureJitCompiled(Main.class, "f" + "oo");
+ Runtime.getRuntime().gc();
+ foo();
+ }
+
+ public static void foo() {
+ System.out.println("foo");
+ }
+
+ public static native void ensureJitCompiled(Class cls, String method_name);
+}
diff --git a/test/628-vdex/expected.txt b/test/628-vdex/expected.txt
new file mode 100644
index 0000000..d0f61f6
--- /dev/null
+++ b/test/628-vdex/expected.txt
@@ -0,0 +1,2 @@
+In foo
+In foo
diff --git a/test/628-vdex/info.txt b/test/628-vdex/info.txt
new file mode 100644
index 0000000..e69de29
--- /dev/null
+++ b/test/628-vdex/info.txt
diff --git a/test/103-string-append/run b/test/628-vdex/run
old mode 100755
new mode 100644
similarity index 77%
rename from test/103-string-append/run
rename to test/628-vdex/run
index e27a622..f1b0a95
--- a/test/103-string-append/run
+++ b/test/628-vdex/run
@@ -1,6 +1,6 @@
#!/bin/bash
#
-# Copyright (C) 2012 The Android Open Source Project
+# Copyright (C) 2016 The Android Open Source Project
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
@@ -14,5 +14,4 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# As this is a performance test we always use the non-debug build.
-exec ${RUN} "${@/#libartd.so/libart.so}"
+exec ${RUN} --vdex "${@}"
diff --git a/test/902-hello-transformation/transform.h b/test/628-vdex/src/Main.java
similarity index 61%
copy from test/902-hello-transformation/transform.h
copy to test/628-vdex/src/Main.java
index 661058d..7ceab2c 100644
--- a/test/902-hello-transformation/transform.h
+++ b/test/628-vdex/src/Main.java
@@ -14,17 +14,24 @@
* limitations under the License.
*/
-#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
+public class Main {
+ Main() {
+ // Will be quickened with RETURN_VOID_NO_BARRIER.
+ }
-#include <jni.h>
+ public static void main(String[] args) {
+ Main m = new Main();
+ Object o = m;
+ // The call and field accesses will be quickened.
+ m.foo(m.a);
-namespace art {
-namespace Test902HelloTransformation {
+ // The checkcast will be quickened.
+ m.foo(((Main)o).a);
+ }
-jint OnLoad(JavaVM* vm, char* options, void* reserved);
+ int a;
+ void foo(int a) {
+ System.out.println("In foo");
+ }
+}
-} // namespace Test902HelloTransformation
-} // namespace art
-
-#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
diff --git a/test/629-vdex-speed/expected.txt b/test/629-vdex-speed/expected.txt
new file mode 100644
index 0000000..6a5618e
--- /dev/null
+++ b/test/629-vdex-speed/expected.txt
@@ -0,0 +1 @@
+JNI_OnLoad called
diff --git a/test/629-vdex-speed/info.txt b/test/629-vdex-speed/info.txt
new file mode 100644
index 0000000..6d84cb5
--- /dev/null
+++ b/test/629-vdex-speed/info.txt
@@ -0,0 +1,2 @@
+Regression test for vdex that used to not AOT compile
+methods when the VerifierDeps were verified.
diff --git a/test/103-string-append/run b/test/629-vdex-speed/run
old mode 100755
new mode 100644
similarity index 77%
copy from test/103-string-append/run
copy to test/629-vdex-speed/run
index e27a622..f1b0a95
--- a/test/103-string-append/run
+++ b/test/629-vdex-speed/run
@@ -1,6 +1,6 @@
#!/bin/bash
#
-# Copyright (C) 2012 The Android Open Source Project
+# Copyright (C) 2016 The Android Open Source Project
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
@@ -14,5 +14,4 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# As this is a performance test we always use the non-debug build.
-exec ${RUN} "${@/#libartd.so/libart.so}"
+exec ${RUN} --vdex "${@}"
diff --git a/test/902-hello-transformation/transform.h b/test/629-vdex-speed/src/Main.java
similarity index 62%
copy from test/902-hello-transformation/transform.h
copy to test/629-vdex-speed/src/Main.java
index 661058d..470565a 100644
--- a/test/902-hello-transformation/transform.h
+++ b/test/629-vdex-speed/src/Main.java
@@ -14,17 +14,14 @@
* limitations under the License.
*/
-#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
+public class Main {
+ public static void main(String[] args) {
+ System.loadLibrary(args[0]);
+ if (!isAotCompiled(Main.class, "main")) {
+ throw new Error("Expected Main.main to be AOT compiled");
+ }
+ }
-#include <jni.h>
+ private native static boolean isAotCompiled(Class<?> cls, String methodName);
+}
-namespace art {
-namespace Test902HelloTransformation {
-
-jint OnLoad(JavaVM* vm, char* options, void* reserved);
-
-} // namespace Test902HelloTransformation
-} // namespace art
-
-#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
diff --git a/test/630-safecast-array/expected.txt b/test/630-safecast-array/expected.txt
new file mode 100644
index 0000000..e69de29
--- /dev/null
+++ b/test/630-safecast-array/expected.txt
diff --git a/test/630-safecast-array/info.txt b/test/630-safecast-array/info.txt
new file mode 100644
index 0000000..e105167
--- /dev/null
+++ b/test/630-safecast-array/info.txt
@@ -0,0 +1,3 @@
+Regression test for vdex, which used to crash in AddAssignability
+called by the dex2dex compiler, not anticipating arrays of primitive
+type.
diff --git a/test/630-safecast-array/smali/Main.smali b/test/630-safecast-array/smali/Main.smali
new file mode 100644
index 0000000..a50f37c
--- /dev/null
+++ b/test/630-safecast-array/smali/Main.smali
@@ -0,0 +1,33 @@
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.class LMain;
+.super Ljava/lang/Object;
+
+.method public static main([Ljava/lang/String;)V
+.registers 1
+ return-void
+.end method
+
+.method public static testPrimitiveDestination([Ljava/lang/String;)V
+.registers 1
+ check-cast p0, [B
+ return-void
+.end method
+
+.method public static testPrimitiveSource([B)V
+.registers 1
+ check-cast p0, [Ljava/lang/String;
+ return-void
+.end method
diff --git a/test/902-hello-transformation/expected.txt b/test/902-hello-transformation/expected.txt
index a826f93..4774b81 100644
--- a/test/902-hello-transformation/expected.txt
+++ b/test/902-hello-transformation/expected.txt
@@ -1,3 +1,2 @@
hello
-modifying class 'Transform'
Goodbye
diff --git a/test/902-hello-transformation/run b/test/902-hello-transformation/run
index 3755d1d..94a8b2d 100755
--- a/test/902-hello-transformation/run
+++ b/test/902-hello-transformation/run
@@ -27,12 +27,11 @@
arg="jvm"
else
arg="art"
-fi
-
-if [[ "$@" != *"--debuggable"* ]]; then
- other_args=" -Xcompiler-option --debuggable "
-else
- other_args=""
+ if [[ "$@" != *"--debuggable"* ]]; then
+ other_args=" -Xcompiler-option --debuggable "
+ else
+ other_args=""
+ fi
fi
./default-run "$@" --experimental agents \
diff --git a/test/902-hello-transformation/src/Main.java b/test/902-hello-transformation/src/Main.java
index 204b6e7..ec47119 100644
--- a/test/902-hello-transformation/src/Main.java
+++ b/test/902-hello-transformation/src/Main.java
@@ -14,7 +14,40 @@
* limitations under the License.
*/
+import java.util.Base64;
public class Main {
+
+ /**
+ * base64 encoded class/dex file for
+ * class Transform {
+ * public void sayHi() {
+ * System.out.println("Goodbye");
+ * }
+ * }
+ */
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+ "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+ "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+ "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+ "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+ "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+ "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+ "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+ "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+ "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+ "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+ "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+ "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+ "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+ "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+ "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+ "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+ "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+ "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
public static void main(String[] args) {
System.loadLibrary(args[1]);
doTest(new Transform());
@@ -22,10 +55,12 @@
public static void doTest(Transform t) {
t.sayHi();
- doClassTransformation(Transform.class);
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
t.sayHi();
}
// Transforms the class
- private static native void doClassTransformation(Class target);
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] class_file,
+ byte[] dex_file);
}
diff --git a/test/902-hello-transformation/transform.cc b/test/902-hello-transformation/transform.cc
deleted file mode 100644
index 3369dd4..0000000
--- a/test/902-hello-transformation/transform.cc
+++ /dev/null
@@ -1,153 +0,0 @@
-/*
- * Copyright (C) 2013 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-#include <iostream>
-#include <pthread.h>
-#include <stdio.h>
-#include <vector>
-
-#include "art_method-inl.h"
-#include "base/logging.h"
-#include "jni.h"
-#include "openjdkjvmti/jvmti.h"
-#include "ti-agent/common_helper.h"
-#include "ti-agent/common_load.h"
-#include "utils.h"
-
-namespace art {
-namespace Test902HelloTransformation {
-
-static bool RuntimeIsJvm = false;
-
-bool IsJVM() {
- return RuntimeIsJvm;
-}
-
-// base64 encoded class/dex file for
-//
-// class Transform {
-// public void sayHi() {
-// System.out.println("Goodbye");
-// }
-// }
-const char* class_file_base64 =
- "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB"
- "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA"
- "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq"
- "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph"
- "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG"
- "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB"
- "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=";
-
-const char* dex_file_base64 =
- "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO"
- "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB"
- "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA"
- "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA"
- "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA"
- "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA"
- "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50"
- "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh"
- "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291"
- "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA"
- "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA"
- "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA"
- "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=";
-
-static void JNICALL transformationHook(jvmtiEnv *jvmtienv,
- JNIEnv* jni_env ATTRIBUTE_UNUSED,
- jclass class_being_redefined ATTRIBUTE_UNUSED,
- jobject loader ATTRIBUTE_UNUSED,
- const char* name,
- jobject protection_domain ATTRIBUTE_UNUSED,
- jint class_data_len ATTRIBUTE_UNUSED,
- const unsigned char* class_data ATTRIBUTE_UNUSED,
- jint* new_class_data_len,
- unsigned char** new_class_data) {
- if (strcmp("Transform", name)) {
- return;
- }
- printf("modifying class '%s'\n", name);
- bool is_jvm = IsJVM();
- size_t decode_len = 0;
- unsigned char* new_data;
- std::unique_ptr<uint8_t[]> file_data(
- DecodeBase64((is_jvm) ? class_file_base64 : dex_file_base64, &decode_len));
- jvmtiError ret = JVMTI_ERROR_NONE;
- if ((ret = jvmtienv->Allocate(static_cast<jlong>(decode_len), &new_data)) != JVMTI_ERROR_NONE) {
- printf("Unable to allocate buffer!\n");
- return;
- }
- memcpy(new_data, file_data.get(), decode_len);
- *new_class_data_len = static_cast<jint>(decode_len);
- *new_class_data = new_data;
- return;
-}
-
-using RetransformWithHookFunction = jvmtiError (*)(jvmtiEnv*, jclass, jvmtiEventClassFileLoadHook);
-static void DoClassTransformation(jvmtiEnv* jvmtienv, JNIEnv* jnienv, jclass target) {
- if (IsJVM()) {
- UNUSED(jnienv);
- jvmtienv->SetEventNotificationMode(JVMTI_ENABLE, JVMTI_EVENT_CLASS_FILE_LOAD_HOOK, nullptr);
- jvmtiError ret = jvmtienv->RetransformClasses(1, &target);
- if (ret != JVMTI_ERROR_NONE) {
- char* err;
- jvmtienv->GetErrorName(ret, &err);
- printf("Error transforming: %s\n", err);
- }
- } else {
- RetransformWithHookFunction f =
- reinterpret_cast<RetransformWithHookFunction>(jvmtienv->functions->reserved1);
- if (f(jvmtienv, target, transformationHook) != JVMTI_ERROR_NONE) {
- printf("Failed to tranform class!");
- return;
- }
- }
-}
-
-extern "C" JNIEXPORT void JNICALL Java_Main_doClassTransformation(JNIEnv* env,
- jclass,
- jclass target) {
- JavaVM* vm;
- if (env->GetJavaVM(&vm)) {
- printf("Unable to get javaVM!\n");
- return;
- }
- DoClassTransformation(jvmti_env, env, target);
-}
-
-// Don't do anything
-jint OnLoad(JavaVM* vm,
- char* options,
- void* reserved ATTRIBUTE_UNUSED) {
- RuntimeIsJvm = (strcmp("jvm", options) == 0);
- if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
- printf("Unable to get jvmti env!\n");
- return 1;
- }
- SetAllCapabilities(jvmti_env);
- if (IsJVM()) {
- jvmtiEventCallbacks cbs;
- memset(&cbs, 0, sizeof(cbs));
- cbs.ClassFileLoadHook = transformationHook;
- jvmti_env->SetEventCallbacks(&cbs, sizeof(jvmtiEventCallbacks));
- }
- return 0;
-}
-
-} // namespace Test902HelloTransformation
-} // namespace art
-
diff --git a/test/910-methods/methods.cc b/test/910-methods/methods.cc
index 8f0850b..3ed91d7 100644
--- a/test/910-methods/methods.cc
+++ b/test/910-methods/methods.cc
@@ -66,6 +66,15 @@
jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(gen));
}
+ // Also run GetMethodName with all parameter pointers null to check for segfaults.
+ jvmtiError result2 = jvmti_env->GetMethodName(id, nullptr, nullptr, nullptr);
+ if (result2 != JVMTI_ERROR_NONE) {
+ char* err;
+ jvmti_env->GetErrorName(result2, &err);
+ printf("Failure running GetMethodName(null, null, null): %s\n", err);
+ return nullptr;
+ }
+
return ret;
}
diff --git a/test/911-get-stack-trace/expected.txt b/test/911-get-stack-trace/expected.txt
index 20bab78..f8c97ce 100644
--- a/test/911-get-stack-trace/expected.txt
+++ b/test/911-get-stack-trace/expected.txt
@@ -3,206 +3,206 @@
###################
From top
---------
- getStackTrace (Ljava/lang/Thread;II)[Ljava/lang/String;
- print (Ljava/lang/Thread;II)V
- printOrWait (IILMain$ControlData;)V
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- doTest ()V
- main ([Ljava/lang/String;)V
+ getStackTrace (Ljava/lang/Thread;II)[[Ljava/lang/String; -1 -2
+ print (Ljava/lang/Thread;II)V 0 124
+ printOrWait (IILMain$ControlData;)V 6 151
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 2 142
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ doTest ()V 38 34
+ main ([Ljava/lang/String;)V 6 24
---------
- print (Ljava/lang/Thread;II)V
- printOrWait (IILMain$ControlData;)V
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- doTest ()V
- main ([Ljava/lang/String;)V
+ print (Ljava/lang/Thread;II)V 0 124
+ printOrWait (IILMain$ControlData;)V 6 151
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 2 142
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ doTest ()V 42 35
+ main ([Ljava/lang/String;)V 6 24
---------
- getStackTrace (Ljava/lang/Thread;II)[Ljava/lang/String;
- print (Ljava/lang/Thread;II)V
- printOrWait (IILMain$ControlData;)V
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
+ getStackTrace (Ljava/lang/Thread;II)[[Ljava/lang/String; -1 -2
+ print (Ljava/lang/Thread;II)V 0 124
+ printOrWait (IILMain$ControlData;)V 6 151
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 2 142
+ bar (IIILMain$ControlData;)J 0 136
---------
- printOrWait (IILMain$ControlData;)V
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
+ printOrWait (IILMain$ControlData;)V 6 151
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 2 142
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
From bottom
---------
- main ([Ljava/lang/String;)V
+ main ([Ljava/lang/String;)V 6 24
---------
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- doTest ()V
- main ([Ljava/lang/String;)V
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ doTest ()V 65 41
+ main ([Ljava/lang/String;)V 6 24
---------
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
################################
### Other thread (suspended) ###
################################
From top
---------
- wait ()V
- printOrWait (IILMain$ControlData;)V
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- run ()V
+ wait ()V -1 -2
+ printOrWait (IILMain$ControlData;)V 24 157
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 2 142
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ run ()V 4 54
---------
- printOrWait (IILMain$ControlData;)V
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- run ()V
+ printOrWait (IILMain$ControlData;)V 24 157
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 2 142
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ run ()V 4 54
---------
- wait ()V
- printOrWait (IILMain$ControlData;)V
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
+ wait ()V -1 -2
+ printOrWait (IILMain$ControlData;)V 24 157
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 2 142
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
---------
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 2 142
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
From bottom
---------
- run ()V
+ run ()V 4 54
---------
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- run ()V
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ run ()V 4 54
---------
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
###########################
### Other thread (live) ###
###########################
From top
---------
- printOrWait (IILMain$ControlData;)V
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- run ()V
+ printOrWait (IILMain$ControlData;)V 44 164
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 2 142
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ run ()V 4 88
---------
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- run ()V
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 2 142
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ run ()V 4 88
---------
- printOrWait (IILMain$ControlData;)V
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
+ printOrWait (IILMain$ControlData;)V 44 164
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 2 142
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
---------
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
From bottom
---------
- run ()V
+ run ()V 4 88
---------
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- run ()V
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ run ()V 4 88
---------
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
- foo (IIILMain$ControlData;)I
- baz (IIILMain$ControlData;)Ljava/lang/Object;
- bar (IIILMain$ControlData;)J
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
+ foo (IIILMain$ControlData;)I 0 131
+ baz (IIILMain$ControlData;)Ljava/lang/Object; 9 144
+ bar (IIILMain$ControlData;)J 0 136
diff --git a/test/911-get-stack-trace/src/Main.java b/test/911-get-stack-trace/src/Main.java
index df4501d..722bee8 100644
--- a/test/911-get-stack-trace/src/Main.java
+++ b/test/911-get-stack-trace/src/Main.java
@@ -109,13 +109,14 @@
t.join();
}
- public static void print(String[] stack) {
+ public static void print(String[][] stack) {
System.out.println("---------");
- for (int i = 0; i < stack.length; i += 2) {
- System.out.print(' ');
- System.out.print(stack[i]);
- System.out.print(' ');
- System.out.println(stack[i + 1]);
+ for (String[] stackElement : stack) {
+ for (String part : stackElement) {
+ System.out.print(' ');
+ System.out.print(part);
+ }
+ System.out.println();
}
}
@@ -174,5 +175,5 @@
volatile boolean stop = false;
}
- public static native String[] getStackTrace(Thread thread, int start, int max);
+ public static native String[][] getStackTrace(Thread thread, int start, int max);
}
diff --git a/test/911-get-stack-trace/stack_trace.cc b/test/911-get-stack-trace/stack_trace.cc
index e7d9380..57f6a92 100644
--- a/test/911-get-stack-trace/stack_trace.cc
+++ b/test/911-get-stack-trace/stack_trace.cc
@@ -16,10 +16,14 @@
#include "stack_trace.h"
+#include <inttypes.h>
#include <memory>
#include <stdio.h>
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
+#include "base/macros.h"
#include "jni.h"
#include "openjdkjvmti/jvmti.h"
#include "ScopedLocalRef.h"
@@ -29,6 +33,25 @@
namespace art {
namespace Test911GetStackTrace {
+using android::base::StringPrintf;
+
+static jint FindLineNumber(jint line_number_count,
+ jvmtiLineNumberEntry* line_number_table,
+ jlocation location) {
+ if (line_number_table == nullptr) {
+ return -2;
+ }
+
+ jint line_number = -1;
+ for (jint i = 0; i != line_number_count; ++i) {
+ if (line_number_table[i].start_location > location) {
+ return line_number;
+ }
+ line_number = line_number_table[i].line_number;
+ }
+ return line_number;
+}
+
extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getStackTrace(
JNIEnv* env, jclass klass ATTRIBUTE_UNUSED, jthread thread, jint start, jint max) {
std::unique_ptr<jvmtiFrameInfo[]> frames(new jvmtiFrameInfo[max]);
@@ -44,8 +67,7 @@
}
}
- auto callback = [&](jint i) -> jstring {
- size_t method_index = static_cast<size_t>(i) / 2;
+ auto callback = [&](jint method_index) -> jobjectArray {
char* name;
char* sig;
char* gen;
@@ -58,13 +80,47 @@
return nullptr;
}
}
- jstring callback_result;
- if (i % 2 == 0) {
- callback_result = name == nullptr ? nullptr : env->NewStringUTF(name);
- } else {
- callback_result = sig == nullptr ? nullptr : env->NewStringUTF(sig);
+
+ jint line_number_count;
+ jvmtiLineNumberEntry* line_number_table;
+ {
+ jvmtiError line_result = jvmti_env->GetLineNumberTable(frames[method_index].method,
+ &line_number_count,
+ &line_number_table);
+ if (line_result != JVMTI_ERROR_NONE) {
+ // Accept absent info and native method errors.
