Merge "Revert "Ignore warning for instantiation after specialization.""
diff --git a/Android.bp b/Android.bp
index b9f1db5..d0e22fb 100644
--- a/Android.bp
+++ b/Android.bp
@@ -27,6 +27,7 @@
     "dexdump",
     "dexlayout",
     "dexlist",
+    "dexoptanalyzer",
     "disassembler",
     "imgdiag",
     "oatdump",
diff --git a/build/Android.common_build.mk b/build/Android.common_build.mk
index 4c82506..f5a95fa 100644
--- a/build/Android.common_build.mk
+++ b/build/Android.common_build.mk
@@ -46,6 +46,9 @@
 $(info Disabling ART_BUILD_HOST_DEBUG)
 endif
 
+# Enable the read barrier by default.
+ART_USE_READ_BARRIER ?= true
+
 ART_CPP_EXTENSION := .cc
 
 ifndef LIBART_IMG_HOST_BASE_ADDRESS
diff --git a/build/Android.common_path.mk b/build/Android.common_path.mk
index e568ce2..6de5aef 100644
--- a/build/Android.common_path.mk
+++ b/build/Android.common_path.mk
@@ -109,6 +109,7 @@
 
 ART_CORE_DEBUGGABLE_EXECUTABLES := \
     dex2oat \
+    dexoptanalyzer \
     imgdiag \
     oatdump \
     patchoat \
diff --git a/build/Android.gtest.mk b/build/Android.gtest.mk
index 5bdfbc7..bc08384 100644
--- a/build/Android.gtest.mk
+++ b/build/Android.gtest.mk
@@ -28,6 +28,7 @@
   DexToDexDecompiler \
   ErroneousA \
   ErroneousB \
+  ErroneousInit \
   ExceptionHandle \
   GetMethodSignature \
   ImageLayoutA \
@@ -87,7 +88,7 @@
 ART_GTEST_dex2oat_environment_tests_DEX_DEPS := Main MainStripped MultiDex MultiDexModifiedSecondary Nested
 
 ART_GTEST_atomic_method_ref_map_test_DEX_DEPS := Interfaces
-ART_GTEST_class_linker_test_DEX_DEPS := ErroneousA ErroneousB Interfaces MethodTypes MultiDex MyClass Nested Statics StaticsFromCode
+ART_GTEST_class_linker_test_DEX_DEPS := AllFields ErroneousA ErroneousB ErroneousInit Interfaces MethodTypes MultiDex MyClass Nested Statics StaticsFromCode
 ART_GTEST_class_table_test_DEX_DEPS := XandY
 ART_GTEST_compiler_driver_test_DEX_DEPS := AbstractMethod StaticLeafMethods ProfileTestMultiDex
 ART_GTEST_dex_cache_test_DEX_DEPS := Main Packages MethodTypes
@@ -100,6 +101,7 @@
 ART_GTEST_jni_compiler_test_DEX_DEPS := MyClassNatives
 ART_GTEST_jni_internal_test_DEX_DEPS := AllFields StaticLeafMethods
 ART_GTEST_oat_file_assistant_test_DEX_DEPS := $(ART_GTEST_dex2oat_environment_tests_DEX_DEPS)
+ART_GTEST_dexoptanalyzer_test_DEX_DEPS := $(ART_GTEST_dex2oat_environment_tests_DEX_DEPS)
 ART_GTEST_oat_file_test_DEX_DEPS := Main MultiDex
 ART_GTEST_oat_test_DEX_DEPS := Main
 ART_GTEST_object_test_DEX_DEPS := ProtoCompare ProtoCompare2 StaticsFromCode XandY
@@ -107,6 +109,7 @@
 ART_GTEST_reflection_test_DEX_DEPS := Main NonStaticLeafMethods StaticLeafMethods
 ART_GTEST_profile_assistant_test_DEX_DEPS := ProfileTestMultiDex
 ART_GTEST_profile_compilation_info_test_DEX_DEPS := ProfileTestMultiDex
+ART_GTEST_runtime_callbacks_test_DEX_DEPS := XandY
 ART_GTEST_stub_test_DEX_DEPS := AllFields
 ART_GTEST_transaction_test_DEX_DEPS := Transaction
 ART_GTEST_type_lookup_table_test_DEX_DEPS := Lookup
@@ -120,14 +123,14 @@
 ART_GTEST_dex2oat_environment_tests_HOST_DEPS := \
   $(HOST_CORE_IMAGE_optimizing_pic_64) \
   $(HOST_CORE_IMAGE_optimizing_pic_32) \
-  $(HOST_CORE_IMAGE_optimizing_no-pic_64) \
-  $(HOST_CORE_IMAGE_optimizing_no-pic_32) \
+  $(HOST_CORE_IMAGE_interpreter_pic_64) \
+  $(HOST_CORE_IMAGE_interpreter_pic_32) \
   $(HOST_OUT_EXECUTABLES)/patchoatd
 ART_GTEST_dex2oat_environment_tests_TARGET_DEPS := \
   $(TARGET_CORE_IMAGE_optimizing_pic_64) \
   $(TARGET_CORE_IMAGE_optimizing_pic_32) \
-  $(TARGET_CORE_IMAGE_optimizing_no-pic_64) \
-  $(TARGET_CORE_IMAGE_optimizing_no-pic_32) \
+  $(TARGET_CORE_IMAGE_interpreter_pic_64) \
+  $(TARGET_CORE_IMAGE_interpreter_pic_32) \
   $(TARGET_OUT_EXECUTABLES)/patchoatd
 
 ART_GTEST_oat_file_assistant_test_HOST_DEPS := \
@@ -135,6 +138,12 @@
 ART_GTEST_oat_file_assistant_test_TARGET_DEPS := \
   $(ART_GTEST_dex2oat_environment_tests_TARGET_DEPS)
 
+ART_GTEST_dexoptanalyzer_test_HOST_DEPS := \
+  $(ART_GTEST_dex2oat_environment_tests_HOST_DEPS) \
+  $(HOST_OUT_EXECUTABLES)/dexoptanalyzerd
+ART_GTEST_dexoptanalyzer_test_TARGET_DEPS := \
+  $(ART_GTEST_dex2oat_environment_tests_TARGET_DEPS) \
+  dexoptanalyzerd
 
 ART_GTEST_dex2oat_test_HOST_DEPS := \
   $(ART_GTEST_dex2oat_environment_tests_HOST_DEPS)
@@ -218,6 +227,7 @@
     art_dexdump_tests \
     art_dexlayout_tests \
     art_dexlist_tests \
+    art_dexoptanalyzer_tests \
     art_imgdiag_tests \
     art_oatdump_tests \
     art_profman_tests \
@@ -613,6 +623,9 @@
 ART_GTEST_oat_file_assistant_test_DEX_DEPS :=
 ART_GTEST_oat_file_assistant_test_HOST_DEPS :=
 ART_GTEST_oat_file_assistant_test_TARGET_DEPS :=
+ART_GTEST_dexoptanalyzer_test_DEX_DEPS :=
+ART_GTEST_dexoptanalyzer_test_HOST_DEPS :=
+ART_GTEST_dexoptanalyzer_test_TARGET_DEPS :=
 ART_GTEST_dex2oat_test_DEX_DEPS :=
 ART_GTEST_dex2oat_test_HOST_DEPS :=
 ART_GTEST_dex2oat_test_TARGET_DEPS :=
diff --git a/build/art.go b/build/art.go
index e6e0544..baa6e59 100644
--- a/build/art.go
+++ b/build/art.go
@@ -58,7 +58,7 @@
 		asflags = append(asflags, "-DART_HEAP_POISONING=1")
 	}
 
-	if envTrue(ctx, "ART_USE_READ_BARRIER") || ctx.AConfig().ArtUseReadBarrier() {
+	if !envFalse(ctx, "ART_USE_READ_BARRIER") && ctx.AConfig().ArtUseReadBarrier() {
 		// Used to change the read barrier type. Valid values are BAKER, BROOKS, TABLELOOKUP.
 		// The default is BAKER.
 		barrierType := envDefault(ctx, "ART_READ_BARRIER_TYPE", "BAKER")
diff --git a/cmdline/cmdline_types.h b/cmdline/cmdline_types.h
index e41d9bd..f1123eb 100644
--- a/cmdline/cmdline_types.h
+++ b/cmdline/cmdline_types.h
@@ -766,12 +766,6 @@
   Result ParseAndAppend(const std::string& option, ExperimentalFlags& existing) {
     if (option == "none") {
       existing = ExperimentalFlags::kNone;
-    } else if (option == "agents") {
-      existing = existing | ExperimentalFlags::kAgents;
-    } else if (option == "runtime-plugins") {
-      existing = existing | ExperimentalFlags::kRuntimePlugins;
-    } else if (option == "method-handles") {
-      existing = existing | ExperimentalFlags::kMethodHandles;
     } else {
       return Result::Failure(std::string("Unknown option '") + option + "'");
     }
diff --git a/compiler/common_compiler_test.h b/compiler/common_compiler_test.h
index f4838c1..0d45a50 100644
--- a/compiler/common_compiler_test.h
+++ b/compiler/common_compiler_test.h
@@ -23,7 +23,7 @@
 
 #include "common_runtime_test.h"
 #include "compiler.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "oat_file.h"
 
 namespace art {
diff --git a/compiler/compiled_method.h b/compiler/compiled_method.h
index bbf9eee..e2a0942 100644
--- a/compiler/compiled_method.h
+++ b/compiler/compiled_method.h
@@ -176,6 +176,7 @@
     kCallRelative,     // NOTE: Actual patching is instruction_set-dependent.
     kType,
     kTypeRelative,     // NOTE: Actual patching is instruction_set-dependent.
+    kTypeBssEntry,     // NOTE: Actual patching is instruction_set-dependent.
     kString,
     kStringRelative,   // NOTE: Actual patching is instruction_set-dependent.
     kStringBssEntry,   // NOTE: Actual patching is instruction_set-dependent.
@@ -228,6 +229,16 @@
     return patch;
   }
 
+  static LinkerPatch TypeBssEntryPatch(size_t literal_offset,
+                                       const DexFile* target_dex_file,
+                                       uint32_t pc_insn_offset,
+                                       uint32_t target_type_idx) {
+    LinkerPatch patch(literal_offset, Type::kTypeBssEntry, target_dex_file);
+    patch.type_idx_ = target_type_idx;
+    patch.pc_insn_offset_ = pc_insn_offset;
+    return patch;
+  }
+
   static LinkerPatch StringPatch(size_t literal_offset,
                                  const DexFile* target_dex_file,
                                  uint32_t target_string_idx) {
@@ -282,6 +293,7 @@
     switch (GetType()) {
       case Type::kCallRelative:
       case Type::kTypeRelative:
+      case Type::kTypeBssEntry:
       case Type::kStringRelative:
       case Type::kStringBssEntry:
       case Type::kDexCacheArray:
@@ -299,12 +311,16 @@
   }
 
   const DexFile* TargetTypeDexFile() const {
-    DCHECK(patch_type_ == Type::kType || patch_type_ == Type::kTypeRelative);
+    DCHECK(patch_type_ == Type::kType ||
+           patch_type_ == Type::kTypeRelative ||
+           patch_type_ == Type::kTypeBssEntry);
     return target_dex_file_;
   }
 
   dex::TypeIndex TargetTypeIndex() const {
-    DCHECK(patch_type_ == Type::kType || patch_type_ == Type::kTypeRelative);
+    DCHECK(patch_type_ == Type::kType ||
+           patch_type_ == Type::kTypeRelative ||
+           patch_type_ == Type::kTypeBssEntry);
     return dex::TypeIndex(type_idx_);
   }
 
@@ -334,6 +350,7 @@
 
   uint32_t PcInsnOffset() const {
     DCHECK(patch_type_ == Type::kTypeRelative ||
+           patch_type_ == Type::kTypeBssEntry ||
            patch_type_ == Type::kStringRelative ||
            patch_type_ == Type::kStringBssEntry ||
            patch_type_ == Type::kDexCacheArray);
diff --git a/compiler/debug/elf_debug_line_writer.h b/compiler/debug/elf_debug_line_writer.h
index 3db7306..18a9165 100644
--- a/compiler/debug/elf_debug_line_writer.h
+++ b/compiler/debug/elf_debug_line_writer.h
@@ -53,7 +53,8 @@
   // Write line table for given set of methods.
   // Returns the number of bytes written.
   size_t WriteCompilationUnit(ElfCompilationUnit& compilation_unit) {
-    const bool is64bit = Is64BitInstructionSet(builder_->GetIsa());
+    const InstructionSet isa = builder_->GetIsa();
+    const bool is64bit = Is64BitInstructionSet(isa);
     const Elf_Addr base_address = compilation_unit.is_code_address_text_relative
         ? builder_->GetText()->GetAddress()
         : 0;
@@ -66,7 +67,7 @@
     std::unordered_map<std::string, size_t> directories_map;
     int code_factor_bits_ = 0;
     int dwarf_isa = -1;
-    switch (builder_->GetIsa()) {
+    switch (isa) {
       case kArm:  // arm actually means thumb2.
       case kThumb2:
         code_factor_bits_ = 1;  // 16-bit instuctions
@@ -103,7 +104,7 @@
         for (uint32_t s = 0; s < code_info.GetNumberOfStackMaps(encoding); s++) {
           StackMap stack_map = code_info.GetStackMapAt(s, encoding);
           DCHECK(stack_map.IsValid());
-          const uint32_t pc = stack_map.GetNativePcOffset(encoding.stack_map_encoding);
+          const uint32_t pc = stack_map.GetNativePcOffset(encoding.stack_map_encoding, isa);
           const int32_t dex = stack_map.GetDexPc(encoding.stack_map_encoding);
           pc2dex_map.push_back({pc, dex});
           if (stack_map.HasDexRegisterMap(encoding.stack_map_encoding)) {
diff --git a/compiler/debug/elf_debug_loc_writer.h b/compiler/debug/elf_debug_loc_writer.h
index 9645643..bce5387 100644
--- a/compiler/debug/elf_debug_loc_writer.h
+++ b/compiler/debug/elf_debug_loc_writer.h
@@ -92,7 +92,8 @@
     bool is64bitValue,
     uint64_t compilation_unit_code_address,
     uint32_t dex_pc_low,
-    uint32_t dex_pc_high) {
+    uint32_t dex_pc_high,
+    InstructionSet isa) {
   std::vector<VariableLocation> variable_locations;
 
   // Get stack maps sorted by pc (they might not be sorted internally).
@@ -111,7 +112,7 @@
       // The main reason for this is to save space by avoiding undefined gaps.
       continue;
     }
-    const uint32_t pc_offset = stack_map.GetNativePcOffset(encoding.stack_map_encoding);
+    const uint32_t pc_offset = stack_map.GetNativePcOffset(encoding.stack_map_encoding, isa);
     DCHECK_LE(pc_offset, method_info->code_size);
     DCHECK_LE(compilation_unit_code_address, method_info->code_address);
     const uint32_t low_pc = dchecked_integral_cast<uint32_t>(
@@ -196,7 +197,8 @@
       is64bitValue,
       compilation_unit_code_address,
       dex_pc_low,
-      dex_pc_high);
+      dex_pc_high,
+      isa);
 
   // Write .debug_loc entries.
   dwarf::Writer<> debug_loc(debug_loc_buffer);
diff --git a/compiler/driver/compiler_driver.cc b/compiler/driver/compiler_driver.cc
index 2950266..3203048 100644
--- a/compiler/driver/compiler_driver.cc
+++ b/compiler/driver/compiler_driver.cc
@@ -284,7 +284,7 @@
       verification_results_(verification_results),
       compiler_(Compiler::Create(this, compiler_kind)),
       compiler_kind_(compiler_kind),
-      instruction_set_(instruction_set == kArm ? kThumb2: instruction_set),
+      instruction_set_(instruction_set == kArm ? kThumb2 : instruction_set),
       instruction_set_features_(instruction_set_features),
       requires_constructor_barrier_lock_("constructor barrier lock"),
       compiled_classes_lock_("compiled classes lock"),
@@ -940,6 +940,31 @@
   DCHECK(single_thread_pool_ != nullptr);
 }
 
+static void EnsureVerifiedOrVerifyAtRuntime(jobject jclass_loader,
+                                            const std::vector<const DexFile*>& dex_files) {
+  ScopedObjectAccess soa(Thread::Current());
+  StackHandleScope<2> hs(soa.Self());
+  Handle<mirror::ClassLoader> class_loader(
+      hs.NewHandle(soa.Decode<mirror::ClassLoader>(jclass_loader)));
+  MutableHandle<mirror::Class> cls(hs.NewHandle<mirror::Class>(nullptr));
+  ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+
+  for (const DexFile* dex_file : dex_files) {
+    for (uint32_t i = 0; i < dex_file->NumClassDefs(); ++i) {
+      const DexFile::ClassDef& class_def = dex_file->GetClassDef(i);
+      const char* descriptor = dex_file->GetClassDescriptor(class_def);
+      cls.Assign(class_linker->FindClass(soa.Self(), descriptor, class_loader));
+      if (cls.Get() == nullptr) {
+        soa.Self()->ClearException();
+      } else if (&cls->GetDexFile() == dex_file) {
+        DCHECK(cls->IsErroneous() || cls->IsVerified() || cls->IsCompileTimeVerified())
+            << cls->PrettyClass()
+            << " " << cls->GetStatus();
+      }
+    }
+  }
+}
+
 void CompilerDriver::PreCompile(jobject class_loader,
                                 const std::vector<const DexFile*>& dex_files,
                                 TimingLogger* timings) {
@@ -984,6 +1009,9 @@
   }
 
   if (compiler_options_->IsAnyMethodCompilationEnabled()) {
+    if (kIsDebugBuild) {
+      EnsureVerifiedOrVerifyAtRuntime(class_loader, dex_files);
+    }
     InitializeClasses(class_loader, dex_files, timings);
     VLOG(compiler) << "InitializeClasses: " << GetMemoryUsageString(false);
   }
@@ -1060,13 +1088,13 @@
   virtual bool operator()(ObjPtr<mirror::Class> c) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
     const auto pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
     for (auto& m : c->GetMethods(pointer_size)) {
-      ResolveExceptionsForMethod(&m, pointer_size);
+      ResolveExceptionsForMethod(&m);
     }
     return true;
   }
 
  private:
-  void ResolveExceptionsForMethod(ArtMethod* method_handle, PointerSize pointer_size)
+  void ResolveExceptionsForMethod(ArtMethod* method_handle)
       REQUIRES_SHARED(Locks::mutator_lock_) {
     const DexFile::CodeItem* code_item = method_handle->GetCodeItem();
     if (code_item == nullptr) {
@@ -1088,8 +1116,7 @@
         dex::TypeIndex encoded_catch_handler_handlers_type_idx =
             dex::TypeIndex(DecodeUnsignedLeb128(&encoded_catch_handler_list));
         // Add to set of types to resolve if not already in the dex cache resolved types
-        if (!method_handle->IsResolvedTypeIdx(encoded_catch_handler_handlers_type_idx,
-                                              pointer_size)) {
+        if (!method_handle->IsResolvedTypeIdx(encoded_catch_handler_handlers_type_idx)) {
           exceptions_to_resolve_.emplace(encoded_catch_handler_handlers_type_idx,
                                          method_handle->GetDexFile());
         }
@@ -1252,7 +1279,7 @@
     }
   }
 
-  // java.lang.Reference visitor for VisitReferences.
+  // java.lang.ref.Reference visitor for VisitReferences.
   void operator()(ObjPtr<mirror::Class> klass ATTRIBUTE_UNUSED,
                   ObjPtr<mirror::Reference> ref ATTRIBUTE_UNUSED) const {}
 
@@ -1950,66 +1977,103 @@
   DCHECK(!it.HasNext());
 }
 
-void CompilerDriver::Verify(jobject jclass_loader,
-                            const std::vector<const DexFile*>& dex_files,
-                            TimingLogger* timings) {
+static void LoadAndUpdateStatus(const DexFile& dex_file,
+                                const DexFile::ClassDef& class_def,
+                                mirror::Class::Status status,
+                                Handle<mirror::ClassLoader> class_loader,
+                                Thread* self)
+    REQUIRES_SHARED(Locks::mutator_lock_) {
+  StackHandleScope<1> hs(self);
+  const char* descriptor = dex_file.GetClassDescriptor(class_def);
+  ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+  Handle<mirror::Class> cls(hs.NewHandle<mirror::Class>(
+      class_linker->FindClass(self, descriptor, class_loader)));
+  if (cls.Get() != nullptr) {
+    // Check that the class is resolved with the current dex file. We might get
+    // a boot image class, or a class in a different dex file for multidex, and
+    // we should not update the status in that case.
+    if (&cls->GetDexFile() == &dex_file) {
+      ObjectLock<mirror::Class> lock(self, cls);
+      mirror::Class::SetStatus(cls, status, self);
+    }
+  } else {
+    DCHECK(self->IsExceptionPending());
+    self->ClearException();
+  }
+}
+
+bool CompilerDriver::FastVerify(jobject jclass_loader,
+                                const std::vector<const DexFile*>& dex_files,
+                                TimingLogger* timings) {
   verifier::VerifierDeps* verifier_deps =
       Runtime::Current()->GetCompilerCallbacks()->GetVerifierDeps();
   // If there is an existing `VerifierDeps`, try to use it for fast verification.
-  if (verifier_deps != nullptr) {
-    TimingLogger::ScopedTiming t("Fast Verify", timings);
-    ScopedObjectAccess soa(Thread::Current());
-    StackHandleScope<2> hs(soa.Self());
-    Handle<mirror::ClassLoader> class_loader(
-        hs.NewHandle(soa.Decode<mirror::ClassLoader>(jclass_loader)));
-    MutableHandle<mirror::Class> cls(hs.NewHandle<mirror::Class>(nullptr));
-    ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
-    if (verifier_deps->ValidateDependencies(class_loader, soa.Self())) {
-      // We successfully validated the dependencies, now update class status
-      // of verified classes. Note that the dependencies also record which classes
-      // could not be fully verified; we could try again, but that would hurt verification
-      // time. So instead we assume these classes still need to be verified at
-      // runtime.
-      for (const DexFile* dex_file : dex_files) {
-        // Fetch the list of unverified classes and turn it into a set for faster
-        // lookups.
-        const std::vector<dex::TypeIndex>& unverified_classes =
-            verifier_deps->GetUnverifiedClasses(*dex_file);
-        std::set<dex::TypeIndex> set(unverified_classes.begin(), unverified_classes.end());
-        for (uint32_t i = 0; i < dex_file->NumClassDefs(); ++i) {
-          const DexFile::ClassDef& class_def = dex_file->GetClassDef(i);
-          if (set.find(class_def.class_idx_) == set.end()) {
-            if (!GetCompilerOptions().IsAnyMethodCompilationEnabled()) {
-              // Just update the compiled_classes_ map. The compiler doesn't need to resolve
-              // the type.
-              compiled_classes_.Overwrite(
-                  ClassReference(dex_file, i), new CompiledClass(mirror::Class::kStatusVerified));
-            } else {
-              // Resolve the type, so later compilation stages know they don't need to verify
-              // the class.
-              const char* descriptor = dex_file->GetClassDescriptor(class_def);
-              cls.Assign(class_linker->FindClass(soa.Self(), descriptor, class_loader));
-              if (cls.Get() != nullptr) {
-                ObjectLock<mirror::Class> lock(soa.Self(), cls);
-                mirror::Class::SetStatus(cls, mirror::Class::kStatusVerified, soa.Self());
-              } else {
-                DCHECK(soa.Self()->IsExceptionPending());
-                soa.Self()->ClearException();
-              }
-              // Create `VerifiedMethod`s for each methods, the compiler expects one for
-              // quickening or compiling.
-              // Note that this means:
-              // - We're only going to compile methods that did verify.
-              // - Quickening will not do checkcast ellision.
-              // TODO(ngeoffray): Reconsider this once we refactor compiler filters.
-              PopulateVerifiedMethods(*dex_file, i, verification_results_);
-            }
-          }
+  if (verifier_deps == nullptr) {
+    return false;
+  }
+  TimingLogger::ScopedTiming t("Fast Verify", timings);
+  ScopedObjectAccess soa(Thread::Current());
+  StackHandleScope<2> hs(soa.Self());
+  Handle<mirror::ClassLoader> class_loader(
+      hs.NewHandle(soa.Decode<mirror::ClassLoader>(jclass_loader)));
+  if (!verifier_deps->ValidateDependencies(class_loader, soa.Self())) {
+    return false;
+  }
+
+  bool compiler_only_verifies = !GetCompilerOptions().IsAnyMethodCompilationEnabled();
+
+  // We successfully validated the dependencies, now update class status
+  // of verified classes. Note that the dependencies also record which classes
+  // could not be fully verified; we could try again, but that would hurt verification
+  // time. So instead we assume these classes still need to be verified at
+  // runtime.
+  for (const DexFile* dex_file : dex_files) {
+    // Fetch the list of unverified classes and turn it into a set for faster
+    // lookups.
+    const std::vector<dex::TypeIndex>& unverified_classes =
+        verifier_deps->GetUnverifiedClasses(*dex_file);
+    std::set<dex::TypeIndex> set(unverified_classes.begin(), unverified_classes.end());
+    for (uint32_t i = 0; i < dex_file->NumClassDefs(); ++i) {
+      const DexFile::ClassDef& class_def = dex_file->GetClassDef(i);
+      if (set.find(class_def.class_idx_) == set.end()) {
+        if (compiler_only_verifies) {
+          // Just update the compiled_classes_ map. The compiler doesn't need to resolve
+          // the type.
+          compiled_classes_.Overwrite(
+              ClassReference(dex_file, i), new CompiledClass(mirror::Class::kStatusVerified));
+        } else {
+          // Update the class status, so later compilation stages know they don't need to verify
+          // the class.
+          LoadAndUpdateStatus(
+              *dex_file, class_def, mirror::Class::kStatusVerified, class_loader, soa.Self());
+          // Create `VerifiedMethod`s for each methods, the compiler expects one for
+          // quickening or compiling.
+          // Note that this means:
+          // - We're only going to compile methods that did verify.
+          // - Quickening will not do checkcast ellision.
+          // TODO(ngeoffray): Reconsider this once we refactor compiler filters.
+          PopulateVerifiedMethods(*dex_file, i, verification_results_);
         }
+      } else if (!compiler_only_verifies) {
+        // Make sure later compilation stages know they should not try to verify
+        // this class again.
+        LoadAndUpdateStatus(*dex_file,
+                            class_def,
+                            mirror::Class::kStatusRetryVerificationAtRuntime,
+                            class_loader,
+                            soa.Self());
       }
-      return;
     }
   }
+  return true;
+}
+
+void CompilerDriver::Verify(jobject jclass_loader,
+                            const std::vector<const DexFile*>& dex_files,
+                            TimingLogger* timings) {
+  if (FastVerify(jclass_loader, dex_files, timings)) {
+    return;
+  }
 
