Use original dex file for retransformation.

The spec requires us to pass the dex file as it appeared before any
retransformation-capable agents had modified it to the
ClassFileLoadHooks when RetransformClasses is called. We do this by
saving the initial dex file bytes into the class as a byte[].

Bug: 32369916
Test: mma -j40 test-art-host

Change-Id: Ic6af3738cd2a831e91ba1144f502fa58b3c333e4
diff --git a/test/932-transform-saves/build b/test/932-transform-saves/build
new file mode 100755
index 0000000..898e2e5
--- /dev/null
+++ b/test/932-transform-saves/build
@@ -0,0 +1,17 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#      http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-build "$@" --experimental agents
diff --git a/test/932-transform-saves/expected.txt b/test/932-transform-saves/expected.txt
new file mode 100644
index 0000000..5097771
--- /dev/null
+++ b/test/932-transform-saves/expected.txt
@@ -0,0 +1,3 @@
+hello
+Goodbye
+hello
diff --git a/test/932-transform-saves/info.txt b/test/932-transform-saves/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/932-transform-saves/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/932-transform-saves/run b/test/932-transform-saves/run
new file mode 100755
index 0000000..4379349
--- /dev/null
+++ b/test/932-transform-saves/run
@@ -0,0 +1,19 @@
+#!/bin/bash
+#
+# Copyright 2016 The Android Open Source Project
+#
+# Licensed under the Apache License, Version 2.0 (the "License");
+# you may not use this file except in compliance with the License.
+# You may obtain a copy of the License at
+#
+#      http://www.apache.org/licenses/LICENSE-2.0
+#
+# Unless required by applicable law or agreed to in writing, software
+# distributed under the License is distributed on an "AS IS" BASIS,
+# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+# See the License for the specific language governing permissions and
+# limitations under the License.
+
+./default-run "$@" --experimental agents \
+                   --experimental runtime-plugins \
+                   --jvmti
diff --git a/test/932-transform-saves/src/Main.java b/test/932-transform-saves/src/Main.java
new file mode 100644
index 0000000..d98ba6d
--- /dev/null
+++ b/test/932-transform-saves/src/Main.java
@@ -0,0 +1,116 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+  /**
+   * base64 encoded class/dex file for
+   * class Transform {
+   *   public void sayHi() {
+   *    System.out.println("hello");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES_A = Base64.getDecoder().decode(
+      "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+      "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+      "BwAIBwAWDAAXABgBAAVoZWxsbwcAGQwAGgAbAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVj" +
+      "dAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZh" +
+      "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgAgAAUABgAA" +
+      "AAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAABEAAQALAAgAAQAJ" +
+      "AAAAJQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAAGgAIABsAAQAMAAAAAgAN");
+  private static final byte[] DEX_BYTES_A = Base64.getDecoder().decode(
+      "ZGV4CjAzNQC6XWInnnDd1H4NdQ3P3inH8eCVmQI6W7LMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+      "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+      "AABqAQAAdwEAAI4BAACiAQAAtgEAAMoBAADaAQAA3QEAAOEBAAD1AQAA/AEAAAECAAAKAgAAAQAA" +
+      "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+      "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAGAAAAAAAAABwCAAAA" +
+      "AAAAAQABAAEAAAARAgAABAAAAHAQAwAAAA4AAwABAAIAAAAWAgAACQAAAGIAAAAbAQoAAABuIAIA" +
+      "EAAOAAAAAQAAAAMABjxpbml0PgALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwAS" +
+      "TGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xhbmcvU3lzdGVt" +
+      "OwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjIABWhlbGxvAANvdXQA" +
+      "B3ByaW50bG4ABXNheUhpABEABw4AGgAHDocAAAABAQCAgASgAgEBuAIAAA0AAAAAAAAAAQAAAAAA" +
+      "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+      "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+      "AgAAABECAAAAIAAAAQAAABwCAAAAEAAAAQAAACwCAAA=");
+
+  /**
+   * base64 encoded class/dex file for
+   * class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES_B = Base64.getDecoder().decode(
+    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+    "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+  private static final byte[] DEX_BYTES_B = Base64.getDecoder().decode(
+    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+  public static void main(String[] args) {
+    System.loadLibrary(args[1]);
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    // TODO We currently need to do this transform call since we don't have any way to make the
+    // original-dex-file a single-class dex-file letting us restore it easily. We should use the
+    // manipulation library that is being made when we store the original dex file.
+    // TODO REMOVE this theoretically does nothing but it ensures the original-dex-file we have set
+    // is one we can return to unaltered.
+    doCommonClassRedefinition(Transform.class, CLASS_BYTES_A, DEX_BYTES_A);
+    t.sayHi();
+
+    // Now turn it into DEX_BYTES_B so it says 'Goodbye'
+    addCommonTransformationResult("Transform", CLASS_BYTES_B, DEX_BYTES_B);
+    enableCommonRetransformation(true);
+    doCommonClassRetransformation(Transform.class);
+    t.sayHi();
+
+    // Now turn it back to normal by removing the load-hook and transforming again.
+    enableCommonRetransformation(false);
+    doCommonClassRetransformation(Transform.class);
+    t.sayHi();
+  }
+
+  // Transforms the class
+  private static native void doCommonClassRedefinition(Class<?> target,
+                                                       byte[] class_bytes,
+                                                       byte[] dex_bytes);
+  private static native void doCommonClassRetransformation(Class<?>... target);
+  private static native void enableCommonRetransformation(boolean enable);
+  private static native void addCommonTransformationResult(String target_name,
+                                                           byte[] class_bytes,
+                                                           byte[] dex_bytes);
+}
diff --git a/test/932-transform-saves/src/Transform.java b/test/932-transform-saves/src/Transform.java
new file mode 100644
index 0000000..8e8af35
--- /dev/null
+++ b/test/932-transform-saves/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+  public void sayHi() {
+    // Use lower 'h' to make sure the string will have a different string id
+    // than the transformation (the transformation code is the same except
+    // the actual printed String, which was making the test inacurately passing
+    // in JIT mode when loading the string from the dex cache, as the string ids
+    // of the two different strings were the same).
+    // We know the string ids will be different because lexicographically:
+    // "Goodbye" < "LTransform;" < "hello".
+    System.out.println("hello");
+  }
+}
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index c8e2185..639996e 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -311,6 +311,7 @@
   929-search \
   930-hello-retransform \
   931-agent-thread \
+  932-transform-saves \
 