+ if (line_result != JVMTI_ERROR_ABSENT_INFORMATION &&
+ line_result != JVMTI_ERROR_NATIVE_METHOD) {
+ char* err;
+ jvmti_env->GetErrorName(line_result, &err);
+ printf("Failure running GetLineNumberTable: %s\n", err);
+ return nullptr;
+ }
+ line_number_table = nullptr;
+ line_number_count = 0;
+ }
}
+ auto inner_callback = [&](jint component_index) -> jstring {
+ switch (component_index) {
+ case 0:
+ return (name == nullptr) ? nullptr : env->NewStringUTF(name);
+ case 1:
+ return (sig == nullptr) ? nullptr : env->NewStringUTF(sig);
+ case 2:
+ return env->NewStringUTF(StringPrintf("%" PRId64, frames[method_index].location).c_str());
+ case 3: {
+ jint line_number = FindLineNumber(line_number_count,
+ line_number_table,
+ frames[method_index].location);
+ return env->NewStringUTF(StringPrintf("%d", line_number).c_str());
+ }
+ }
+ LOG(FATAL) << "Unreachable";
+ UNREACHABLE();
+ };
+ jobjectArray inner_array = CreateObjectArray(env, 4, "java/lang/String", inner_callback);
+
if (name != nullptr) {
jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(name));
}
@@ -74,9 +130,13 @@
if (gen != nullptr) {
jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(gen));
}
- return callback_result;
+ if (line_number_table != nullptr) {
+ jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(line_number_table));
+ }
+
+ return inner_array;
};
- return CreateObjectArray(env, 2 * count, "java/lang/String", callback);
+ return CreateObjectArray(env, count, "[Ljava/lang/String;", callback);
}
// Don't do anything
diff --git a/test/913-heaps/expected.txt b/test/913-heaps/expected.txt
index d1ddbae..7522a65 100644
--- a/test/913-heaps/expected.txt
+++ b/test/913-heaps/expected.txt
@@ -1,16 +1,16 @@
---
true true
-root@root --(stack-local)--> 1@1000 [size=16, length=-1]
-root@root --(stack-local)--> 3000@0 [size=132, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestNonRoot,vreg=11,location= 31])--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=3,method=doFollowReferencesTest,vreg=1,location= 28])--> 3000@0 [size=132, length=-1]
root@root --(thread)--> 3000@0 [size=132, length=-1]
0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
-1002@0 --(interface)--> 2001@0 [size=132, length=-1]
+1002@0 --(interface)--> 2001@0 [size=124, length=-1]
1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
1@1000 --(class)--> 1000@0 [size=123, length=-1]
1@1000 --(field@12)--> 3@1001 [size=24, length=-1]
1@1000 --(field@8)--> 2@1000 [size=16, length=-1]
-2001@0 --(interface)--> 2000@0 [size=132, length=-1]
+2001@0 --(interface)--> 2000@0 [size=124, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@16)--> 4@1000 [size=16, length=-1]
@@ -21,19 +21,13 @@
5@1002 --(field@28)--> 1@1000 [size=16, length=-1]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
-root@root --(stack-local)--> 1@1000 [size=16, length=-1]
-root@root --(stack-local)--> 2@1000 [size=16, length=-1]
-root@root --(stack-local)--> 3000@0 [size=132, length=-1]
-root@root --(thread)--> 2@1000 [size=16, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
-0@0 --(array-element@0)--> 1@1000 [size=16, length=-1]
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
-1002@0 --(interface)--> 2001@0 [size=132, length=-1]
+1002@0 --(interface)--> 2001@0 [size=124, length=-1]
1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
1@1000 --(class)--> 1000@0 [size=123, length=-1]
1@1000 --(field@12)--> 3@1001 [size=24, length=-1]
1@1000 --(field@8)--> 2@1000 [size=16, length=-1]
-2001@0 --(interface)--> 2000@0 [size=132, length=-1]
+2001@0 --(interface)--> 2000@0 [size=124, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@16)--> 4@1000 [size=16, length=-1]
@@ -45,17 +39,19 @@
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
root@root --(jni-global)--> 1@1000 [size=16, length=-1]
-root@root --(jni-local)--> 1@1000 [size=16, length=-1]
-root@root --(stack-local)--> 1@1000 [size=16, length=-1]
+root@root --(jni-local[id=1,tag=3000,depth=0,method=followReferences])--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=10,location= 6])--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=1,method=doFollowReferencesTestImpl,vreg=5,location= 6])--> 1@1000 [size=16, length=-1]
+root@root --(stack-local[id=1,tag=3000,depth=2,method=doFollowReferencesTestRoot,vreg=3,location= 18])--> 1@1000 [size=16, length=-1]
root@root --(thread)--> 1@1000 [size=16, length=-1]
root@root --(thread)--> 3000@0 [size=132, length=-1]
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
-1002@0 --(interface)--> 2001@0 [size=132, length=-1]
+1002@0 --(interface)--> 2001@0 [size=124, length=-1]
1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
1@1000 --(class)--> 1000@0 [size=123, length=-1]
1@1000 --(field@12)--> 3@1001 [size=24, length=-1]
1@1000 --(field@8)--> 2@1000 [size=16, length=-1]
-2001@0 --(interface)--> 2000@0 [size=132, length=-1]
+2001@0 --(interface)--> 2000@0 [size=124, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@16)--> 4@1000 [size=16, length=-1]
@@ -66,20 +62,13 @@
5@1002 --(field@28)--> 1@1000 [size=16, length=-1]
6@1000 --(class)--> 1000@0 [size=123, length=-1]
---
-root@root --(jni-global)--> 1@1000 [size=16, length=-1]
-root@root --(jni-local)--> 1@1000 [size=16, length=-1]
-root@root --(stack-local)--> 1@1000 [size=16, length=-1]
-root@root --(stack-local)--> 2@1000 [size=16, length=-1]
-root@root --(thread)--> 1@1000 [size=16, length=-1]
-root@root --(thread)--> 2@1000 [size=16, length=-1]
-root@root --(thread)--> 3000@0 [size=132, length=-1]
1001@0 --(superclass)--> 1000@0 [size=123, length=-1]
-1002@0 --(interface)--> 2001@0 [size=132, length=-1]
+1002@0 --(interface)--> 2001@0 [size=124, length=-1]
1002@0 --(superclass)--> 1001@0 [size=123, length=-1]
1@1000 --(class)--> 1000@0 [size=123, length=-1]
1@1000 --(field@12)--> 3@1001 [size=24, length=-1]
1@1000 --(field@8)--> 2@1000 [size=16, length=-1]
-2001@0 --(interface)--> 2000@0 [size=132, length=-1]
+2001@0 --(interface)--> 2000@0 [size=124, length=-1]
2@1000 --(class)--> 1000@0 [size=123, length=-1]
3@1001 --(class)--> 1001@0 [size=123, length=-1]
3@1001 --(field@16)--> 4@1000 [size=16, length=-1]
diff --git a/test/913-heaps/heaps.cc b/test/913-heaps/heaps.cc
index 871902e..49ab7dd 100644
--- a/test/913-heaps/heaps.cc
+++ b/test/913-heaps/heaps.cc
@@ -22,9 +22,10 @@
#include <vector>
+#include "android-base/stringprintf.h"
+
#include "base/logging.h"
#include "base/macros.h"
-#include "base/stringprintf.h"
#include "jit/jit.h"
#include "jni.h"
#include "native_stack_dump.h"
@@ -39,6 +40,8 @@
namespace art {
namespace Test913Heaps {
+using android::base::StringPrintf;
+
extern "C" JNIEXPORT void JNICALL Java_Main_forceGarbageCollection(JNIEnv* env ATTRIBUTE_UNUSED,
jclass klass ATTRIBUTE_UNUSED) {
jvmtiError ret = jvmti_env->ForceGarbageCollection();
@@ -180,7 +183,7 @@
if (*tag_ptr >= 1000) {
// This is a class or interface, the size of which will be dependent on the architecture.
// Do not print the size, but detect known values and "normalize" for the golden file.
- if ((sizeof(void*) == 4 && size == 180) || (sizeof(void*) == 8 && size == 232)) {
+ if ((sizeof(void*) == 4 && size == 172) || (sizeof(void*) == 8 && size == 224)) {
adapted_size = 123;
}
}
@@ -234,6 +237,78 @@
jint length_;
};
+ class JNILocalElement : public Elem {
+ public:
+ JNILocalElement(const std::string& referrer,
+ const std::string& referree,
+ jlong size,
+ jint length,
+ const jvmtiHeapReferenceInfo* reference_info)
+ : Elem(referrer, referree, size, length) {
+ memcpy(&info_, reference_info, sizeof(jvmtiHeapReferenceInfo));
+ }
+
+ protected:
+ std::string PrintArrowType() const OVERRIDE {
+ char* name = nullptr;
+ if (info_.jni_local.method != nullptr) {
+ jvmti_env->GetMethodName(info_.jni_local.method, &name, nullptr, nullptr);
+ }
+ std::string ret = StringPrintf("jni-local[id=%" PRId64 ",tag=%" PRId64 ",depth=%d,"
+ "method=%s]",
+ info_.jni_local.thread_id,
+ info_.jni_local.thread_tag,
+ info_.jni_local.depth,
+ name == nullptr ? "<null>" : name);
+ if (name != nullptr) {
+ jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(name));
+ }
+
+ return ret;
+ }
+
+ private:
+ const std::string string_;
+ jvmtiHeapReferenceInfo info_;
+ };
+
+ class StackLocalElement : public Elem {
+ public:
+ StackLocalElement(const std::string& referrer,
+ const std::string& referree,
+ jlong size,
+ jint length,
+ const jvmtiHeapReferenceInfo* reference_info)
+ : Elem(referrer, referree, size, length) {
+ memcpy(&info_, reference_info, sizeof(jvmtiHeapReferenceInfo));
+ }
+
+ protected:
+ std::string PrintArrowType() const OVERRIDE {
+ char* name = nullptr;
+ if (info_.stack_local.method != nullptr) {
+ jvmti_env->GetMethodName(info_.stack_local.method, &name, nullptr, nullptr);
+ }
+ std::string ret = StringPrintf("stack-local[id=%" PRId64 ",tag=%" PRId64 ",depth=%d,"
+ "method=%s,vreg=%d,location=% " PRId64 "]",
+ info_.stack_local.thread_id,
+ info_.stack_local.thread_tag,
+ info_.stack_local.depth,
+ name == nullptr ? "<null>" : name,
+ info_.stack_local.slot,
+ info_.stack_local.location);
+ if (name != nullptr) {
+ jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(name));
+ }
+
+ return ret;
+ }
+
+ private:
+ const std::string string_;
+ jvmtiHeapReferenceInfo info_;
+ };
+
// For simple or unimplemented cases.
class StringElement : public Elem {
public:
@@ -345,17 +420,17 @@
length,
"monitor"));
case JVMTI_HEAP_REFERENCE_STACK_LOCAL:
- return std::unique_ptr<Elem>(new StringElement(referrer,
- referree,
- size,
- length,
- "stack-local"));
+ return std::unique_ptr<Elem>(new StackLocalElement(referrer,
+ referree,
+ size,
+ length,
+ reference_info));
case JVMTI_HEAP_REFERENCE_JNI_LOCAL:
- return std::unique_ptr<Elem>(new StringElement(referrer,
- referree,
- size,
- length,
- "jni-local"));
+ return std::unique_ptr<Elem>(new JNILocalElement(referrer,
+ referree,
+ size,
+ length,
+ reference_info));
case JVMTI_HEAP_REFERENCE_THREAD:
return std::unique_ptr<Elem>(new StringElement(referrer,
referree,
diff --git a/test/913-heaps/src/Main.java b/test/913-heaps/src/Main.java
index a6ace9a..564596e 100644
--- a/test/913-heaps/src/Main.java
+++ b/test/913-heaps/src/Main.java
@@ -85,7 +85,7 @@
v.add("0@0", "1@1000"); // tmpStorage[0] --(array-element)--> a.
doFollowReferencesTestImpl(null, Integer.MAX_VALUE, -1, null, v, null);
- doFollowReferencesTestImpl(a.foo, Integer.MAX_VALUE, -1, null, v, "2@1000");
+ doFollowReferencesTestImpl(a.foo2, Integer.MAX_VALUE, -1, null, v, "3@1001");
tmpStorage.clear();
}
@@ -96,7 +96,7 @@
A a = createTree(v);
doFollowReferencesTestImpl(null, Integer.MAX_VALUE, -1, a, v, null);
- doFollowReferencesTestImpl(a.foo, Integer.MAX_VALUE, -1, a, v, "2@1000");
+ doFollowReferencesTestImpl(a.foo2, Integer.MAX_VALUE, -1, a, v, "3@1001");
}
private static void doFollowReferencesTestImpl(A root, int stopAfter, int followSet,
diff --git a/test/103-string-append/run b/test/917-fields-transformation/build
similarity index 70%
copy from test/103-string-append/run
copy to test/917-fields-transformation/build
index e27a622..898e2e5 100755
--- a/test/103-string-append/run
+++ b/test/917-fields-transformation/build
@@ -1,12 +1,12 @@
#!/bin/bash
#
-# Copyright (C) 2012 The Android Open Source Project
+# Copyright 2016 The Android Open Source Project
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
-# http://www.apache.org/licenses/LICENSE-2.0
+# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
@@ -14,5 +14,4 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# As this is a performance test we always use the non-debug build.
-exec ${RUN} "${@/#libartd.so/libart.so}"
+./default-build "$@" --experimental agents
diff --git a/test/917-fields-transformation/expected.txt b/test/917-fields-transformation/expected.txt
new file mode 100644
index 0000000..bcdd201
--- /dev/null
+++ b/test/917-fields-transformation/expected.txt
@@ -0,0 +1,12 @@
+Result is Hello
+take1 is Hello
+take2 is Goodbye
+Result is start
+take1 is start
+take2 is end
+Result is Goodbye
+take1 is Hello
+take2 is Goodbye
+Result is end
+take1 is start
+take2 is end
diff --git a/test/917-fields-transformation/info.txt b/test/917-fields-transformation/info.txt
new file mode 100644
index 0000000..4cd1bd9
--- /dev/null
+++ b/test/917-fields-transformation/info.txt
@@ -0,0 +1 @@
+Tests field access after class redefinition support in the jvmti plugin.
diff --git a/test/917-fields-transformation/run b/test/917-fields-transformation/run
new file mode 100755
index 0000000..a434b63
--- /dev/null
+++ b/test/917-fields-transformation/run
@@ -0,0 +1,43 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+plugin=libopenjdkjvmtid.so
+agent=libtiagentd.so
+lib=tiagentd
+if [[ "$@" == *"-O"* ]]; then
+ agent=libtiagent.so
+ plugin=libopenjdkjvmti.so
+ lib=tiagent
+fi
+
+if [[ "$@" == *"--jvm"* ]]; then
+ arg="jvm"
+else
+ arg="art"
+ if [[ "$@" != *"--debuggable"* ]]; then
+ other_args=" -Xcompiler-option --debuggable "
+ else
+ other_args=""
+ fi
+fi
+
+./default-run "$@" --experimental agents \
+ --experimental runtime-plugins \
+ --runtime-option -agentpath:${agent}=917-fields-transformation,${arg} \
+ --android-runtime-option -Xplugin:${plugin} \
+ --android-runtime-option -Xfully-deoptable \
+ ${other_args} \
+ --args ${lib}
diff --git a/test/917-fields-transformation/src/Main.java b/test/917-fields-transformation/src/Main.java
new file mode 100644
index 0000000..5378bb7
--- /dev/null
+++ b/test/917-fields-transformation/src/Main.java
@@ -0,0 +1,80 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+
+ // base64 encoded class/dex file for
+ // class Transform {
+ // public String take1;
+ // public String take2;
+ //
+ // public Transform(String a, String b) {
+ // take1 = a;
+ // take2 = b;
+ // }
+ //
+ // public String getResult() {
+ // return take2;
+ // }
+ // }
+ private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+ "yv66vgAAADQAFwoABQARCQAEABIJAAQAEwcAFAcAFQEABXRha2UxAQASTGphdmEvbGFuZy9TdHJp" +
+ "bmc7AQAFdGFrZTIBAAY8aW5pdD4BACcoTGphdmEvbGFuZy9TdHJpbmc7TGphdmEvbGFuZy9TdHJp" +
+ "bmc7KVYBAARDb2RlAQAPTGluZU51bWJlclRhYmxlAQAJZ2V0UmVzdWx0AQAUKClMamF2YS9sYW5n" +
+ "L1N0cmluZzsBAApTb3VyY2VGaWxlAQAOVHJhbnNmb3JtLmphdmEMAAkAFgwABgAHDAAIAAcBAAlU" +
+ "cmFuc2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQADKClWACAABAAFAAAAAgABAAYABwAAAAEACAAH" +
+ "AAAAAgABAAkACgABAAsAAAAzAAIAAwAAAA8qtwABKiu1AAIqLLUAA7EAAAABAAwAAAASAAQAAAAU" +
+ "AAQAFQAJABYADgAXAAEADQAOAAEACwAAAB0AAQABAAAABSq0AAOwAAAAAQAMAAAABgABAAAAGgAB" +
+ "AA8AAAACABA=");
+ private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+ "ZGV4CjAzNQAGUTBb4jIABRlaI9rejdk7RCfyqR2kmNSkAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAM" +
+ "AAAAcAAAAAQAAACgAAAAAwAAALAAAAACAAAA1AAAAAMAAADkAAAAAQAAAPwAAACIAQAAHAEAAFwB" +
+ "AABkAQAAZwEAAHQBAACIAQAAnAEAAKwBAACvAQAAtAEAAMgBAADTAQAA2gEAAAIAAAADAAAABAAA" +
+ "AAYAAAABAAAAAgAAAAAAAAAGAAAAAwAAAAAAAAAHAAAAAwAAAFQBAAAAAAIACgAAAAAAAgALAAAA" +
+ "AAACAAAAAAAAAAAACQAAAAEAAQAAAAAAAAAAAAAAAAABAAAAAAAAAAUAAAAAAAAA8AEAAAAAAAAD" +
+ "AAMAAQAAAOEBAAAIAAAAcBACAAAAWwEAAFsCAQAOAAIAAQAAAAAA6wEAAAMAAABUEAEAEQAAAAIA" +
+ "AAACAAIABjxpbml0PgABTAALTFRyYW5zZm9ybTsAEkxqYXZhL2xhbmcvT2JqZWN0OwASTGphdmEv" +
+ "bGFuZy9TdHJpbmc7AA5UcmFuc2Zvcm0uamF2YQABVgADVkxMABJlbWl0dGVyOiBqYWNrLTQuMTkA" +
+ "CWdldFJlc3VsdAAFdGFrZTEABXRha2UyABQCAAAHDjwtLQAaAAcOAAACAQEAAQEBAIGABJwCAQG8" +
+ "AgAADQAAAAAAAAABAAAAAAAAAAEAAAAMAAAAcAAAAAIAAAAEAAAAoAAAAAMAAAADAAAAsAAAAAQA" +
+ "AAACAAAA1AAAAAUAAAADAAAA5AAAAAYAAAABAAAA/AAAAAEgAAACAAAAHAEAAAEQAAABAAAAVAEA" +
+ "AAIgAAAMAAAAXAEAAAMgAAACAAAA4QEAAAAgAAABAAAA8AEAAAAQAAABAAAABAIAAA==");
+
+ public static void main(String[] args) {
+ System.loadLibrary(args[1]);
+ doTest(new Transform("Hello", "Goodbye"),
+ new Transform("start", "end"));
+ }
+
+ private static void printTransform(Transform t) {
+ System.out.println("Result is " + t.getResult());
+ System.out.println("take1 is " + t.take1);
+ System.out.println("take2 is " + t.take2);
+ }
+ public static void doTest(Transform t1, Transform t2) {
+ printTransform(t1);
+ printTransform(t2);
+ doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
+ printTransform(t1);
+ printTransform(t2);
+ }
+
+ // Transforms the class
+ private static native void doCommonClassRedefinition(Class<?> target,
+ byte[] class_file,
+ byte[] dex_file);
+}
diff --git a/runtime/base/stringprintf_test.cc b/test/917-fields-transformation/src/Transform.java
similarity index 62%
rename from runtime/base/stringprintf_test.cc
rename to test/917-fields-transformation/src/Transform.java
index 0bfde33..6fe6223 100644
--- a/runtime/base/stringprintf_test.cc
+++ b/test/917-fields-transformation/src/Transform.java
@@ -1,5 +1,5 @@
/*
- * Copyright (C) 2011 The Android Open Source Project
+ * Copyright (C) 2016 The Android Open Source Project
*
* Licensed under the Apache License, Version 2.0 (the "License");
* you may not use this file except in compliance with the License.