   // If there is no existing `verifier_deps` (because of non-existing vdex), or
   // the existing `verifier_deps` is not valid anymore, create a new one for
@@ -2017,7 +2081,7 @@
   // Then dex2oat can update the vdex file with these new dependencies.
   if (!GetCompilerOptions().IsBootImage()) {
     // Create the main VerifierDeps, and set it to this thread.
-    verifier_deps = new verifier::VerifierDeps(dex_files);
+    verifier::VerifierDeps* verifier_deps = new verifier::VerifierDeps(dex_files);
     Runtime::Current()->GetCompilerCallbacks()->SetVerifierDeps(verifier_deps);
     Thread::Current()->SetVerifierDeps(verifier_deps);
     // Create per-thread VerifierDeps to avoid contention on the main one.
@@ -2026,6 +2090,7 @@
       worker->GetThread()->SetVerifierDeps(new verifier::VerifierDeps(dex_files));
     }
   }
+
   // Note: verification should not be pulling in classes anymore when compiling the boot image,
   //       as all should have been resolved before. As such, doing this in parallel should still
   //       be deterministic.
@@ -2041,6 +2106,7 @@
 
   if (!GetCompilerOptions().IsBootImage()) {
     // Merge all VerifierDeps into the main one.
+    verifier::VerifierDeps* verifier_deps = Thread::Current()->GetVerifierDeps();
     for (ThreadPoolWorker* worker : parallel_thread_pool_->GetWorkers()) {
       verifier::VerifierDeps* thread_deps = worker->GetThread()->GetVerifierDeps();
       worker->GetThread()->SetVerifierDeps(nullptr);
@@ -2061,7 +2127,10 @@
     ScopedObjectAccess soa(Thread::Current());
     const DexFile& dex_file = *manager_->GetDexFile();
     if (!manager_->GetCompiler()->ShouldVerifyClassBasedOnProfile(dex_file, class_def_index)) {
-      // Skip verification since the class is not in the profile.
+      // Skip verification since the class is not in the profile, and let the VerifierDeps know
+      // that the class will need to be verified at runtime.
+      verifier::VerifierDeps::MaybeRecordVerificationStatus(
+          dex_file, dex::TypeIndex(class_def_index), verifier::MethodVerifier::kSoftFailure);
       return;
     }
     const DexFile::ClassDef& class_def = dex_file.GetClassDef(class_def_index);
@@ -2179,7 +2248,7 @@
     if (klass.Get() != nullptr) {
       // Only do this if the class is resolved. If even resolution fails, quickening will go very,
       // very wrong.
-      if (klass->IsResolved()) {
+      if (klass->IsResolved() && !klass->IsErroneousResolved()) {
         if (klass->GetStatus() < mirror::Class::kStatusVerified) {
           ObjectLock<mirror::Class> lock(soa.Self(), klass);
           // Set class status to verified.
@@ -2606,7 +2675,8 @@
 void CompilerDriver::RecordClassStatus(ClassReference ref, mirror::Class::Status status) {
   switch (status) {
     case mirror::Class::kStatusNotReady:
-    case mirror::Class::kStatusError:
+    case mirror::Class::kStatusErrorResolved:
+    case mirror::Class::kStatusErrorUnresolved:
     case mirror::Class::kStatusRetryVerificationAtRuntime:
     case mirror::Class::kStatusVerified:
     case mirror::Class::kStatusInitialized:
diff --git a/compiler/driver/compiler_driver.h b/compiler/driver/compiler_driver.h
index 2e3b7c8..503fe3a 100644
--- a/compiler/driver/compiler_driver.h
+++ b/compiler/driver/compiler_driver.h
@@ -33,7 +33,7 @@
 #include "dex_file.h"
 #include "dex_file_types.h"
 #include "driver/compiled_method_storage.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "invoke_type.h"
 #include "method_reference.h"
 #include "mirror/class.h"  // For mirror::Class::Status.
@@ -433,12 +433,18 @@
                       TimingLogger* timings)
       REQUIRES(!Locks::mutator_lock_);
 
+  // Do fast verification through VerifierDeps if possible. Return whether
+  // verification was successful.
   // NO_THREAD_SAFETY_ANALYSIS as the method accesses a guarded value in a
   // single-threaded way.
+  bool FastVerify(jobject class_loader,
+                  const std::vector<const DexFile*>& dex_files,
+                  TimingLogger* timings)
+      NO_THREAD_SAFETY_ANALYSIS;
+
   void Verify(jobject class_loader,
               const std::vector<const DexFile*>& dex_files,
-              TimingLogger* timings)
-    NO_THREAD_SAFETY_ANALYSIS;
+              TimingLogger* timings);
 
   void VerifyDexFile(jobject class_loader,
                      const DexFile& dex_file,
diff --git a/compiler/driver/compiler_driver_test.cc b/compiler/driver/compiler_driver_test.cc
index 12684c0..1e4ca16 100644
--- a/compiler/driver/compiler_driver_test.cc
+++ b/compiler/driver/compiler_driver_test.cc
@@ -32,7 +32,7 @@
 #include "mirror/object_array-inl.h"
 #include "mirror/object-inl.h"
 #include "handle_scope-inl.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "scoped_thread_state_change-inl.h"
 
 namespace art {
diff --git a/compiler/exception_test.cc b/compiler/exception_test.cc
index f9e5cb9..eac46e5 100644
--- a/compiler/exception_test.cc
+++ b/compiler/exception_test.cc
@@ -61,7 +61,7 @@
 
     ArenaPool pool;
     ArenaAllocator allocator(&pool);
-    StackMapStream stack_maps(&allocator);
+    StackMapStream stack_maps(&allocator, kRuntimeISA);
     stack_maps.BeginStackMapEntry(/* dex_pc */ 3u,
                                   /* native_pc_offset */ 3u,
                                   /* register_mask */ 0u,
diff --git a/compiler/image_writer.cc b/compiler/image_writer.cc
index 9c38445..15e4cd8 100644
--- a/compiler/image_writer.cc
+++ b/compiler/image_writer.cc
@@ -756,7 +756,7 @@
   bool my_early_exit = false;  // Only for ourselves, ignore caller.
   // Remove classes that failed to verify since we don't want to have java.lang.VerifyError in the
   // app image.
-  if (klass->GetStatus() == mirror::Class::kStatusError) {
+  if (klass->IsErroneous()) {
     result = true;
   } else {
     ObjPtr<mirror::ClassExt> ext(klass->GetExtData());
@@ -777,8 +777,8 @@
                                                   visited);
   }
   // Check static fields and their classes.
-  size_t num_static_fields = klass->NumReferenceStaticFields();
-  if (num_static_fields != 0 && klass->IsResolved()) {
+  if (klass->IsResolved() && klass->NumReferenceStaticFields() != 0) {
+    size_t num_static_fields = klass->NumReferenceStaticFields();
     // Presumably GC can happen when we are cross compiling, it should not cause performance
     // problems to do pointer size logic.
     MemberOffset field_offset = klass->GetFirstReferenceStaticFieldOffset(
@@ -1154,7 +1154,7 @@
       // Visit and assign offsets for fields and field arrays.
       mirror::Class* as_klass = obj->AsClass();
       mirror::DexCache* dex_cache = as_klass->GetDexCache();
-      DCHECK_NE(as_klass->GetStatus(), mirror::Class::kStatusError);
+      DCHECK(!as_klass->IsErroneous()) << as_klass->GetStatus();
       if (compile_app_image_) {
         // Extra sanity, no boot loader classes should be left!
         CHECK(!IsBootClassLoaderClass(as_klass)) << as_klass->PrettyClass();
@@ -1166,9 +1166,9 @@
       // belongs.
       oat_index = GetOatIndexForDexCache(dex_cache);
       ImageInfo& image_info = GetImageInfo(oat_index);
-      {
-        // Note: This table is only accessed from the image writer, avoid locking to prevent lock
-        // order violations from root visiting.
+      if (!compile_app_image_) {
+        // Note: Avoid locking to prevent lock order violations from root visiting;
+        // image_info.class_table_ is only accessed from the image writer.
         image_info.class_table_->InsertWithoutLocks(as_klass);
       }
       for (LengthPrefixedArray<ArtField>* cur_fields : fields) {
@@ -1265,7 +1265,14 @@
       // class loader.
       mirror::ClassLoader* class_loader = obj->AsClassLoader();
       if (class_loader->GetClassTable() != nullptr) {
+        DCHECK(compile_app_image_);
+        DCHECK(class_loaders_.empty());
         class_loaders_.insert(class_loader);
+        ImageInfo& image_info = GetImageInfo(oat_index);
+        // Note: Avoid locking to prevent lock order violations from root visiting;
+        // image_info.class_table_ table is only accessed from the image writer
+        // and class_loader->GetClassTable() is iterated but not modified.
+        image_info.class_table_->CopyWithoutLocks(*class_loader->GetClassTable());
       }
     }
     AssignImageBinSlot(obj, oat_index);
@@ -2346,8 +2353,6 @@
   copy->SetDeclaringClass(GetImageAddress(orig->GetDeclaringClassUnchecked()));
   ArtMethod** orig_resolved_methods = orig->GetDexCacheResolvedMethods(target_ptr_size_);
   copy->SetDexCacheResolvedMethods(NativeLocationInImage(orig_resolved_methods), target_ptr_size_);
-  GcRoot<mirror::Class>* orig_resolved_types = orig->GetDexCacheResolvedTypes(target_ptr_size_);
-  copy->SetDexCacheResolvedTypes(NativeLocationInImage(orig_resolved_types), target_ptr_size_);
 
   // OatWriter replaces the code_ with an offset value. Here we re-adjust to a pointer relative to
   // oat_begin_
diff --git a/compiler/jni/quick/x86_64/calling_convention_x86_64.cc b/compiler/jni/quick/x86_64/calling_convention_x86_64.cc
index 8ca0ffe..ba654f4 100644
--- a/compiler/jni/quick/x86_64/calling_convention_x86_64.cc
+++ b/compiler/jni/quick/x86_64/calling_convention_x86_64.cc
@@ -160,7 +160,7 @@
     while (HasNext()) {
       ManagedRegister in_reg = CurrentParamRegister();
       if (!in_reg.IsNoRegister()) {
-        int32_t size = IsParamALongOrDouble(itr_args_)? 8 : 4;
+        int32_t size = IsParamALongOrDouble(itr_args_) ? 8 : 4;
         int32_t spill_offset = CurrentParamStackOffset().Uint32Value();
         ManagedRegisterSpill spill(in_reg, size, spill_offset);
         entry_spills_.push_back(spill);
diff --git a/compiler/linker/arm64/relative_patcher_arm64.cc b/compiler/linker/arm64/relative_patcher_arm64.cc
index 4a9de7f..79e1785 100644
--- a/compiler/linker/arm64/relative_patcher_arm64.cc
+++ b/compiler/linker/arm64/relative_patcher_arm64.cc
@@ -224,6 +224,7 @@
     } else {
       // LDR/STR 32-bit or 64-bit with imm12 == 0 (unset).
       DCHECK(patch.GetType() == LinkerPatch::Type::kDexCacheArray ||
+             patch.GetType() == LinkerPatch::Type::kTypeBssEntry ||
              patch.GetType() == LinkerPatch::Type::kStringBssEntry) << patch.GetType();
       DCHECK_EQ(insn & 0xbfbffc00, 0xb9000000) << std::hex << insn;
     }
diff --git a/compiler/oat_test.cc b/compiler/oat_test.cc
index 4180e0e..34b33a1 100644
--- a/compiler/oat_test.cc
+++ b/compiler/oat_test.cc
@@ -487,7 +487,7 @@
   EXPECT_EQ(72U, sizeof(OatHeader));
   EXPECT_EQ(4U, sizeof(OatMethodOffsets));
   EXPECT_EQ(20U, sizeof(OatQuickMethodHeader));
-  EXPECT_EQ(163 * static_cast<size_t>(GetInstructionSetPointerSize(kRuntimeISA)),
+  EXPECT_EQ(157 * static_cast<size_t>(GetInstructionSetPointerSize(kRuntimeISA)),
             sizeof(QuickEntryPoints));
 }
 
diff --git a/compiler/oat_writer.cc b/compiler/oat_writer.cc
index a9da09c..bd2c5e3 100644
--- a/compiler/oat_writer.cc
+++ b/compiler/oat_writer.cc
@@ -296,6 +296,7 @@
     bss_start_(0u),
     bss_size_(0u),
     bss_roots_offset_(0u),
+    bss_type_entries_(),
     bss_string_entries_(),
     oat_data_offset_(0u),
     oat_header_(nullptr),
@@ -585,7 +586,7 @@
   }
   oat_size_ = offset;
 
-  if (!HasBootImage()) {
+  {
     TimingLogger::ScopedTiming split("InitBssLayout", timings_);
     InitBssLayout(instruction_set);
   }
@@ -715,7 +716,10 @@
     if (compiled_class != nullptr) {
       status = compiled_class->GetStatus();
     } else if (writer_->compiler_driver_->GetVerificationResults()->IsClassRejected(class_ref)) {
-      status = mirror::Class::kStatusError;
+      // The oat class status is used only for verification of resolved classes,
+      // so use kStatusErrorResolved whether the class was resolved or unresolved
+      // during compile-time verification.
+      status = mirror::Class::kStatusErrorResolved;
     } else {
       status = mirror::Class::kStatusNotReady;
     }
@@ -847,6 +851,10 @@
             if (!patch.IsPcRelative()) {
               writer_->absolute_patch_locations_.push_back(base_loc + patch.LiteralOffset());
             }
+            if (patch.GetType() == LinkerPatch::Type::kTypeBssEntry) {
+              TypeReference ref(patch.TargetTypeDexFile(), patch.TargetTypeIndex());
+              writer_->bss_type_entries_.Overwrite(ref, /* placeholder */ 0u);
+            }
             if (patch.GetType() == LinkerPatch::Type::kStringBssEntry) {
               StringReference ref(patch.TargetStringDexFile(), patch.TargetStringIndex());
               writer_->bss_string_entries_.Overwrite(ref, /* placeholder */ 0u);
@@ -1185,6 +1193,15 @@
                                                                      target_offset);
                 break;
               }
+              case LinkerPatch::Type::kTypeBssEntry: {
+                TypeReference ref(patch.TargetTypeDexFile(), patch.TargetTypeIndex());
+                uint32_t target_offset = writer_->bss_type_entries_.Get(ref);
+                writer_->relative_patcher_->PatchPcRelativeReference(&patched_code_,
+                                                                     patch,
+                                                                     offset_ + literal_offset,
+                                                                     target_offset);
+                break;
+              }
               case LinkerPatch::Type::kCall: {
                 uint32_t target_offset = GetTargetOffset(patch);
                 PatchCodeAddress(&patched_code_, literal_offset, target_offset);
@@ -1619,20 +1636,34 @@
 }
 
 void OatWriter::InitBssLayout(InstructionSet instruction_set) {
-  DCHECK(!HasBootImage());
+  if (HasBootImage()) {
+    DCHECK(bss_string_entries_.empty());
+    if (bss_type_entries_.empty()) {
+      // Nothing to put to the .bss section.
+      return;
+    }
+  }
 
   // Allocate space for app dex cache arrays in the .bss section.
   bss_start_ = RoundUp(oat_size_, kPageSize);
-  PointerSize pointer_size = GetInstructionSetPointerSize(instruction_set);
   bss_size_ = 0u;
-  for (const DexFile* dex_file : *dex_files_) {
-    dex_cache_arrays_offsets_.Put(dex_file, bss_start_ + bss_size_);
-    DexCacheArraysLayout layout(pointer_size, dex_file);
-    bss_size_ += layout.Size();
+  if (!HasBootImage()) {
+    PointerSize pointer_size = GetInstructionSetPointerSize(instruction_set);
+    for (const DexFile* dex_file : *dex_files_) {
+      dex_cache_arrays_offsets_.Put(dex_file, bss_start_ + bss_size_);
+      DexCacheArraysLayout layout(pointer_size, dex_file);
+      bss_size_ += layout.Size();
+    }
   }
 
   bss_roots_offset_ = bss_size_;
 
+  // Prepare offsets for .bss Class entries.
+  for (auto& entry : bss_type_entries_) {
+    DCHECK_EQ(entry.second, 0u);
+    entry.second = bss_start_ + bss_size_;
+    bss_size_ += sizeof(GcRoot<mirror::Class>);
+  }
   // Prepare offsets for .bss String entries.
   for (auto& entry : bss_string_entries_) {
     DCHECK_EQ(entry.second, 0u);
diff --git a/compiler/oat_writer.h b/compiler/oat_writer.h
index 8d087f4..db84166 100644
--- a/compiler/oat_writer.h
+++ b/compiler/oat_writer.h
@@ -31,6 +31,7 @@
 #include "os.h"
 #include "safe_map.h"
 #include "string_reference.h"
+#include "utils/type_reference.h"
 
 namespace art {
 
@@ -372,6 +373,11 @@
   // The offset of the GC roots in .bss section.
   size_t bss_roots_offset_;
 
+  // Map for allocating Class entries in .bss. Indexed by TypeReference for the source
+  // type in the dex file with the "type value comparator" for deduplication. The value
+  // is the target offset for patching, starting at `bss_start_ + bss_roots_offset_`.
+  SafeMap<TypeReference, size_t, TypeReferenceValueComparator> bss_type_entries_;
+
   // Map for allocating String entries in .bss. Indexed by StringReference for the source
   // string in the dex file with the "string value comparator" for deduplication. The value
   // is the target offset for patching, starting at `bss_start_ + bss_roots_offset_`.
diff --git a/compiler/optimizing/bounds_check_elimination.cc b/compiler/optimizing/bounds_check_elimination.cc
index 7dc094b..2ee4db9 100644
--- a/compiler/optimizing/bounds_check_elimination.cc
+++ b/compiler/optimizing/bounds_check_elimination.cc
@@ -153,21 +153,6 @@
     return instruction_ == bound.instruction_ && constant_ == bound.constant_;
   }
 
-  /*
-   * Hunt "under the hood" of array lengths (leading to array references),
-   * null checks (also leading to array references), and new arrays
-   * (leading to the actual length). This makes it more likely related
-   * instructions become actually comparable.
-   */
-  static HInstruction* HuntForDeclaration(HInstruction* instruction) {
-    while (instruction->IsArrayLength() ||
-           instruction->IsNullCheck() ||
-           instruction->IsNewArray()) {
-      instruction = instruction->InputAt(0);
-    }
-    return instruction;
-  }
-
   static bool Equal(HInstruction* instruction1, HInstruction* instruction2) {
     if (instruction1 == instruction2) {
       return true;
@@ -1136,7 +1121,7 @@
   }
 
   void VisitNewArray(HNewArray* new_array) OVERRIDE {
-    HInstruction* len = new_array->InputAt(0);
+    HInstruction* len = new_array->GetLength();
     if (!len->IsIntConstant()) {
       HInstruction *left;
       int32_t right_const;
@@ -1324,7 +1309,7 @@
     InductionVarRange::Value v2;
     bool needs_finite_test = false;
     HInstruction* index = context->InputAt(0);
-    HInstruction* hint = ValueBound::HuntForDeclaration(context->InputAt(1));
+    HInstruction* hint = HuntForDeclaration(context->InputAt(1));
     if (induction_range_.GetInductionRange(context, index, hint, &v1, &v2, &needs_finite_test)) {
       if (v1.is_known && (v1.a_constant == 0 || v1.a_constant == 1) &&
           v2.is_known && (v2.a_constant == 0 || v2.a_constant == 1)) {
diff --git a/compiler/optimizing/bounds_check_elimination_test.cc b/compiler/optimizing/bounds_check_elimination_test.cc
index dfa1504..5d58207 100644
--- a/compiler/optimizing/bounds_check_elimination_test.cc
+++ b/compiler/optimizing/bounds_check_elimination_test.cc
@@ -596,13 +596,11 @@
   HBasicBlock* block = new (allocator) HBasicBlock(graph);
   graph->AddBlock(block);
   entry->AddSuccessor(block);
+  // We pass a bogus constant for the class to avoid mocking one.
   HInstruction* new_array = new (allocator) HNewArray(
       constant_10,
-      graph->GetCurrentMethod(),
-      0,
-      dex::TypeIndex(static_cast<uint16_t>(Primitive::kPrimInt)),
-      graph->GetDexFile(),
-      kQuickAllocArray);
+      constant_10,
+      0);
   block->AddInstruction(new_array);
   block->AddInstruction(new (allocator) HGoto());
 
diff --git a/compiler/optimizing/builder.h b/compiler/optimizing/builder.h
index f896f11..8cf4089 100644
--- a/compiler/optimizing/builder.h
+++ b/compiler/optimizing/builder.h
@@ -63,7 +63,8 @@
                              driver,
                              interpreter_metadata,
                              compiler_stats,
-                             dex_cache) {}
+                             dex_cache,
+                             handles) {}
 
   // Only for unit testing.
   HGraphBuilder(HGraph* graph,
@@ -90,7 +91,8 @@
                              /* compiler_driver */ nullptr,
                              /* interpreter_metadata */ nullptr,
                              /* compiler_stats */ nullptr,
-                             null_dex_cache_) {}
+                             null_dex_cache_,
+                             handles) {}
 
   GraphAnalysisResult BuildGraph();
 
diff --git a/compiler/optimizing/code_generator.cc b/compiler/optimizing/code_generator.cc
index f00648f..99427f0 100644
--- a/compiler/optimizing/code_generator.cc
+++ b/compiler/optimizing/code_generator.cc
@@ -367,6 +367,12 @@
   InvokeRuntime(entrypoint, invoke, invoke->GetDexPc(), nullptr);
 }
 