 ifneq (,$(filter target,$(TARGET_TYPES)))
   ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index 8799c91..4bceef5 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -253,11 +253,12 @@
                                                     jint* new_class_data_len,
                                                     unsigned char** new_class_data) {
   std::string name_str(name);
-  if (gTransformations.find(name_str) != gTransformations.end()) {
+  if (gTransformations.find(name_str) != gTransformations.end() &&
+      gTransformations[name_str].size() > 0) {
     CommonTransformationResult& res = gTransformations[name_str][0];
     const std::vector<unsigned char>& desired_array = IsJVM() ? res.class_bytes : res.dex_bytes;
     unsigned char* new_data;
-    jvmti_env->Allocate(desired_array.size(), &new_data);
+    CHECK_EQ(JVMTI_ERROR_NONE, jvmti_env->Allocate(desired_array.size(), &new_data));
     memcpy(new_data, desired_array.data(), desired_array.size());
     *new_class_data = new_data;
     *new_class_data_len = desired_array.size();
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 1b11442..f4ce4c3 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -67,6 +67,7 @@
   { "921-hello-failure", common_retransform::OnLoad, nullptr },
   { "926-multi-obsolescence", common_redefine::OnLoad, nullptr },
   { "930-hello-retransform", common_retransform::OnLoad, nullptr },
+  { "932-transform-saves", common_retransform::OnLoad, nullptr },
 };
 
 static AgentLib* FindAgent(char* name) {