@@ -14,16 +14,16 @@
* limitations under the License.
*/
-#include "stringprintf.h"
+class Transform {
+ public String take1;
+ public String take2;
-#include "gtest/gtest.h"
+ public Transform(String take1, String take2) {
+ this.take1 = take1;
+ this.take2 = take2;
+ }
-namespace art {
-
-TEST(StringPrintfTest, HexSizeT) {
- size_t size = 0x00107e59;
- EXPECT_STREQ("00107e59", StringPrintf("%08zx", size).c_str());
- EXPECT_STREQ("0x00107e59", StringPrintf("0x%08zx", size).c_str());
+ public String getResult() {
+ return take1;
+ }
}
-
-} // namespace art
diff --git a/test/103-string-append/run b/test/954-invoke-polymorphic-verifier/build
similarity index 64%
copy from test/103-string-append/run
copy to test/954-invoke-polymorphic-verifier/build
index e27a622..a423ca6 100755
--- a/test/103-string-append/run
+++ b/test/954-invoke-polymorphic-verifier/build
@@ -1,12 +1,12 @@
#!/bin/bash
#
-# Copyright (C) 2012 The Android Open Source Project
+# Copyright 2016 The Android Open Source Project
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
-# http://www.apache.org/licenses/LICENSE-2.0
+# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
@@ -14,5 +14,12 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# As this is a performance test we always use the non-debug build.
-exec ${RUN} "${@/#libartd.so/libart.so}"
+# make us exit on a failure
+set -e
+
+if [[ $@ != *"--jvm"* ]]; then
+ # Don't do anything with jvm.
+ export USE_JACK=true
+fi
+
+./default-build "$@" --experimental method-handles
diff --git a/test/103-string-append/run b/test/954-invoke-polymorphic-verifier/check
similarity index 68%
copy from test/103-string-append/run
copy to test/954-invoke-polymorphic-verifier/check
index e27a622..dc5ddb7 100755
--- a/test/103-string-append/run
+++ b/test/954-invoke-polymorphic-verifier/check
@@ -1,6 +1,6 @@
#!/bin/bash
#
-# Copyright (C) 2012 The Android Open Source Project
+# Copyright (C) 2014 The Android Open Source Project
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
@@ -14,5 +14,6 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# As this is a performance test we always use the non-debug build.
-exec ${RUN} "${@/#libartd.so/libart.so}"
+# Strip out temporary file path information and indicies from output.
+sed -e "s/ [(]declaration of.*//" -e "s/\[0x[0-9A-F]*\] //g" "$2" > "$2.tmp"
+diff --strip-trailing-cr -q "$1" "$2.tmp" >/dev/null
diff --git a/test/954-invoke-polymorphic-verifier/expected.txt b/test/954-invoke-polymorphic-verifier/expected.txt
new file mode 100644
index 0000000..5df393a
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/expected.txt
@@ -0,0 +1,10 @@
+java.lang.VerifyError: Verifier rejected class MethodHandleNotInvoke: void MethodHandleNotInvoke.<init>() failed to verify: void MethodHandleNotInvoke.<init>(): void MethodHandleNotInvoke.<init>(): couldn't find method java.lang.invoke.MethodHandle.notInvoke ([Ljava/lang/Object;)Ljava/lang/Object;
+java.lang.VerifyError: Verifier rejected class MethodHandleToString: void MethodHandleToString.<init>() failed to verify: void MethodHandleToString.<init>(): void MethodHandleToString.<init>(): invoke type (METHOD_POLYMORPHIC) does not match method type of java.lang.String java.lang.invoke.MethodHandle.toString()
+java.lang.VerifyError: Verifier rejected class NonReference: void NonReference.<init>() failed to verify: void NonReference.<init>(): void NonReference.<init>(): tried to get class from non-reference register v0 (type=Precise Low-half Constant: 0)
+java.lang.VerifyError: Verifier rejected class TooFewArguments: void TooFewArguments.<init>() failed to verify: void TooFewArguments.<init>(): void TooFewArguments.<init>(): Rejecting invocation, expected 2 argument registers, method signature has 3 or more
+java.lang.VerifyError: Verifier rejected class TooManyArguments: void TooManyArguments.<init>() failed to verify: void TooManyArguments.<init>(): void TooManyArguments.<init>(): Rejecting invocation, expected 4 argument registers, method signature has 3
+java.lang.VerifyError: Verifier rejected class BadThis: void BadThis.<init>() failed to verify: void BadThis.<init>(): void BadThis.<init>(): 'this' argument 'Precise Reference: java.lang.String' not instance of 'Reference: java.lang.invoke.MethodHandle'
+java.lang.VerifyError: Verifier rejected class FakeSignaturePolymorphic: void FakeSignaturePolymorphic.<init>() failed to verify: void FakeSignaturePolymorphic.<init>(): void FakeSignaturePolymorphic.<init>(): invoke type (METHOD_POLYMORPHIC) does not match method type of java.lang.Object Main.invoke(java.lang.Object[])
+java.lang.VerifyError: Verifier rejected class BetterFakeSignaturePolymorphic: void BetterFakeSignaturePolymorphic.<init>() failed to verify: void BetterFakeSignaturePolymorphic.<init>(): Signature polymorphic method must be declared in java.lang.invoke.MethodClass
+Passed Subclass test
+java.lang.VerifyError: Verifier rejected class Unresolved: void Unresolved.<init>() failed to verify: void Unresolved.<init>(): invoke-polymorphic receiver has no class: Unresolved Reference: other.thing.Foo
diff --git a/test/954-invoke-polymorphic-verifier/info.txt b/test/954-invoke-polymorphic-verifier/info.txt
new file mode 100644
index 0000000..cb10d42
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/info.txt
@@ -0,0 +1,3 @@
+Test cases that should be rejected by the method verifier.
+
+NOTE: needs to run under ART.
diff --git a/test/103-string-append/run b/test/954-invoke-polymorphic-verifier/run
similarity index 70%
copy from test/103-string-append/run
copy to test/954-invoke-polymorphic-verifier/run
index e27a622..a9f1822 100755
--- a/test/103-string-append/run
+++ b/test/954-invoke-polymorphic-verifier/run
@@ -1,12 +1,12 @@
#!/bin/bash
#
-# Copyright (C) 2012 The Android Open Source Project
+# Copyright 2016 The Android Open Source Project
#
# Licensed under the Apache License, Version 2.0 (the "License");
# you may not use this file except in compliance with the License.
# You may obtain a copy of the License at
#
-# http://www.apache.org/licenses/LICENSE-2.0
+# http://www.apache.org/licenses/LICENSE-2.0
#
# Unless required by applicable law or agreed to in writing, software
# distributed under the License is distributed on an "AS IS" BASIS,
@@ -14,5 +14,7 @@
# See the License for the specific language governing permissions and
# limitations under the License.
-# As this is a performance test we always use the non-debug build.
-exec ${RUN} "${@/#libartd.so/libart.so}"
+# make us exit on a failure
+set -e
+
+./default-run "$@" --experimental method-handles
diff --git a/test/954-invoke-polymorphic-verifier/smali/BadThis.smali b/test/954-invoke-polymorphic-verifier/smali/BadThis.smali
new file mode 100644
index 0000000..d9edf67
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/smali/BadThis.smali
@@ -0,0 +1,30 @@
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.source "BadThis.smali"
+
+.class public LBadThis;
+.super Ljava/lang/Object;
+
+.method public constructor <init>()V
+.registers 4
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ const-string v0, "0"
+ const-string v1, "1"
+ const-string v2, "2"
+ # v0 is a String, not a MethodHandle.
+ invoke-polymorphic {v0, v1, v2}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String;
+ return-void
+.end method
\ No newline at end of file
diff --git a/test/954-invoke-polymorphic-verifier/smali/BetterFakeSignaturePolymorphic.smali b/test/954-invoke-polymorphic-verifier/smali/BetterFakeSignaturePolymorphic.smali
new file mode 100644
index 0000000..631e704
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/smali/BetterFakeSignaturePolymorphic.smali
@@ -0,0 +1,43 @@
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.source "BetterFakeSignaturePolymorphic.smali"
+
+.class public LBetterFakeSignaturePolymorphic;
+.super Ljava/lang/Object;
+
+.method public constructor <init>()V
+.registers 4
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ invoke-static {}, LBetterFakeSignaturePolymorphic;->getMain()LMain;
+ move-result-object v0
+ const/4 v1, 0
+ move-object v1, v1
+ # Fail here because Main;->invokeExact is on wrong class.
+ invoke-polymorphic {v0, v1}, LMain;->invokeExact([Ljava/lang/Object;)Ljava/lang/Object;, ([Ljava/lang/Object;)Ljava/lang/Object;
+ return-void
+.end method
+
+.method public static getMethodHandle()Ljava/lang/invoke/MethodHandle;
+.registers 1
+ const/4 v0, 0
+ return-object v0
+.end method
+
+.method public static getMain()LMain;
+.registers 1
+ const/4 v0, 0
+ return-object v0
+.end method
\ No newline at end of file
diff --git a/test/954-invoke-polymorphic-verifier/smali/FakeSignaturePolymorphic.smali b/test/954-invoke-polymorphic-verifier/smali/FakeSignaturePolymorphic.smali
new file mode 100644
index 0000000..5bd054a
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/smali/FakeSignaturePolymorphic.smali
@@ -0,0 +1,43 @@
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.source "FakeSignaturePolymorphic.smali"
+
+.class public LFakeSignaturePolymorphic;
+.super Ljava/lang/Object;
+
+.method public constructor <init>()V
+.registers 4
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ invoke-static {}, LFakeSignaturePolymorphic;->getMain()LMain;
+ move-result-object v0
+ const/4 v1, 0
+ move-object v1, v1
+ # Fail here because Main;->invoke does not have right flags (ie not native or varargs).
+ invoke-polymorphic {v0, v1}, LMain;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, ([Ljava/lang/Object;)Ljava/lang/Object;
+ return-void
+.end method
+
+.method public static getMethodHandle()Ljava/lang/invoke/MethodHandle;
+.registers 1
+ const/4 v0, 0
+ return-object v0
+.end method
+
+.method public static getMain()LMain;
+.registers 1
+ const/4 v0, 0
+ return-object v0
+.end method
\ No newline at end of file
diff --git a/test/954-invoke-polymorphic-verifier/smali/Main.smali b/test/954-invoke-polymorphic-verifier/smali/Main.smali
new file mode 100644
index 0000000..5b5e555
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/smali/Main.smali
@@ -0,0 +1,85 @@
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+# This is the test suite runner. It is written in smali rather than
+# Java pending support in dx/dxmerge for invoke-polymorphic (b/33191712).
+
+.source "Main.smali"
+
+.class public LMain;
+.super Ljava/lang/Object;
+
+.method public constructor<init>()V
+.registers 1
+ invoke-direct {v0}, Ljava/lang/Object;-><init>()V
+ return-void
+.end method
+
+.method public static main([Ljava/lang/String;)V
+.registers 1
+ # New tests should be added here.
+ const-string v0, "MethodHandleNotInvoke"
+ invoke-static {v0}, LMain;->test(Ljava/lang/String;)V
+ const-string v0, "MethodHandleToString"
+ invoke-static {v0}, LMain;->test(Ljava/lang/String;)V
+ const-string v0, "NonReference"
+ invoke-static {v0}, LMain;->test(Ljava/lang/String;)V
+ const-string v0, "TooFewArguments"
+ invoke-static {v0}, LMain;->test(Ljava/lang/String;)V
+ const-string v0, "TooManyArguments"
+ invoke-static {v0}, LMain;->test(Ljava/lang/String;)V
+ const-string v0, "BadThis"
+ invoke-static {v0}, LMain;->test(Ljava/lang/String;)V
+ const-string v0, "FakeSignaturePolymorphic"
+ invoke-static {v0}, LMain;->test(Ljava/lang/String;)V
+ const-string v0, "BetterFakeSignaturePolymorphic"
+ invoke-static {v0}, LMain;->test(Ljava/lang/String;)V
+ const-string v0, "Subclass"
+ invoke-static {v0}, LMain;->test(Ljava/lang/String;)V
+ const-string v0, "Unresolved"
+ invoke-static {v0}, LMain;->test(Ljava/lang/String;)V
+ return-void
+.end method
+
+.method public static test(Ljava/lang/String;)V
+.registers 6
+ :try_start_1
+ invoke-static {v5}, Ljava/lang/Class;->forName(Ljava/lang/String;)Ljava/lang/Class;
+ move-result-object v0
+ invoke-virtual {v0}, Ljava/lang/Class;->newInstance()Ljava/lang/Object;
+ :try_end_1
+ .catch Ljava/lang/VerifyError; {:try_start_1 .. :try_end_1} :catch_verifier
+ return-void
+ :catch_verifier
+ move-exception v3
+ invoke-virtual {v3}, Ljava/lang/Exception;->toString()Ljava/lang/String;
+ move-result-object v3
+ sget-object v2, Ljava/lang/System;->out:Ljava/io/PrintStream;
+ invoke-virtual {v2, v3}, Ljava/io/PrintStream;->println(Ljava/lang/String;)V
+ return-void
+.end method
+
+# A test method called "invoke", but on a class other than MethodHandle.
+.method public invoke([Ljava/lang/Object;)Ljava/lang/Object;
+.registers 2
+ const/4 v0, 0
+ aget-object v0, p0, v0
+ return-object v0
+.end method
+
+# A test method called "invokeExact" that is native varargs, but is on a class
+# other than MethodHandle.
+.method public native varargs invokeExact([Ljava/lang/Object;)Ljava/lang/Object;
+.end method
\ No newline at end of file
diff --git a/test/954-invoke-polymorphic-verifier/smali/MethodHandleNotInvoke.smali b/test/954-invoke-polymorphic-verifier/smali/MethodHandleNotInvoke.smali
new file mode 100644
index 0000000..42546d1
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/smali/MethodHandleNotInvoke.smali
@@ -0,0 +1,37 @@
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.source "MethodHandleNotInvoke.smali"
+
+.class public LMethodHandleNotInvoke;
+.super Ljava/lang/Object;
+
+.method public constructor <init>()V
+.registers 4
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ invoke-static {}, LMethodHandleNotInvoke;->getMethodHandle()Ljava/lang/invoke/MethodHandle;
+ move-result-object v0
+ const/4 v1, 0
+ move-object v1, v1
+ # Attempt invoke-polymorphic on MethodHandle.notInvoke().
+ invoke-polymorphic {v0, v1}, Ljava/lang/invoke/MethodHandle;->notInvoke([Ljava/lang/Object;)Ljava/lang/Object;, ([Ljava/lang/Object;)Ljava/lang/Object;
+ return-void
+.end method
+
+.method public static getMethodHandle()Ljava/lang/invoke/MethodHandle;
+.registers 1
+ const/4 v0, 0
+ return-object v0
+.end method
diff --git a/test/954-invoke-polymorphic-verifier/smali/MethodHandleToString.smali b/test/954-invoke-polymorphic-verifier/smali/MethodHandleToString.smali
new file mode 100644
index 0000000..c48429c
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/smali/MethodHandleToString.smali
@@ -0,0 +1,35 @@
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.source "MethodHandleToString.smali"
+
+.class public LMethodHandleToString;
+.super Ljava/lang/Object;
+
+.method public constructor <init>()V
+.registers 1
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ invoke-static {}, LMethodHandleToString;->getMethodHandle()Ljava/lang/invoke/MethodHandle;
+ move-result-object v0
+ # Attempt invoke-polymorphic on MethodHandle.toString().
+ invoke-polymorphic {v0}, Ljava/lang/invoke/MethodHandle;->toString()Ljava/lang/String;, ()Ljava/lang/Object;
+ return-void
+.end method
+
+.method public static getMethodHandle()Ljava/lang/invoke/MethodHandle;
+.registers 1
+ const/4 v0, 0
+ return-object v0
+.end method
diff --git a/test/954-invoke-polymorphic-verifier/smali/NonReference.smali b/test/954-invoke-polymorphic-verifier/smali/NonReference.smali
new file mode 100644
index 0000000..4e1eff2
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/smali/NonReference.smali
@@ -0,0 +1,30 @@
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.source "NonReference.smali"
+
+.class public LNonReference;
+.super Ljava/lang/Object;
+
+.method public constructor <init>()V
+.registers 4
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ # Set v0 to have incorrect type (not a MethodHandle) and value (not null).