+void CodeGenerator::GenerateInvokePolymorphicCall(HInvokePolymorphic* invoke) {
+  MoveConstant(invoke->GetLocations()->GetTemp(0), static_cast<int32_t>(invoke->GetType()));
+  QuickEntrypointEnum entrypoint = kQuickInvokePolymorphic;
+  InvokeRuntime(entrypoint, invoke, invoke->GetDexPc(), nullptr);
+}
+
 void CodeGenerator::CreateUnresolvedFieldLocationSummary(
     HInstruction* field_access,
     Primitive::Type field_type,
@@ -491,30 +497,33 @@
   }
 }
 
-// TODO: Remove argument `code_generator_supports_read_barrier` when
-// all code generators have read barrier support.
-void CodeGenerator::CreateLoadClassLocationSummary(HLoadClass* cls,
-                                                   Location runtime_type_index_location,
-                                                   Location runtime_return_location,
-                                                   bool code_generator_supports_read_barrier) {
-  ArenaAllocator* allocator = cls->GetBlock()->GetGraph()->GetArena();
-  LocationSummary::CallKind call_kind = cls->NeedsAccessCheck()
-      ? LocationSummary::kCallOnMainOnly
-      : (((code_generator_supports_read_barrier && kEmitCompilerReadBarrier) ||
-          cls->CanCallRuntime())
-            ? LocationSummary::kCallOnSlowPath
-            : LocationSummary::kNoCall);
-  LocationSummary* locations = new (allocator) LocationSummary(cls, call_kind);
-  if (cls->NeedsAccessCheck()) {
-    locations->SetInAt(0, Location::NoLocation());
-    locations->AddTemp(runtime_type_index_location);
-    locations->SetOut(runtime_return_location);
-  } else {
-    locations->SetInAt(0, Location::RequiresRegister());
-    locations->SetOut(Location::RequiresRegister());
-  }
+void CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(HLoadClass* cls,
+                                                              Location runtime_type_index_location,
+                                                              Location runtime_return_location) {
+  DCHECK_EQ(cls->GetLoadKind(), HLoadClass::LoadKind::kDexCacheViaMethod);
+  DCHECK_EQ(cls->InputCount(), 1u);
+  LocationSummary* locations = new (cls->GetBlock()->GetGraph()->GetArena()) LocationSummary(
+      cls, LocationSummary::kCallOnMainOnly);
+  locations->SetInAt(0, Location::NoLocation());
+  locations->AddTemp(runtime_type_index_location);
+  locations->SetOut(runtime_return_location);
 }
 
+void CodeGenerator::GenerateLoadClassRuntimeCall(HLoadClass* cls) {
+  DCHECK_EQ(cls->GetLoadKind(), HLoadClass::LoadKind::kDexCacheViaMethod);
+  LocationSummary* locations = cls->GetLocations();
+  MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
+  if (cls->NeedsAccessCheck()) {
+    CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+    InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
+  } else if (cls->MustGenerateClinitCheck()) {
+    CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
+    InvokeRuntime(kQuickInitializeStaticStorage, cls, cls->GetDexPc());
+  } else {
+    CheckEntrypointTypes<kQuickInitializeType, void*, uint32_t>();
+    InvokeRuntime(kQuickInitializeType, cls, cls->GetDexPc());
+  }
+}
 
 void CodeGenerator::BlockIfInRegister(Location location, bool is_out) const {
   // The DCHECKS below check that a register is not specified twice in
@@ -830,8 +839,8 @@
     // last emitted is different than the native pc of the stack map just emitted.
     size_t number_of_stack_maps = stack_map_stream_.GetNumberOfStackMaps();
     if (number_of_stack_maps > 1) {
-      DCHECK_NE(stack_map_stream_.GetStackMap(number_of_stack_maps - 1).native_pc_offset,
-                stack_map_stream_.GetStackMap(number_of_stack_maps - 2).native_pc_offset);
+      DCHECK_NE(stack_map_stream_.GetStackMap(number_of_stack_maps - 1).native_pc_code_offset,
+                stack_map_stream_.GetStackMap(number_of_stack_maps - 2).native_pc_code_offset);
     }
   }
 }
@@ -839,7 +848,8 @@
 bool CodeGenerator::HasStackMapAtCurrentPc() {
   uint32_t pc = GetAssembler()->CodeSize();
   size_t count = stack_map_stream_.GetNumberOfStackMaps();
-  return count > 0 && stack_map_stream_.GetStackMap(count - 1).native_pc_offset == pc;
+  CodeOffset native_pc_offset = stack_map_stream_.GetStackMap(count - 1).native_pc_code_offset;
+  return (count > 0) && (native_pc_offset.Uint32Value(GetInstructionSet()) == pc);
 }
 
 void CodeGenerator::MaybeRecordNativeDebugInfo(HInstruction* instruction,
@@ -927,10 +937,10 @@
   if (environment->GetParent() != nullptr) {
     // We emit the parent environment first.
     EmitEnvironment(environment->GetParent(), slow_path);
-    stack_map_stream_.BeginInlineInfoEntry(environment->GetMethodIdx(),
+    stack_map_stream_.BeginInlineInfoEntry(environment->GetMethod(),
                                            environment->GetDexPc(),
-                                           environment->GetInvokeType(),
-                                           environment->Size());
+                                           environment->Size(),
+                                           &graph_->GetDexFile());
   }
 
   // Walk over the environment, and record the location of dex registers.
diff --git a/compiler/optimizing/code_generator.h b/compiler/optimizing/code_generator.h
index 6366b98..2d129af 100644
--- a/compiler/optimizing/code_generator.h
+++ b/compiler/optimizing/code_generator.h
@@ -426,12 +426,12 @@
   }
 
 
-  // Perfoms checks pertaining to an InvokeRuntime call.
+  // Performs checks pertaining to an InvokeRuntime call.
   void ValidateInvokeRuntime(QuickEntrypointEnum entrypoint,
                              HInstruction* instruction,
                              SlowPathCode* slow_path);
 
-  // Perfoms checks pertaining to an InvokeRuntimeWithoutRecordingPcInfo call.
+  // Performs checks pertaining to an InvokeRuntimeWithoutRecordingPcInfo call.
   static void ValidateInvokeRuntimeWithoutRecordingPcInfo(HInstruction* instruction,
                                                           SlowPathCode* slow_path);
 
@@ -495,6 +495,8 @@
 
   void GenerateInvokeUnresolvedRuntimeCall(HInvokeUnresolved* invoke);
 
+  void GenerateInvokePolymorphicCall(HInvokePolymorphic* invoke);
+
   void CreateUnresolvedFieldLocationSummary(
       HInstruction* field_access,
       Primitive::Type field_type,
@@ -507,11 +509,10 @@
       uint32_t dex_pc,
       const FieldAccessCallingConvention& calling_convention);
 
-  // TODO: This overlaps a bit with MoveFromReturnRegister. Refactor for a better design.
-  static void CreateLoadClassLocationSummary(HLoadClass* cls,
-                                             Location runtime_type_index_location,
-                                             Location runtime_return_location,
-                                             bool code_generator_supports_read_barrier = false);
+  static void CreateLoadClassRuntimeCallLocationSummary(HLoadClass* cls,
+                                                        Location runtime_type_index_location,
+                                                        Location runtime_return_location);
+  void GenerateLoadClassRuntimeCall(HLoadClass* cls);
 
   static void CreateSystemArrayCopyLocationSummary(HInvoke* invoke);
 
@@ -521,7 +522,7 @@
   virtual void InvokeRuntime(QuickEntrypointEnum entrypoint,
                              HInstruction* instruction,
                              uint32_t dex_pc,
-                             SlowPathCode* slow_path) = 0;
+                             SlowPathCode* slow_path = nullptr) = 0;
 
   // Check if the desired_string_load_kind is supported. If it is, return it,
   // otherwise return a fall-back kind that should be used instead.
@@ -607,7 +608,7 @@
         number_of_register_pairs_(number_of_register_pairs),
         core_callee_save_mask_(core_callee_save_mask),
         fpu_callee_save_mask_(fpu_callee_save_mask),
-        stack_map_stream_(graph->GetArena()),
+        stack_map_stream_(graph->GetArena(), graph->GetInstructionSet()),
         block_order_(nullptr),
         jit_string_roots_(StringReferenceValueComparator(),
                           graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
diff --git a/compiler/optimizing/code_generator_arm.cc b/compiler/optimizing/code_generator_arm.cc
index 541a1c5..f5b6ebe 100644
--- a/compiler/optimizing/code_generator_arm.cc
+++ b/compiler/optimizing/code_generator_arm.cc
@@ -371,22 +371,23 @@
                        HInstruction* at,
                        uint32_t dex_pc,
                        bool do_clinit)
-      : SlowPathCodeARM(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+      : SlowPathCodeARM(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
     DCHECK(at->IsLoadClass() || at->IsClinitCheck());
   }
 
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
-    LocationSummary* locations = at_->GetLocations();
+    LocationSummary* locations = instruction_->GetLocations();
 
     CodeGeneratorARM* arm_codegen = down_cast<CodeGeneratorARM*>(codegen);
     __ Bind(GetEntryLabel());
     SaveLiveRegisters(codegen, locations);
 
     InvokeRuntimeCallingConvention calling_convention;
-    __ LoadImmediate(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
+    dex::TypeIndex type_index = cls_->GetTypeIndex();
+    __ LoadImmediate(calling_convention.GetRegisterAt(0), type_index.index_);
     QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
                                                 : kQuickInitializeType;
-    arm_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
+    arm_codegen->InvokeRuntime(entrypoint, instruction_, dex_pc_, this);
     if (do_clinit_) {
       CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
     } else {
@@ -400,6 +401,23 @@
       arm_codegen->Move32(locations->Out(), Location::RegisterLocation(R0));
     }
     RestoreLiveRegisters(codegen, locations);
+    // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+    DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+    if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+      DCHECK(out.IsValid());
+      // TODO: Change art_quick_initialize_type/art_quick_initialize_static_storage to
+      // kSaveEverything and use a temporary for the .bss entry address in the fast path,
+      // so that we can avoid another calculation here.
+      CodeGeneratorARM::PcRelativePatchInfo* labels =
+          arm_codegen->NewTypeBssEntryPatch(cls_->GetDexFile(), type_index);
+      __ BindTrackedLabel(&labels->movw_label);
+      __ movw(IP, /* placeholder */ 0u);
+      __ BindTrackedLabel(&labels->movt_label);
+      __ movt(IP, /* placeholder */ 0u);
+      __ BindTrackedLabel(&labels->add_pc_label);
+      __ add(IP, IP, ShifterOperand(PC));
+      __ str(locations->Out().AsRegister<Register>(), Address(IP));
+    }
     __ b(GetExitLabel());
   }
 
@@ -409,10 +427,6 @@
   // The class this slow path will load.
   HLoadClass* const cls_;
 
-  // The instruction where this slow path is happening.
-  // (Might be the load class or an initialization check).
-  HInstruction* const at_;
-
   // The dex PC of `at_`.
   const uint32_t dex_pc_;
 
@@ -430,7 +444,7 @@
     LocationSummary* locations = instruction_->GetLocations();
     DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(locations->Out().reg()));
     HLoadString* load = instruction_->AsLoadString();
-    const uint32_t string_index = load->GetStringIndex().index_;
+    const dex::StringIndex string_index = load->GetStringIndex();
     Register out = locations->Out().AsRegister<Register>();
     Register temp = locations->GetTemp(0).AsRegister<Register>();
     constexpr bool call_saves_everything_except_r0 = (!kUseReadBarrier || kUseBakerReadBarrier);
@@ -449,7 +463,7 @@
       __ mov(entry_address, ShifterOperand(temp));
     }
 
-    __ LoadImmediate(calling_convention.GetRegisterAt(0), string_index);
+    __ LoadImmediate(calling_convention.GetRegisterAt(0), string_index.index_);
     arm_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
     CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
 
@@ -1208,6 +1222,7 @@
       boot_image_type_patches_(TypeReferenceValueComparator(),
                                graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+      type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       boot_image_address_patches_(std::less<uint32_t>(),
                                   graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       jit_string_patches_(StringReferenceValueComparator(),
@@ -1224,7 +1239,8 @@
 
   // Adjust native pc offsets in stack maps.
   for (size_t i = 0, num = stack_map_stream_.GetNumberOfStackMaps(); i != num; ++i) {
-    uint32_t old_position = stack_map_stream_.GetStackMap(i).native_pc_offset;
+    uint32_t old_position =
+        stack_map_stream_.GetStackMap(i).native_pc_code_offset.Uint32Value(kThumb2);
     uint32_t new_position = __ GetAdjustedPosition(old_position);
     stack_map_stream_.SetStackMapNativePcOffset(i, new_position);
   }
@@ -2370,6 +2386,14 @@
   codegen_->RecordPcInfo(invoke, invoke->GetDexPc());
 }
 
+void LocationsBuilderARM::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorARM::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
 void LocationsBuilderARM::VisitNeg(HNeg* neg) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
@@ -3308,7 +3332,7 @@
         InvokeRuntimeCallingConvention calling_convention;
         locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
         locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
-        // Note: divrem will compute both the quotient and the remainder as the pair R0 and R1, but
+        // Note: divmod will compute both the quotient and the remainder as the pair R0 and R1, but
         //       we only need the former.
         locations->SetOut(Location::RegisterLocation(R0));
       }
@@ -3435,7 +3459,7 @@
         InvokeRuntimeCallingConvention calling_convention;
         locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
         locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
-        // Note: divrem will compute both the quotient and the remainder as the pair R0 and R1, but
+        // Note: divmod will compute both the quotient and the remainder as the pair R0 and R1, but
         //       we only need the latter.
         locations->SetOut(Location::RegisterLocation(R1));
       }
@@ -3961,19 +3985,16 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
   InvokeRuntimeCallingConvention calling_convention;
-  locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetOut(Location::RegisterLocation(R0));
-  locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
-  locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
+  locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+  locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
 }
 
 void InstructionCodeGeneratorARM::VisitNewArray(HNewArray* instruction) {
-  InvokeRuntimeCallingConvention calling_convention;
-  __ LoadImmediate(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex().index_);
   // Note: if heap poisoning is enabled, the entry point takes cares
   // of poisoning the reference.
-  codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
-  CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
+  codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+  CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
 }
 
 void LocationsBuilderARM::VisitParameterValue(HParameterValue* instruction) {
@@ -5708,17 +5729,11 @@
       break;
     case HLoadClass::LoadKind::kBootImageAddress:
       break;
-    case HLoadClass::LoadKind::kJitTableAddress:
-      break;
-    case HLoadClass::LoadKind::kDexCachePcRelative:
+    case HLoadClass::LoadKind::kBssEntry:
       DCHECK(!Runtime::Current()->UseJitCompilation());
-      // We disable pc-relative load when there is an irreducible loop, as the optimization
-      // is incompatible with it.
-      // TODO: Create as many ArmDexCacheArraysBase instructions as needed for methods
-      // with irreducible loops.
-      if (GetGraph()->HasIrreducibleLoops()) {
-        return HLoadClass::LoadKind::kDexCacheViaMethod;
-      }
+      break;
+    case HLoadClass::LoadKind::kJitTableAddress:
+      DCHECK(Runtime::Current()->UseJitCompilation());
       break;
     case HLoadClass::LoadKind::kDexCacheViaMethod:
       break;
@@ -5727,15 +5742,16 @@
 }
 
 void LocationsBuilderARM::VisitLoadClass(HLoadClass* cls) {
-  if (cls->NeedsAccessCheck()) {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
     InvokeRuntimeCallingConvention calling_convention;
-    CodeGenerator::CreateLoadClassLocationSummary(
+    CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
         cls,
         Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-        Location::RegisterLocation(R0),
-        /* code_generator_supports_read_barrier */ true);
+        Location::RegisterLocation(R0));
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
   const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage();
   LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier)
@@ -5746,24 +5762,23 @@
     locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty());  // No caller-save registers.
   }
 
-  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
-  if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
-      load_kind == HLoadClass::LoadKind::kDexCacheViaMethod ||
-      load_kind == HLoadClass::LoadKind::kDexCachePcRelative) {
+  if (load_kind == HLoadClass::LoadKind::kReferrersClass) {
     locations->SetInAt(0, Location::RequiresRegister());
   }
   locations->SetOut(Location::RequiresRegister());
 }
 
-void InstructionCodeGeneratorARM::VisitLoadClass(HLoadClass* cls) {
-  LocationSummary* locations = cls->GetLocations();
-  if (cls->NeedsAccessCheck()) {
-    codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
-    codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
-    CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorARM::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+    codegen_->GenerateLoadClassRuntimeCall(cls);
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
+  LocationSummary* locations = cls->GetLocations();
   Location out_loc = locations->Out();
   Register out = out_loc.AsRegister<Register>();
 
@@ -5771,7 +5786,7 @@
       ? kWithoutReadBarrier
       : kCompilerReadBarrierOption;
   bool generate_null_check = false;
-  switch (cls->GetLoadKind()) {
+  switch (load_kind) {
     case HLoadClass::LoadKind::kReferrersClass: {
       DCHECK(!cls->CanCallRuntime());
       DCHECK(!cls->MustGenerateClinitCheck());
@@ -5785,12 +5800,14 @@
       break;
     }
     case HLoadClass::LoadKind::kBootImageLinkTimeAddress: {
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
       __ LoadLiteral(out, codegen_->DeduplicateBootImageTypeLiteral(cls->GetDexFile(),
                                                                     cls->GetTypeIndex()));
       break;
     }
     case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: {
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
       CodeGeneratorARM::PcRelativePatchInfo* labels =
           codegen_->NewPcRelativeTypePatch(cls->GetDexFile(), cls->GetTypeIndex());
@@ -5804,41 +5821,36 @@
     }
     case HLoadClass::LoadKind::kBootImageAddress: {
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
-      DCHECK_NE(cls->GetAddress(), 0u);
-      uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+      uint32_t address = dchecked_integral_cast<uint32_t>(
+          reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+      DCHECK_NE(address, 0u);
       __ LoadLiteral(out, codegen_->DeduplicateBootImageAddressLiteral(address));
       break;
     }
+    case HLoadClass::LoadKind::kBssEntry: {
+      CodeGeneratorARM::PcRelativePatchInfo* labels =
+          codegen_->NewTypeBssEntryPatch(cls->GetDexFile(), cls->GetTypeIndex());
+      __ BindTrackedLabel(&labels->movw_label);
+      __ movw(out, /* placeholder */ 0u);
+      __ BindTrackedLabel(&labels->movt_label);
+      __ movt(out, /* placeholder */ 0u);
+      __ BindTrackedLabel(&labels->add_pc_label);
+      __ add(out, out, ShifterOperand(PC));
+      GenerateGcRootFieldLoad(cls, out_loc, out, 0, kCompilerReadBarrierOption);
+      generate_null_check = true;
+      break;
+    }
     case HLoadClass::LoadKind::kJitTableAddress: {
       __ LoadLiteral(out, codegen_->DeduplicateJitClassLiteral(cls->GetDexFile(),
                                                                cls->GetTypeIndex(),
-                                                               cls->GetAddress()));
+                                                               cls->GetClass()));
       // /* GcRoot<mirror::Class> */ out = *out
       GenerateGcRootFieldLoad(cls, out_loc, out, /* offset */ 0, kCompilerReadBarrierOption);
       break;
     }
-    case HLoadClass::LoadKind::kDexCachePcRelative: {
-      Register base_reg = locations->InAt(0).AsRegister<Register>();
-      HArmDexCacheArraysBase* base = cls->InputAt(0)->AsArmDexCacheArraysBase();
-      int32_t offset = cls->GetDexCacheElementOffset() - base->GetElementOffset();
-      // /* GcRoot<mirror::Class> */ out = *(dex_cache_arrays_base + offset)
-      GenerateGcRootFieldLoad(cls, out_loc, base_reg, offset, read_barrier_option);
-      generate_null_check = !cls->IsInDexCache();
-      break;
-    }
-    case HLoadClass::LoadKind::kDexCacheViaMethod: {
-      // /* GcRoot<mirror::Class>[] */ out =
-      //        current_method.ptr_sized_fields_->dex_cache_resolved_types_
-      Register current_method = locations->InAt(0).AsRegister<Register>();
-      __ LoadFromOffset(kLoadWord,
-                        out,
-                        current_method,
-                        ArtMethod::DexCacheResolvedTypesOffset(kArmPointerSize).Int32Value());
-      // /* GcRoot<mirror::Class> */ out = out[type_index]
-      size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_);
-      GenerateGcRootFieldLoad(cls, out_loc, out, offset, read_barrier_option);
-      generate_null_check = !cls->IsInDexCache();
-    }
+    case HLoadClass::LoadKind::kDexCacheViaMethod:
+      LOG(FATAL) << "UNREACHABLE";
+      UNREACHABLE();
   }
 
   if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -5946,6 +5958,7 @@
 
   switch (load_kind) {
     case HLoadString::LoadKind::kBootImageLinkTimeAddress: {
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       __ LoadLiteral(out, codegen_->DeduplicateBootImageStringLiteral(load->GetDexFile(),
                                                                       load->GetStringIndex()));
       return;  // No dex cache slow path.
@@ -5953,7 +5966,7 @@
     case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
       DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       CodeGeneratorARM::PcRelativePatchInfo* labels =
-          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
       __ BindTrackedLabel(&labels->movw_label);
       __ movw(out, /* placeholder */ 0u);
       __ BindTrackedLabel(&labels->movt_label);
@@ -5973,7 +5986,7 @@
       DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
       Register temp = locations->GetTemp(0).AsRegister<Register>();
       CodeGeneratorARM::PcRelativePatchInfo* labels =
-          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
       __ BindTrackedLabel(&labels->movw_label);
       __ movw(temp, /* placeholder */ 0u);
       __ BindTrackedLabel(&labels->movt_label);
@@ -7138,18 +7151,7 @@
 HInvokeStaticOrDirect::DispatchInfo CodeGeneratorARM::GetSupportedInvokeStaticOrDirectDispatch(
       const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info,
       HInvokeStaticOrDirect* invoke ATTRIBUTE_UNUSED) {
-  HInvokeStaticOrDirect::DispatchInfo dispatch_info = desired_dispatch_info;
-  // We disable pc-relative load when there is an irreducible loop, as the optimization
-  // is incompatible with it.
-  // TODO: Create as many ArmDexCacheArraysBase instructions as needed for methods
-  // with irreducible loops.
-  if (GetGraph()->HasIrreducibleLoops() &&
-      (dispatch_info.method_load_kind ==
-          HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative)) {
-    dispatch_info.method_load_kind = HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod;
-  }
-
-  return dispatch_info;
+  return desired_dispatch_info;
 }
 
 Register CodeGeneratorARM::GetInvokeStaticOrDirectExtraParameter(HInvokeStaticOrDirect* invoke,
@@ -7169,8 +7171,7 @@
   // save one load. However, since this is just an intrinsic slow path we prefer this
   // simple and more robust approach rather that trying to determine if that's the case.
   SlowPathCode* slow_path = GetCurrentSlowPath();
-  DCHECK(slow_path != nullptr);  // For intrinsified invokes the call is emitted on the slow path.
-  if (slow_path->IsCoreRegisterSaved(location.AsRegister<Register>())) {
+  if (slow_path != nullptr && slow_path->IsCoreRegisterSaved(location.AsRegister<Register>())) {
     int stack_offset = slow_path->GetStackOffsetOfCoreRegister(location.AsRegister<Register>());
     __ LoadFromOffset(kLoadWord, temp, SP, stack_offset);
     return temp;
@@ -7178,7 +7179,8 @@
   return location.AsRegister<Register>();
 }
 
-void CodeGeneratorARM::GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) {
+Location CodeGeneratorARM::GenerateCalleeMethodStaticOrDirectCall(HInvokeStaticOrDirect* invoke,
+                                                                  Location temp) {
   Location callee_method = temp;  // For all kinds except kRecursive, callee will be in temp.
   switch (invoke->GetMethodLoadKind()) {
     case HInvokeStaticOrDirect::MethodLoadKind::kStringInit: {
@@ -7227,6 +7229,11 @@
       break;
     }
   }
+  return callee_method;
+}
+
+void CodeGeneratorARM::GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) {
+  Location callee_method = GenerateCalleeMethodStaticOrDirectCall(invoke, temp);
 
   switch (invoke->GetCodePtrLocation()) {
     case HInvokeStaticOrDirect::CodePtrLocation::kCallSelf:
@@ -7279,8 +7286,8 @@
 }
 