+ const-wide v0, 0
+ const-string v1, "1"
+ const-string v2, "2"
+ invoke-polymorphic {v0, v1, v2}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String;
+ return-void
+.end method
diff --git a/test/954-invoke-polymorphic-verifier/smali/Subclass.smali b/test/954-invoke-polymorphic-verifier/smali/Subclass.smali
new file mode 100644
index 0000000..7ef61be
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/smali/Subclass.smali
@@ -0,0 +1,45 @@
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.source "Subclass.smali"
+
+.class public LSubclass;
+.super Ljava/lang/Object;
+
+.method public constructor <init>()V
+.registers 3
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ goto :happy
+ # Get a MethodHandleImpl instance (subclass of MethodHandle).
+ invoke-static {}, LSubclass;->getMethodHandleSubclassInstance()Ljava/lang/invoke/MethodHandleImpl;
+ move-result-object v0
+ const-string v1, "1"
+ const-string v2, "2"
+ # Calling MethodHandle.invoke() on MethodHandleImpl instance (subclass of MethodHandle) => Okay
+ invoke-polymorphic {v0, v1, v2}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String;
+ # Calling MethodHandleImpl.invoke() rather than MethodHandle.invoke() [ declaring class is okay ] => Okay
+ invoke-polymorphic {v0, v1, v2}, Ljava/lang/invoke/MethodHandleImpl;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String;
+:happy
+ sget-object v1, Ljava/lang/System;->out:Ljava/io/PrintStream;
+ const-string v2, "Passed Subclass test"
+ invoke-virtual {v1, v2}, Ljava/io/PrintStream;->println(Ljava/lang/String;)V
+ return-void
+.end method
+
+.method public static getMethodHandleSubclassInstance()Ljava/lang/invoke/MethodHandleImpl;
+.registers 1
+ const/4 v0, 0
+ return-object v0
+.end method
diff --git a/test/954-invoke-polymorphic-verifier/smali/TooFewArguments.smali b/test/954-invoke-polymorphic-verifier/smali/TooFewArguments.smali
new file mode 100644
index 0000000..da29c6f
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/smali/TooFewArguments.smali
@@ -0,0 +1,33 @@
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.source "TooFewArguments.smali"
+
+.class public LTooFewArguments;
+.super Ljava/lang/Object;
+
+.method public constructor <init>()V
+.registers 4
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ # Set up v0 as a null MethodHandle
+ const/4 v0, 0
+ move-object v0, v0
+ invoke-virtual {v0}, Ljava/lang/invoke/MethodHandle;->asFixedArity()Ljava/lang/invoke/MethodHandle;
+ move-result-object v0
+ const-string v1, "1"
+ # Invoke with one argument too few for prototype.
+ invoke-polymorphic {v0, v1}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String;
+ return-void
+.end method
diff --git a/test/954-invoke-polymorphic-verifier/smali/TooManyArguments.smali b/test/954-invoke-polymorphic-verifier/smali/TooManyArguments.smali
new file mode 100644
index 0000000..bc0135e
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/smali/TooManyArguments.smali
@@ -0,0 +1,35 @@
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.source "TooManyArguments.smali"
+
+.class public LTooManyArguments;
+.super Ljava/lang/Object;
+
+.method public constructor <init>()V
+.registers 4
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ # Set up v0 as a null MethodHandle
+ const/4 v0, 0
+ move-object v0, v0
+ invoke-virtual {v0}, Ljava/lang/invoke/MethodHandle;->asFixedArity()Ljava/lang/invoke/MethodHandle;
+ move-result-object v0
+ const-string v1, "1"
+ const-string v2, "2"
+ const-string v3, "3"
+ # Invoke with one argument too many for prototype.
+ invoke-polymorphic {v0, v1, v2, v3}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String;
+ return-void
+.end method
diff --git a/test/954-invoke-polymorphic-verifier/smali/Unresolved.smali b/test/954-invoke-polymorphic-verifier/smali/Unresolved.smali
new file mode 100644
index 0000000..882f0e9
--- /dev/null
+++ b/test/954-invoke-polymorphic-verifier/smali/Unresolved.smali
@@ -0,0 +1,40 @@
+#
+# Copyright (C) 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+# http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+.source "Unresolved.smali"
+
+.class public LUnresolved;
+.super Ljava/lang/Object;
+
+.method public constructor <init>()V
+.registers 3
+.line 23
+ invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+ # Get an unresolvable instance (abstract class)
+ invoke-static {}, LAbstract;->getUnresolvedInstance()Lother/thing/Foo;
+ move-result-object v0
+ const-string v1, "1"
+ const-string v2, "2"
+ # Calling MethodHandle.invoke() on unresolved receiver.
+ invoke-polymorphic {v0, v1, v2}, Ljava/lang/invoke/MethodHandle;->invoke([Ljava/lang/Object;)Ljava/lang/Object;, (Ljava/lang/String;Ljava/lang/String;)Ljava/lang/String;
+ return-void
+.end method
+
+.method public static getUnresolvedInstance()Lother/thing/Foo;
+.registers 1
+.line 37
+ const/4 v0, 0
+ return-object v0
+.end method
diff --git a/test/956-methodhandles/expected.txt b/test/956-methodhandles/expected.txt
index 0a5caa1..9b09327 100644
--- a/test/956-methodhandles/expected.txt
+++ b/test/956-methodhandles/expected.txt
@@ -7,3 +7,11 @@
String constructors done.
testReferenceReturnValueConversions done.
testPrimitiveReturnValueConversions done.
+Hi
+Hi
+Hi
+Hi
+Expect Hi here: Hi
+Don't expect Hi now
+[3, 2, 1]
+[1, 2, 3]
diff --git a/test/956-methodhandles/src/Main.java b/test/956-methodhandles/src/Main.java
index 8713caa..17b56b4 100644
--- a/test/956-methodhandles/src/Main.java
+++ b/test/956-methodhandles/src/Main.java
@@ -19,13 +19,14 @@
import java.lang.invoke.MethodHandles.Lookup;
import java.lang.invoke.MethodType;
import java.lang.invoke.WrongMethodTypeException;
-import java.nio.charset.Charset;
-import java.nio.charset.StandardCharsets;
-
import java.lang.reflect.Constructor;
import java.lang.reflect.Field;
import java.lang.reflect.Method;
+import java.nio.charset.Charset;
+import java.nio.charset.StandardCharsets;
+import java.util.ArrayList;
import java.util.Arrays;
+import java.util.List;
public class Main {
@@ -74,6 +75,7 @@
testConstructors();
testStringConstructors();
testReturnValueConversions();
+ testVariableArity();
}
public static void testfindSpecial_invokeSuperBehaviour() throws Throwable {
@@ -555,6 +557,34 @@
}
}
+ public static void assertTrue(boolean value) {
+ if (!value) {
+ throw new AssertionError("assertTrue value: " + value);
+ }
+ }
+
+ public static void assertFalse(boolean value) {
+ if (value) {
+ throw new AssertionError("assertTrue value: " + value);
+ }
+ }
+
+ public static void assertEquals(int i1, int i2) {
+ if (i1 == i2) { return; }
+ throw new AssertionError("assertEquals i1: " + i1 + ", i2: " + i2);
+ }
+
+ public static void assertEquals(long i1, long i2) {
+ if (i1 == i2) { return; }
+ throw new AssertionError("assertEquals l1: " + i1 + ", l2: " + i2);
+ }
+
+ public static void assertEquals(Object o, Object p) {
+ if (o == p) { return; }
+ if (o != null && p != null && o.equals(p)) { return; }
+ throw new AssertionError("assertEquals: o1: " + o + ", o2: " + p);
+ }
+
public static void assertEquals(String s1, String s2) {
if (s1 == s2) {
return;
@@ -960,4 +990,480 @@
testReferenceReturnValueConversions();
testPrimitiveReturnValueConversions();
}
+
+ public static class BaseVariableArityTester {
+ public String update(Float f0, Float... floats) {
+ return "base " + f0 + ", " + Arrays.toString(floats);
+ }
+ }
+
+ public static class VariableArityTester extends BaseVariableArityTester {
+ private String lastResult;
+
+ // Constructors
+ public VariableArityTester() {}
+ public VariableArityTester(boolean... booleans) { update(booleans); }
+ public VariableArityTester(byte... bytes) { update(bytes); }
+ public VariableArityTester(char... chars) { update(chars); }
+ public VariableArityTester(short... shorts) { update(shorts); }
+ public VariableArityTester(int... ints) { update(ints); }
+ public VariableArityTester(long... longs) { update(longs); }
+ public VariableArityTester(float... floats) { update(floats); }
+ public VariableArityTester(double... doubles) { update(doubles); }
+ public VariableArityTester(Float f0, Float... floats) { update(f0, floats); }
+ public VariableArityTester(String s0, String... strings) { update(s0, strings); }
+ public VariableArityTester(char c, Number... numbers) { update(c, numbers); }
+ @SafeVarargs
+ public VariableArityTester(ArrayList<Integer> l0, ArrayList<Integer>... lists) {
+ update(l0, lists);
+ }
+ public VariableArityTester(List l0, List... lists) { update(l0, lists); }
+
+ // Methods
+ public String update(boolean... booleans) { return lastResult = tally(booleans); }
+ public String update(byte... bytes) { return lastResult = tally(bytes); }
+ public String update(char... chars) { return lastResult = tally(chars); }
+ public String update(short... shorts) { return lastResult = tally(shorts); }
+ public String update(int... ints) {
+ lastResult = tally(ints);
+ return lastResult;
+ }
+ public String update(long... longs) { return lastResult = tally(longs); }
+ public String update(float... floats) { return lastResult = tally(floats); }
+ public String update(double... doubles) { return lastResult = tally(doubles); }
+ @Override
+ public String update(Float f0, Float... floats) { return lastResult = tally(f0, floats); }
+ public String update(String s0, String... strings) { return lastResult = tally(s0, strings); }
+ public String update(char c, Number... numbers) { return lastResult = tally(c, numbers); }
+ @SafeVarargs
+ public final String update(ArrayList<Integer> l0, ArrayList<Integer>... lists) {
+ lastResult = tally(l0, lists);
+ return lastResult;
+ }
+ public String update(List l0, List... lists) { return lastResult = tally(l0, lists); }
+
+ public String arrayMethod(Object[] o) {
+ return Arrays.deepToString(o);
+ }
+
+ public String lastResult() { return lastResult; }
+
+ // Static Methods
+ public static String tally(boolean... booleans) { return Arrays.toString(booleans); }
+ public static String tally(byte... bytes) { return Arrays.toString(bytes); }
+ public static String tally(char... chars) { return Arrays.toString(chars); }
+ public static String tally(short... shorts) { return Arrays.toString(shorts); }
+ public static String tally(int... ints) { return Arrays.toString(ints); }
+ public static String tally(long... longs) { return Arrays.toString(longs); }
+ public static String tally(float... floats) { return Arrays.toString(floats); }
+ public static String tally(double... doubles) { return Arrays.toString(doubles); }
+ public static String tally(Float f0, Float... floats) {
+ return f0 + ", " + Arrays.toString(floats);
+ }
+ public static String tally(String s0, String... strings) {
+ return s0 + ", " + Arrays.toString(strings);
+ }
+ public static String tally(char c, Number... numbers) {
+ return c + ", " + Arrays.toString(numbers);
+ }
+ @SafeVarargs
+ public static String tally(ArrayList<Integer> l0, ArrayList<Integer>... lists) {
+ return Arrays.toString(l0.toArray()) + ", " + Arrays.deepToString(lists);
+ }
+ public static String tally(List l0, List... lists) {
+ return Arrays.deepToString(l0.toArray()) + ", " + Arrays.deepToString(lists);
+ }
+ public static void foo(int... ints) { System.out.println(Arrays.toString(ints)); }
+ public static long sumToPrimitive(int... ints) {
+ long result = 0;
+ for (int i : ints) result += i;
+ return result;
+ }
+ public static Long sumToReference(int... ints) {
+ System.out.println("Hi");
+ return new Long(sumToPrimitive(ints));
+ }
+ public static MethodHandles.Lookup lookup() {
+ return MethodHandles.lookup();
+ }
+ }
+
+ // This method only exists to fool Jack's handling of types. See b/32536744.
+ public static Object getAsObject(String[] strings) {
+ return (Object) strings;
+ }
+
+ public static void testVariableArity() throws Throwable {
+ MethodHandle mh;
+ VariableArityTester vat = new VariableArityTester();
+
+ assertEquals("[1]", vat.update(1));
+ assertEquals("[1, 1]", vat.update(1, 1));
+ assertEquals("[1, 1, 1]", vat.update(1, 1, 1));
+
+ // Methods - boolean
+ mh = MethodHandles.lookup().findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, boolean[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertFalse(mh.asFixedArity().isVarargsCollector());
+ assertEquals("[]", mh.invoke(vat));
+ assertEquals("[true, false, true]", mh.invoke(vat, true, false, true));
+ assertEquals("[true, false, true]", mh.invoke(vat, new boolean[] { true, false, true}));
+ assertEquals("[false, true]", mh.invoke(vat, Boolean.valueOf(false), Boolean.valueOf(true)));
+ try {
+ mh.invoke(vat, true, true, 0);
+ fail();
+ } catch (WrongMethodTypeException e) {}
+ try {
+ assertEquals("[false, true]", mh.invoke(vat, Boolean.valueOf(false), (Boolean) null));
+ fail();
+ } catch (NullPointerException e) {}
+
+ // Methods - byte
+ mh = MethodHandles.lookup().findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, byte[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("[]", mh.invoke(vat));
+ assertEquals("[32, 64, 97]", mh.invoke(vat, (byte) 32, Byte.valueOf((byte) 64), (byte) 97));
+ assertEquals("[32, 64, 97]", mh.invoke(vat, new byte[] {(byte) 32, (byte) 64, (byte) 97}));
+ try {
+ mh.invoke(vat, (byte) 1, Integer.valueOf(3), (byte) 0);
+ fail();
+ } catch (WrongMethodTypeException e) {}
+
+ // Methods - char
+ mh = MethodHandles.lookup().findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, char[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("[]", mh.invoke(vat));
+ assertEquals("[A, B, C]", mh.invoke(vat, 'A', Character.valueOf('B'), 'C'));
+ assertEquals("[W, X, Y, Z]", mh.invoke(vat, new char[] { 'W', 'X', 'Y', 'Z' }));
+
+ // Methods - short
+ mh = MethodHandles.lookup().findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, short[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("[]", mh.invoke(vat));
+ assertEquals("[32767, -32768, 0]",
+ mh.invoke(vat, Short.MAX_VALUE, Short.MIN_VALUE, Short.valueOf((short) 0)));
+ assertEquals("[1, -1]", mh.invoke(vat, new short[] { (short) 1, (short) -1 }));
+
+ // Methods - int
+ mh = MethodHandles.lookup().findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, int[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("[]", mh.invoke(vat));
+ assertEquals("[0, 2147483647, -2147483648, 0]",
+ mh.invoke(vat, Integer.valueOf(0), Integer.MAX_VALUE, Integer.MIN_VALUE, 0));
+ assertEquals("[0, -1, 1, 0]", mh.invoke(vat, new int[] { 0, -1, 1, 0 }));
+
+ assertEquals("[5, 4, 3, 2, 1]", (String) mh.invokeExact(vat, new int [] { 5, 4, 3, 2, 1 }));
+ try {
+ assertEquals("[5, 4, 3, 2, 1]", (String) mh.invokeExact(vat, 5, 4, 3, 2, 1));
+ fail();
+ } catch (WrongMethodTypeException e) {}
+ assertEquals("[5, 4, 3, 2, 1]", (String) mh.invoke(vat, 5, 4, 3, 2, 1));
+
+ // Methods - long
+ mh = MethodHandles.lookup().findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, long[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("[]", mh.invoke(vat));
+ assertEquals("[0, 9223372036854775807, -9223372036854775808]",
+ mh.invoke(vat, Long.valueOf(0), Long.MAX_VALUE, Long.MIN_VALUE));
+ assertEquals("[0, -1, 1, 0]", mh.invoke(vat, new long[] { 0, -1, 1, 0 }));
+
+ // Methods - float
+ mh = MethodHandles.lookup().findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, float[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("[]", mh.invoke(vat));
+ assertEquals("[0.0, 1.25, -1.25]",
+ mh.invoke(vat, 0.0f, Float.valueOf(1.25f), Float.valueOf(-1.25f)));
+ assertEquals("[0.0, -1.0, 1.0, 0.0]",
+ mh.invoke(vat, new float[] { 0.0f, -1.0f, 1.0f, 0.0f }));
+
+ // Methods - double
+ mh = MethodHandles.lookup().findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, double[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("[]", mh.invoke(vat));
+ assertEquals("[0.0, 1.25, -1.25]",
+ mh.invoke(vat, 0.0, Double.valueOf(1.25), Double.valueOf(-1.25)));
+ assertEquals("[0.0, -1.0, 1.0, 0.0]",
+ mh.invoke(vat, new double[] { 0.0, -1.0, 1.0, 0.0 }));
+ mh.invoke(vat, 0.3f, 1.33, 1.33);
+
+ // Methods - String
+ mh = MethodHandles.lookup().
+ findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, String.class, String[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("Echidna, []", mh.invoke(vat, "Echidna"));
+ assertEquals("Bongo, [Jerboa, Okapi]",
+ mh.invoke(vat, "Bongo", "Jerboa", "Okapi"));
+
+ // Methods - Float
+ mh = MethodHandles.lookup().
+ findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, Float.class, Float[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invoke(vat, Float.valueOf(9.99f),
+ new Float[] { Float.valueOf(0.0f),
+ Float.valueOf(0.1f),
+ Float.valueOf(1.1f) }));
+ assertEquals("9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invoke(vat, Float.valueOf(9.99f), Float.valueOf(0.0f),
+ Float.valueOf(0.1f), Float.valueOf(1.1f)));
+ assertEquals("9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invoke(vat, Float.valueOf(9.99f), 0.0f, 0.1f, 1.1f));
+ try {
+ assertEquals("9.99, [77.0, 33.0, 64.0]",
+ (String) mh.invoke(vat, Float.valueOf(9.99f), 77, 33, 64));
+ fail();
+ } catch (WrongMethodTypeException e) {}
+ assertEquals("9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invokeExact(vat, Float.valueOf(9.99f),
+ new Float[] { Float.valueOf(0.0f),
+ Float.valueOf(0.1f),
+ Float.valueOf(1.1f) }));
+ assertEquals("9.99, [0.0, null, 1.1]",
+ (String) mh.invokeExact(vat, Float.valueOf(9.99f),
+ new Float[] { Float.valueOf(0.0f),
+ null,
+ Float.valueOf(1.1f) }));
+ try {
+ assertEquals("9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invokeExact(vat, Float.valueOf(9.99f), 0.0f, 0.1f, 1.1f));
+ fail();
+ } catch (WrongMethodTypeException e) {}
+
+ // Methods - Number
+ mh = MethodHandles.lookup().
+ findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, char.class, Number[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertFalse(mh.asFixedArity().isVarargsCollector());
+ assertEquals("x, []", (String) mh.invoke(vat, 'x'));
+ assertEquals("x, [3.141]", (String) mh.invoke(vat, 'x', 3.141));
+ assertEquals("x, [null, 3.131, 37]",
+ (String) mh.invoke(vat, 'x', null, 3.131, new Integer(37)));
+ try {
+ assertEquals("x, [null, 3.131, bad, 37]",
+ (String) mh.invoke(vat, 'x', null, 3.131, "bad", new Integer(37)));
+ assertTrue(false);
+ fail();
+ } catch (ClassCastException e) {}
+ try {
+ assertEquals("x, [null, 3.131, bad, 37]",
+ (String) mh.invoke(
+ vat, 'x', (Process) null, 3.131, "bad", new Integer(37)));
+ assertTrue(false);
+ fail();
+ } catch (ClassCastException e) {}
+
+ // Methods - an array method that is not variable arity.
+ mh = MethodHandles.lookup().findVirtual(
+ VariableArityTester.class, "arrayMethod",
+ MethodType.methodType(String.class, Object[].class));
+ assertFalse(mh.isVarargsCollector());
+ mh.invoke(vat, new Object[] { "123" });
+ try {
+ assertEquals("-", mh.invoke(vat, new Float(3), new Float(4)));
+ fail();
+ } catch (WrongMethodTypeException e) {}
+ mh = mh.asVarargsCollector(Object[].class);
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("[3.0, 4.0]", (String) mh.invoke(vat, new Float(3), new Float(4)));
+
+ // Constructors - default
+ mh = MethodHandles.lookup().findConstructor(
+ VariableArityTester.class, MethodType.methodType(void.class));
+ assertFalse(mh.isVarargsCollector());
+
+ // Constructors - boolean
+ mh = MethodHandles.lookup().findConstructor(
+ VariableArityTester.class, MethodType.methodType(void.class, boolean[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("[true, true, false]",
+ ((VariableArityTester) mh.invoke(new boolean[] {true, true, false})).lastResult());
+ assertEquals("[true, true, false]",
+ ((VariableArityTester) mh.invoke(true, true, false)).lastResult());
+ try {
+ assertEquals("[true, true, false]",
+ ((VariableArityTester) mh.invokeExact(true, true, false)).lastResult());
+ fail();
+ } catch (WrongMethodTypeException e) {}
+
+ // Constructors - byte
+ mh = MethodHandles.lookup().findConstructor(
+ VariableArityTester.class, MethodType.methodType(void.class, byte[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("[55, 66, 60]",
+ ((VariableArityTester)
+ mh.invoke(new byte[] {(byte) 55, (byte) 66, (byte) 60})).lastResult());
+ assertEquals("[55, 66, 60]",
+ ((VariableArityTester) mh.invoke(
+ (byte) 55, (byte) 66, (byte) 60)).lastResult());
+ try {
+ assertEquals("[55, 66, 60]",
+ ((VariableArityTester) mh.invokeExact(
+ (byte) 55, (byte) 66, (byte) 60)).lastResult());
+ fail();
+ } catch (WrongMethodTypeException e) {}
+ try {
+ assertEquals("[3, 3]",
+ ((VariableArityTester) mh.invoke(
+ new Number[] { Byte.valueOf((byte) 3), (byte) 3})).lastResult());
+ fail();
+ } catch (WrongMethodTypeException e) {}
+
+ // Constructors - String (have a different path than other reference types).
+ mh = MethodHandles.lookup().findConstructor(
+ VariableArityTester.class, MethodType.methodType(void.class, String.class, String[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("x, []", ((VariableArityTester) mh.invoke("x")).lastResult());
+ assertEquals("x, [y]", ((VariableArityTester) mh.invoke("x", "y")).lastResult());
+ assertEquals("x, [y, z]",
+ ((VariableArityTester) mh.invoke("x", new String[] { "y", "z" })).lastResult());
+ try {
+ assertEquals("x, [y]", ((VariableArityTester) mh.invokeExact("x", "y")).lastResult());
+ fail();
+ } catch (WrongMethodTypeException e) {}
+ assertEquals("x, [null, z]",
+ ((VariableArityTester) mh.invoke("x", new String[] { null, "z" })).lastResult());
+
+ // Constructors - Number
+ mh = MethodHandles.lookup().findConstructor(
+ VariableArityTester.class, MethodType.methodType(void.class, char.class, Number[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertFalse(mh.asFixedArity().isVarargsCollector());
+ assertEquals("x, []", ((VariableArityTester) mh.invoke('x')).lastResult());
+ assertEquals("x, [3.141]", ((VariableArityTester) mh.invoke('x', 3.141)).lastResult());
+ assertEquals("x, [null, 3.131, 37]",
+ ((VariableArityTester) mh.invoke('x', null, 3.131, new Integer(37))).lastResult());
+ try {
+ assertEquals("x, [null, 3.131, bad, 37]",
+ ((VariableArityTester) mh.invoke(
+ 'x', null, 3.131, "bad", new Integer(37))).lastResult());
+ assertTrue(false);
+ fail();
+ } catch (ClassCastException e) {}
+ try {
+ assertEquals("x, [null, 3.131, bad, 37]",
+ ((VariableArityTester) mh.invoke(
+ 'x', (Process) null, 3.131, "bad", new Integer(37))).lastResult());
+ assertTrue(false);
+ fail();
+ } catch (ClassCastException e) {}
+
+ // Static Methods - Float
+ mh = MethodHandles.lookup().
+ findStatic(VariableArityTester.class, "tally",
+ MethodType.methodType(String.class, Float.class, Float[].class));
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invoke(Float.valueOf(9.99f),
+ new Float[] { Float.valueOf(0.0f),
+ Float.valueOf(0.1f),
+ Float.valueOf(1.1f) }));
+ assertEquals("9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invoke(Float.valueOf(9.99f), Float.valueOf(0.0f),
+ Float.valueOf(0.1f), Float.valueOf(1.1f)));
+ assertEquals("9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invoke(Float.valueOf(9.99f), 0.0f, 0.1f, 1.1f));
+ try {
+ assertEquals("9.99, [77.0, 33.0, 64.0]",
+ (String) mh.invoke(Float.valueOf(9.99f), 77, 33, 64));
+ fail();
+ } catch (WrongMethodTypeException e) {}
+ assertEquals("9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invokeExact(Float.valueOf(9.99f),
+ new Float[] { Float.valueOf(0.0f),
+ Float.valueOf(0.1f),
+ Float.valueOf(1.1f) }));
+ assertEquals("9.99, [0.0, null, 1.1]",
+ (String) mh.invokeExact(Float.valueOf(9.99f),
+ new Float[] { Float.valueOf(0.0f),
+ null,
+ Float.valueOf(1.1f) }));
+ try {
+ assertEquals("9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invokeExact(Float.valueOf(9.99f), 0.0f, 0.1f, 1.1f));
+ fail();
+ } catch (WrongMethodTypeException e) {}
+
+ // Special methods - Float
+ mh = VariableArityTester.lookup().
+ findSpecial(BaseVariableArityTester.class, "update",
+ MethodType.methodType(String.class, Float.class, Float[].class),
+ VariableArityTester.class);
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("base 9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invoke(vat,
+ Float.valueOf(9.99f),
+ new Float[] { Float.valueOf(0.0f),
+ Float.valueOf(0.1f),
+ Float.valueOf(1.1f) }));
+ assertEquals("base 9.99, [0.0, 0.1, 1.1]",
+ (String) mh.invoke(vat, Float.valueOf(9.99f), Float.valueOf(0.0f),
+ Float.valueOf(0.1f), Float.valueOf(1.1f)));
+
+ // Return value conversions.
+ mh = MethodHandles.lookup().findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, int[].class));
+ assertEquals("[1, 2, 3]", (String) mh.invoke(vat, 1, 2, 3));
+ assertEquals("[1, 2, 3]", (Object) mh.invoke(vat, 1, 2, 3));
+ try {
+ assertEquals("[1, 2, 3, 4]", (long) mh.invoke(vat, 1, 2, 3));
+ fail();
+ } catch (WrongMethodTypeException e) {}
+ assertEquals("[1, 2, 3]", vat.lastResult());
+ mh = MethodHandles.lookup().findStatic(VariableArityTester.class, "sumToPrimitive",
+ MethodType.methodType(long.class, int[].class));
+ assertEquals(10l, (long) mh.invoke(1, 2, 3, 4));
+ assertEquals(Long.valueOf(10l), (Long) mh.invoke(1, 2, 3, 4));
+ mh = MethodHandles.lookup().findStatic(VariableArityTester.class, "sumToReference",
+ MethodType.methodType(Long.class, int[].class));
+ Object o = mh.invoke(1, 2, 3, 4);
+ long l = (long) mh.invoke(1, 2, 3, 4);
+ assertEquals(10l, (long) mh.invoke(1, 2, 3, 4));
+ assertEquals(Long.valueOf(10l), (Long) mh.invoke(1, 2, 3, 4));
+ try {
+ // WrongMethodTypeException should be raised before invoke here.
+ System.out.print("Expect Hi here: ");
+ assertEquals(Long.valueOf(10l), (Byte) mh.invoke(1, 2, 3, 4));
+ fail();
+ } catch (ClassCastException e) {}
+ try {
+ // WrongMethodTypeException should be raised before invoke here.
+ System.out.println("Don't expect Hi now");
+ byte b = (byte) mh.invoke(1, 2, 3, 4);
+ fail();
+ } catch (WrongMethodTypeException e) {}
+
+ // Return void produces 0 / null.
+ mh = MethodHandles.lookup().findStatic(VariableArityTester.class, "foo",
+ MethodType.methodType(void.class, int[].class));
+ assertEquals(null, (Object) mh.invoke(3, 2, 1));
+ assertEquals(0l, (long) mh.invoke(1, 2, 3));
+
+ // Combinators
+ mh = MethodHandles.lookup().findVirtual(VariableArityTester.class, "update",
+ MethodType.methodType(String.class, boolean[].class));
+ assertTrue(mh.isVarargsCollector());
+ mh = mh.bindTo(vat);
+ assertFalse(mh.isVarargsCollector());
+ mh = mh.asVarargsCollector(boolean[].class);
+ assertTrue(mh.isVarargsCollector());
+ assertEquals("[]", mh.invoke());
+ assertEquals("[true, false, true]", mh.invoke(true, false, true));
+ assertEquals("[true, false, true]", mh.invoke(new boolean[] { true, false, true}));
+ assertEquals("[false, true]", mh.invoke(Boolean.valueOf(false), Boolean.valueOf(true)));
+ try {
+ mh.invoke(true, true, 0);
+ fail();
+ } catch (WrongMethodTypeException e) {}
+ }
}
diff --git a/test/Android.arm_vixl.mk b/test/Android.arm_vixl.mk
deleted file mode 100644
index 21b31b4..0000000
--- a/test/Android.arm_vixl.mk
+++ /dev/null
@@ -1,51 +0,0 @@
-#
-# Copyright (C) 2016 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-# http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-#
-
-# Known broken tests for the ARM VIXL backend.
-TEST_ART_BROKEN_OPTIMIZING_ARM_VIXL_RUN_TESTS := \
- 003-omnibus-opcodes \
- 020-string \
- 021-string2 \
- 042-new-instance \
- 044-proxy \
- 080-oom-throw \
- 082-inline-execute \
- 096-array-copy-concurrent-gc \
- 099-vmdebug \
- 100-reflect2 \
- 103-string-append \
- 114-ParallelGC \
- 122-npe \
- 129-ThreadGetId \
- 137-cfi \
- 144-static-field-sigquit \
- 412-new-array \
- 439-npe \
- 450-checker-types \
- 488-checker-inline-recursive-calls \
- 515-dce-dominator \
- 520-equivalent-phi \
- 525-checker-arrays-fields1 \
- 525-checker-arrays-fields2 \
- 527-checker-array-access-split \
- 538-checker-embed-constants \
- 552-checker-sharpening \
- 562-checker-no-intermediate \
- 570-checker-osr \
- 602-deoptimizeable \
- 700-LoadArgRegs \
- 800-smali \
-
diff --git a/test/Android.bp b/test/Android.bp
index fe20f29..2625f56 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -244,8 +244,8 @@
defaults: ["libartagent-defaults"],
srcs: [
"ti-agent/common_load.cc",
+ "ti-agent/common_helper.cc",
"901-hello-ti-agent/basics.cc",
- "902-hello-transformation/transform.cc",
"903-hello-tagging/tagging.cc",
"904-object-allocation/tracking.cc",
"905-object-free/tracking_free.cc",
@@ -314,6 +314,7 @@
"595-profile-saving/profile-saving.cc",
"596-app-images/app_images.cc",
"597-deopt-new-string/deopt.cc",
+ "626-const-class-linking/clear_dex_cache_types.cc",
],
shared_libs: [
"libbacktrace",
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index e92ba1a..6df81e4 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -280,6 +280,7 @@
911-get-stack-trace \
912-classes \
913-heaps \
+ 917-fields-transformation \
ifneq (,$(filter target,$(TARGET_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \
@@ -360,8 +361,10 @@
TEST_ART_BROKEN_NO_RELOCATE_TESTS :=
# Temporarily disable some broken tests when forcing access checks in interpreter b/22414682
+# 629 requires compilation.
TEST_ART_BROKEN_INTERPRETER_ACCESS_CHECK_TESTS := \
- 137-cfi
+ 137-cfi \
+ 629-vdex-speed
ifneq (,$(filter interp-ac,$(COMPILER_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \
@@ -425,6 +428,7 @@
# explicitly test for them. These all also assume we have an image.
# 147-stripped-dex-fallback is disabled because it requires --prebuild.
# 554-jit-profile-file is disabled because it needs a primary oat file to know what it should save.
+# 629-vdex-speed requires compiled code.
TEST_ART_BROKEN_FALLBACK_RUN_TESTS := \
116-nodex2oat \
117-nopatchoat \
@@ -433,12 +437,15 @@
137-cfi \
138-duplicate-classes-check2 \
147-stripped-dex-fallback \
- 554-jit-profile-file
+ 554-jit-profile-file \
+ 629-vdex-speed
# This test fails without an image.
+# 964 often times out due to the large number of classes it tries to compile.
TEST_ART_BROKEN_NO_IMAGE_RUN_TESTS := \
137-cfi \
- 138-duplicate-classes-check
+ 138-duplicate-classes-check \
+ 964-default-iface-init
ifneq (,$(filter no-dex2oat,$(PREBUILD_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),no-dex2oat, \
@@ -470,12 +477,14 @@
# This test dynamically enables tracing to force a deoptimization. This makes the test meaningless
# when already tracing, and writes an error message that we do not want to check for.
# 130 occasional timeout b/32383962.
+# 629 requires compilation.
TEST_ART_BROKEN_TRACING_RUN_TESTS := \
087-gc-after-link \
130-hprof \
137-cfi \
141-class-unload \
570-checker-osr \
+ 629-vdex-speed \
802-deoptimization
ifneq (,$(filter trace stream,$(TRACE_TYPES)))
@@ -484,11 +493,31 @@
$(PICTEST_TYPES),$(DEBUGGABLE_TYPES), $(TEST_ART_BROKEN_TRACING_RUN_TESTS),$(ALL_ADDRESS_SIZES))
endif
+TEST_ART_BROKEN_TRACING_RUN_TESTS :=
+
+# These tests expect JIT compilation, which is suppressed when tracing.
+TEST_ART_BROKEN_JIT_TRACING_RUN_TESTS := \
+ 604-hot-static-interface \
+ 612-jit-dex-cache \
+ 613-inlining-dex-cache \
+ 616-cha \
+ 626-set-resolved-string \
+
+ifneq (,$(filter trace stream,$(TRACE_TYPES)))
+ ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \
+ jit,$(RELOCATE_TYPES),trace stream,$(GC_TYPES),$(JNI_TYPES),$(IMAGE_TYPES), \
+ $(PICTEST_TYPES),$(DEBUGGABLE_TYPES), $(TEST_ART_BROKEN_JIT_TRACING_RUN_TESTS),$(ALL_ADDRESS_SIZES))
+endif
+
+TEST_ART_BROKEN_JIT_TRACING_RUN_TESTS :=
+
# Known broken tests for the interpreter.
# CFI unwinding expects managed frames.
+# 629 requires compilation.
TEST_ART_BROKEN_INTERPRETER_RUN_TESTS := \
137-cfi \
- 554-jit-profile-file
+ 554-jit-profile-file \
+ 629-vdex-speed
ifneq (,$(filter interpreter,$(COMPILER_TYPES)))
ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \
@@ -504,8 +533,12 @@
# Test 906 iterates the heap filtering with different options. No instances should be created
# between those runs to be able to have precise checks.
# Test 902 hits races with the JIT compiler. b/32821077
+# Test 626-const-class-linking can deadlock with JIT. b/33567581
+# Test 629 requires compilation.
TEST_ART_BROKEN_JIT_RUN_TESTS := \
137-cfi \
+ 626-const-class-linking \
+ 629-vdex-speed \
902-hello-transformation \
904-object-allocation \
906-iterate-heap \
@@ -532,26 +565,6 @@
$(TEST_ART_BROKEN_OPTIMIZING_GRAPH_COLOR),$(ALL_ADDRESS_SIZES))
endif
-# Known broken tests for the ARM VIXL backend.
-# Android.arm_vixl.mk defines TEST_ART_BROKEN_OPTIMIZING_ARM_VIXL_RUN_TESTS.
-include $(LOCAL_PATH)/Android.arm_vixl.mk
-
-ifdef ART_USE_VIXL_ARM_BACKEND
- ifeq (arm,$(filter arm,$(TARGET_ARCH) $(TARGET_2ND_ARCH)))
- ifneq (,$(filter $(OPTIMIZING_COMPILER_TYPES),$(COMPILER_TYPES)))
- ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \
- $(OPTIMIZING_COMPILER_TYPES),$(RELOCATE_TYPES),$(TRACE_TYPES),$(GC_TYPES),$(JNI_TYPES), \
- $(IMAGE_TYPES),$(PICTEST_TYPES),$(DEBUGGABLE_TYPES), \
- $(TEST_ART_BROKEN_OPTIMIZING_ARM_VIXL_RUN_TESTS),32)
- endif
- endif
- # TODO(VIXL): These two tests currently fail, but adding them to `ART_TEST_KNOWN_BROKEN` breaks
- # `export ART_USE_VIXL_ARM_BACKEND=true && mma -j6 test-art-target-gtest dist`
- #ART_TEST_KNOWN_BROKEN += test-art-target-gtest-dex2oat_test32
- #ART_TEST_KNOWN_BROKEN += test-art-target-gtest-image_test32
-endif
-
-
# Known broken tests for the mips32 optimizing compiler backend.
TEST_ART_BROKEN_OPTIMIZING_MIPS_RUN_TESTS := \
@@ -608,10 +621,7 @@
TEST_ART_BROKEN_INTERPRETER_READ_BARRIER_RUN_TESTS :=
# Tests that should fail in the read barrier configuration with the Optimizing compiler (AOT).
-# 484: Baker's fast path based read barrier compiler instrumentation generates code containing
-# more parallel moves on x86, thus some Checker assertions may fail.
-TEST_ART_BROKEN_OPTIMIZING_READ_BARRIER_RUN_TESTS := \
- 484-checker-register-hints
+TEST_ART_BROKEN_OPTIMIZING_READ_BARRIER_RUN_TESTS :=
# Tests that should fail in the read barrier configuration with JIT (Optimizing compiler).
TEST_ART_BROKEN_JIT_READ_BARRIER_RUN_TESTS :=
@@ -663,6 +673,15 @@
endif
endif
+# Tests disabled for GSS.
+TEST_ART_BROKEN_GSS_RUN_TESTS := 080-oom-fragmentation
+ifeq ($(ART_DEFAULT_GC_TYPE),GSS)
+ ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES), \
+ $(PREBUILD_TYPES),$(COMPILER_TYPES),$(RELOCATE_TYPES),$(TRACE_TYPES),$(GC_TYPES), \
+ $(JNI_TYPES),$(IMAGE_TYPES),$(PICTEST_TYPES),$(DEBUGGABLE_TYPES), \
+ $(TEST_ART_BROKEN_GSS_RUN_TESTS),$(ALL_ADDRESS_SIZES))
+endif
+
TEST_ART_BROKEN_OPTIMIZING_READ_BARRIER_RUN_TESTS :=
TEST_ART_BROKEN_JIT_READ_BARRIER_RUN_TESTS :=
@@ -791,6 +810,10 @@
TEST_ART_TARGET_SYNC_DEPS += $(OUT_DIR)/$(ART_TEST_LIST_device_$(TARGET_2ND_ARCH)_libnativebridgetest)
endif
+# Also need libopenjdkjvmti.
+TEST_ART_TARGET_SYNC_DEPS += libopenjdkjvmti
+TEST_ART_TARGET_SYNC_DEPS += libopenjdkjvmtid
+
# All tests require the host executables. The tests also depend on the core images, but on
# specific version depending on the compiler.
ART_TEST_HOST_RUN_TEST_DEPENDENCIES := \
diff --git a/test/902-hello-transformation/transform.h b/test/ErroneousA/ErroneousA.java
similarity index 62%
copy from test/902-hello-transformation/transform.h
copy to test/ErroneousA/ErroneousA.java
index 661058d..49da544 100644
--- a/test/902-hello-transformation/transform.h
+++ b/test/ErroneousA/ErroneousA.java
@@ -14,17 +14,4 @@
* limitations under the License.
*/
-#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-
-#include <jni.h>
-
-namespace art {
-namespace Test902HelloTransformation {
-
-jint OnLoad(JavaVM* vm, char* options, void* reserved);
-
-} // namespace Test902HelloTransformation
-} // namespace art
-
-#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
+final class FinalSuper {}
diff --git a/test/902-hello-transformation/transform.h b/test/ErroneousB/ErroneousB.java
similarity index 62%
rename from test/902-hello-transformation/transform.h
rename to test/ErroneousB/ErroneousB.java
index 661058d..6c2902a 100644
--- a/test/902-hello-transformation/transform.h
+++ b/test/ErroneousB/ErroneousB.java
@@ -14,17 +14,7 @@
* limitations under the License.
*/
-#ifndef ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
-#define ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
+// Only final in first dex.
+class FinalSuper {}
-#include <jni.h>
-
-namespace art {
-namespace Test902HelloTransformation {
-
-jint OnLoad(JavaVM* vm, char* options, void* reserved);
-
-} // namespace Test902HelloTransformation
-} // namespace art
-
-#endif // ART_TEST_902_HELLO_TRANSFORMATION_TRANSFORM_H_
+class Erroneous extends FinalSuper {}
diff --git a/test/common/runtime_state.cc b/test/common/runtime_state.cc
index a2eb370..285f3aa 100644
--- a/test/common/runtime_state.cc
+++ b/test/common/runtime_state.cc
@@ -119,6 +119,24 @@
return JNI_TRUE;
}
+extern "C" JNIEXPORT jboolean JNICALL Java_Main_isAotCompiled(JNIEnv* env,
+ jclass,
+ jclass cls,
+ jstring method_name) {
+ Thread* self = Thread::Current();
+ ScopedObjectAccess soa(self);
+ ScopedUtfChars chars(env, method_name);
+ CHECK(chars.c_str() != nullptr);
+ ArtMethod* method = soa.Decode<mirror::Class>(cls)->FindDeclaredDirectMethodByName(
+ chars.c_str(), kRuntimePointerSize);
+ const void* code = method->GetOatMethodQuickCode(kRuntimePointerSize);
+ jit::Jit* jit = Runtime::Current()->GetJit();
+ if (jit != nullptr && jit->GetCodeCache()->ContainsPc(code)) {
+ return true;
+ }
+ return code != nullptr;
+}
+
extern "C" JNIEXPORT void JNICALL Java_Main_ensureJitCompiled(JNIEnv* env,
jclass,
jclass cls,
@@ -157,4 +175,17 @@
}
}
+extern "C" JNIEXPORT jboolean JNICALL Java_Main_hasSingleImplementation(JNIEnv* env,
+ jclass,
+ jclass cls,
+ jstring method_name) {
+ ArtMethod* method = nullptr;
+ ScopedObjectAccess soa(Thread::Current());
+ ScopedUtfChars chars(env, method_name);
+ CHECK(chars.c_str() != nullptr);
+ method = soa.Decode<mirror::Class>(cls)->FindDeclaredVirtualMethodByName(
+ chars.c_str(), kRuntimePointerSize);
+ return method->HasSingleImplementation();
+}
+
} // namespace art
diff --git a/test/etc/default-build b/test/etc/default-build
index e663496..51ae175 100755
--- a/test/etc/default-build
+++ b/test/etc/default-build
@@ -71,7 +71,7 @@
declare -A JACK_EXPERIMENTAL_ARGS
JACK_EXPERIMENTAL_ARGS["default-methods"]="-D jack.java.source.version=1.8 -D jack.android.min-api-level=24"
JACK_EXPERIMENTAL_ARGS["lambdas"]="-D jack.java.source.version=1.8 -D jack.android.min-api-level=24"
-JACK_EXPERIMENTAL_ARGS["method-handles"]="-D jack.java.source.version=1.8 -D jack.android.min-api-level=26"
+JACK_EXPERIMENTAL_ARGS["method-handles"]="-D jack.java.source.version=1.7 -D jack.android.min-api-level=o-b1"
declare -A SMALI_EXPERIMENTAL_ARGS
SMALI_EXPERIMENTAL_ARGS["default-methods"]="--api-level 24"
@@ -273,8 +273,10 @@
fi
# Create a single jar with two dex files for multidex.
-if [ ${HAS_SRC_MULTIDEX} = "true" ] || [ ${HAS_SMALI_MULTIDEX} = "true" ]; then
- zip $TEST_NAME.jar classes.dex classes2.dex
-elif [ ${NEED_DEX} = "true" ]; then
- zip $TEST_NAME.jar classes.dex
+if [ ${NEED_DEX} = "true" ]; then
+ if [ ${HAS_SRC_MULTIDEX} = "true" ] || [ ${HAS_SMALI_MULTIDEX} = "true" ]; then
+ zip $TEST_NAME.jar classes.dex classes2.dex
+ else
+ zip $TEST_NAME.jar classes.dex
+ fi
fi
diff --git a/test/etc/run-test-jar b/test/etc/run-test-jar
index 06e4219..f395866 100755
--- a/test/etc/run-test-jar
+++ b/test/etc/run-test-jar
@@ -58,6 +58,7 @@
ARGS=""
EXTERNAL_LOG_TAGS="n" # if y respect externally set ANDROID_LOG_TAGS.
DRY_RUN="n" # if y prepare to run the test but don't run it.
+TEST_VDEX="n"
while true; do
if [ "x$1" = "x--quiet" ]; then
@@ -243,6 +244,9 @@
elif [ "x$1" = "x--dry-run" ]; then
DRY_RUN="y"
shift
+ elif [ "x$1" = "x--vdex" ]; then
+ TEST_VDEX="y"
+ shift
elif expr "x$1" : "x--" >/dev/null 2>&1; then
echo "unknown $0 option: $1" 1>&2
exit 1
@@ -312,7 +316,8 @@
if [ "$USE_JVM" = "y" ]; then
export LD_LIBRARY_PATH=${ANDROID_HOST_OUT}/lib64
# Xmx is necessary since we don't pass down the ART flags to JVM.
- cmdline="${JAVA} ${DEBUGGER_OPTS} ${JVM_VERIFY_ARG} -Xmx256m -classpath classes ${FLAGS} $MAIN $@ ${ARGS}"
+ # We pass the classes2 path whether it's used (src-multidex) or not.
+ cmdline="${JAVA} ${DEBUGGER_OPTS} ${JVM_VERIFY_ARG} -Xmx256m -classpath classes:classes2 ${FLAGS} $MAIN $@ ${ARGS}"
if [ "$DEV_MODE" = "y" ]; then
echo $cmdline
fi
@@ -444,6 +449,7 @@
fi
dex2oat_cmdline="true"
+vdex_cmdline="true"
mkdir_locations="${DEX_LOCATION}/dalvik-cache/$ISA"
strip_cmdline="true"
@@ -473,6 +479,9 @@
# Use -k 1m to SIGKILL it a minute later if it hasn't ended.
dex2oat_cmdline="timeout -k 1m -s SIGRTMIN+2 1m ${dex2oat_cmdline}"
fi
+ if [ "$TEST_VDEX" = "y" ]; then
+ vdex_cmdline="${dex2oat_cmdline} --input-vdex=$DEX_LOCATION/oat/$ISA/$TEST_NAME.vdex"
+ fi
fi
if [ "$STRIP_DEX" = "y" ]; then
@@ -513,6 +522,7 @@
# Remove whitespace.
dex2oat_cmdline=$(echo $dex2oat_cmdline)
dalvikvm_cmdline=$(echo $dalvikvm_cmdline)
+vdex_cmdline=$(echo $vdex_cmdline)
if [ "$HOST" = "n" ]; then
adb root > /dev/null
@@ -553,6 +563,7 @@
export LD_LIBRARY_PATH=$LD_LIBRARY_PATH && \
export PATH=$ANDROID_ROOT/bin:$PATH && \
$dex2oat_cmdline && \
+ $vdex_cmdline && \
$strip_cmdline && \
$dalvikvm_cmdline"
@@ -626,7 +637,7 @@
fi
if [ "$DEV_MODE" = "y" ]; then
- echo "mkdir -p ${mkdir_locations} && $dex2oat_cmdline && $strip_cmdline && $cmdline"
+ echo "mkdir -p ${mkdir_locations} && $dex2oat_cmdline && $vdex_cmdline && $strip_cmdline && $cmdline"
fi
cd $ANDROID_BUILD_TOP
@@ -634,6 +645,7 @@
rm -rf ${DEX_LOCATION}/dalvik-cache/
mkdir -p ${mkdir_locations} || exit 1
$dex2oat_cmdline || { echo "Dex2oat failed." >&2 ; exit 2; }
+ $vdex_cmdline || { echo "Dex2oat failed." >&2 ; exit 2; }
$strip_cmdline || { echo "Strip failed." >&2 ; exit 3; }
# For running, we must turn off logging when dex2oat or patchoat are missing. Otherwise we use
diff --git a/test/run-test b/test/run-test
index 37eefb3..ea9622a 100755
--- a/test/run-test
+++ b/test/run-test
@@ -351,6 +351,9 @@
elif [ "x$1" = "x--bisection-search" ]; then
bisection_search="yes"
shift
+ elif [ "x$1" = "x--vdex" ]; then
+ run_args="${run_args} --vdex"
+ shift
elif expr "x$1" : "x--" >/dev/null 2>&1; then
echo "unknown $0 option: $1" 1>&2
usage="yes"
@@ -640,6 +643,7 @@
echo " --pic-test Compile the test code position independent."
echo " --quiet Don't print anything except failure messages"
echo " --bisection-search Perform bisection bug search."
+ echo " --vdex Test using vdex as in input to dex2oat. Only works with --prebuild."
) 1>&2 # Direct to stderr so usage is not printed if --quiet is set.
exit 1
fi
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
new file mode 100644
index 0000000..3e2b168
--- /dev/null
+++ b/test/ti-agent/common_helper.cc
@@ -0,0 +1,91 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "ti-agent/common_helper.h"
+
+#include <stdio.h>
+
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+#include "ti-agent/common_load.h"
+#include "utils.h"
+
+namespace art {
+bool RuntimeIsJVM;
+
+bool IsJVM() {
+ return RuntimeIsJVM;
+}
+
+void SetAllCapabilities(jvmtiEnv* env) {
+ jvmtiCapabilities caps;
+ env->GetPotentialCapabilities(&caps);
+ env->AddCapabilities(&caps);
+}
+
+namespace common_redefine {
+
+using RedefineDirectFunction = jvmtiError (*)(jvmtiEnv*, jclass, jint, const unsigned char*);
+static void DoClassTransformation(jvmtiEnv* jvmti_env, JNIEnv* env,
+ jclass target,
+ jbyteArray class_file_bytes,
+ jbyteArray dex_file_bytes) {
+ jbyteArray desired_array = IsJVM() ? class_file_bytes : dex_file_bytes;
+ jint len = static_cast<jint>(env->GetArrayLength(desired_array));
+ const unsigned char* redef_bytes = reinterpret_cast<const unsigned char*>(
+ env->GetByteArrayElements(desired_array, nullptr));
+ jvmtiError res;
+ if (IsJVM()) {
+ jvmtiClassDefinition def;
+ def.klass = target;
+ def.class_byte_count = static_cast<jint>(len);
+ def.class_bytes = redef_bytes;
+ res = jvmti_env->RedefineClasses(1, &def);
+ } else {
+ RedefineDirectFunction f =
+ reinterpret_cast<RedefineDirectFunction>(jvmti_env->functions->reserved3);
+ res = f(jvmti_env, target, len, redef_bytes);
+ }
+ if (res != JVMTI_ERROR_NONE) {
+ printf("Redefinition failed!");
+ }
+}
+
+// Magic JNI export that classes can use for redefining classes.
+// To use classes should declare this as a native function with signature (Ljava/lang/Class;[B[B)V
+extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRedefinition(JNIEnv* env,
+ jclass,
+ jclass target,
+ jbyteArray class_file_bytes,
+ jbyteArray dex_file_bytes) {
+ DoClassTransformation(jvmti_env, env, target, class_file_bytes, dex_file_bytes);
+}
+
+// Don't do anything
+jint OnLoad(JavaVM* vm,
+ char* options ATTRIBUTE_UNUSED,
+ void* reserved ATTRIBUTE_UNUSED) {
+ if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+ printf("Unable to get jvmti env!\n");
+ return 1;
+ }
+ SetAllCapabilities(jvmti_env);
+ return 0;
+}
+
+} // namespace common_redefine
+
+} // namespace art
diff --git a/test/ti-agent/common_helper.h b/test/ti-agent/common_helper.h
index 84997f3..76543fe 100644
--- a/test/ti-agent/common_helper.h
+++ b/test/ti-agent/common_helper.h
@@ -18,9 +18,19 @@
#define ART_TEST_TI_AGENT_COMMON_HELPER_H_
#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
#include "ScopedLocalRef.h"
namespace art {
+namespace common_redefine {
+
+jint OnLoad(JavaVM* vm, char* options, void* reserved);
+
+} // namespace common_redefine
+
+extern bool RuntimeIsJVM;
+
+bool IsJVM();
template <typename T>
static jobjectArray CreateObjectArray(JNIEnv* env,
@@ -53,11 +63,7 @@
return ret.release();
}
-static void SetAllCapabilities(jvmtiEnv* env) {
- jvmtiCapabilities caps;
- env->GetPotentialCapabilities(&caps);
- env->AddCapabilities(&caps);
-}
+void SetAllCapabilities(jvmtiEnv* env);
} // namespace art
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index a959482..3886148 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -23,9 +23,9 @@
#include "base/logging.h"
#include "base/macros.h"
#include "common_load.h"
+#include "common_helper.h"
#include "901-hello-ti-agent/basics.h"
-#include "902-hello-transformation/transform.h"
#include "903-hello-tagging/tagging.h"
#include "904-object-allocation/tracking.h"
#include "905-object-free/tracking_free.h"
@@ -54,7 +54,7 @@
// A list of all the agents we have for testing.
AgentLib agents[] = {
{ "901-hello-ti-agent", Test901HelloTi::OnLoad, nullptr },
- { "902-hello-transformation", Test902HelloTransformation::OnLoad, nullptr },
+ { "902-hello-transformation", common_redefine::OnLoad, nullptr },
{ "903-hello-tagging", Test903HelloTagging::OnLoad, nullptr },
{ "904-object-allocation", Test904ObjectAllocation::OnLoad, nullptr },
{ "905-object-free", Test905ObjectFree::OnLoad, nullptr },
@@ -66,6 +66,7 @@
{ "911-get-stack-trace", Test911GetStackTrace::OnLoad, nullptr },
{ "912-classes", Test912Classes::OnLoad, nullptr },
{ "913-heaps", Test913Heaps::OnLoad, nullptr },
+ { "917-fields-transformation", common_redefine::OnLoad, nullptr },
};
static AgentLib* FindAgent(char* name) {
@@ -95,6 +96,10 @@
return true;
}
+static void SetIsJVM(char* options) {
+ RuntimeIsJVM = strncmp(options, "jvm", 3) == 0;
+}
+
extern "C" JNIEXPORT jint JNICALL Agent_OnLoad(JavaVM* vm, char* options, void* reserved) {
char* remaining_options = nullptr;
char* name_option = nullptr;
@@ -112,6 +117,7 @@
printf("agent: %s does not include an OnLoad method.\n", name_option);
return -3;
}
+ SetIsJVM(remaining_options);
return lib->load(vm, remaining_options, reserved);
}
@@ -132,6 +138,7 @@
printf("agent: %s does not include an OnAttach method.\n", name_option);
return -3;
}
+ SetIsJVM(remaining_options);
return lib->attach(vm, remaining_options, reserved);
}
diff --git a/tools/ahat/Android.mk b/tools/ahat/Android.mk
index 27c2054..493eafb 100644
--- a/tools/ahat/Android.mk
+++ b/tools/ahat/Android.mk
@@ -48,7 +48,7 @@
include $(CLEAR_VARS)
LOCAL_SRC_FILES := $(call all-java-files-under, test)
LOCAL_JAR_MANIFEST := test/manifest.txt
-LOCAL_STATIC_JAVA_LIBRARIES := ahat junit
+LOCAL_STATIC_JAVA_LIBRARIES := ahat junit-host
LOCAL_IS_HOST_MODULE := true
LOCAL_MODULE_TAGS := tests
LOCAL_MODULE := ahat-tests
diff --git a/tools/art b/tools/art
index 1394a46..91d6e27 100644
--- a/tools/art
+++ b/tools/art
@@ -30,8 +30,9 @@
}
function find_libdir() {
+ # Get the actual file, $DALVIKVM may be a symbolic link.