 CodeGeneratorARM::PcRelativePatchInfo* CodeGeneratorARM::NewPcRelativeStringPatch(
-    const DexFile& dex_file, uint32_t string_index) {
-  return NewPcRelativePatch(dex_file, string_index, &pc_relative_string_patches_);
+    const DexFile& dex_file, dex::StringIndex string_index) {
+  return NewPcRelativePatch(dex_file, string_index.index_, &pc_relative_string_patches_);
 }
 
 CodeGeneratorARM::PcRelativePatchInfo* CodeGeneratorARM::NewPcRelativeTypePatch(
@@ -7288,6 +7295,11 @@
   return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_);
 }
 
+CodeGeneratorARM::PcRelativePatchInfo* CodeGeneratorARM::NewTypeBssEntryPatch(
+    const DexFile& dex_file, dex::TypeIndex type_index) {
+  return NewPcRelativePatch(dex_file, type_index.index_, &type_bss_entry_patches_);
+}
+
 CodeGeneratorARM::PcRelativePatchInfo* CodeGeneratorARM::NewPcRelativeDexCacheArrayPatch(
     const DexFile& dex_file, uint32_t element_offset) {
   return NewPcRelativePatch(dex_file, element_offset, &pc_relative_dex_cache_patches_);
@@ -7331,8 +7343,9 @@
 
 Literal* CodeGeneratorARM::DeduplicateJitClassLiteral(const DexFile& dex_file,
                                                       dex::TypeIndex type_index,
-                                                      uint64_t address) {
-  jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index), address);
+                                                      Handle<mirror::Class> handle) {
+  jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index),
+                             reinterpret_cast64<uint64_t>(handle.GetReference()));
   return jit_class_patches_.GetOrCreate(
       TypeReference(&dex_file, type_index),
       [this]() { return __ NewLiteral<uint32_t>(/* placeholder */ 0u); });
@@ -7366,6 +7379,7 @@
       /* MOVW+MOVT for each entry */ 2u * pc_relative_string_patches_.size() +
       boot_image_type_patches_.size() +
       /* MOVW+MOVT for each entry */ 2u * pc_relative_type_patches_.size() +
+      /* MOVW+MOVT for each entry */ 2u * type_bss_entry_patches_.size() +
       boot_image_address_patches_.size();
   linker_patches->reserve(size);
   EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
@@ -7380,12 +7394,17 @@
                                                        target_string.string_index.index_));
   }
   if (!GetCompilerOptions().IsBootImage()) {
+    DCHECK(pc_relative_type_patches_.empty());
     EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
                                                                   linker_patches);
   } else {
+    EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+                                                                linker_patches);
     EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_,
                                                                   linker_patches);
   }
+  EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
+                                                              linker_patches);
   for (const auto& entry : boot_image_type_patches_) {
     const TypeReference& target_type = entry.first;
     Literal* literal = entry.second;
@@ -7395,8 +7414,6 @@
                                                      target_type.dex_file,
                                                      target_type.type_index.index_));
   }
-  EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
-                                                              linker_patches);
   for (const auto& entry : boot_image_address_patches_) {
     DCHECK(GetCompilerOptions().GetIncludePatchInformation());
     Literal* literal = entry.second;
@@ -7404,6 +7421,7 @@
     uint32_t literal_offset = literal->GetLabel()->Position();
     linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
   }
+  DCHECK_EQ(size, linker_patches->size());
 }
 
 Literal* CodeGeneratorARM::DeduplicateUint32Literal(uint32_t value, Uint32ToLiteralMap* map) {
diff --git a/compiler/optimizing/code_generator_arm.h b/compiler/optimizing/code_generator_arm.h
index d5968e0..df2dbc7 100644
--- a/compiler/optimizing/code_generator_arm.h
+++ b/compiler/optimizing/code_generator_arm.h
@@ -456,6 +456,7 @@
       const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info,
       HInvokeStaticOrDirect* invoke) OVERRIDE;
 
+  Location GenerateCalleeMethodStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp);
   void GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) OVERRIDE;
   void GenerateVirtualCall(HInvokeVirtual* invoke, Location temp) OVERRIDE;
 
@@ -481,8 +482,10 @@
     Label add_pc_label;
   };
 
-  PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index);
+  PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file,
+                                                dex::StringIndex string_index);
   PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index);
+  PcRelativePatchInfo* NewTypeBssEntryPatch(const DexFile& dex_file, dex::TypeIndex type_index);
   PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
                                                        uint32_t element_offset);
   Literal* DeduplicateBootImageStringLiteral(const DexFile& dex_file,
@@ -494,7 +497,7 @@
                                        Handle<mirror::String> handle);
   Literal* DeduplicateJitClassLiteral(const DexFile& dex_file,
                                       dex::TypeIndex type_index,
-                                      uint64_t address);
+                                      Handle<mirror::Class> handle);
 
   void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
 
@@ -635,8 +638,10 @@
   ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
   // Deduplication map for boot type literals for kBootImageLinkTimeAddress.
   TypeToLiteralMap boot_image_type_patches_;
-  // PC-relative type patch info.
+  // PC-relative type patch info for kBootImageLinkTimePcRelative.
   ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
+  // PC-relative type patch info for kBssEntry.
+  ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
   // Deduplication map for patchable boot image addresses.
   Uint32ToLiteralMap boot_image_address_patches_;
 
diff --git a/compiler/optimizing/code_generator_arm64.cc b/compiler/optimizing/code_generator_arm64.cc
index 9aaeadb..9762ee8 100644
--- a/compiler/optimizing/code_generator_arm64.cc
+++ b/compiler/optimizing/code_generator_arm64.cc
@@ -276,22 +276,23 @@
                          HInstruction* at,
                          uint32_t dex_pc,
                          bool do_clinit)
-      : SlowPathCodeARM64(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+      : SlowPathCodeARM64(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
     DCHECK(at->IsLoadClass() || at->IsClinitCheck());
   }
 
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
-    LocationSummary* locations = at_->GetLocations();
+    LocationSummary* locations = instruction_->GetLocations();
     CodeGeneratorARM64* arm64_codegen = down_cast<CodeGeneratorARM64*>(codegen);
 
     __ Bind(GetEntryLabel());
     SaveLiveRegisters(codegen, locations);
 
     InvokeRuntimeCallingConvention calling_convention;
-    __ Mov(calling_convention.GetRegisterAt(0).W(), cls_->GetTypeIndex().index_);
+    dex::TypeIndex type_index = cls_->GetTypeIndex();
+    __ Mov(calling_convention.GetRegisterAt(0).W(), type_index.index_);
     QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
                                                 : kQuickInitializeType;
-    arm64_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
+    arm64_codegen->InvokeRuntime(entrypoint, instruction_, dex_pc_, this);
     if (do_clinit_) {
       CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
     } else {
@@ -302,11 +303,32 @@
     Location out = locations->Out();
     if (out.IsValid()) {
       DCHECK(out.IsRegister() && !locations->GetLiveRegisters()->ContainsCoreRegister(out.reg()));
-      Primitive::Type type = at_->GetType();
+      Primitive::Type type = instruction_->GetType();
       arm64_codegen->MoveLocation(out, calling_convention.GetReturnLocation(type), type);
     }
-
     RestoreLiveRegisters(codegen, locations);
+    // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+    DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+    if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+      DCHECK(out.IsValid());
+      UseScratchRegisterScope temps(arm64_codegen->GetVIXLAssembler());
+      Register temp = temps.AcquireX();
+      const DexFile& dex_file = cls_->GetDexFile();
+      // TODO: Change art_quick_initialize_type/art_quick_initialize_static_storage to
+      // kSaveEverything and use a temporary for the ADRP in the fast path, so that we
+      // can avoid the ADRP here.
+      vixl::aarch64::Label* adrp_label =
+          arm64_codegen->NewBssEntryTypePatch(dex_file, type_index);
+      arm64_codegen->EmitAdrpPlaceholder(adrp_label, temp);
+      vixl::aarch64::Label* strp_label =
+          arm64_codegen->NewBssEntryTypePatch(dex_file, type_index, adrp_label);
+      {
+        SingleEmissionCheckScope guard(arm64_codegen->GetVIXLAssembler());
+        __ Bind(strp_label);
+        __ str(RegisterFrom(locations->Out(), Primitive::kPrimNot),
+               MemOperand(temp, /* offset placeholder */ 0));
+      }
+    }
     __ B(GetExitLabel());
   }
 
@@ -316,10 +338,6 @@
   // The class this slow path will load.
   HLoadClass* const cls_;
 
-  // The instruction where this slow path is happening.
-  // (Might be the load class or an initialization check).
-  HInstruction* const at_;
-
   // The dex PC of `at_`.
   const uint32_t dex_pc_;
 
@@ -349,8 +367,8 @@
     SaveLiveRegisters(codegen, locations);
 
     InvokeRuntimeCallingConvention calling_convention;
-    const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
-    __ Mov(calling_convention.GetRegisterAt(0).W(), string_index);
+    const dex::StringIndex string_index = instruction_->AsLoadString()->GetStringIndex();
+    __ Mov(calling_convention.GetRegisterAt(0).W(), string_index.index_);
     arm64_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
     CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
     Primitive::Type type = instruction_->GetType();
@@ -1154,6 +1172,7 @@
       boot_image_type_patches_(TypeReferenceValueComparator(),
                                graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+      type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       boot_image_address_patches_(std::less<uint32_t>(),
                                   graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       jit_string_patches_(StringReferenceValueComparator(),
@@ -3974,7 +3993,8 @@
   return desired_dispatch_info;
 }
 
-void CodeGeneratorARM64::GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) {
+Location CodeGeneratorARM64::GenerateCalleeMethodStaticOrDirectCall(HInvokeStaticOrDirect* invoke,
+                                                                    Location temp) {
   // Make sure that ArtMethod* is passed in kArtMethodRegister as per the calling convention.
   Location callee_method = temp;  // For all kinds except kRecursive, callee will be in temp.
   switch (invoke->GetMethodLoadKind()) {
@@ -3994,7 +4014,7 @@
       break;
     case HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative: {
       // Add ADRP with its PC-relative DexCache access patch.
-      const DexFile& dex_file = invoke->GetDexFile();
+      const DexFile& dex_file = invoke->GetDexFileForPcRelativeDexCache();
       uint32_t element_offset = invoke->GetDexCacheArrayOffset();
       vixl::aarch64::Label* adrp_label = NewPcRelativeDexCacheArrayPatch(dex_file, element_offset);
       EmitAdrpPlaceholder(adrp_label, XRegisterFrom(temp));
@@ -4028,6 +4048,12 @@
       break;
     }
   }
+  return callee_method;
+}
+
+void CodeGeneratorARM64::GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) {
+  // All registers are assumed to be correctly set up.
+  Location callee_method = GenerateCalleeMethodStaticOrDirectCall(invoke, temp);
 
   switch (invoke->GetCodePtrLocation()) {
     case HInvokeStaticOrDirect::CodePtrLocation::kCallSelf:
@@ -4080,11 +4106,20 @@
   __ Blr(lr);
 }
 
+void LocationsBuilderARM64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorARM64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
 vixl::aarch64::Label* CodeGeneratorARM64::NewPcRelativeStringPatch(
     const DexFile& dex_file,
-    uint32_t string_index,
+    dex::StringIndex string_index,
     vixl::aarch64::Label* adrp_label) {
-  return NewPcRelativePatch(dex_file, string_index, adrp_label, &pc_relative_string_patches_);
+  return
+      NewPcRelativePatch(dex_file, string_index.index_, adrp_label, &pc_relative_string_patches_);
 }
 
 vixl::aarch64::Label* CodeGeneratorARM64::NewPcRelativeTypePatch(
@@ -4094,6 +4129,13 @@
   return NewPcRelativePatch(dex_file, type_index.index_, adrp_label, &pc_relative_type_patches_);
 }
 
+vixl::aarch64::Label* CodeGeneratorARM64::NewBssEntryTypePatch(
+    const DexFile& dex_file,
+    dex::TypeIndex type_index,
+    vixl::aarch64::Label* adrp_label) {
+  return NewPcRelativePatch(dex_file, type_index.index_, adrp_label, &type_bss_entry_patches_);
+}
+
 vixl::aarch64::Label* CodeGeneratorARM64::NewPcRelativeDexCacheArrayPatch(
     const DexFile& dex_file,
     uint32_t element_offset,
@@ -4146,8 +4188,9 @@
 }
 
 vixl::aarch64::Literal<uint32_t>* CodeGeneratorARM64::DeduplicateJitClassLiteral(
-    const DexFile& dex_file, dex::TypeIndex type_index, uint64_t address) {
-  jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index), address);
+    const DexFile& dex_file, dex::TypeIndex type_index, Handle<mirror::Class> handle) {
+  jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index),
+                             reinterpret_cast64<uint64_t>(handle.GetReference()));
   return jit_class_patches_.GetOrCreate(
       TypeReference(&dex_file, type_index),
       [this]() { return __ CreateLiteralDestroyedWithPool<uint32_t>(/* placeholder */ 0u); });
@@ -4200,6 +4243,7 @@
       pc_relative_string_patches_.size() +
       boot_image_type_patches_.size() +
       pc_relative_type_patches_.size() +
+      type_bss_entry_patches_.size() +
       boot_image_address_patches_.size();
   linker_patches->reserve(size);
   for (const PcRelativePatchInfo& info : pc_relative_dex_cache_patches_) {
@@ -4216,12 +4260,17 @@
                                                        target_string.string_index.index_));
   }
   if (!GetCompilerOptions().IsBootImage()) {
+    DCHECK(pc_relative_type_patches_.empty());
     EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
                                                                   linker_patches);
   } else {
+    EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+                                                                linker_patches);
     EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_,
                                                                   linker_patches);
   }
+  EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
+                                                              linker_patches);
   for (const auto& entry : boot_image_type_patches_) {
     const TypeReference& target_type = entry.first;
     vixl::aarch64::Literal<uint32_t>* literal = entry.second;
@@ -4229,13 +4278,12 @@
                                                      target_type.dex_file,
                                                      target_type.type_index.index_));
   }
-  EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
-                                                                linker_patches);
   for (const auto& entry : boot_image_address_patches_) {
     DCHECK(GetCompilerOptions().GetIncludePatchInformation());
     vixl::aarch64::Literal<uint32_t>* literal = entry.second;
     linker_patches->push_back(LinkerPatch::RecordPosition(literal->GetOffset()));
   }
+  DCHECK_EQ(size, linker_patches->size());
 }
 
 vixl::aarch64::Literal<uint32_t>* CodeGeneratorARM64::DeduplicateUint32Literal(uint32_t value,
@@ -4298,12 +4346,12 @@
       break;
     case HLoadClass::LoadKind::kBootImageAddress:
       break;
+    case HLoadClass::LoadKind::kBssEntry:
+      DCHECK(!Runtime::Current()->UseJitCompilation());
+      break;
     case HLoadClass::LoadKind::kJitTableAddress:
       DCHECK(Runtime::Current()->UseJitCompilation());
       break;
-    case HLoadClass::LoadKind::kDexCachePcRelative:
-      DCHECK(!Runtime::Current()->UseJitCompilation());
-      break;
     case HLoadClass::LoadKind::kDexCacheViaMethod:
       break;
   }
@@ -4311,15 +4359,16 @@
 }
 
 void LocationsBuilderARM64::VisitLoadClass(HLoadClass* cls) {
-  if (cls->NeedsAccessCheck()) {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
     InvokeRuntimeCallingConvention calling_convention;
-    CodeGenerator::CreateLoadClassLocationSummary(
+    CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
         cls,
         LocationFrom(calling_convention.GetRegisterAt(0)),
-        LocationFrom(vixl::aarch64::x0),
-        /* code_generator_supports_read_barrier */ true);
+        LocationFrom(vixl::aarch64::x0));
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
   const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage();
   LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier)
@@ -4330,21 +4379,21 @@
     locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty());  // No caller-save registers.
   }
 
-  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
-  if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
-      load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+  if (load_kind == HLoadClass::LoadKind::kReferrersClass) {
     locations->SetInAt(0, Location::RequiresRegister());
   }
   locations->SetOut(Location::RequiresRegister());
 }
 
-void InstructionCodeGeneratorARM64::VisitLoadClass(HLoadClass* cls) {
-  if (cls->NeedsAccessCheck()) {
-    codegen_->MoveConstant(cls->GetLocations()->GetTemp(0), cls->GetTypeIndex().index_);
-    codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
-    CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorARM64::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+    codegen_->GenerateLoadClassRuntimeCall(cls);
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
   Location out_loc = cls->GetLocations()->Out();
   Register out = OutputRegister(cls);
@@ -4353,7 +4402,7 @@
       ? kWithoutReadBarrier
       : kCompilerReadBarrierOption;
   bool generate_null_check = false;
-  switch (cls->GetLoadKind()) {
+  switch (load_kind) {
     case HLoadClass::LoadKind::kReferrersClass: {
       DCHECK(!cls->CanCallRuntime());
       DCHECK(!cls->MustGenerateClinitCheck());
@@ -4387,14 +4436,35 @@
     }
     case HLoadClass::LoadKind::kBootImageAddress: {
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
-      DCHECK(cls->GetAddress() != 0u && IsUint<32>(cls->GetAddress()));
-      __ Ldr(out.W(), codegen_->DeduplicateBootImageAddressLiteral(cls->GetAddress()));
+      uint32_t address = dchecked_integral_cast<uint32_t>(
+          reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+      DCHECK_NE(address, 0u);
+      __ Ldr(out.W(), codegen_->DeduplicateBootImageAddressLiteral(address));
+      break;
+    }
+    case HLoadClass::LoadKind::kBssEntry: {
+      // Add ADRP with its PC-relative Class .bss entry patch.
+      const DexFile& dex_file = cls->GetDexFile();
+      dex::TypeIndex type_index = cls->GetTypeIndex();
+      vixl::aarch64::Label* adrp_label = codegen_->NewBssEntryTypePatch(dex_file, type_index);
+      codegen_->EmitAdrpPlaceholder(adrp_label, out.X());
+      // Add LDR with its PC-relative Class patch.
+      vixl::aarch64::Label* ldr_label =
+          codegen_->NewBssEntryTypePatch(dex_file, type_index, adrp_label);
+      // /* GcRoot<mirror::Class> */ out = *(base_address + offset)  /* PC-relative */
+      GenerateGcRootFieldLoad(cls,
+                              cls->GetLocations()->Out(),
+                              out.X(),
+                              /* placeholder */ 0u,
+                              ldr_label,
+                              kCompilerReadBarrierOption);
+      generate_null_check = true;
       break;
     }
     case HLoadClass::LoadKind::kJitTableAddress: {
       __ Ldr(out, codegen_->DeduplicateJitClassLiteral(cls->GetDexFile(),
                                                        cls->GetTypeIndex(),
-                                                       cls->GetAddress()));
+                                                       cls->GetClass()));
       GenerateGcRootFieldLoad(cls,
                               out_loc,
                               out.X(),
@@ -4403,43 +4473,9 @@
                               kCompilerReadBarrierOption);
       break;
     }
-    case HLoadClass::LoadKind::kDexCachePcRelative: {
-      // Add ADRP with its PC-relative DexCache access patch.
-      const DexFile& dex_file = cls->GetDexFile();
-      uint32_t element_offset = cls->GetDexCacheElementOffset();
-      vixl::aarch64::Label* adrp_label =
-          codegen_->NewPcRelativeDexCacheArrayPatch(dex_file, element_offset);
-      codegen_->EmitAdrpPlaceholder(adrp_label, out.X());
-      // Add LDR with its PC-relative DexCache access patch.
-      vixl::aarch64::Label* ldr_label =
-          codegen_->NewPcRelativeDexCacheArrayPatch(dex_file, element_offset, adrp_label);
-      // /* GcRoot<mirror::Class> */ out = *(base_address + offset)  /* PC-relative */
-      GenerateGcRootFieldLoad(cls,
-                              out_loc,
-                              out.X(),
-                              /* offset placeholder */ 0,
-                              ldr_label,
-                              read_barrier_option);
-      generate_null_check = !cls->IsInDexCache();
-      break;
-    }
-    case HLoadClass::LoadKind::kDexCacheViaMethod: {
-      MemberOffset resolved_types_offset =
-          ArtMethod::DexCacheResolvedTypesOffset(kArm64PointerSize);
-      // /* GcRoot<mirror::Class>[] */ out =
-      //        current_method.ptr_sized_fields_->dex_cache_resolved_types_
-      Register current_method = InputRegisterAt(cls, 0);
-      __ Ldr(out.X(), MemOperand(current_method, resolved_types_offset.Int32Value()));
-      // /* GcRoot<mirror::Class> */ out = out[type_index]
-      GenerateGcRootFieldLoad(cls,
-                              out_loc,
-                              out.X(),
-                              CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_),
-                              /* fixup_label */ nullptr,
-                              read_barrier_option);
-      generate_null_check = !cls->IsInDexCache();
-      break;
-    }
+    case HLoadClass::LoadKind::kDexCacheViaMethod:
+      LOG(FATAL) << "UNREACHABLE";
+      UNREACHABLE();
   }
 
   if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -4494,11 +4530,11 @@
     case HLoadString::LoadKind::kBssEntry:
       DCHECK(!Runtime::Current()->UseJitCompilation());
       break;
-    case HLoadString::LoadKind::kDexCacheViaMethod:
-      break;
     case HLoadString::LoadKind::kJitTableAddress:
       DCHECK(Runtime::Current()->UseJitCompilation());
       break;
+    case HLoadString::LoadKind::kDexCacheViaMethod:
+      break;
   }
   return desired_string_load_kind;
 }
@@ -4542,7 +4578,7 @@
     case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
       // Add ADRP with its PC-relative String patch.
       const DexFile& dex_file = load->GetDexFile();
-      uint32_t string_index = load->GetStringIndex().index_;
+      const dex::StringIndex string_index = load->GetStringIndex();
       DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       vixl::aarch64::Label* adrp_label = codegen_->NewPcRelativeStringPatch(dex_file, string_index);
       codegen_->EmitAdrpPlaceholder(adrp_label, out.X());
@@ -4562,7 +4598,7 @@
     case HLoadString::LoadKind::kBssEntry: {
       // Add ADRP with its PC-relative String .bss entry patch.
       const DexFile& dex_file = load->GetDexFile();
-      uint32_t string_index = load->GetStringIndex().index_;
+      const dex::StringIndex string_index = load->GetStringIndex();
       DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
       UseScratchRegisterScope temps(codegen_->GetVIXLAssembler());
       Register temp = temps.AcquireX();
@@ -4626,7 +4662,7 @@
 }
 
 void InstructionCodeGeneratorARM64::VisitMonitorOperation(HMonitorOperation* instruction) {
-  codegen_->InvokeRuntime(instruction->IsEnter() ? kQuickLockObject: kQuickUnlockObject,
+  codegen_->InvokeRuntime(instruction->IsEnter() ? kQuickLockObject : kQuickUnlockObject,
                           instruction,
                           instruction->GetDexPc());
   if (instruction->IsEnter()) {
@@ -4718,22 +4754,16 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
   InvokeRuntimeCallingConvention calling_convention;
-  locations->AddTemp(LocationFrom(calling_convention.GetRegisterAt(0)));
   locations->SetOut(LocationFrom(x0));
-  locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(1)));
-  locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(2)));
+  locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(0)));
+  locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(1)));
 }
 
 void InstructionCodeGeneratorARM64::VisitNewArray(HNewArray* instruction) {
-  LocationSummary* locations = instruction->GetLocations();
-  InvokeRuntimeCallingConvention calling_convention;
-  Register type_index = RegisterFrom(locations->GetTemp(0), Primitive::kPrimInt);
-  DCHECK(type_index.Is(w0));
-  __ Mov(type_index, instruction->GetTypeIndex().index_);
   // Note: if heap poisoning is enabled, the entry point takes cares
   // of poisoning the reference.
-  codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
-  CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
+  codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+  CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
 }
 
 void LocationsBuilderARM64::VisitNewInstance(HNewInstance* instruction) {
diff --git a/compiler/optimizing/code_generator_arm64.h b/compiler/optimizing/code_generator_arm64.h
index d6a5f9d..7d3c655 100644
--- a/compiler/optimizing/code_generator_arm64.h
+++ b/compiler/optimizing/code_generator_arm64.h
@@ -527,6 +527,7 @@
       const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info,
       HInvokeStaticOrDirect* invoke) OVERRIDE;
 
+  Location GenerateCalleeMethodStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp);
   void GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) OVERRIDE;
   void GenerateVirtualCall(HInvokeVirtual* invoke, Location temp) OVERRIDE;
 
@@ -540,7 +541,7 @@
   // ADRP (pass `adrp_label = null`) or the ADD (pass `adrp_label` pointing
   // to the associated ADRP patch label).
   vixl::aarch64::Label* NewPcRelativeStringPatch(const DexFile& dex_file,
-                                                 uint32_t string_index,
+                                                 dex::StringIndex string_index,
                                                  vixl::aarch64::Label* adrp_label = nullptr);
 
   // Add a new PC-relative type patch for an instruction and return the label
@@ -551,6 +552,14 @@
                                                dex::TypeIndex type_index,
                                                vixl::aarch64::Label* adrp_label = nullptr);
 
+  // Add a new .bss entry type patch for an instruction and return the label
+  // to be bound before the instruction. The instruction will be either the
+  // ADRP (pass `adrp_label = null`) or the ADD (pass `adrp_label` pointing
+  // to the associated ADRP patch label).
+  vixl::aarch64::Label* NewBssEntryTypePatch(const DexFile& dex_file,
+                                             dex::TypeIndex type_index,
+                                             vixl::aarch64::Label* adrp_label = nullptr);
+
   // Add a new PC-relative dex cache array patch for an instruction and return
   // the label to be bound before the instruction. The instruction will be
   // either the ADRP (pass `adrp_label = null`) or the LDR (pass `adrp_label`
@@ -571,7 +580,7 @@
                                                                 Handle<mirror::String> handle);
   vixl::aarch64::Literal<uint32_t>* DeduplicateJitClassLiteral(const DexFile& dex_file,
                                                                dex::TypeIndex string_index,
-                                                               uint64_t address);
+                                                               Handle<mirror::Class> handle);
 
   void EmitAdrpPlaceholder(vixl::aarch64::Label* fixup_label, vixl::aarch64::Register reg);
   void EmitAddPlaceholder(vixl::aarch64::Label* fixup_label,
@@ -744,8 +753,10 @@
   ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
   // Deduplication map for boot type literals for kBootImageLinkTimeAddress.
   TypeToLiteralMap boot_image_type_patches_;
-  // PC-relative type patch info.
+  // PC-relative type patch info for kBootImageLinkTimePcRelative.
   ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
+  // PC-relative type patch info for kBssEntry.
+  ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
   // Deduplication map for patchable boot image addresses.
   Uint32ToLiteralMap boot_image_address_patches_;
 
diff --git a/compiler/optimizing/code_generator_arm_vixl.cc b/compiler/optimizing/code_generator_arm_vixl.cc
index c769dec..ffaf18f 100644
--- a/compiler/optimizing/code_generator_arm_vixl.cc
+++ b/compiler/optimizing/code_generator_arm_vixl.cc
@@ -394,22 +394,23 @@
 class LoadClassSlowPathARMVIXL : public SlowPathCodeARMVIXL {
  public:
   LoadClassSlowPathARMVIXL(HLoadClass* cls, HInstruction* at, uint32_t dex_pc, bool do_clinit)
-      : SlowPathCodeARMVIXL(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+      : SlowPathCodeARMVIXL(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
     DCHECK(at->IsLoadClass() || at->IsClinitCheck());
   }
 
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
-    LocationSummary* locations = at_->GetLocations();
+    LocationSummary* locations = instruction_->GetLocations();
 
     CodeGeneratorARMVIXL* arm_codegen = down_cast<CodeGeneratorARMVIXL*>(codegen);
     __ Bind(GetEntryLabel());
     SaveLiveRegisters(codegen, locations);
 
     InvokeRuntimeCallingConventionARMVIXL calling_convention;
-    __ Mov(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
+    dex::TypeIndex type_index = cls_->GetTypeIndex();
+    __ Mov(calling_convention.GetRegisterAt(0), type_index.index_);
     QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
                                                 : kQuickInitializeType;
-    arm_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
+    arm_codegen->InvokeRuntime(entrypoint, instruction_, dex_pc_, this);
     if (do_clinit_) {
       CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
     } else {
@@ -423,6 +424,20 @@
       arm_codegen->Move32(locations->Out(), LocationFrom(r0));
     }
     RestoreLiveRegisters(codegen, locations);
+    // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+    DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+    if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+      DCHECK(out.IsValid());
+      // TODO: Change art_quick_initialize_type/art_quick_initialize_static_storage to
+      // kSaveEverything and use a temporary for the .bss entry address in the fast path,
+      // so that we can avoid another calculation here.
+      UseScratchRegisterScope temps(down_cast<CodeGeneratorARMVIXL*>(codegen)->GetVIXLAssembler());
+      vixl32::Register temp = temps.Acquire();
+      CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
+          arm_codegen->NewTypeBssEntryPatch(cls_->GetDexFile(), type_index);
+      arm_codegen->EmitMovwMovtPlaceholder(labels, temp);
+      __ Str(OutputRegister(cls_), MemOperand(temp));
+    }
     __ B(GetExitLabel());
   }
 
@@ -432,10 +447,6 @@
   // The class this slow path will load.
   HLoadClass* const cls_;
 
-  // The instruction where this slow path is happening.
-  // (Might be the load class or an initialization check).
-  HInstruction* const at_;
-
   // The dex PC of `at_`.
   const uint32_t dex_pc_;
 
@@ -454,7 +465,7 @@
     LocationSummary* locations = instruction_->GetLocations();
     DCHECK(!locations->GetLiveRegisters()->ContainsCoreRegister(locations->Out().reg()));
     HLoadString* load = instruction_->AsLoadString();
-    const uint32_t string_index = load->GetStringIndex().index_;
+    const dex::StringIndex string_index = load->GetStringIndex();
     vixl32::Register out = OutputRegister(load);
     vixl32::Register temp = RegisterFrom(locations->GetTemp(0));
     constexpr bool call_saves_everything_except_r0 = (!kUseReadBarrier || kUseBakerReadBarrier);
@@ -473,7 +484,7 @@
       __ Mov(entry_address, temp);
     }
 
-    __ Mov(calling_convention.GetRegisterAt(0), string_index);
+    __ Mov(calling_convention.GetRegisterAt(0), string_index.index_);
     arm_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
     CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
 
@@ -1252,6 +1263,7 @@
       boot_image_type_patches_(TypeReferenceValueComparator(),
                                graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+      type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       boot_image_address_patches_(std::less<uint32_t>(),
                                   graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       jit_string_patches_(StringReferenceValueComparator(),
@@ -2445,6 +2457,14 @@
   }
 }
 
+void LocationsBuilderARMVIXL::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorARMVIXL::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
 void LocationsBuilderARMVIXL::VisitNeg(HNeg* neg) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
@@ -3316,7 +3336,7 @@
         InvokeRuntimeCallingConventionARMVIXL calling_convention;
         locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(0)));
         locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(1)));
-        // Note: divrem will compute both the quotient and the remainder as the pair R0 and R1, but
+        // Note: divmod will compute both the quotient and the remainder as the pair R0 and R1, but
         //       we only need the former.
         locations->SetOut(LocationFrom(r0));
       }
@@ -3430,7 +3450,7 @@
         InvokeRuntimeCallingConventionARMVIXL calling_convention;
         locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(0)));
         locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(1)));
-        // Note: divrem will compute both the quotient and the remainder as the pair R0 and R1, but
+        // Note: divmod will compute both the quotient and the remainder as the pair R0 and R1, but
         //       we only need the latter.
         locations->SetOut(LocationFrom(r1));
       }
@@ -3977,19 +3997,16 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
   InvokeRuntimeCallingConventionARMVIXL calling_convention;
-  locations->AddTemp(LocationFrom(calling_convention.GetRegisterAt(0)));
   locations->SetOut(LocationFrom(r0));
   locations->SetInAt(0, LocationFrom(calling_convention.GetRegisterAt(1)));
   locations->SetInAt(1, LocationFrom(calling_convention.GetRegisterAt(2)));
 }
 
 void InstructionCodeGeneratorARMVIXL::VisitNewArray(HNewArray* instruction) {
-  InvokeRuntimeCallingConventionARMVIXL calling_convention;
-  __ Mov(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex().index_);
   // Note: if heap poisoning is enabled, the entry point takes cares
   // of poisoning the reference.
-  codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
-  CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
+  codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+  CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
 }
 
 void LocationsBuilderARMVIXL::VisitParameterValue(HParameterValue* instruction) {
@@ -5789,17 +5806,11 @@
       break;
     case HLoadClass::LoadKind::kBootImageAddress:
       break;
-    case HLoadClass::LoadKind::kJitTableAddress:
-      break;
-    case HLoadClass::LoadKind::kDexCachePcRelative:
+    case HLoadClass::LoadKind::kBssEntry:
       DCHECK(!Runtime::Current()->UseJitCompilation());
-      // We disable pc-relative load when there is an irreducible loop, as the optimization
-      // is incompatible with it.
-      // TODO: Create as many ArmDexCacheArraysBase instructions as needed for methods
-      // with irreducible loops.
-      if (GetGraph()->HasIrreducibleLoops()) {
-        return HLoadClass::LoadKind::kDexCacheViaMethod;
-      }
+      break;
+    case HLoadClass::LoadKind::kJitTableAddress:
+      DCHECK(Runtime::Current()->UseJitCompilation());
       break;
     case HLoadClass::LoadKind::kDexCacheViaMethod:
       break;
@@ -5808,15 +5819,16 @@
 }
 
 void LocationsBuilderARMVIXL::VisitLoadClass(HLoadClass* cls) {
-  if (cls->NeedsAccessCheck()) {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
     InvokeRuntimeCallingConventionARMVIXL calling_convention;
-    CodeGenerator::CreateLoadClassLocationSummary(
+    CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
         cls,
         LocationFrom(calling_convention.GetRegisterAt(0)),
-        LocationFrom(r0),
-        /* code_generator_supports_read_barrier */ true);
+        LocationFrom(r0));
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
   const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage();
   LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier)
@@ -5827,24 +5839,23 @@
     locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty());  // No caller-save registers.
   }
 
-  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
-  if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
-      load_kind == HLoadClass::LoadKind::kDexCacheViaMethod ||
-      load_kind == HLoadClass::LoadKind::kDexCachePcRelative) {
+  if (load_kind == HLoadClass::LoadKind::kReferrersClass) {
     locations->SetInAt(0, Location::RequiresRegister());
   }
   locations->SetOut(Location::RequiresRegister());
 }
 
-void InstructionCodeGeneratorARMVIXL::VisitLoadClass(HLoadClass* cls) {
-  LocationSummary* locations = cls->GetLocations();
-  if (cls->NeedsAccessCheck()) {
-    codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
-    codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
-    CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorARMVIXL::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+    codegen_->GenerateLoadClassRuntimeCall(cls);
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
+  LocationSummary* locations = cls->GetLocations();
   Location out_loc = locations->Out();
   vixl32::Register out = OutputRegister(cls);
 
@@ -5852,7 +5863,7 @@
       ? kWithoutReadBarrier
       : kCompilerReadBarrierOption;
   bool generate_null_check = false;
-  switch (cls->GetLoadKind()) {
+  switch (load_kind) {
     case HLoadClass::LoadKind::kReferrersClass: {
       DCHECK(!cls->CanCallRuntime());
       DCHECK(!cls->MustGenerateClinitCheck());
@@ -5866,12 +5877,14 @@
       break;
     }
     case HLoadClass::LoadKind::kBootImageLinkTimeAddress: {
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
       __ Ldr(out, codegen_->DeduplicateBootImageTypeLiteral(cls->GetDexFile(),
                                                             cls->GetTypeIndex()));
       break;
     }
     case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: {
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
       CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
           codegen_->NewPcRelativeTypePatch(cls->GetDexFile(), cls->GetTypeIndex());
@@ -5880,43 +5893,31 @@
     }
     case HLoadClass::LoadKind::kBootImageAddress: {
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
-      DCHECK_NE(cls->GetAddress(), 0u);
-      uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+      uint32_t address = dchecked_integral_cast<uint32_t>(
+          reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+      DCHECK_NE(address, 0u);
       __ Ldr(out, codegen_->DeduplicateBootImageAddressLiteral(address));
       break;
     }
+    case HLoadClass::LoadKind::kBssEntry: {
+      CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
+          codegen_->NewTypeBssEntryPatch(cls->GetDexFile(), cls->GetTypeIndex());
+      codegen_->EmitMovwMovtPlaceholder(labels, out);
+      GenerateGcRootFieldLoad(cls, out_loc, out, 0, kCompilerReadBarrierOption);
+      generate_null_check = true;
+      break;
+    }
     case HLoadClass::LoadKind::kJitTableAddress: {
       __ Ldr(out, codegen_->DeduplicateJitClassLiteral(cls->GetDexFile(),
                                                        cls->GetTypeIndex(),
-                                                       cls->GetAddress()));
+                                                       cls->GetClass()));
       // /* GcRoot<mirror::Class> */ out = *out
       GenerateGcRootFieldLoad(cls, out_loc, out, /* offset */ 0, kCompilerReadBarrierOption);
       break;
     }
-    case HLoadClass::LoadKind::kDexCachePcRelative: {
-      vixl32::Register base_reg = InputRegisterAt(cls, 0);
-      HArmDexCacheArraysBase* base = cls->InputAt(0)->AsArmDexCacheArraysBase();
-      int32_t offset = cls->GetDexCacheElementOffset() - base->GetElementOffset();
-      // /* GcRoot<mirror::Class> */ out = *(dex_cache_arrays_base + offset)
-      GenerateGcRootFieldLoad(cls, out_loc, base_reg, offset, read_barrier_option);
-      generate_null_check = !cls->IsInDexCache();
-      break;
-    }
-    case HLoadClass::LoadKind::kDexCacheViaMethod: {
-      // /* GcRoot<mirror::Class>[] */ out =
-      //        current_method.ptr_sized_fields_->dex_cache_resolved_types_
-      vixl32::Register current_method = InputRegisterAt(cls, 0);
-      const int32_t resolved_types_offset =
-          ArtMethod::DexCacheResolvedTypesOffset(kArmPointerSize).Int32Value();
-      GetAssembler()->LoadFromOffset(kLoadWord, out, current_method, resolved_types_offset);
-      // /* GcRoot<mirror::Class> */ out = out[type_index]
-      size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_);
-      GenerateGcRootFieldLoad(cls, out_loc, out, offset, read_barrier_option);
-      generate_null_check = !cls->IsInDexCache();
-      break;
-    }
-    default:
-      TODO_VIXL32(FATAL);
+    case HLoadClass::LoadKind::kDexCacheViaMethod:
+      LOG(FATAL) << "UNREACHABLE";
+      UNREACHABLE();
   }
 
   if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -6038,7 +6039,7 @@
     case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
       DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
-          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
       codegen_->EmitMovwMovtPlaceholder(labels, out);
       return;  // No dex cache slow path.
     }
@@ -6053,7 +6054,7 @@
       DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
       vixl32::Register temp = RegisterFrom(locations->GetTemp(0));
       CodeGeneratorARMVIXL::PcRelativePatchInfo* labels =
-          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
       codegen_->EmitMovwMovtPlaceholder(labels, temp);
       GenerateGcRootFieldLoad(load, out_loc, temp, /* offset */ 0, kCompilerReadBarrierOption);
       LoadStringSlowPathARMVIXL* slow_path =
@@ -7232,18 +7233,7 @@
 HInvokeStaticOrDirect::DispatchInfo CodeGeneratorARMVIXL::GetSupportedInvokeStaticOrDirectDispatch(
     const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info,
     HInvokeStaticOrDirect* invoke ATTRIBUTE_UNUSED) {
-  HInvokeStaticOrDirect::DispatchInfo dispatch_info = desired_dispatch_info;
-  // We disable pc-relative load when there is an irreducible loop, as the optimization
-  // is incompatible with it.
-  // TODO: Create as many ArmDexCacheArraysBase instructions as needed for methods
-  // with irreducible loops.
-  if (GetGraph()->HasIrreducibleLoops() &&
-      (dispatch_info.method_load_kind ==
-          HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative)) {
-    dispatch_info.method_load_kind = HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod;
-  }
-
-  return dispatch_info;
+  return desired_dispatch_info;
 }
 
 vixl32::Register CodeGeneratorARMVIXL::GetInvokeStaticOrDirectExtraParameter(
@@ -7272,7 +7262,7 @@
   return RegisterFrom(location);
 }
 
-void CodeGeneratorARMVIXL::GenerateStaticOrDirectCall(
+Location CodeGeneratorARMVIXL::GenerateCalleeMethodStaticOrDirectCall(
     HInvokeStaticOrDirect* invoke, Location temp) {
   Location callee_method = temp;  // For all kinds except kRecursive, callee will be in temp.
   switch (invoke->GetMethodLoadKind()) {
@@ -7323,6 +7313,12 @@
       break;
     }
   }
+  return callee_method;
+}
+
+void CodeGeneratorARMVIXL::GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke,
+                                                      Location temp) {
+  Location callee_method = GenerateCalleeMethodStaticOrDirectCall(invoke, temp);
 
   switch (invoke->GetCodePtrLocation()) {
     case HInvokeStaticOrDirect::CodePtrLocation::kCallSelf:
@@ -7397,8 +7393,8 @@
 }
 
 CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeStringPatch(
-    const DexFile& dex_file, uint32_t string_index) {
-  return NewPcRelativePatch(dex_file, string_index, &pc_relative_string_patches_);
+    const DexFile& dex_file, dex::StringIndex string_index) {
+  return NewPcRelativePatch(dex_file, string_index.index_, &pc_relative_string_patches_);
 }
 
 CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeTypePatch(
@@ -7406,6 +7402,11 @@
   return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_);
 }
 
+CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewTypeBssEntryPatch(
+    const DexFile& dex_file, dex::TypeIndex type_index) {
+  return NewPcRelativePatch(dex_file, type_index.index_, &type_bss_entry_patches_);
+}
+
 CodeGeneratorARMVIXL::PcRelativePatchInfo* CodeGeneratorARMVIXL::NewPcRelativeDexCacheArrayPatch(
     const DexFile& dex_file, uint32_t element_offset) {
   return NewPcRelativePatch(dex_file, element_offset, &pc_relative_dex_cache_patches_);
@@ -7462,8 +7463,9 @@
 
 VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateJitClassLiteral(const DexFile& dex_file,
                                                       dex::TypeIndex type_index,
-                                                      uint64_t address) {
-  jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index), address);
+                                                      Handle<mirror::Class> handle) {
+  jit_class_roots_.Overwrite(TypeReference(&dex_file, type_index),
+                             reinterpret_cast64<uint64_t>(handle.GetReference()));
   return jit_class_patches_.GetOrCreate(
       TypeReference(&dex_file, type_index),
       [this]() {
@@ -7499,6 +7501,7 @@
       /* MOVW+MOVT for each entry */ 2u * pc_relative_string_patches_.size() +
       boot_image_type_patches_.size() +
       /* MOVW+MOVT for each entry */ 2u * pc_relative_type_patches_.size() +
+      /* MOVW+MOVT for each entry */ 2u * type_bss_entry_patches_.size() +
       boot_image_address_patches_.size();
   linker_patches->reserve(size);
   EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
@@ -7513,12 +7516,17 @@
                                                        target_string.string_index.index_));
   }
   if (!GetCompilerOptions().IsBootImage()) {
+    DCHECK(pc_relative_type_patches_.empty());
     EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
                                                                   linker_patches);
   } else {
+    EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+                                                                linker_patches);
     EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_,
                                                                   linker_patches);
   }
+  EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
+                                                              linker_patches);
   for (const auto& entry : boot_image_type_patches_) {
     const TypeReference& target_type = entry.first;
     VIXLUInt32Literal* literal = entry.second;
@@ -7528,8 +7536,6 @@
                                                      target_type.dex_file,
                                                      target_type.type_index.index_));
   }
-  EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
-                                                              linker_patches);
   for (const auto& entry : boot_image_address_patches_) {
     DCHECK(GetCompilerOptions().GetIncludePatchInformation());
     VIXLUInt32Literal* literal = entry.second;
@@ -7537,6 +7543,7 @@
     uint32_t literal_offset = literal->GetLocation();
     linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
   }
+  DCHECK_EQ(size, linker_patches->size());
 }
 
 VIXLUInt32Literal* CodeGeneratorARMVIXL::DeduplicateUint32Literal(
diff --git a/compiler/optimizing/code_generator_arm_vixl.h b/compiler/optimizing/code_generator_arm_vixl.h
index 200a463..8ae3b7d 100644
--- a/compiler/optimizing/code_generator_arm_vixl.h
+++ b/compiler/optimizing/code_generator_arm_vixl.h
@@ -537,6 +537,7 @@
       const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info,
       HInvokeStaticOrDirect* invoke) OVERRIDE;
 
+  Location GenerateCalleeMethodStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp);
   void GenerateStaticOrDirectCall(HInvokeStaticOrDirect* invoke, Location temp) OVERRIDE;
   void GenerateVirtualCall(HInvokeVirtual* invoke, Location temp) OVERRIDE;
 
@@ -562,8 +563,10 @@
     vixl::aarch32::Label add_pc_label;
   };
 
-  PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index);
+  PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file,
+                                                dex::StringIndex string_index);
   PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index);
+  PcRelativePatchInfo* NewTypeBssEntryPatch(const DexFile& dex_file, dex::TypeIndex type_index);
   PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
                                                        uint32_t element_offset);
   VIXLUInt32Literal* DeduplicateBootImageStringLiteral(const DexFile& dex_file,
@@ -577,7 +580,7 @@
                                                  Handle<mirror::String> handle);
   VIXLUInt32Literal* DeduplicateJitClassLiteral(const DexFile& dex_file,
                                                 dex::TypeIndex type_index,
-                                                uint64_t address);
+                                                Handle<mirror::Class> handle);
 
   void EmitLinkerPatches(ArenaVector<LinkerPatch>* linker_patches) OVERRIDE;
 
@@ -731,8 +734,10 @@
   ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
   // Deduplication map for boot type literals for kBootImageLinkTimeAddress.
   TypeToLiteralMap boot_image_type_patches_;
-  // PC-relative type patch info.
+  // PC-relative type patch info for kBootImageLinkTimePcRelative.
   ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
+  // PC-relative type patch info for kBssEntry.
+  ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
   // Deduplication map for patchable boot image addresses.
   Uint32ToLiteralMap boot_image_address_patches_;
 
diff --git a/compiler/optimizing/code_generator_mips.cc b/compiler/optimizing/code_generator_mips.cc
index bc62854..76be74e 100644
--- a/compiler/optimizing/code_generator_mips.cc
+++ b/compiler/optimizing/code_generator_mips.cc
@@ -213,23 +213,24 @@
                         HInstruction* at,
                         uint32_t dex_pc,
                         bool do_clinit)
-      : SlowPathCodeMIPS(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+      : SlowPathCodeMIPS(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
     DCHECK(at->IsLoadClass() || at->IsClinitCheck());
   }
 
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
-    LocationSummary* locations = at_->GetLocations();
+    LocationSummary* locations = instruction_->GetLocations();
     CodeGeneratorMIPS* mips_codegen = down_cast<CodeGeneratorMIPS*>(codegen);
 
     __ Bind(GetEntryLabel());
     SaveLiveRegisters(codegen, locations);
 
     InvokeRuntimeCallingConvention calling_convention;
-    __ LoadConst32(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
+    dex::TypeIndex type_index = cls_->GetTypeIndex();
+    __ LoadConst32(calling_convention.GetRegisterAt(0), type_index.index_);
 
     QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
                                                 : kQuickInitializeType;
-    mips_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
+    mips_codegen->InvokeRuntime(entrypoint, instruction_, dex_pc_, this);
     if (do_clinit_) {
       CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
     } else {
@@ -240,11 +241,26 @@
     Location out = locations->Out();
     if (out.IsValid()) {
       DCHECK(out.IsRegister() && !locations->GetLiveRegisters()->ContainsCoreRegister(out.reg()));
-      Primitive::Type type = at_->GetType();
+      Primitive::Type type = instruction_->GetType();
       mips_codegen->MoveLocation(out, calling_convention.GetReturnLocation(type), type);
     }
 