# Use realpath instead of readlink because Android does not have a readlink.
- if [ "$(realpath "$ANDROID_ROOT/bin/$DALVIKVM")" = "$(realpath "$ANDROID_ROOT/bin/dalvikvm64")" ]; then
+ if [[ "$(realpath "$ANDROID_ROOT/bin/$DALVIKVM")" == *dalvikvm64 ]]; then
echo "lib64"
else
echo "lib"
diff --git a/tools/cpp-define-generator/offset_dexcache.def b/tools/cpp-define-generator/offset_dexcache.def
index 4b9d481..abb5e1e 100644
--- a/tools/cpp-define-generator/offset_dexcache.def
+++ b/tools/cpp-define-generator/offset_dexcache.def
@@ -38,7 +38,6 @@
DEFINE_ART_METHOD_OFFSET_SIZED(JNI, EntryPointFromJni)
DEFINE_ART_METHOD_OFFSET_SIZED(QUICK_CODE, EntryPointFromQuickCompiledCode)
DEFINE_ART_METHOD_OFFSET(DECLARING_CLASS, DeclaringClass)
-DEFINE_DECLARING_CLASS_OFFSET(DEX_CACHE_STRINGS, DexCacheStrings)
#undef DEFINE_ART_METHOD_OFFSET
#undef DEFINE_ART_METHOD_OFFSET_32
diff --git a/tools/dexfuzz/README b/tools/dexfuzz/README
index a0658ec..c1cdf1e 100644
--- a/tools/dexfuzz/README
+++ b/tools/dexfuzz/README
@@ -4,7 +4,7 @@
DexFuzz is primarily a tool for fuzzing DEX files. Fuzzing is the introduction of
subtle changes ("mutations") to a file to produce a new test case. These test cases
can be used to test the various modes of execution available to ART (Interpreter,
-Quick compiler, Optimizing compiler) to check for bugs in these modes of execution.
+Optimizing compiler) to check for bugs in these modes of execution.
This is done by differential testing - each test file is executed with each mode of
execution, and any differences between the resulting outputs may be an indication of
a bug in one of the modes.
@@ -53,17 +53,16 @@
And also at least two of the following backends:
--interpreter
- --quick
--optimizing
Note that if you wanted to test both ARM and ARM64 on an ARM64 device, you can use
--allarm. Also in this case only one backend is needed, if i.e., you wanted to test
-ARM Quick Backend vs. ARM64 Quick Backend.
+ARM Optimizing Backend vs. ARM64 Optimizing Backend.
Some legal examples:
- --arm --quick --optimizing
- --x86 --quick --optimizing --interpreter
- --allarm --quick
+ --arm --optimizing --interpreter
+ --x86 --optimizing --interpreter
+ --allarm --optimizing
Add in --device=<device name, e.g. device:generic> if you want to specify a device.
Add in --execute-dir=<dir on device> if you want to specify an execution directory.
@@ -98,7 +97,6 @@
those occurrences.
Timed Out - mutated files that timed out for one or more backends.
Current timeouts are:
- Quick - 5 seconds
Optimizing - 5 seconds
Intepreter - 30 seconds
(use --short-timeouts to set all backends to 2 seconds.)
diff --git a/tools/dexfuzz/src/dexfuzz/DexFuzz.java b/tools/dexfuzz/src/dexfuzz/DexFuzz.java
index 7337ffc..18db4c1 100644
--- a/tools/dexfuzz/src/dexfuzz/DexFuzz.java
+++ b/tools/dexfuzz/src/dexfuzz/DexFuzz.java
@@ -21,9 +21,9 @@
import dexfuzz.fuzzers.FuzzerMultipleNoExecute;
import dexfuzz.fuzzers.FuzzerSingleExecute;
import dexfuzz.fuzzers.FuzzerSingleNoExecute;
-import dexfuzz.listeners.BaseListener;
import dexfuzz.listeners.BisectionSearchListener;
import dexfuzz.listeners.ConsoleLoggerListener;
+import dexfuzz.listeners.FinalStatusListener;
import dexfuzz.listeners.LogFileListener;
import dexfuzz.listeners.MultiplexerListener;
import dexfuzz.listeners.UniqueProgramTrackerListener;
@@ -52,12 +52,15 @@
Options.usage();
}
- // Create the Listener, which will listen for events and report them.
- BaseListener listener = null;
+
+ // Create a Listener that is responsible for multiple Listeners.
+ MultiplexerListener multipleListener = new MultiplexerListener();
+ multipleListener.setup();
+
+ FinalStatusListener statusListener = new FinalStatusListener();
+ multipleListener.addListener(statusListener);
+
if (Options.repeat > 1 && Options.execute) {
- // Create a Listener that is responsible for multiple Listeners.
- MultiplexerListener multipleListener = new MultiplexerListener();
- multipleListener.setup();
// Add the live updating listener, but only if we're not printing out lots of logs.
if (!Log.likelyToLog()) {
multipleListener.addListener(new UpdatingConsoleListener());
@@ -73,22 +76,21 @@
}
// Add the unique program tracker.
multipleListener.addListener(new UniqueProgramTrackerListener(Options.uniqueDatabaseFile));
- listener = multipleListener;
} else {
// Just use the basic listener.
- listener = new ConsoleLoggerListener();
+ multipleListener.addListener(new ConsoleLoggerListener());
}
// Create the Fuzzer that uses a particular strategy for fuzzing.
Fuzzer fuzzer = null;
if ((Options.repeat > 1) && Options.execute) {
- fuzzer = new FuzzerMultipleExecute(listener);
+ fuzzer = new FuzzerMultipleExecute(multipleListener);
} else if ((Options.repeat > 1) && !Options.execute) {
- fuzzer = new FuzzerMultipleNoExecute(listener);
+ fuzzer = new FuzzerMultipleNoExecute(multipleListener);
} else if ((Options.repeat == 1) && Options.execute) {
- fuzzer = new FuzzerSingleExecute(listener);
+ fuzzer = new FuzzerSingleExecute(multipleListener);
} else if ((Options.repeat == 1) && !Options.execute) {
- fuzzer = new FuzzerSingleNoExecute(listener);
+ fuzzer = new FuzzerSingleNoExecute(multipleListener);
} else {
Log.errorAndQuit("Invalid options provided, desired fuzzer unknown.");
}
@@ -101,6 +103,10 @@
fuzzer.shutdown();
// Cleanup the Listener.
- listener.shutdown();
+ multipleListener.shutdown();
+
+ if (!statusListener.isSuccessful()) {
+ System.exit(1);
+ }
}
}
diff --git a/tools/dexfuzz/src/dexfuzz/Options.java b/tools/dexfuzz/src/dexfuzz/Options.java
index b442b22..99e03e8 100644
--- a/tools/dexfuzz/src/dexfuzz/Options.java
+++ b/tools/dexfuzz/src/dexfuzz/Options.java
@@ -51,6 +51,7 @@
public static boolean usingSpecificDevice = false;
public static int repeat = 1;
public static String executeDirectory = "/data/art-test";
+ public static String androidRoot = "";
public static String dumpMutationsFile = "mutations.dump";
public static String loadMutationsFile = "mutations.dump";
public static String reportLogFile = "report.log";
@@ -61,7 +62,6 @@
public static boolean executeOnHost;
public static boolean noBootImage;
public static boolean useInterpreter;
- public static boolean useQuick;
public static boolean useOptimizing;
public static boolean useArchArm;
public static boolean useArchArm64;
@@ -96,12 +96,13 @@
Log.always(" the argument given to adb -s. Default execution mode.");
Log.always(" --execute-dir=<dir> : Push tests to this directory to execute them.");
Log.always(" (Default: /data/art-test)");
+ Log.always(" --android-root=<dir> : Set path where dalvikvm should look for binaries.");
+ Log.always(" Use this when pushing binaries to a custom location.");
Log.always(" --no-boot-image : Use this flag when boot.art is not available.");
Log.always(" --skip-host-verify : When executing, skip host-verification stage");
Log.always(" --execute-class=<c> : When executing, execute this class (default: Main)");
Log.always("");
Log.always(" --interpreter : Include the Interpreter in comparisons");
- Log.always(" --quick : Include the Quick Compiler in comparisons");
Log.always(" --optimizing : Include the Optimizing Compiler in comparisons");
Log.always("");
Log.always(" --arm : Include ARM backends in comparisons");
@@ -160,8 +161,6 @@
skipHostVerify = true;
} else if (flag.equals("interpreter")) {
useInterpreter = true;
- } else if (flag.equals("quick")) {
- useQuick = true;
} else if (flag.equals("optimizing")) {
useOptimizing = true;
} else if (flag.equals("arm")) {
@@ -261,6 +260,8 @@
usingSpecificDevice = true;
} else if (key.equals("execute-dir")) {
executeDirectory = value;
+ } else if (key.equals("android-root")) {
+ androidRoot = value;
} else {
Log.error("Unrecognised key: --" + key);
usage();
@@ -423,18 +424,15 @@
if (useInterpreter) {
backends++;
}
- if (useQuick) {
- backends++;
- }
if (useOptimizing) {
backends++;
}
if (useArchArm && useArchArm64) {
- // Could just be comparing quick-ARM versus quick-ARM64?
+ // Could just be comparing optimizing-ARM versus optimizing-ARM64?
backends++;
}
if (backends < 2) {
- Log.error("Not enough backends specified! Try --quick --interpreter!");
+ Log.error("Not enough backends specified! Try --optimizing --interpreter!");
return false;
}
}
diff --git a/tools/dexfuzz/src/dexfuzz/executors/Arm64OptimizingBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/Arm64OptimizingBackendExecutor.java
index 72e36e8..84ed4c4 100644
--- a/tools/dexfuzz/src/dexfuzz/executors/Arm64OptimizingBackendExecutor.java
+++ b/tools/dexfuzz/src/dexfuzz/executors/Arm64OptimizingBackendExecutor.java
@@ -29,6 +29,9 @@
protected String constructCommand(String programName) {
StringBuilder commandBuilder = new StringBuilder();
commandBuilder.append("dalvikvm64 -Xcompiler-option --compiler-backend=Optimizing ");
+ // The -Xno-dex-file-fallback option ensures that the execution does not default to
+ // interpreter if compilations fails.
+ commandBuilder.append("-Xno-dex-file-fallback ");
if (device.noBootImageAvailable()) {
commandBuilder.append("-Ximage:/data/art-test/core.art -Xnorelocate ");
}
diff --git a/tools/dexfuzz/src/dexfuzz/executors/Arm64QuickBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/Arm64QuickBackendExecutor.java
deleted file mode 100644
index d9228ed..0000000
--- a/tools/dexfuzz/src/dexfuzz/executors/Arm64QuickBackendExecutor.java
+++ /dev/null
@@ -1,39 +0,0 @@
-/*
- * Copyright (C) 2014 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-package dexfuzz.executors;
-
-import dexfuzz.listeners.BaseListener;
-
-public class Arm64QuickBackendExecutor extends Executor {
-
- public Arm64QuickBackendExecutor(BaseListener listener, Device device) {
- super("ARM64 Quick Backend", 5, listener, Architecture.ARM64, device,
- /*needsCleanCodeCache*/ true, /*isBisectable*/ false);
- }
-
- @Override
- protected String constructCommand(String programName) {
- StringBuilder commandBuilder = new StringBuilder();
- commandBuilder.append("dalvikvm64 -Xcompiler-option --compiler-backend=Quick ");
- if (device.noBootImageAvailable()) {
- commandBuilder.append("-Ximage:/data/art-test/core.art -Xnorelocate ");
- }
- commandBuilder.append("-cp ").append(testLocation).append("/").append(programName).append(" ");
- commandBuilder.append(executeClass);
- return commandBuilder.toString();
- }
-}
diff --git a/tools/dexfuzz/src/dexfuzz/executors/ArmOptimizingBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/ArmOptimizingBackendExecutor.java
index ded8cf9..26a5eea 100644
--- a/tools/dexfuzz/src/dexfuzz/executors/ArmOptimizingBackendExecutor.java
+++ b/tools/dexfuzz/src/dexfuzz/executors/ArmOptimizingBackendExecutor.java
@@ -29,6 +29,9 @@
protected String constructCommand(String programName) {
StringBuilder commandBuilder = new StringBuilder();
commandBuilder.append("dalvikvm32 -Xcompiler-option --compiler-backend=Optimizing ");
+ // The -Xno-dex-file-fallback option ensures that the execution does not default to
+ // interpreter if compilations fails.
+ commandBuilder.append("-Xno-dex-file-fallback ");
if (device.noBootImageAvailable()) {
commandBuilder.append("-Ximage:/data/art-test/core.art -Xnorelocate ");
}
diff --git a/tools/dexfuzz/src/dexfuzz/executors/ArmQuickBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/ArmQuickBackendExecutor.java
deleted file mode 100644
index 0eb35f7..0000000
--- a/tools/dexfuzz/src/dexfuzz/executors/ArmQuickBackendExecutor.java
+++ /dev/null
@@ -1,39 +0,0 @@
-/*
- * Copyright (C) 2014 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-package dexfuzz.executors;
-
-import dexfuzz.listeners.BaseListener;
-
-public class ArmQuickBackendExecutor extends Executor {
-
- public ArmQuickBackendExecutor(BaseListener listener, Device device) {
- super("ARM Quick Backend", 5, listener, Architecture.ARM, device,
- /*needsCleanCodeCache*/ true, /*isBisectable*/ false);
- }
-
- @Override
- protected String constructCommand(String programName) {
- StringBuilder commandBuilder = new StringBuilder();
- commandBuilder.append("dalvikvm32 -Xcompiler-option --compiler-backend=Quick ");
- if (device.noBootImageAvailable()) {
- commandBuilder.append("-Ximage:/data/art-test/core.art -Xnorelocate ");
- }
- commandBuilder.append("-cp ").append(testLocation).append("/").append(programName).append(" ");
- commandBuilder.append(executeClass);
- return commandBuilder.toString();
- }
-}
diff --git a/tools/dexfuzz/src/dexfuzz/executors/Device.java b/tools/dexfuzz/src/dexfuzz/executors/Device.java
index 72f73b8..ba1365e 100644
--- a/tools/dexfuzz/src/dexfuzz/executors/Device.java
+++ b/tools/dexfuzz/src/dexfuzz/executors/Device.java
@@ -272,7 +272,7 @@
}
public void cleanCodeCache(Architecture architecture, String testLocation, String programName) {
- String command = "rm -f " + getCacheLocation(architecture)
+ String command = getExecutionPrefixWithAdb("shell") + "rm -f " + getCacheLocation(architecture)
+ getOatFileName(testLocation, programName);
executeCommand(command, false);
}
@@ -280,7 +280,11 @@
public void pushProgramToDevice(String programName, String testLocation) {
assert(!isHost);
if (!programPushed) {
- executeCommand(getExecutionPrefixWithAdb("push") + programName + " " + testLocation, false);
+ String command = getExecutionPrefixWithAdb("push") + programName + " " + testLocation;
+ ExecutionResult result = executeCommand(command, false);
+ if (result.returnValue != 0) {
+ Log.errorAndQuit("Could not ADB PUSH program to device.");
+ }
programPushed = true;
}
}
diff --git a/tools/dexfuzz/src/dexfuzz/executors/Executor.java b/tools/dexfuzz/src/dexfuzz/executors/Executor.java
index c62a3ad..2bcf3a1 100644
--- a/tools/dexfuzz/src/dexfuzz/executors/Executor.java
+++ b/tools/dexfuzz/src/dexfuzz/executors/Executor.java
@@ -177,7 +177,15 @@
* Executes runtime.
*/
public void execute(String programName) {
- executionResult = executeCommandWithTimeout(constructCommand(programName), true);
+ String command = "";
+ String androidRoot = Options.androidRoot.trim();
+ if (androidRoot.length() != 0) {
+ command = "PATH=" + androidRoot + "/bin ";
+ command += "ANDROID_ROOT=" + androidRoot + " ";
+ command += "LD_LIBRARY_PATH="+ androidRoot + "/lib:" + androidRoot + "/lib64 ";
+ }
+ command += constructCommand(programName);
+ executionResult = executeCommandWithTimeout(command, true);
}
/**
diff --git a/tools/dexfuzz/src/dexfuzz/executors/Mips64OptimizingBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/Mips64OptimizingBackendExecutor.java
index 72d43e7..883ff2a 100644
--- a/tools/dexfuzz/src/dexfuzz/executors/Mips64OptimizingBackendExecutor.java
+++ b/tools/dexfuzz/src/dexfuzz/executors/Mips64OptimizingBackendExecutor.java
@@ -29,6 +29,9 @@
protected String constructCommand(String programName) {
StringBuilder commandBuilder = new StringBuilder();
commandBuilder.append("dalvikvm64 -Xcompiler-option --compiler-backend=Optimizing ");
+ // The -Xno-dex-file-fallback option ensures that the execution does not default to
+ // interpreter if compilations fails.
+ commandBuilder.append("-Xno-dex-file-fallback ");
commandBuilder.append("-cp ").append(testLocation).append("/").append(programName).append(" ");
commandBuilder.append(executeClass);
return commandBuilder.toString();
diff --git a/tools/dexfuzz/src/dexfuzz/executors/Mips64QuickBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/Mips64QuickBackendExecutor.java
deleted file mode 100644
index e7e5ff6..0000000
--- a/tools/dexfuzz/src/dexfuzz/executors/Mips64QuickBackendExecutor.java
+++ /dev/null
@@ -1,36 +0,0 @@
-/*
- * Copyright (C) 2014 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-package dexfuzz.executors;
-
-import dexfuzz.listeners.BaseListener;
-
-public class Mips64QuickBackendExecutor extends Executor {
-
- public Mips64QuickBackendExecutor(BaseListener listener, Device device) {
- super("MIPS64 Quick Backend", 5, listener, Architecture.MIPS64, device,
- /*needsCleanCodeCache*/ true, /*isBisectable*/ false);
- }
-
- @Override
- protected String constructCommand(String programName) {
- StringBuilder commandBuilder = new StringBuilder();
- commandBuilder.append("dalvikvm64 -Xcompiler-option --compiler-backend=Quick ");
- commandBuilder.append("-cp ").append(testLocation).append("/").append(programName).append(" ");
- commandBuilder.append(executeClass);
- return commandBuilder.toString();
- }
-}
diff --git a/tools/dexfuzz/src/dexfuzz/executors/MipsOptimizingBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/MipsOptimizingBackendExecutor.java
index 63f6858..b7babdc 100644
--- a/tools/dexfuzz/src/dexfuzz/executors/MipsOptimizingBackendExecutor.java
+++ b/tools/dexfuzz/src/dexfuzz/executors/MipsOptimizingBackendExecutor.java
@@ -29,6 +29,9 @@
protected String constructCommand(String programName) {
StringBuilder commandBuilder = new StringBuilder();
commandBuilder.append("dalvikvm32 -Xcompiler-option --compiler-backend=Optimizing ");
+ // The -Xno-dex-file-fallback option ensures that the execution does not default to
+ // interpreter if compilations fails.