     RestoreLiveRegisters(codegen, locations);
+    // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+    DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+    if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+      DCHECK(out.IsValid());
+      // TODO: Change art_quick_initialize_type/art_quick_initialize_static_storage to
+      // kSaveEverything and use a temporary for the .bss entry address in the fast path,
+      // so that we can avoid another calculation here.
+      bool isR6 = mips_codegen->GetInstructionSetFeatures().IsR6();
+      Register base = isR6 ? ZERO : locations->InAt(0).AsRegister<Register>();
+      DCHECK_NE(out.AsRegister<Register>(), AT);
+      CodeGeneratorMIPS::PcRelativePatchInfo* info =
+          mips_codegen->NewTypeBssEntryPatch(cls_->GetDexFile(), type_index);
+      mips_codegen->EmitPcRelativeAddressPlaceholder(info, TMP, base);
+      __ StoreToOffset(kStoreWord, out.AsRegister<Register>(), TMP, 0);
+    }
     __ B(GetExitLabel());
   }
 
@@ -254,10 +270,6 @@
   // The class this slow path will load.
   HLoadClass* const cls_;
 
-  // The instruction where this slow path is happening.
-  // (Might be the load class or an initialization check).
-  HInstruction* const at_;
-
   // The dex PC of `at_`.
   const uint32_t dex_pc_;
 
@@ -281,8 +293,8 @@
 
     InvokeRuntimeCallingConvention calling_convention;
     HLoadString* load = instruction_->AsLoadString();
-    const uint32_t string_index = load->GetStringIndex().index_;
-    __ LoadConst32(calling_convention.GetRegisterAt(0), string_index);
+    const dex::StringIndex string_index = load->GetStringIndex();
+    __ LoadConst32(calling_convention.GetRegisterAt(0), string_index.index_);
     mips_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
     CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
     Primitive::Type type = instruction_->GetType();
@@ -465,6 +477,7 @@
       boot_image_type_patches_(TypeReferenceValueComparator(),
                                graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+      type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       boot_image_address_patches_(std::less<uint32_t>(),
                                   graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       clobbered_ra_(false) {
@@ -483,7 +496,8 @@
 
   // Adjust native pc offsets in stack maps.
   for (size_t i = 0, num = stack_map_stream_.GetNumberOfStackMaps(); i != num; ++i) {
-    uint32_t old_position = stack_map_stream_.GetStackMap(i).native_pc_offset;
+    uint32_t old_position =
+        stack_map_stream_.GetStackMap(i).native_pc_code_offset.Uint32Value(kMips);
     uint32_t new_position = __ GetAdjustedPosition(old_position);
     DCHECK_GE(new_position, old_position);
     stack_map_stream_.SetStackMapNativePcOffset(i, new_position);
@@ -1007,6 +1021,7 @@
       pc_relative_dex_cache_patches_.size() +
       pc_relative_string_patches_.size() +
       pc_relative_type_patches_.size() +
+      type_bss_entry_patches_.size() +
       boot_image_string_patches_.size() +
       boot_image_type_patches_.size() +
       boot_image_address_patches_.size();
@@ -1014,13 +1029,16 @@
   EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
                                                                linker_patches);
   if (!GetCompilerOptions().IsBootImage()) {
+    DCHECK(pc_relative_type_patches_.empty());
     EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
                                                                   linker_patches);
   } else {
+    EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+                                                                linker_patches);
     EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_,
                                                                   linker_patches);
   }
-  EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+  EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
                                                               linker_patches);
   for (const auto& entry : boot_image_string_patches_) {
     const StringReference& target_string = entry.first;
@@ -1047,11 +1065,12 @@
     uint32_t literal_offset = __ GetLabelLocation(literal->GetLabel());
     linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
   }
+  DCHECK_EQ(size, linker_patches->size());
 }
 
 CodeGeneratorMIPS::PcRelativePatchInfo* CodeGeneratorMIPS::NewPcRelativeStringPatch(
-    const DexFile& dex_file, uint32_t string_index) {
-  return NewPcRelativePatch(dex_file, string_index, &pc_relative_string_patches_);
+    const DexFile& dex_file, dex::StringIndex string_index) {
+  return NewPcRelativePatch(dex_file, string_index.index_, &pc_relative_string_patches_);
 }
 
 CodeGeneratorMIPS::PcRelativePatchInfo* CodeGeneratorMIPS::NewPcRelativeTypePatch(
@@ -1059,6 +1078,11 @@
   return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_);
 }
 
+CodeGeneratorMIPS::PcRelativePatchInfo* CodeGeneratorMIPS::NewTypeBssEntryPatch(
+    const DexFile& dex_file, dex::TypeIndex type_index) {
+  return NewPcRelativePatch(dex_file, type_index.index_, &type_bss_entry_patches_);
+}
+
 CodeGeneratorMIPS::PcRelativePatchInfo* CodeGeneratorMIPS::NewPcRelativeDexCacheArrayPatch(
     const DexFile& dex_file, uint32_t element_offset) {
   return NewPcRelativePatch(dex_file, element_offset, &pc_relative_dex_cache_patches_);
@@ -5154,6 +5178,14 @@
   }
 }
 
+void LocationsBuilderMIPS::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorMIPS::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
 static bool TryGenerateIntrinsicCode(HInvoke* invoke, CodeGeneratorMIPS* codegen) {
   if (invoke->GetLocations()->Intrinsified()) {
     IntrinsicCodeGeneratorMIPS intrinsic(codegen);
@@ -5186,14 +5218,14 @@
     case HLoadString::LoadKind::kBssEntry:
       DCHECK(!Runtime::Current()->UseJitCompilation());
       break;
-    case HLoadString::LoadKind::kDexCacheViaMethod:
-      fallback_load = false;
-      break;
     case HLoadString::LoadKind::kJitTableAddress:
       DCHECK(Runtime::Current()->UseJitCompilation());
       // TODO: implement.
       fallback_load = true;
       break;
+    case HLoadString::LoadKind::kDexCacheViaMethod:
+      fallback_load = false;
+      break;
   }
   if (fallback_load) {
     desired_string_load_kind = HLoadString::LoadKind::kDexCacheViaMethod;
@@ -5222,15 +5254,13 @@
       break;
     case HLoadClass::LoadKind::kBootImageAddress:
       break;
+    case HLoadClass::LoadKind::kBssEntry:
+      DCHECK(!Runtime::Current()->UseJitCompilation());
+      break;
     case HLoadClass::LoadKind::kJitTableAddress:
       DCHECK(Runtime::Current()->UseJitCompilation());
       fallback_load = true;
       break;
-    case HLoadClass::LoadKind::kDexCachePcRelative:
-      DCHECK(!Runtime::Current()->UseJitCompilation());
-      // TODO: Create as many MipsDexCacheArraysBase instructions as needed for methods
-      // with irreducible loops.
-      break;
     case HLoadClass::LoadKind::kDexCacheViaMethod:
       fallback_load = false;
       break;
@@ -5427,34 +5457,32 @@
 }
 
 void LocationsBuilderMIPS::VisitLoadClass(HLoadClass* cls) {
-  if (cls->NeedsAccessCheck()) {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
     InvokeRuntimeCallingConvention calling_convention;
-    CodeGenerator::CreateLoadClassLocationSummary(
+    CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
         cls,
         Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-        Location::RegisterLocation(V0),
-        /* code_generator_supports_read_barrier */ false);  // TODO: revisit this bool.
+        Location::RegisterLocation(V0));
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
   LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || kEmitCompilerReadBarrier)
       ? LocationSummary::kCallOnSlowPath
       : LocationSummary::kNoCall;
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(cls, call_kind);
-  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
   switch (load_kind) {
     // We need an extra register for PC-relative literals on R2.
     case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
-    case HLoadClass::LoadKind::kBootImageAddress:
     case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
+    case HLoadClass::LoadKind::kBootImageAddress:
+    case HLoadClass::LoadKind::kBssEntry:
       if (codegen_->GetInstructionSetFeatures().IsR6()) {
         break;
       }
       FALLTHROUGH_INTENDED;
-    // We need an extra register for PC-relative dex cache accesses.
-    case HLoadClass::LoadKind::kDexCachePcRelative:
     case HLoadClass::LoadKind::kReferrersClass:
-    case HLoadClass::LoadKind::kDexCacheViaMethod:
       locations->SetInAt(0, Location::RequiresRegister());
       break;
     default:
@@ -5463,16 +5491,17 @@
   locations->SetOut(Location::RequiresRegister());
 }
 
-void InstructionCodeGeneratorMIPS::VisitLoadClass(HLoadClass* cls) {
-  LocationSummary* locations = cls->GetLocations();
-  if (cls->NeedsAccessCheck()) {
-    codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
-    codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
-    CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorMIPS::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+    codegen_->GenerateLoadClassRuntimeCall(cls);
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
-  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  LocationSummary* locations = cls->GetLocations();
   Location out_loc = locations->Out();
   Register out = out_loc.AsRegister<Register>();
   Register base_or_current_method_reg;
@@ -5480,12 +5509,11 @@
   switch (load_kind) {
     // We need an extra register for PC-relative literals on R2.
     case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
-    case HLoadClass::LoadKind::kBootImageAddress:
     case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
+    case HLoadClass::LoadKind::kBootImageAddress:
+    case HLoadClass::LoadKind::kBssEntry:
       base_or_current_method_reg = isR6 ? ZERO : locations->InAt(0).AsRegister<Register>();
       break;
-    // We need an extra register for PC-relative dex cache accesses.
-    case HLoadClass::LoadKind::kDexCachePcRelative:
     case HLoadClass::LoadKind::kReferrersClass:
     case HLoadClass::LoadKind::kDexCacheViaMethod:
       base_or_current_method_reg = locations->InAt(0).AsRegister<Register>();
@@ -5508,14 +5536,14 @@
       break;
     }
     case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
-      DCHECK(!kEmitCompilerReadBarrier);
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       __ LoadLiteral(out,
                      base_or_current_method_reg,
                      codegen_->DeduplicateBootImageTypeLiteral(cls->GetDexFile(),
                                                                cls->GetTypeIndex()));
       break;
     case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: {
-      DCHECK(!kEmitCompilerReadBarrier);
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       CodeGeneratorMIPS::PcRelativePatchInfo* info =
           codegen_->NewPcRelativeTypePatch(cls->GetDexFile(), cls->GetTypeIndex());
       codegen_->EmitPcRelativeAddressPlaceholder(info, out, base_or_current_method_reg);
@@ -5523,38 +5551,29 @@
     }
     case HLoadClass::LoadKind::kBootImageAddress: {
       DCHECK(!kEmitCompilerReadBarrier);
-      DCHECK_NE(cls->GetAddress(), 0u);
-      uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+      uint32_t address = dchecked_integral_cast<uint32_t>(
+          reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+      DCHECK_NE(address, 0u);
       __ LoadLiteral(out,
                      base_or_current_method_reg,
                      codegen_->DeduplicateBootImageAddressLiteral(address));
       break;
     }
+    case HLoadClass::LoadKind::kBssEntry: {
+      CodeGeneratorMIPS::PcRelativePatchInfo* info =
+          codegen_->NewTypeBssEntryPatch(cls->GetDexFile(), cls->GetTypeIndex());
+      codegen_->EmitPcRelativeAddressPlaceholder(info, out, base_or_current_method_reg);
+      __ LoadFromOffset(kLoadWord, out, out, 0);
+      generate_null_check = true;
+      break;
+    }
     case HLoadClass::LoadKind::kJitTableAddress: {
       LOG(FATAL) << "Unimplemented";
       break;
     }
-    case HLoadClass::LoadKind::kDexCachePcRelative: {
-      HMipsDexCacheArraysBase* base = cls->InputAt(0)->AsMipsDexCacheArraysBase();
-      int32_t offset =
-          cls->GetDexCacheElementOffset() - base->GetElementOffset() - kDexCacheArrayLwOffset;
-      // /* GcRoot<mirror::Class> */ out = *(dex_cache_arrays_base + offset)
-      GenerateGcRootFieldLoad(cls, out_loc, base_or_current_method_reg, offset);
-      generate_null_check = !cls->IsInDexCache();
-      break;
-    }
-    case HLoadClass::LoadKind::kDexCacheViaMethod: {
-      // /* GcRoot<mirror::Class>[] */ out =
-      //        current_method.ptr_sized_fields_->dex_cache_resolved_types_
-      __ LoadFromOffset(kLoadWord,
-                        out,
-                        base_or_current_method_reg,
-                        ArtMethod::DexCacheResolvedTypesOffset(kArmPointerSize).Int32Value());
-      // /* GcRoot<mirror::Class> */ out = out[type_index]
-      size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_);
-      GenerateGcRootFieldLoad(cls, out_loc, out, offset);
-      generate_null_check = !cls->IsInDexCache();
-    }
+    case HLoadClass::LoadKind::kDexCacheViaMethod:
+      LOG(FATAL) << "UNREACHABLE";
+      UNREACHABLE();
   }
 
   if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -5649,6 +5668,7 @@
 
   switch (load_kind) {
     case HLoadString::LoadKind::kBootImageLinkTimeAddress:
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       __ LoadLiteral(out,
                      base_or_current_method_reg,
                      codegen_->DeduplicateBootImageStringLiteral(load->GetDexFile(),
@@ -5657,7 +5677,7 @@
     case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
       DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       CodeGeneratorMIPS::PcRelativePatchInfo* info =
-          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
       codegen_->EmitPcRelativeAddressPlaceholder(info, out, base_or_current_method_reg);
       return;  // No dex cache slow path.
     }
@@ -5673,7 +5693,7 @@
     case HLoadString::LoadKind::kBssEntry: {
       DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
       CodeGeneratorMIPS::PcRelativePatchInfo* info =
-          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
       codegen_->EmitPcRelativeAddressPlaceholder(info, out, base_or_current_method_reg);
       __ LoadFromOffset(kLoadWord, out, out, 0);
       SlowPathCodeMIPS* slow_path = new (GetGraph()->GetArena()) LoadStringSlowPathMIPS(load);
@@ -5878,21 +5898,14 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
   InvokeRuntimeCallingConvention calling_convention;
-  locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
-  locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
   locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
-  locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
+  locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+  locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
 }
 
 void InstructionCodeGeneratorMIPS::VisitNewArray(HNewArray* instruction) {
-  InvokeRuntimeCallingConvention calling_convention;
-  Register current_method_register = calling_convention.GetRegisterAt(2);
-  __ Lw(current_method_register, SP, kCurrentMethodStackOffset);
-  // Move an uint16_t value to a register.
-  __ LoadConst32(calling_convention.GetRegisterAt(0), instruction->GetTypeIndex().index_);
-  codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
-  CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck,
-                       void*, uint32_t, int32_t, ArtMethod*>();
+  codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+  CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
 }
 
 void LocationsBuilderMIPS::VisitNewInstance(HNewInstance* instruction) {
diff --git a/compiler/optimizing/code_generator_mips.h b/compiler/optimizing/code_generator_mips.h
index 7b0812c..c8fd325 100644
--- a/compiler/optimizing/code_generator_mips.h
+++ b/compiler/optimizing/code_generator_mips.h
@@ -452,8 +452,10 @@
     MipsLabel pc_rel_label;
   };
 
-  PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index);
+  PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file,
+                                                dex::StringIndex string_index);
   PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index);
+  PcRelativePatchInfo* NewTypeBssEntryPatch(const DexFile& dex_file, dex::TypeIndex type_index);
   PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
                                                        uint32_t element_offset);
   Literal* DeduplicateBootImageStringLiteral(const DexFile& dex_file,
@@ -504,8 +506,10 @@
   ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
   // Deduplication map for boot type literals for kBootImageLinkTimeAddress.
   BootTypeToLiteralMap boot_image_type_patches_;
-  // PC-relative type patch info.
+  // PC-relative type patch info for kBootImageLinkTimePcRelative.
   ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
+  // PC-relative type patch info for kBssEntry.
+  ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
   // Deduplication map for patchable boot image addresses.
   Uint32ToLiteralMap boot_image_address_patches_;
 
diff --git a/compiler/optimizing/code_generator_mips64.cc b/compiler/optimizing/code_generator_mips64.cc
index 1b9c6da..192b4a5 100644
--- a/compiler/optimizing/code_generator_mips64.cc
+++ b/compiler/optimizing/code_generator_mips64.cc
@@ -167,22 +167,23 @@
                           HInstruction* at,
                           uint32_t dex_pc,
                           bool do_clinit)
-      : SlowPathCodeMIPS64(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+      : SlowPathCodeMIPS64(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
     DCHECK(at->IsLoadClass() || at->IsClinitCheck());
   }
 
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
-    LocationSummary* locations = at_->GetLocations();
+    LocationSummary* locations = instruction_->GetLocations();
     CodeGeneratorMIPS64* mips64_codegen = down_cast<CodeGeneratorMIPS64*>(codegen);
 
     __ Bind(GetEntryLabel());
     SaveLiveRegisters(codegen, locations);
 
     InvokeRuntimeCallingConvention calling_convention;
-    __ LoadConst32(calling_convention.GetRegisterAt(0), cls_->GetTypeIndex().index_);
+    dex::TypeIndex type_index = cls_->GetTypeIndex();
+    __ LoadConst32(calling_convention.GetRegisterAt(0), type_index.index_);
     QuickEntrypointEnum entrypoint = do_clinit_ ? kQuickInitializeStaticStorage
                                                 : kQuickInitializeType;
-    mips64_codegen->InvokeRuntime(entrypoint, at_, dex_pc_, this);
+    mips64_codegen->InvokeRuntime(entrypoint, instruction_, dex_pc_, this);
     if (do_clinit_) {
       CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
     } else {
@@ -193,11 +194,24 @@
     Location out = locations->Out();
     if (out.IsValid()) {
       DCHECK(out.IsRegister() && !locations->GetLiveRegisters()->ContainsCoreRegister(out.reg()));
-      Primitive::Type type = at_->GetType();
+      Primitive::Type type = instruction_->GetType();
       mips64_codegen->MoveLocation(out, calling_convention.GetReturnLocation(type), type);
     }
 
     RestoreLiveRegisters(codegen, locations);
+    // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+    DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+    if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+      DCHECK(out.IsValid());
+      // TODO: Change art_quick_initialize_type/art_quick_initialize_static_storage to
+      // kSaveEverything and use a temporary for the .bss entry address in the fast path,
+      // so that we can avoid another calculation here.
+      DCHECK_NE(out.AsRegister<GpuRegister>(), AT);
+      CodeGeneratorMIPS64::PcRelativePatchInfo* info =
+          mips64_codegen->NewTypeBssEntryPatch(cls_->GetDexFile(), type_index);
+      mips64_codegen->EmitPcRelativeAddressPlaceholderHigh(info, AT);
+      __ Sw(out.AsRegister<GpuRegister>(), AT, /* placeholder */ 0x5678);
+    }
     __ Bc(GetExitLabel());
   }
 
@@ -207,10 +221,6 @@
   // The class this slow path will load.
   HLoadClass* const cls_;
 
-  // The instruction where this slow path is happening.
-  // (Might be the load class or an initialization check).
-  HInstruction* const at_;
-
   // The dex PC of `at_`.
   const uint32_t dex_pc_;
 
@@ -234,8 +244,8 @@
 
     InvokeRuntimeCallingConvention calling_convention;
     HLoadString* load = instruction_->AsLoadString();
-    const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
-    __ LoadConst32(calling_convention.GetRegisterAt(0), string_index);
+    const dex::StringIndex string_index = instruction_->AsLoadString()->GetStringIndex();
+    __ LoadConst32(calling_convention.GetRegisterAt(0), string_index.index_);
     mips64_codegen->InvokeRuntime(kQuickResolveString,
                                   instruction_,
                                   instruction_->GetDexPc(),
@@ -422,6 +432,7 @@
       boot_image_type_patches_(TypeReferenceValueComparator(),
                                graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       pc_relative_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+      type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       boot_image_address_patches_(std::less<uint32_t>(),
                                   graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
   // Save RA (containing the return address) to mimic Quick.
@@ -439,7 +450,8 @@
 
   // Adjust native pc offsets in stack maps.
   for (size_t i = 0, num = stack_map_stream_.GetNumberOfStackMaps(); i != num; ++i) {
-    uint32_t old_position = stack_map_stream_.GetStackMap(i).native_pc_offset;
+    uint32_t old_position =
+        stack_map_stream_.GetStackMap(i).native_pc_code_offset.Uint32Value(kMips64);
     uint32_t new_position = __ GetAdjustedPosition(old_position);
     DCHECK_GE(new_position, old_position);
     stack_map_stream_.SetStackMapNativePcOffset(i, new_position);
@@ -922,6 +934,7 @@
       pc_relative_dex_cache_patches_.size() +
       pc_relative_string_patches_.size() +
       pc_relative_type_patches_.size() +
+      type_bss_entry_patches_.size() +
       boot_image_string_patches_.size() +
       boot_image_type_patches_.size() +
       boot_image_address_patches_.size();
@@ -929,13 +942,16 @@
   EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
                                                                linker_patches);
   if (!GetCompilerOptions().IsBootImage()) {
+    DCHECK(pc_relative_type_patches_.empty());
     EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(pc_relative_string_patches_,
                                                                   linker_patches);
   } else {
+    EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+                                                                linker_patches);
     EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(pc_relative_string_patches_,
                                                                   linker_patches);
   }
-  EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(pc_relative_type_patches_,
+  EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
                                                               linker_patches);
   for (const auto& entry : boot_image_string_patches_) {
     const StringReference& target_string = entry.first;
@@ -962,11 +978,12 @@
     uint32_t literal_offset = __ GetLabelLocation(literal->GetLabel());
     linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
   }
+  DCHECK_EQ(size, linker_patches->size());
 }
 
 CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewPcRelativeStringPatch(
-    const DexFile& dex_file, uint32_t string_index) {
-  return NewPcRelativePatch(dex_file, string_index, &pc_relative_string_patches_);
+    const DexFile& dex_file, dex::StringIndex string_index) {
+  return NewPcRelativePatch(dex_file, string_index.index_, &pc_relative_string_patches_);
 }
 
 CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewPcRelativeTypePatch(
@@ -974,6 +991,11 @@
   return NewPcRelativePatch(dex_file, type_index.index_, &pc_relative_type_patches_);
 }
 
+CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewTypeBssEntryPatch(
+    const DexFile& dex_file, dex::TypeIndex type_index) {
+  return NewPcRelativePatch(dex_file, type_index.index_, &type_bss_entry_patches_);
+}
+
 CodeGeneratorMIPS64::PcRelativePatchInfo* CodeGeneratorMIPS64::NewPcRelativeDexCacheArrayPatch(
     const DexFile& dex_file, uint32_t element_offset) {
   return NewPcRelativePatch(dex_file, element_offset, &pc_relative_dex_cache_patches_);
@@ -3095,7 +3117,7 @@
     Location root,
     GpuRegister obj,
     uint32_t offset) {
-  // When handling HLoadClass::LoadKind::kDexCachePcRelative, the caller calls
+  // When handling PC-relative loads, the caller calls
   // EmitPcRelativeAddressPlaceholderHigh() and then GenerateGcRootFieldLoad().
   // The relative patcher expects the two methods to emit the following patchable
   // sequence of instructions in this case:
@@ -3256,6 +3278,14 @@
   HandleInvoke(invoke);
 }
 
+void LocationsBuilderMIPS64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorMIPS64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
 static bool TryGenerateIntrinsicCode(HInvoke* invoke, CodeGeneratorMIPS64* codegen) {
   if (invoke->GetLocations()->Intrinsified()) {
     IntrinsicCodeGeneratorMIPS64 intrinsic(codegen);
@@ -3314,14 +3344,14 @@
       break;
     case HLoadClass::LoadKind::kBootImageAddress:
       break;
+    case HLoadClass::LoadKind::kBssEntry:
+      DCHECK(!Runtime::Current()->UseJitCompilation());
+      break;
     case HLoadClass::LoadKind::kJitTableAddress:
       DCHECK(Runtime::Current()->UseJitCompilation());
       // TODO: implement.
       fallback_load = true;
       break;
-    case HLoadClass::LoadKind::kDexCachePcRelative:
-      DCHECK(!Runtime::Current()->UseJitCompilation());
-      break;
     case HLoadClass::LoadKind::kDexCacheViaMethod:
       break;
   }
@@ -3366,7 +3396,7 @@
     case HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative: {
       uint32_t offset = invoke->GetDexCacheArrayOffset();
       CodeGeneratorMIPS64::PcRelativePatchInfo* info =
-          NewPcRelativeDexCacheArrayPatch(invoke->GetDexFile(), offset);
+          NewPcRelativeDexCacheArrayPatch(invoke->GetDexFileForPcRelativeDexCache(), offset);
       EmitPcRelativeAddressPlaceholderHigh(info, AT);
       __ Ld(temp.AsRegister<GpuRegister>(), AT, /* placeholder */ 0x5678);
       break;
@@ -3474,38 +3504,38 @@
 }
 
 void LocationsBuilderMIPS64::VisitLoadClass(HLoadClass* cls) {
-  if (cls->NeedsAccessCheck()) {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
     InvokeRuntimeCallingConvention calling_convention;
-    CodeGenerator::CreateLoadClassLocationSummary(
+    CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
         cls,
         Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-        calling_convention.GetReturnLocation(Primitive::kPrimNot),
-        /* code_generator_supports_read_barrier */ false);
+        calling_convention.GetReturnLocation(Primitive::kPrimNot));
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
   LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || kEmitCompilerReadBarrier)
       ? LocationSummary::kCallOnSlowPath
       : LocationSummary::kNoCall;
   LocationSummary* locations = new (GetGraph()->GetArena()) LocationSummary(cls, call_kind);
-  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
-  if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
-      load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+  if (load_kind == HLoadClass::LoadKind::kReferrersClass) {
     locations->SetInAt(0, Location::RequiresRegister());
   }
   locations->SetOut(Location::RequiresRegister());
 }
 
-void InstructionCodeGeneratorMIPS64::VisitLoadClass(HLoadClass* cls) {
-  LocationSummary* locations = cls->GetLocations();
-  if (cls->NeedsAccessCheck()) {
-    codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
-    codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
-    CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorMIPS64::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+    codegen_->GenerateLoadClassRuntimeCall(cls);
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
-  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  LocationSummary* locations = cls->GetLocations();
   Location out_loc = locations->Out();
   GpuRegister out = out_loc.AsRegister<GpuRegister>();
   GpuRegister current_method_reg = ZERO;
@@ -3526,14 +3556,14 @@
                               ArtMethod::DeclaringClassOffset().Int32Value());
       break;
     case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
-      DCHECK(!kEmitCompilerReadBarrier);
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       __ LoadLiteral(out,
                      kLoadUnsignedWord,
                      codegen_->DeduplicateBootImageTypeLiteral(cls->GetDexFile(),
                                                                cls->GetTypeIndex()));
       break;
     case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: {
-      DCHECK(!kEmitCompilerReadBarrier);
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       CodeGeneratorMIPS64::PcRelativePatchInfo* info =
           codegen_->NewPcRelativeTypePatch(cls->GetDexFile(), cls->GetTypeIndex());
       codegen_->EmitPcRelativeAddressPlaceholderHigh(info, AT);
@@ -3542,39 +3572,29 @@
     }
     case HLoadClass::LoadKind::kBootImageAddress: {
       DCHECK(!kEmitCompilerReadBarrier);
-      DCHECK_NE(cls->GetAddress(), 0u);
-      uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+      uint32_t address = dchecked_integral_cast<uint32_t>(
+          reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+      DCHECK_NE(address, 0u);
       __ LoadLiteral(out,
                      kLoadUnsignedWord,
                      codegen_->DeduplicateBootImageAddressLiteral(address));
       break;
     }
+    case HLoadClass::LoadKind::kBssEntry: {
+      CodeGeneratorMIPS64::PcRelativePatchInfo* info =
+          codegen_->NewTypeBssEntryPatch(cls->GetDexFile(), cls->GetTypeIndex());
+      codegen_->EmitPcRelativeAddressPlaceholderHigh(info, AT);
+      __ Lwu(out, AT, /* placeholder */ 0x5678);
+      generate_null_check = true;
+      break;
+    }
     case HLoadClass::LoadKind::kJitTableAddress: {
       LOG(FATAL) << "Unimplemented";
       break;
     }
-    case HLoadClass::LoadKind::kDexCachePcRelative: {
-      uint32_t element_offset = cls->GetDexCacheElementOffset();
-      CodeGeneratorMIPS64::PcRelativePatchInfo* info =
-          codegen_->NewPcRelativeDexCacheArrayPatch(cls->GetDexFile(), element_offset);
-      codegen_->EmitPcRelativeAddressPlaceholderHigh(info, AT);
-      // /* GcRoot<mirror::Class> */ out = *address  /* PC-relative */
-      GenerateGcRootFieldLoad(cls, out_loc, AT, /* placeholder */ 0x5678);
-      generate_null_check = !cls->IsInDexCache();
-      break;
-    }
-    case HLoadClass::LoadKind::kDexCacheViaMethod: {
-      // /* GcRoot<mirror::Class>[] */ out =
-      //        current_method.ptr_sized_fields_->dex_cache_resolved_types_
-      __ LoadFromOffset(kLoadDoubleword,
-                        out,
-                        current_method_reg,
-                        ArtMethod::DexCacheResolvedTypesOffset(kMips64PointerSize).Int32Value());
-      // /* GcRoot<mirror::Class> */ out = out[type_index]
-      size_t offset = CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_);
-      GenerateGcRootFieldLoad(cls, out_loc, out, offset);
-      generate_null_check = !cls->IsInDexCache();
-    }
+    case HLoadClass::LoadKind::kDexCacheViaMethod:
+      LOG(FATAL) << "UNREACHABLE";
+      UNREACHABLE();
   }
 
   if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -3638,6 +3658,7 @@
 
   switch (load_kind) {
     case HLoadString::LoadKind::kBootImageLinkTimeAddress:
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       __ LoadLiteral(out,
                      kLoadUnsignedWord,
                      codegen_->DeduplicateBootImageStringLiteral(load->GetDexFile(),
@@ -3646,7 +3667,7 @@
     case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
       DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       CodeGeneratorMIPS64::PcRelativePatchInfo* info =
-          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
       codegen_->EmitPcRelativeAddressPlaceholderHigh(info, AT);
       __ Daddiu(out, AT, /* placeholder */ 0x5678);
       return;  // No dex cache slow path.
@@ -3663,7 +3684,7 @@
     case HLoadString::LoadKind::kBssEntry: {
       DCHECK(!codegen_->GetCompilerOptions().IsBootImage());
       CodeGeneratorMIPS64::PcRelativePatchInfo* info =
-          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex().index_);
+          codegen_->NewPcRelativeStringPatch(load->GetDexFile(), load->GetStringIndex());
       codegen_->EmitPcRelativeAddressPlaceholderHigh(info, AT);
       __ Lwu(out, AT, /* placeholder */ 0x5678);
       SlowPathCodeMIPS64* slow_path = new (GetGraph()->GetArena()) LoadStringSlowPathMIPS64(load);
@@ -3821,19 +3842,14 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
   InvokeRuntimeCallingConvention calling_convention;
-  locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetOut(calling_convention.GetReturnLocation(Primitive::kPrimNot));
-  locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
-  locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
+  locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+  locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
 }
 
 void InstructionCodeGeneratorMIPS64::VisitNewArray(HNewArray* instruction) {
-  LocationSummary* locations = instruction->GetLocations();
-  // Move an uint16_t value to a register.
-  __ LoadConst32(locations->GetTemp(0).AsRegister<GpuRegister>(),
-                 instruction->GetTypeIndex().index_);
-  codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
-  CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
+  codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+  CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
 }
 
 void LocationsBuilderMIPS64::VisitNewInstance(HNewInstance* instruction) {
diff --git a/compiler/optimizing/code_generator_mips64.h b/compiler/optimizing/code_generator_mips64.h
index 8ac919f..52b780c 100644
--- a/compiler/optimizing/code_generator_mips64.h
+++ b/compiler/optimizing/code_generator_mips64.h
@@ -411,8 +411,10 @@
     Mips64Label pc_rel_label;
   };
 
-  PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file, uint32_t string_index);
+  PcRelativePatchInfo* NewPcRelativeStringPatch(const DexFile& dex_file,
+                                                dex::StringIndex string_index);
   PcRelativePatchInfo* NewPcRelativeTypePatch(const DexFile& dex_file, dex::TypeIndex type_index);
+  PcRelativePatchInfo* NewTypeBssEntryPatch(const DexFile& dex_file, dex::TypeIndex type_index);
   PcRelativePatchInfo* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
                                                        uint32_t element_offset);
   PcRelativePatchInfo* NewPcRelativeCallPatch(const DexFile& dex_file,
@@ -469,8 +471,10 @@
   ArenaDeque<PcRelativePatchInfo> pc_relative_string_patches_;
   // Deduplication map for boot type literals for kBootImageLinkTimeAddress.
   BootTypeToLiteralMap boot_image_type_patches_;
-  // PC-relative type patch info.
+  // PC-relative type patch info for kBootImageLinkTimePcRelative.
   ArenaDeque<PcRelativePatchInfo> pc_relative_type_patches_;
+  // PC-relative type patch info for kBssEntry.
+  ArenaDeque<PcRelativePatchInfo> type_bss_entry_patches_;
   // Deduplication map for patchable boot image addresses.
   Uint32ToLiteralMap boot_image_address_patches_;
 
diff --git a/compiler/optimizing/code_generator_x86.cc b/compiler/optimizing/code_generator_x86.cc
index a9b717d..1b74316 100644
--- a/compiler/optimizing/code_generator_x86.cc
+++ b/compiler/optimizing/code_generator_x86.cc
@@ -225,8 +225,8 @@
     SaveLiveRegisters(codegen, locations);
 
     InvokeRuntimeCallingConvention calling_convention;
-    const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
-    __ movl(calling_convention.GetRegisterAt(0), Immediate(string_index));
+    const dex::StringIndex string_index = instruction_->AsLoadString()->GetStringIndex();
+    __ movl(calling_convention.GetRegisterAt(0), Immediate(string_index.index_));
     x86_codegen->InvokeRuntime(kQuickResolveString, instruction_, instruction_->GetDexPc(), this);
     CheckEntrypointTypes<kQuickResolveString, void*, uint32_t>();
     x86_codegen->Move32(locations->Out(), Location::RegisterLocation(EAX));
@@ -254,21 +254,24 @@
                        HInstruction* at,
                        uint32_t dex_pc,
                        bool do_clinit)
-      : SlowPathCode(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+      : SlowPathCode(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
     DCHECK(at->IsLoadClass() || at->IsClinitCheck());
   }
 
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
-    LocationSummary* locations = at_->GetLocations();
+    LocationSummary* locations = instruction_->GetLocations();
     CodeGeneratorX86* x86_codegen = down_cast<CodeGeneratorX86*>(codegen);
     __ Bind(GetEntryLabel());
     SaveLiveRegisters(codegen, locations);
 
     InvokeRuntimeCallingConvention calling_convention;
-    __ movl(calling_convention.GetRegisterAt(0), Immediate(cls_->GetTypeIndex().index_));
+    dex::TypeIndex type_index = cls_->GetTypeIndex();
+    __ movl(calling_convention.GetRegisterAt(0), Immediate(type_index.index_));
     x86_codegen->InvokeRuntime(do_clinit_ ? kQuickInitializeStaticStorage
                                           : kQuickInitializeType,
-                               at_, dex_pc_, this);
+                               instruction_,
+                               dex_pc_,
+                               this);
     if (do_clinit_) {
       CheckEntrypointTypes<kQuickInitializeStaticStorage, void*, uint32_t>();
     } else {
@@ -281,8 +284,17 @@
       DCHECK(out.IsRegister() && !locations->GetLiveRegisters()->ContainsCoreRegister(out.reg()));
       x86_codegen->Move32(out, Location::RegisterLocation(EAX));
     }
-
     RestoreLiveRegisters(codegen, locations);
+    // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+    DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+    if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+      DCHECK(out.IsValid());
+      Register method_address = locations->InAt(0).AsRegister<Register>();
+      __ movl(Address(method_address, CodeGeneratorX86::kDummy32BitOffset),
+              locations->Out().AsRegister<Register>());
+      Label* fixup_label = x86_codegen->NewTypeBssEntryPatch(cls_);
+      __ Bind(fixup_label);
+    }
     __ jmp(GetExitLabel());
   }
 
@@ -292,10 +304,6 @@
   // The class this slow path will load.
   HLoadClass* const cls_;
 
-  // The instruction where this slow path is happening.
-  // (Might be the load class or an initialization check).
-  HInstruction* const at_;
-
   // The dex PC of `at_`.
   const uint32_t dex_pc_;
 
@@ -1009,12 +1017,14 @@
       pc_relative_dex_cache_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       simple_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
-      type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+      boot_image_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+      type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       jit_string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       jit_class_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
       constant_area_start_(-1),
       fixups_to_jump_tables_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
-      method_address_offset_(-1) {
+      method_address_offset_(std::less<uint32_t>(),
+                             graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
   // Use a fake return address register to mimic Quick.
   AddAllocatedRegister(Location::RegisterLocation(kFakeReturnRegister));
 }
@@ -1489,8 +1499,9 @@
       DCHECK(const_area->IsEmittedAtUseSite());
       __ ucomisd(lhs.AsFpuRegister<XmmRegister>(),
                  codegen_->LiteralDoubleAddress(
-                   const_area->GetConstant()->AsDoubleConstant()->GetValue(),
-                   const_area->GetLocations()->InAt(0).AsRegister<Register>()));
+                     const_area->GetConstant()->AsDoubleConstant()->GetValue(),
+                     const_area->GetBaseMethodAddress(),
+                     const_area->GetLocations()->InAt(0).AsRegister<Register>()));
     } else {
       DCHECK(rhs.IsDoubleStackSlot());
       __ ucomisd(lhs.AsFpuRegister<XmmRegister>(), Address(ESP, rhs.GetStackIndex()));
@@ -1502,8 +1513,9 @@
       DCHECK(const_area->IsEmittedAtUseSite());
       __ ucomiss(lhs.AsFpuRegister<XmmRegister>(),
                  codegen_->LiteralFloatAddress(
-                   const_area->GetConstant()->AsFloatConstant()->GetValue(),
-                   const_area->GetLocations()->InAt(0).AsRegister<Register>()));
+                     const_area->GetConstant()->AsFloatConstant()->GetValue(),
+                     const_area->GetBaseMethodAddress(),
+                     const_area->GetLocations()->InAt(0).AsRegister<Register>()));
     } else {
       DCHECK(rhs.IsStackSlot());
       __ ucomiss(lhs.AsFpuRegister<XmmRegister>(), Address(ESP, rhs.GetStackIndex()));
@@ -1769,7 +1781,7 @@
         cond = X86Condition(condition->GetCondition());
       }
     } else {
-      // Must be a boolean condition, which needs to be compared to 0.
+      // Must be a Boolean condition, which needs to be compared to 0.
       Register cond_reg = locations->InAt(2).AsRegister<Register>();
       __ testl(cond_reg, cond_reg);
     }
@@ -2244,6 +2256,14 @@
   codegen_->RecordPcInfo(invoke, invoke->GetDexPc());
 }
 
+void LocationsBuilderX86::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorX86::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
 void LocationsBuilderX86::VisitNeg(HNeg* neg) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
@@ -2343,10 +2363,14 @@
   Register constant_area = locations->InAt(1).AsRegister<Register>();
   XmmRegister mask = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
   if (neg->GetType() == Primitive::kPrimFloat) {
-    __ movss(mask, codegen_->LiteralInt32Address(INT32_C(0x80000000), constant_area));
+    __ movss(mask, codegen_->LiteralInt32Address(INT32_C(0x80000000),
+                                                 neg->GetBaseMethodAddress(),
+                                                 constant_area));
     __ xorps(out.AsFpuRegister<XmmRegister>(), mask);
   } else {
-     __ movsd(mask, codegen_->LiteralInt64Address(INT64_C(0x8000000000000000), constant_area));
+     __ movsd(mask, codegen_->LiteralInt64Address(INT64_C(0x8000000000000000),
+                                                  neg->GetBaseMethodAddress(),
+                                                  constant_area));
      __ xorpd(out.AsFpuRegister<XmmRegister>(), mask);
   }
 }
@@ -2995,8 +3019,9 @@
         DCHECK(const_area->IsEmittedAtUseSite());
         __ addss(first.AsFpuRegister<XmmRegister>(),
                  codegen_->LiteralFloatAddress(
-                   const_area->GetConstant()->AsFloatConstant()->GetValue(),
-                   const_area->GetLocations()->InAt(0).AsRegister<Register>()));
+                     const_area->GetConstant()->AsFloatConstant()->GetValue(),
+                     const_area->GetBaseMethodAddress(),
+                     const_area->GetLocations()->InAt(0).AsRegister<Register>()));
       } else {
         DCHECK(second.IsStackSlot());
         __ addss(first.AsFpuRegister<XmmRegister>(), Address(ESP, second.GetStackIndex()));
@@ -3012,8 +3037,9 @@
         DCHECK(const_area->IsEmittedAtUseSite());
         __ addsd(first.AsFpuRegister<XmmRegister>(),
                  codegen_->LiteralDoubleAddress(
-                   const_area->GetConstant()->AsDoubleConstant()->GetValue(),
-                   const_area->GetLocations()->InAt(0).AsRegister<Register>()));
+                     const_area->GetConstant()->AsDoubleConstant()->GetValue(),
+                     const_area->GetBaseMethodAddress(),
+                     const_area->GetLocations()->InAt(0).AsRegister<Register>()));
       } else {
         DCHECK(second.IsDoubleStackSlot());
         __ addsd(first.AsFpuRegister<XmmRegister>(), Address(ESP, second.GetStackIndex()));
@@ -3099,8 +3125,9 @@
         DCHECK(const_area->IsEmittedAtUseSite());
         __ subss(first.AsFpuRegister<XmmRegister>(),
                  codegen_->LiteralFloatAddress(
-                   const_area->GetConstant()->AsFloatConstant()->GetValue(),
-                   const_area->GetLocations()->InAt(0).AsRegister<Register>()));
+                     const_area->GetConstant()->AsFloatConstant()->GetValue(),
+                     const_area->GetBaseMethodAddress(),
+                     const_area->GetLocations()->InAt(0).AsRegister<Register>()));
       } else {
         DCHECK(second.IsStackSlot());
         __ subss(first.AsFpuRegister<XmmRegister>(), Address(ESP, second.GetStackIndex()));
@@ -3117,6 +3144,7 @@
         __ subsd(first.AsFpuRegister<XmmRegister>(),
                  codegen_->LiteralDoubleAddress(
                      const_area->GetConstant()->AsDoubleConstant()->GetValue(),
+                     const_area->GetBaseMethodAddress(),
                      const_area->GetLocations()->InAt(0).AsRegister<Register>()));
       } else {
         DCHECK(second.IsDoubleStackSlot());
@@ -3287,6 +3315,7 @@
         __ mulss(first.AsFpuRegister<XmmRegister>(),
                  codegen_->LiteralFloatAddress(
                      const_area->GetConstant()->AsFloatConstant()->GetValue(),
+                     const_area->GetBaseMethodAddress(),
                      const_area->GetLocations()->InAt(0).AsRegister<Register>()));
       } else {
         DCHECK(second.IsStackSlot());
@@ -3305,6 +3334,7 @@
         __ mulsd(first.AsFpuRegister<XmmRegister>(),
                  codegen_->LiteralDoubleAddress(
                      const_area->GetConstant()->AsDoubleConstant()->GetValue(),
+                     const_area->GetBaseMethodAddress(),
                      const_area->GetLocations()->InAt(0).AsRegister<Register>()));
       } else {
         DCHECK(second.IsDoubleStackSlot());
@@ -3673,6 +3703,7 @@
         __ divss(first.AsFpuRegister<XmmRegister>(),
                  codegen_->LiteralFloatAddress(
                    const_area->GetConstant()->AsFloatConstant()->GetValue(),
+                   const_area->GetBaseMethodAddress(),
                    const_area->GetLocations()->InAt(0).AsRegister<Register>()));
       } else {
         DCHECK(second.IsStackSlot());
@@ -3689,8 +3720,9 @@
         DCHECK(const_area->IsEmittedAtUseSite());
         __ divsd(first.AsFpuRegister<XmmRegister>(),
                  codegen_->LiteralDoubleAddress(
-                   const_area->GetConstant()->AsDoubleConstant()->GetValue(),
-                   const_area->GetLocations()->InAt(0).AsRegister<Register>()));
+                     const_area->GetConstant()->AsDoubleConstant()->GetValue(),
+                     const_area->GetBaseMethodAddress(),
+                     const_area->GetLocations()->InAt(0).AsRegister<Register>()));
       } else {
         DCHECK(second.IsDoubleStackSlot());
         __ divsd(first.AsFpuRegister<XmmRegister>(), Address(ESP, second.GetStackIndex()));
@@ -4175,18 +4207,15 @@
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
   locations->SetOut(Location::RegisterLocation(EAX));
   InvokeRuntimeCallingConvention calling_convention;
-  locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
-  locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
-  locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
+  locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+  locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
 }
 
 void InstructionCodeGeneratorX86::VisitNewArray(HNewArray* instruction) {
-  InvokeRuntimeCallingConvention calling_convention;
-  __ movl(calling_convention.GetRegisterAt(0), Immediate(instruction->GetTypeIndex().index_));
   // Note: if heap poisoning is enabled, the entry point takes cares
   // of poisoning the reference.
-  codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
-  CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
+  codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+  CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
   DCHECK(!codegen_->IsLeafMethod());
 }
 
@@ -4440,18 +4469,7 @@
 HInvokeStaticOrDirect::DispatchInfo CodeGeneratorX86::GetSupportedInvokeStaticOrDirectDispatch(
       const HInvokeStaticOrDirect::DispatchInfo& desired_dispatch_info,
       HInvokeStaticOrDirect* invoke ATTRIBUTE_UNUSED) {
-  HInvokeStaticOrDirect::DispatchInfo dispatch_info = desired_dispatch_info;
-
-  // We disable pc-relative load when there is an irreducible loop, as the optimization
-  // is incompatible with it.
-  // TODO: Create as many X86ComputeBaseMethodAddress instructions
-  // as needed for methods with irreducible loops.
-  if (GetGraph()->HasIrreducibleLoops() &&
-      (dispatch_info.method_load_kind ==
-          HInvokeStaticOrDirect::MethodLoadKind::kDexCachePcRelative)) {
-    dispatch_info.method_load_kind = HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod;
-  }
-  return dispatch_info;
+  return desired_dispatch_info;
 }
 
 Register CodeGeneratorX86::GetInvokeStaticOrDirectExtraParameter(HInvokeStaticOrDirect* invoke,
@@ -4504,7 +4522,10 @@
       __ movl(temp.AsRegister<Register>(), Address(base_reg, kDummy32BitOffset));
       // Bind a new fixup label at the end of the "movl" insn.
       uint32_t offset = invoke->GetDexCacheArrayOffset();
-      __ Bind(NewPcRelativeDexCacheArrayPatch(invoke->GetDexFile(), offset));
+      __ Bind(NewPcRelativeDexCacheArrayPatch(
+          invoke->InputAt(invoke->GetSpecialInputIndex())->AsX86ComputeBaseMethodAddress(),
+          invoke->GetDexFileForPcRelativeDexCache(),
+          offset));
       break;
     }
     case HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod: {
@@ -4589,25 +4610,54 @@
 
 void CodeGeneratorX86::RecordBootStringPatch(HLoadString* load_string) {
   DCHECK(GetCompilerOptions().IsBootImage());
-  string_patches_.emplace_back(load_string->GetDexFile(), load_string->GetStringIndex().index_);
+  HX86ComputeBaseMethodAddress* address = nullptr;
+  if (GetCompilerOptions().GetCompilePic()) {
+    address = load_string->InputAt(0)->AsX86ComputeBaseMethodAddress();
+  } else {
+    DCHECK_EQ(load_string->InputCount(), 0u);
+  }
+  string_patches_.emplace_back(address,
+                               load_string->GetDexFile(),
+                               load_string->GetStringIndex().index_);
   __ Bind(&string_patches_.back().label);
 }
 