+ commandBuilder.append("-Xno-dex-file-fallback ");
commandBuilder.append("-cp ").append(testLocation).append("/").append(programName).append(" ");
commandBuilder.append(executeClass);
return commandBuilder.toString();
diff --git a/tools/dexfuzz/src/dexfuzz/executors/MipsQuickBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/MipsQuickBackendExecutor.java
deleted file mode 100644
index b262090..0000000
--- a/tools/dexfuzz/src/dexfuzz/executors/MipsQuickBackendExecutor.java
+++ /dev/null
@@ -1,36 +0,0 @@
-/*
- * Copyright (C) 2014 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-package dexfuzz.executors;
-
-import dexfuzz.listeners.BaseListener;
-
-public class MipsQuickBackendExecutor extends Executor {
-
- public MipsQuickBackendExecutor(BaseListener listener, Device device) {
- super("MIPS Quick Backend", 5, listener, Architecture.MIPS, device,
- /*needsCleanCodeCache*/ true, /*isBisectable*/ false);
- }
-
- @Override
- protected String constructCommand(String programName) {
- StringBuilder commandBuilder = new StringBuilder();
- commandBuilder.append("dalvikvm32 -Xcompiler-option --compiler-backend=Quick ");
- commandBuilder.append("-cp ").append(testLocation).append("/").append(programName).append(" ");
- commandBuilder.append(executeClass);
- return commandBuilder.toString();
- }
-}
diff --git a/tools/dexfuzz/src/dexfuzz/executors/X86OptimizingBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/X86OptimizingBackendExecutor.java
index 5908a8b..1d62051 100644
--- a/tools/dexfuzz/src/dexfuzz/executors/X86OptimizingBackendExecutor.java
+++ b/tools/dexfuzz/src/dexfuzz/executors/X86OptimizingBackendExecutor.java
@@ -30,6 +30,9 @@
protected String constructCommand(String programName) {
StringBuilder commandBuilder = new StringBuilder();
commandBuilder.append("dalvikvm32 -Xcompiler-option --compiler-backend=Optimizing ");
+ // The -Xno-dex-file-fallback option ensures that the execution does not default to
+ // interpreter if compilations fails.
+ commandBuilder.append("-Xno-dex-file-fallback ");
if (Options.executeOnHost) {
commandBuilder.append(device.getHostExecutionFlags()).append(" ");
}
diff --git a/tools/dexfuzz/src/dexfuzz/executors/X86QuickBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/X86QuickBackendExecutor.java
deleted file mode 100644
index 9e8039d..0000000
--- a/tools/dexfuzz/src/dexfuzz/executors/X86QuickBackendExecutor.java
+++ /dev/null
@@ -1,40 +0,0 @@
-/*
- * Copyright (C) 2014 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-package dexfuzz.executors;
-
-import dexfuzz.Options;
-import dexfuzz.listeners.BaseListener;
-
-public class X86QuickBackendExecutor extends Executor {
-
- public X86QuickBackendExecutor(BaseListener listener, Device device) {
- super("x86 Quick Backend", 5, listener, Architecture.X86, device,
- /*needsCleanCodeCache*/ true, /*isBisectable*/ false);
- }
-
- @Override
- protected String constructCommand(String programName) {
- StringBuilder commandBuilder = new StringBuilder();
- commandBuilder.append("dalvikvm32 -Xcompiler-option --compiler-backend=Quick ");
- if (Options.executeOnHost) {
- commandBuilder.append(device.getHostExecutionFlags()).append(" ");
- }
- commandBuilder.append("-cp ").append(testLocation).append("/").append(programName).append(" ");
- commandBuilder.append(executeClass);
- return commandBuilder.toString();
- }
-}
diff --git a/tools/dexfuzz/src/dexfuzz/executors/X86_64OptimizingBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/X86_64OptimizingBackendExecutor.java
index 28ff1a5..ad44259 100644
--- a/tools/dexfuzz/src/dexfuzz/executors/X86_64OptimizingBackendExecutor.java
+++ b/tools/dexfuzz/src/dexfuzz/executors/X86_64OptimizingBackendExecutor.java
@@ -29,6 +29,9 @@
protected String constructCommand(String programName) {
StringBuilder commandBuilder = new StringBuilder();
commandBuilder.append("dalvikvm64 -Xcompiler-option --compiler-backend=Optimizing ");
+ // The -Xno-dex-file-fallback option ensures that the execution does not default to
+ // interpreter if compilations fails.
+ commandBuilder.append("-Xno-dex-file-fallback ");
commandBuilder.append("-cp ").append(testLocation).append("/").append(programName).append(" ");
commandBuilder.append(executeClass);
return commandBuilder.toString();
diff --git a/tools/dexfuzz/src/dexfuzz/executors/X86_64QuickBackendExecutor.java b/tools/dexfuzz/src/dexfuzz/executors/X86_64QuickBackendExecutor.java
deleted file mode 100644
index 22cafe2..0000000
--- a/tools/dexfuzz/src/dexfuzz/executors/X86_64QuickBackendExecutor.java
+++ /dev/null
@@ -1,36 +0,0 @@
-/*
- * Copyright (C) 2014 The Android Open Source Project
- *
- * Licensed under the Apache License, Version 2.0 (the "License");
- * you may not use this file except in compliance with the License.
- * You may obtain a copy of the License at
- *
- * http://www.apache.org/licenses/LICENSE-2.0
- *
- * Unless required by applicable law or agreed to in writing, software
- * distributed under the License is distributed on an "AS IS" BASIS,
- * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
- * See the License for the specific language governing permissions and
- * limitations under the License.
- */
-
-package dexfuzz.executors;
-
-import dexfuzz.listeners.BaseListener;
-
-public class X86_64QuickBackendExecutor extends Executor {
-
- public X86_64QuickBackendExecutor(BaseListener listener, Device device) {
- super("x86_64 Quick Backend", 5, listener, Architecture.X86_64, device,
- /*needsCleanCodeCache*/ true, /*isBisectable*/ false);
- }
-
- @Override
- protected String constructCommand(String programName) {
- StringBuilder commandBuilder = new StringBuilder();
- commandBuilder.append("dalvikvm64 -Xcompiler-option --compiler-backend=Quick ");
- commandBuilder.append("-cp ").append(testLocation).append("/").append(programName).append(" ");
- commandBuilder.append(executeClass);
- return commandBuilder.toString();
- }
-}
diff --git a/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java b/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java
index bc39d79..1797d90 100644
--- a/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java
+++ b/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java
@@ -22,24 +22,18 @@
import dexfuzz.executors.Architecture;
import dexfuzz.executors.Arm64InterpreterExecutor;
import dexfuzz.executors.Arm64OptimizingBackendExecutor;
-import dexfuzz.executors.Arm64QuickBackendExecutor;
import dexfuzz.executors.ArmInterpreterExecutor;
import dexfuzz.executors.ArmOptimizingBackendExecutor;
-import dexfuzz.executors.ArmQuickBackendExecutor;
import dexfuzz.executors.Device;
import dexfuzz.executors.Executor;
import dexfuzz.executors.Mips64InterpreterExecutor;
import dexfuzz.executors.Mips64OptimizingBackendExecutor;
-import dexfuzz.executors.Mips64QuickBackendExecutor;
import dexfuzz.executors.MipsInterpreterExecutor;
import dexfuzz.executors.MipsOptimizingBackendExecutor;
-import dexfuzz.executors.MipsQuickBackendExecutor;
import dexfuzz.executors.X86InterpreterExecutor;
import dexfuzz.executors.X86OptimizingBackendExecutor;
-import dexfuzz.executors.X86QuickBackendExecutor;
import dexfuzz.executors.X86_64InterpreterExecutor;
import dexfuzz.executors.X86_64OptimizingBackendExecutor;
-import dexfuzz.executors.X86_64QuickBackendExecutor;
import dexfuzz.listeners.BaseListener;
import dexfuzz.program.Mutation;
import dexfuzz.program.Program;
@@ -121,18 +115,13 @@
}
}
- private void addExecutorsForArchitecture(Device device, Class<? extends Executor> quick,
- Class<? extends Executor> optimizing, Class<? extends Executor> interpreter) {
- // NB: Currently QuickBackend MUST come immediately before same arch's Interpreter.
+ private void addExecutorsForArchitecture(Device device, Class<? extends Executor> optimizing,
+ Class<? extends Executor> interpreter) {
+ // NB: Currently OptimizingBackend MUST come immediately before same arch's Interpreter.
// This is because intepreter execution relies on there being an OAT file already
// created to produce correct debug information. Otherwise we will see
// false-positive divergences.
try {
- if (Options.useQuick) {
- Constructor<? extends Executor> constructor =
- quick.getConstructor(BaseListener.class, Device.class);
- executors.add(constructor.newInstance(listener, device));
- }
if (Options.useOptimizing) {
Constructor<? extends Executor> constructor =
optimizing.getConstructor(BaseListener.class, Device.class);
@@ -165,33 +154,33 @@
}
if (Options.useArchArm64) {
- addExecutorsForArchitecture(device, Arm64QuickBackendExecutor.class,
- Arm64OptimizingBackendExecutor.class, Arm64InterpreterExecutor.class);
+ addExecutorsForArchitecture(device, Arm64OptimizingBackendExecutor.class,
+ Arm64InterpreterExecutor.class);
}
if (Options.useArchArm) {
- addExecutorsForArchitecture(device, ArmQuickBackendExecutor.class,
- ArmOptimizingBackendExecutor.class, ArmInterpreterExecutor.class);
+ addExecutorsForArchitecture(device, ArmOptimizingBackendExecutor.class,
+ ArmInterpreterExecutor.class);
}
if (Options.useArchX86_64) {
- addExecutorsForArchitecture(device, X86_64QuickBackendExecutor.class,
- X86_64OptimizingBackendExecutor.class, X86_64InterpreterExecutor.class);
+ addExecutorsForArchitecture(device, X86_64OptimizingBackendExecutor.class,
+ X86_64InterpreterExecutor.class);
}
if (Options.useArchX86) {
- addExecutorsForArchitecture(device, X86QuickBackendExecutor.class,
- X86OptimizingBackendExecutor.class, X86InterpreterExecutor.class);
+ addExecutorsForArchitecture(device, X86OptimizingBackendExecutor.class,
+ X86InterpreterExecutor.class);
}
if (Options.useArchMips64) {
- addExecutorsForArchitecture(device, Mips64QuickBackendExecutor.class,
- Mips64OptimizingBackendExecutor.class, Mips64InterpreterExecutor.class);
+ addExecutorsForArchitecture(device, Mips64OptimizingBackendExecutor.class,
+ Mips64InterpreterExecutor.class);
}
if (Options.useArchMips) {
- addExecutorsForArchitecture(device, MipsQuickBackendExecutor.class,
- MipsOptimizingBackendExecutor.class, MipsInterpreterExecutor.class);
+ addExecutorsForArchitecture(device, MipsOptimizingBackendExecutor.class,
+ MipsInterpreterExecutor.class);
}
// Add the first backend as the golden executor for self-divergence tests.
diff --git a/tools/dexfuzz/src/dexfuzz/listeners/FinalStatusListener.java b/tools/dexfuzz/src/dexfuzz/listeners/FinalStatusListener.java
new file mode 100644
index 0000000..0f85f62
--- /dev/null
+++ b/tools/dexfuzz/src/dexfuzz/listeners/FinalStatusListener.java
@@ -0,0 +1,52 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ * http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package dexfuzz.listeners;
+
+import java.util.List;
+import java.util.Map;
+
+import dexfuzz.executors.Executor;
+
+/**
+ * Counts divergences as they appear and checks if the testing was successful
+ * or not. Testing is successful if all divergences found are either self
+ * divergent or caused by differences in architectures.
+ */
+public class FinalStatusListener extends BaseListener {
+ private long divergence;
+ private long selfDivergent;
+ private long architectureSplit;
+
+ @Override
+ public void handleDivergences(Map<String, List<Executor>> outputMap) {
+ divergence++;
+ }
+
+ @Override
+ public void handleSelfDivergence() {
+ selfDivergent++;
+ }
+
+ @Override
+ public void handleArchitectureSplit() {
+ architectureSplit++;
+ }
+
+ public boolean isSuccessful() {
+ return (divergence - selfDivergent - architectureSplit) == 0;
+ }
+}
diff --git a/tools/dexfuzz/src/dexfuzz/program/CodeTranslator.java b/tools/dexfuzz/src/dexfuzz/program/CodeTranslator.java
index 650501b..5335d15 100644
--- a/tools/dexfuzz/src/dexfuzz/program/CodeTranslator.java
+++ b/tools/dexfuzz/src/dexfuzz/program/CodeTranslator.java
@@ -259,8 +259,15 @@
// Get the MInsns that form the start and end of the try block.
int startLocation = tryItem.startAddr;
mTryBlock.startInsn = insnLocationMap.get(startLocation);
- int endLocation = tryItem.startAddr + tryItem.insnCount;
+
+ // The instructions vary in size, so we have to find the last instruction in the block in a
+ // few tries.
+ int endLocation = tryItem.startAddr + tryItem.insnCount - 1;
mTryBlock.endInsn = insnLocationMap.get(endLocation);
+ while ((mTryBlock.endInsn == null) && (endLocation >= startLocation)) {
+ endLocation--;
+ mTryBlock.endInsn = insnLocationMap.get(endLocation);
+ }
// Sanity checks.
if (mTryBlock.startInsn == null) {
@@ -356,8 +363,9 @@
TryItem tryItem = codeItem.tries[tryItemIdx];
tryItem.startAddr = mTryBlock.startInsn.location;
- tryItem.insnCount =
- (short) (mTryBlock.endInsn.location - mTryBlock.startInsn.location);
+ int insnCount = mTryBlock.endInsn.location - mTryBlock.startInsn.location +
+ mTryBlock.endInsn.insn.getSize();
+ tryItem.insnCount = (short) insnCount;
// Get the EncodedCatchHandler.
EncodedCatchHandler encodedCatchHandler =
diff --git a/tools/dexfuzz/src/dexfuzz/program/mutators/TryBlockShifter.java b/tools/dexfuzz/src/dexfuzz/program/mutators/TryBlockShifter.java
index 1bf6463..55e3e60 100644
--- a/tools/dexfuzz/src/dexfuzz/program/mutators/TryBlockShifter.java
+++ b/tools/dexfuzz/src/dexfuzz/program/mutators/TryBlockShifter.java
@@ -81,12 +81,15 @@
@Override
protected boolean canMutate(MutatableCode mutatableCode) {
- if (mutatableCode.triesSize > 0) {
- return true;
+ if (mutatableCode.triesSize == 0) {
+ Log.debug("Method contains no tries.");
+ return false;
}
-
- Log.debug("Method contains no tries.");
- return false;
+ if (mutatableCode.getInstructionCount() <= 1) {
+ Log.debug("Not enough instructions to shift try block.");
+ return false;
+ }
+ return true;
}
@Override
diff --git a/tools/dexfuzz/src/dexfuzz/rawdex/DebugInfoItem.java b/tools/dexfuzz/src/dexfuzz/rawdex/DebugInfoItem.java
index 922ee58..561e986 100644
--- a/tools/dexfuzz/src/dexfuzz/rawdex/DebugInfoItem.java
+++ b/tools/dexfuzz/src/dexfuzz/rawdex/DebugInfoItem.java
@@ -16,6 +16,8 @@
package dexfuzz.rawdex;
+import dexfuzz.Log;
+
import java.io.IOException;
// Right now we are not parsing debug_info_item, just take the raw size
@@ -32,6 +34,11 @@
file.getOffsetTracker().getNewOffsettable(file, this);
data = new byte[size];
file.read(data);
+
+ // Since we are not parsing the section, ensure that the last byte is DBG_END_SEQUENCE.
+ if (data[size - 1] != 0) {
+ Log.errorAndQuit("Error reading debug_info_item. The last byte is not DBG_END_SEQUENCE.");
+ }
}
@Override
diff --git a/tools/dexfuzz/src/dexfuzz/rawdex/MapList.java b/tools/dexfuzz/src/dexfuzz/rawdex/MapList.java
index 080b5a4..729aa71 100644
--- a/tools/dexfuzz/src/dexfuzz/rawdex/MapList.java
+++ b/tools/dexfuzz/src/dexfuzz/rawdex/MapList.java
@@ -162,10 +162,15 @@
case MapItem.TYPE_DEBUG_INFO_ITEM:
{
// We aren't interested in updating the debug data, so just read it as a blob.
- int start = mapItem.offset.getOriginalOffset();
- int end = mapItems.get(mapItemIdx + 1).offset.getOriginalOffset();
- int size = end - start;
- rawDexFile.debugInfoItem = new DebugInfoItem(size);
+ long start = mapItem.offset.getOriginalOffset();
+ long end = 0;
+ if (mapItemIdx + 1 == mapItems.size()) {
+ end = file.length();
+ } else {
+ end = mapItems.get(mapItemIdx + 1).offset.getOriginalOffset();
+ }
+ long size = end - start;
+ rawDexFile.debugInfoItem = new DebugInfoItem((int)size);
rawDexFile.debugInfoItem.read(file);
break;
}
diff --git a/tools/jfuzz/run_jfuzz_test.py b/tools/jfuzz/run_jfuzz_test.py
index fd8415d..42745d2 100755
--- a/tools/jfuzz/run_jfuzz_test.py
+++ b/tools/jfuzz/run_jfuzz_test.py
@@ -414,14 +414,16 @@
retc2: int, normalized return code of second runner
"""
if retc1 == retc2:
- # Non-divergent in return code.
+ # No divergence in return code.
if retc1 == RetCode.SUCCESS:
# Both compilations and runs were successful, inspect generated output.
runner1_out = self._runner1.output_file
runner2_out = self._runner2.output_file
if not filecmp.cmp(runner1_out, runner2_out, shallow=False):
+ # Divergence in output.
self.ReportDivergence(retc1, retc2, is_output_divergence=True)
else:
+ # No divergence in output.
self._num_success += 1
elif retc1 == RetCode.TIMEOUT:
self._num_timed_out += 1
@@ -429,8 +431,12 @@
self._num_not_compiled += 1
else:
self._num_not_run += 1
+ elif self._true_divergence_only and RetCode.TIMEOUT in (retc1, retc2):
+ # When only true divergences are requested, any divergence in return
+ # code where one is a time out is treated as a regular time out.
+ self._num_timed_out += 1
else:
- # Divergent in return code.
+ # Divergence in return code.
self.ReportDivergence(retc1, retc2, is_output_divergence=False)
def GetCurrentDivergenceDir(self):
@@ -450,13 +456,12 @@
os.mkdir(ddir)
for f in glob('*.txt') + ['Test.java']:
shutil.copy(f, ddir)
- if not (self._true_divergence_only and RetCode.TIMEOUT in (retc1, retc2)):
- # Maybe run bisection bug search.
- if retc1 in BISECTABLE_RET_CODES and retc2 in BISECTABLE_RET_CODES:
- self.MaybeBisectDivergence(retc1, retc2, is_output_divergence)
- # Call reporting script.
- if self._report_script:
- self.RunReportScript(retc1, retc2, is_output_divergence)
+ # Maybe run bisection bug search.
+ if retc1 in BISECTABLE_RET_CODES and retc2 in BISECTABLE_RET_CODES:
+ self.MaybeBisectDivergence(retc1, retc2, is_output_divergence)
+ # Call reporting script.
+ if self._report_script:
+ self.RunReportScript(retc1, retc2, is_output_divergence)
def RunReportScript(self, retc1, retc2, is_output_divergence):
"""Runs report script."""
diff --git a/tools/run-jdwp-tests.sh b/tools/run-jdwp-tests.sh
index 74b0f16..6d5c74b 100755
--- a/tools/run-jdwp-tests.sh
+++ b/tools/run-jdwp-tests.sh
@@ -155,6 +155,7 @@
--classpath $test_jack \
--toolchain jack --language JN \
--vm-arg -Xcompiler-option --vm-arg --debuggable \
+ --jack-arg -g \
$test
vogar_exit_status=$?