-void CodeGeneratorX86::RecordTypePatch(HLoadClass* load_class) {
-  type_patches_.emplace_back(load_class->GetDexFile(), load_class->GetTypeIndex().index_);
-  __ Bind(&type_patches_.back().label);
+void CodeGeneratorX86::RecordBootTypePatch(HLoadClass* load_class) {
+  HX86ComputeBaseMethodAddress* address = nullptr;
+  if (GetCompilerOptions().GetCompilePic()) {
+    address = load_class->InputAt(0)->AsX86ComputeBaseMethodAddress();
+  } else {
+    DCHECK_EQ(load_class->InputCount(), 0u);
+  }
+  boot_image_type_patches_.emplace_back(address,
+                                        load_class->GetDexFile(),
+                                        load_class->GetTypeIndex().index_);
+  __ Bind(&boot_image_type_patches_.back().label);
+}
+
+Label* CodeGeneratorX86::NewTypeBssEntryPatch(HLoadClass* load_class) {
+  HX86ComputeBaseMethodAddress* address =
+      load_class->InputAt(0)->AsX86ComputeBaseMethodAddress();
+  type_bss_entry_patches_.emplace_back(
+      address, load_class->GetDexFile(), load_class->GetTypeIndex().index_);
+  return &type_bss_entry_patches_.back().label;
 }
 
 Label* CodeGeneratorX86::NewStringBssEntryPatch(HLoadString* load_string) {
   DCHECK(!GetCompilerOptions().IsBootImage());
-  string_patches_.emplace_back(load_string->GetDexFile(), load_string->GetStringIndex().index_);
+  HX86ComputeBaseMethodAddress* address =
+      load_string->InputAt(0)->AsX86ComputeBaseMethodAddress();
+  string_patches_.emplace_back(
+      address, load_string->GetDexFile(), load_string->GetStringIndex().index_);
   return &string_patches_.back().label;
 }
 
-Label* CodeGeneratorX86::NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file,
-                                                         uint32_t element_offset) {
+Label* CodeGeneratorX86::NewPcRelativeDexCacheArrayPatch(
+    HX86ComputeBaseMethodAddress* method_address,
+    const DexFile& dex_file,
+    uint32_t element_offset) {
   // Add the patch entry and bind its label at the end of the instruction.
-  pc_relative_dex_cache_patches_.emplace_back(dex_file, element_offset);
+  pc_relative_dex_cache_patches_.emplace_back(method_address, dex_file, element_offset);
   return &pc_relative_dex_cache_patches_.back().label;
 }
 
@@ -4617,12 +4667,12 @@
 
 template <LinkerPatch (*Factory)(size_t, const DexFile*, uint32_t, uint32_t)>
 inline void CodeGeneratorX86::EmitPcRelativeLinkerPatches(
-    const ArenaDeque<PatchInfo<Label>>& infos,
+    const ArenaDeque<X86PcRelativePatchInfo>& infos,
     ArenaVector<LinkerPatch>* linker_patches) {
-  for (const PatchInfo<Label>& info : infos) {
+  for (const X86PcRelativePatchInfo& info : infos) {
     uint32_t literal_offset = info.label.Position() - kLabelPositionToLiteralOffsetAdjustment;
-    linker_patches->push_back(
-        Factory(literal_offset, &info.dex_file, GetMethodAddressOffset(), info.index));
+    linker_patches->push_back(Factory(
+        literal_offset, &info.dex_file, GetMethodAddressOffset(info.method_address), info.index));
   }
 }
 
@@ -4632,7 +4682,8 @@
       pc_relative_dex_cache_patches_.size() +
       simple_patches_.size() +
       string_patches_.size() +
-      type_patches_.size();
+      boot_image_type_patches_.size() +
+      type_bss_entry_patches_.size();
   linker_patches->reserve(size);
   EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
                                                                linker_patches);
@@ -4641,24 +4692,26 @@
     linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
   }
   if (!GetCompilerOptions().IsBootImage()) {
+    DCHECK(boot_image_type_patches_.empty());
     EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(string_patches_, linker_patches);
   } else if (GetCompilerOptions().GetCompilePic()) {
+    EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(boot_image_type_patches_,
+                                                                linker_patches);
     EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(string_patches_, linker_patches);
   } else {
+    for (const PatchInfo<Label>& info : boot_image_type_patches_) {
+      uint32_t literal_offset = info.label.Position() - kLabelPositionToLiteralOffsetAdjustment;
+      linker_patches->push_back(LinkerPatch::TypePatch(literal_offset, &info.dex_file, info.index));
+    }
     for (const PatchInfo<Label>& info : string_patches_) {
       uint32_t literal_offset = info.label.Position() - kLabelPositionToLiteralOffsetAdjustment;
       linker_patches->push_back(
           LinkerPatch::StringPatch(literal_offset, &info.dex_file, info.index));
     }
   }
-  if (GetCompilerOptions().GetCompilePic()) {
-    EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(type_patches_, linker_patches);
-  } else {
-    for (const PatchInfo<Label>& info : type_patches_) {
-      uint32_t literal_offset = info.label.Position() - kLabelPositionToLiteralOffsetAdjustment;
-      linker_patches->push_back(LinkerPatch::TypePatch(literal_offset, &info.dex_file, info.index));
-    }
-  }
+  EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
+                                                              linker_patches);
+  DCHECK_EQ(size, linker_patches->size());
 }
 
 void CodeGeneratorX86::MarkGCCard(Register temp,
@@ -5977,15 +6030,8 @@
     case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
       DCHECK(GetCompilerOptions().GetCompilePic());
       FALLTHROUGH_INTENDED;
-    case HLoadClass::LoadKind::kDexCachePcRelative:
+    case HLoadClass::LoadKind::kBssEntry:
       DCHECK(!Runtime::Current()->UseJitCompilation());  // Note: boot image is also non-JIT.
-      // We disable pc-relative load when there is an irreducible loop, as the optimization
-      // is incompatible with it.
-      // TODO: Create as many X86ComputeBaseMethodAddress instructions as needed for methods
-      // with irreducible loops.
-      if (GetGraph()->HasIrreducibleLoops()) {
-        return HLoadClass::LoadKind::kDexCacheViaMethod;
-      }
       break;
     case HLoadClass::LoadKind::kBootImageAddress:
       break;
@@ -5999,15 +6045,16 @@
 }
 
 void LocationsBuilderX86::VisitLoadClass(HLoadClass* cls) {
-  if (cls->NeedsAccessCheck()) {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
     InvokeRuntimeCallingConvention calling_convention;
-    CodeGenerator::CreateLoadClassLocationSummary(
+    CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
         cls,
         Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-        Location::RegisterLocation(EAX),
-        /* code_generator_supports_read_barrier */ true);
+        Location::RegisterLocation(EAX));
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
   const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage();
   LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier)
@@ -6018,11 +6065,9 @@
     locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty());  // No caller-save registers.
   }
 
-  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
   if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
-      load_kind == HLoadClass::LoadKind::kDexCacheViaMethod ||
       load_kind == HLoadClass::LoadKind::kBootImageLinkTimePcRelative ||
-      load_kind == HLoadClass::LoadKind::kDexCachePcRelative) {
+      load_kind == HLoadClass::LoadKind::kBssEntry) {
     locations->SetInAt(0, Location::RequiresRegister());
   }
   locations->SetOut(Location::RequiresRegister());
@@ -6030,23 +6075,26 @@
 
 Label* CodeGeneratorX86::NewJitRootClassPatch(const DexFile& dex_file,
                                               dex::TypeIndex dex_index,
-                                              uint64_t address) {
-  jit_class_roots_.Overwrite(TypeReference(&dex_file, dex_index), address);
+                                              Handle<mirror::Class> handle) {
+  jit_class_roots_.Overwrite(TypeReference(&dex_file, dex_index),
+                             reinterpret_cast64<uint64_t>(handle.GetReference()));
   // Add a patch entry and return the label.
   jit_class_patches_.emplace_back(dex_file, dex_index.index_);
   PatchInfo<Label>* info = &jit_class_patches_.back();
   return &info->label;
 }
 
-void InstructionCodeGeneratorX86::VisitLoadClass(HLoadClass* cls) {
-  LocationSummary* locations = cls->GetLocations();
-  if (cls->NeedsAccessCheck()) {
-    codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
-    codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
-    CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorX86::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+    codegen_->GenerateLoadClassRuntimeCall(cls);
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
+  LocationSummary* locations = cls->GetLocations();
   Location out_loc = locations->Out();
   Register out = out_loc.AsRegister<Register>();
 
@@ -6054,7 +6102,7 @@
   const ReadBarrierOption read_barrier_option = cls->IsInBootImage()
       ? kWithoutReadBarrier
       : kCompilerReadBarrierOption;
-  switch (cls->GetLoadKind()) {
+  switch (load_kind) {
     case HLoadClass::LoadKind::kReferrersClass: {
       DCHECK(!cls->CanCallRuntime());
       DCHECK(!cls->MustGenerateClinitCheck());
@@ -6069,63 +6117,48 @@
       break;
     }
     case HLoadClass::LoadKind::kBootImageLinkTimeAddress: {
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
       __ movl(out, Immediate(/* placeholder */ 0));
-      codegen_->RecordTypePatch(cls);
+      codegen_->RecordBootTypePatch(cls);
       break;
     }
     case HLoadClass::LoadKind::kBootImageLinkTimePcRelative: {
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
       Register method_address = locations->InAt(0).AsRegister<Register>();
       __ leal(out, Address(method_address, CodeGeneratorX86::kDummy32BitOffset));
-      codegen_->RecordTypePatch(cls);
+      codegen_->RecordBootTypePatch(cls);
       break;
     }
     case HLoadClass::LoadKind::kBootImageAddress: {
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
-      DCHECK_NE(cls->GetAddress(), 0u);
-      uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+      uint32_t address = dchecked_integral_cast<uint32_t>(
+          reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+      DCHECK_NE(address, 0u);
       __ movl(out, Immediate(address));
       codegen_->RecordSimplePatch();
       break;
     }
+    case HLoadClass::LoadKind::kBssEntry: {
+      Register method_address = locations->InAt(0).AsRegister<Register>();
+      Address address(method_address, CodeGeneratorX86::kDummy32BitOffset);
+      Label* fixup_label = codegen_->NewTypeBssEntryPatch(cls);
+      GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, read_barrier_option);
+      generate_null_check = true;
+      break;
+    }
     case HLoadClass::LoadKind::kJitTableAddress: {
       Address address = Address::Absolute(CodeGeneratorX86::kDummy32BitOffset);
       Label* fixup_label = codegen_->NewJitRootClassPatch(
-          cls->GetDexFile(), cls->GetTypeIndex(), cls->GetAddress());
+          cls->GetDexFile(), cls->GetTypeIndex(), cls->GetClass());
       // /* GcRoot<mirror::Class> */ out = *address
       GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, kCompilerReadBarrierOption);
       break;
     }
-    case HLoadClass::LoadKind::kDexCachePcRelative: {
-      Register base_reg = locations->InAt(0).AsRegister<Register>();
-      uint32_t offset = cls->GetDexCacheElementOffset();
-      Label* fixup_label = codegen_->NewPcRelativeDexCacheArrayPatch(cls->GetDexFile(), offset);
-      // /* GcRoot<mirror::Class> */ out = *(base + offset)  /* PC-relative */
-      GenerateGcRootFieldLoad(cls,
-                              out_loc,
-                              Address(base_reg, CodeGeneratorX86::kDummy32BitOffset),
-                              fixup_label,
-                              read_barrier_option);
-      generate_null_check = !cls->IsInDexCache();
-      break;
-    }
-    case HLoadClass::LoadKind::kDexCacheViaMethod: {
-      // /* GcRoot<mirror::Class>[] */ out =
-      //        current_method.ptr_sized_fields_->dex_cache_resolved_types_
-      Register current_method = locations->InAt(0).AsRegister<Register>();
-      __ movl(out, Address(current_method,
-                           ArtMethod::DexCacheResolvedTypesOffset(kX86PointerSize).Int32Value()));
-      // /* GcRoot<mirror::Class> */ out = out[type_index]
-      GenerateGcRootFieldLoad(cls,
-                              out_loc,
-                              Address(out,
-                                      CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_)),
-                              /* fixup_label */ nullptr,
-                              read_barrier_option);
-      generate_null_check = !cls->IsInDexCache();
-      break;
-    }
+    case HLoadClass::LoadKind::kDexCacheViaMethod:
+      LOG(FATAL) << "UNREACHABLE";
+      UNREACHABLE();
   }
 
   if (generate_null_check || cls->MustGenerateClinitCheck()) {
@@ -6185,21 +6218,14 @@
       FALLTHROUGH_INTENDED;
     case HLoadString::LoadKind::kBssEntry:
       DCHECK(!Runtime::Current()->UseJitCompilation());  // Note: boot image is also non-JIT.
-      // We disable pc-relative load when there is an irreducible loop, as the optimization
-      // is incompatible with it.
-      // TODO: Create as many X86ComputeBaseMethodAddress instructions as needed for methods
-      // with irreducible loops.
-      if (GetGraph()->HasIrreducibleLoops()) {
-        return HLoadString::LoadKind::kDexCacheViaMethod;
-      }
       break;
     case HLoadString::LoadKind::kBootImageAddress:
       break;
-    case HLoadString::LoadKind::kDexCacheViaMethod:
-      break;
     case HLoadString::LoadKind::kJitTableAddress:
       DCHECK(Runtime::Current()->UseJitCompilation());
       break;
+    case HLoadString::LoadKind::kDexCacheViaMethod:
+      break;
   }
   return desired_string_load_kind;
 }
@@ -6250,11 +6276,13 @@
 
   switch (load->GetLoadKind()) {
     case HLoadString::LoadKind::kBootImageLinkTimeAddress: {
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       __ movl(out, Immediate(/* placeholder */ 0));
       codegen_->RecordBootStringPatch(load);
       return;  // No dex cache slow path.
     }
     case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       Register method_address = locations->InAt(0).AsRegister<Register>();
       __ leal(out, Address(method_address, CodeGeneratorX86::kDummy32BitOffset));
       codegen_->RecordBootStringPatch(load);
@@ -7477,7 +7505,7 @@
   __ Bind(&next_instruction);
 
   // Remember this offset for later use with constant area.
-  codegen_->SetMethodAddressOffset(GetAssembler()->CodeSize());
+  codegen_->AddMethodAddressOffset(insn, GetAssembler()->CodeSize());
 
   // Grab the return address off the stack.
   __ popl(reg);
@@ -7524,17 +7552,20 @@
   switch (insn->GetType()) {
     case Primitive::kPrimFloat:
       __ movss(out.AsFpuRegister<XmmRegister>(),
-               codegen_->LiteralFloatAddress(value->AsFloatConstant()->GetValue(), const_area));
+               codegen_->LiteralFloatAddress(
+                  value->AsFloatConstant()->GetValue(), insn->GetBaseMethodAddress(), const_area));
       break;
 
     case Primitive::kPrimDouble:
       __ movsd(out.AsFpuRegister<XmmRegister>(),
-               codegen_->LiteralDoubleAddress(value->AsDoubleConstant()->GetValue(), const_area));
+               codegen_->LiteralDoubleAddress(
+                  value->AsDoubleConstant()->GetValue(), insn->GetBaseMethodAddress(), const_area));
       break;
 
     case Primitive::kPrimInt:
       __ movl(out.AsRegister<Register>(),
-              codegen_->LiteralInt32Address(value->AsIntConstant()->GetValue(), const_area));
+              codegen_->LiteralInt32Address(
+                  value->AsIntConstant()->GetValue(), insn->GetBaseMethodAddress(), const_area));
       break;
 
     default:
@@ -7547,13 +7578,18 @@
  */
 class RIPFixup : public AssemblerFixup, public ArenaObject<kArenaAllocCodeGenerator> {
  public:
-  RIPFixup(CodeGeneratorX86& codegen, size_t offset)
-      : codegen_(&codegen), offset_into_constant_area_(offset) {}
+  RIPFixup(CodeGeneratorX86& codegen,
+           HX86ComputeBaseMethodAddress* base_method_address,
+           size_t offset)
+      : codegen_(&codegen),
+        base_method_address_(base_method_address),
+        offset_into_constant_area_(offset) {}
 
  protected:
   void SetOffset(size_t offset) { offset_into_constant_area_ = offset; }
 
   CodeGeneratorX86* codegen_;
+  HX86ComputeBaseMethodAddress* base_method_address_;
 
  private:
   void Process(const MemoryRegion& region, int pos) OVERRIDE {
@@ -7562,7 +7598,8 @@
     // The value to patch is the distance from the offset in the constant area
     // from the address computed by the HX86ComputeBaseMethodAddress instruction.
     int32_t constant_offset = codegen_->ConstantAreaStart() + offset_into_constant_area_;
-    int32_t relative_position = constant_offset - codegen_->GetMethodAddressOffset();
+    int32_t relative_position =
+        constant_offset - codegen_->GetMethodAddressOffset(base_method_address_);
 
     // Patch in the right value.
     region.StoreUnaligned<int32_t>(pos - 4, relative_position);
@@ -7579,7 +7616,8 @@
 class JumpTableRIPFixup : public RIPFixup {
  public:
   JumpTableRIPFixup(CodeGeneratorX86& codegen, HX86PackedSwitch* switch_instr)
-      : RIPFixup(codegen, static_cast<size_t>(-1)), switch_instr_(switch_instr) {}
+      : RIPFixup(codegen, switch_instr->GetBaseMethodAddress(), static_cast<size_t>(-1)),
+        switch_instr_(switch_instr) {}
 
   void CreateJumpTable() {
     X86Assembler* assembler = codegen_->GetAssembler();
@@ -7590,7 +7628,7 @@
 
     // The label values in the jump table are computed relative to the
     // instruction addressing the constant area.
-    const int32_t relative_offset = codegen_->GetMethodAddressOffset();
+    const int32_t relative_offset = codegen_->GetMethodAddressOffset(base_method_address_);
 
     // Populate the jump table with the correct values for the jump table.
     int32_t num_entries = switch_instr_->GetNumEntries();
@@ -7632,23 +7670,32 @@
   CodeGenerator::Finalize(allocator);
 }
 
-Address CodeGeneratorX86::LiteralDoubleAddress(double v, Register reg) {
-  AssemblerFixup* fixup = new (GetGraph()->GetArena()) RIPFixup(*this, __ AddDouble(v));
+Address CodeGeneratorX86::LiteralDoubleAddress(double v,
+                                               HX86ComputeBaseMethodAddress* method_base,
+                                               Register reg) {
+  AssemblerFixup* fixup =
+      new (GetGraph()->GetArena()) RIPFixup(*this, method_base, __ AddDouble(v));
   return Address(reg, kDummy32BitOffset, fixup);
 }
 
-Address CodeGeneratorX86::LiteralFloatAddress(float v, Register reg) {
-  AssemblerFixup* fixup = new (GetGraph()->GetArena()) RIPFixup(*this, __ AddFloat(v));
+Address CodeGeneratorX86::LiteralFloatAddress(float v,
+                                              HX86ComputeBaseMethodAddress* method_base,
+                                              Register reg) {
+  AssemblerFixup* fixup = new (GetGraph()->GetArena()) RIPFixup(*this, method_base, __ AddFloat(v));
   return Address(reg, kDummy32BitOffset, fixup);
 }
 
-Address CodeGeneratorX86::LiteralInt32Address(int32_t v, Register reg) {
-  AssemblerFixup* fixup = new (GetGraph()->GetArena()) RIPFixup(*this, __ AddInt32(v));
+Address CodeGeneratorX86::LiteralInt32Address(int32_t v,
+                                              HX86ComputeBaseMethodAddress* method_base,
+                                              Register reg) {
+  AssemblerFixup* fixup = new (GetGraph()->GetArena()) RIPFixup(*this, method_base, __ AddInt32(v));
   return Address(reg, kDummy32BitOffset, fixup);
 }
 
-Address CodeGeneratorX86::LiteralInt64Address(int64_t v, Register reg) {
-  AssemblerFixup* fixup = new (GetGraph()->GetArena()) RIPFixup(*this, __ AddInt64(v));
+Address CodeGeneratorX86::LiteralInt64Address(int64_t v,
+                                              HX86ComputeBaseMethodAddress* method_base,
+                                              Register reg) {
+  AssemblerFixup* fixup = new (GetGraph()->GetArena()) RIPFixup(*this, method_base, __ AddInt64(v));
   return Address(reg, kDummy32BitOffset, fixup);
 }
 
diff --git a/compiler/optimizing/code_generator_x86.h b/compiler/optimizing/code_generator_x86.h
index dd1628c..7350fcc 100644
--- a/compiler/optimizing/code_generator_x86.h
+++ b/compiler/optimizing/code_generator_x86.h
@@ -412,13 +412,18 @@
 
   void RecordSimplePatch();
   void RecordBootStringPatch(HLoadString* load_string);
-  void RecordTypePatch(HLoadClass* load_class);
+  void RecordBootTypePatch(HLoadClass* load_class);
+  Label* NewTypeBssEntryPatch(HLoadClass* load_class);
   Label* NewStringBssEntryPatch(HLoadString* load_string);
-  Label* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file, uint32_t element_offset);
+  Label* NewPcRelativeDexCacheArrayPatch(HX86ComputeBaseMethodAddress* method_address,
+                                         const DexFile& dex_file,
+                                         uint32_t element_offset);
   Label* NewJitRootStringPatch(const DexFile& dex_file,
                                dex::StringIndex dex_index,
                                Handle<mirror::String> handle);
-  Label* NewJitRootClassPatch(const DexFile& dex_file, dex::TypeIndex dex_index, uint64_t address);
+  Label* NewJitRootClassPatch(const DexFile& dex_file,
+                              dex::TypeIndex dex_index,
+                              Handle<mirror::Class> handle);
 
   void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE;
 
@@ -460,22 +465,22 @@
     return isa_features_;
   }
 
-  void SetMethodAddressOffset(int32_t offset) {
-    method_address_offset_ = offset;
+  void AddMethodAddressOffset(HX86ComputeBaseMethodAddress* method_base, int32_t offset) {
+    method_address_offset_.Put(method_base->GetId(), offset);
   }
 
-  int32_t GetMethodAddressOffset() const {
-    return method_address_offset_;
+  int32_t GetMethodAddressOffset(HX86ComputeBaseMethodAddress* method_base) const {
+    return method_address_offset_.Get(method_base->GetId());
   }
 
   int32_t ConstantAreaStart() const {
     return constant_area_start_;
   }
 
-  Address LiteralDoubleAddress(double v, Register reg);
-  Address LiteralFloatAddress(float v, Register reg);
-  Address LiteralInt32Address(int32_t v, Register reg);
-  Address LiteralInt64Address(int64_t v, Register reg);
+  Address LiteralDoubleAddress(double v, HX86ComputeBaseMethodAddress* method_base, Register reg);
+  Address LiteralFloatAddress(float v, HX86ComputeBaseMethodAddress* method_base, Register reg);
+  Address LiteralInt32Address(int32_t v, HX86ComputeBaseMethodAddress* method_base, Register reg);
+  Address LiteralInt64Address(int64_t v, HX86ComputeBaseMethodAddress* method_base, Register reg);
 
   // Load a 32-bit value into a register in the most efficient manner.
   void Load32BitValue(Register dest, int32_t value);
@@ -600,12 +605,21 @@
   static constexpr int32_t kDummy32BitOffset = 256;
 
  private:
-  Register GetInvokeStaticOrDirectExtraParameter(HInvokeStaticOrDirect* invoke, Register temp);
+  struct X86PcRelativePatchInfo : PatchInfo<Label> {
+    X86PcRelativePatchInfo(HX86ComputeBaseMethodAddress* address,
+                           const DexFile& target_dex_file,
+                           uint32_t target_index)
+        : PatchInfo(target_dex_file, target_index),
+          method_address(address) {}
+    HX86ComputeBaseMethodAddress* method_address;
+  };
 
   template <LinkerPatch (*Factory)(size_t, const DexFile*, uint32_t, uint32_t)>
-  void EmitPcRelativeLinkerPatches(const ArenaDeque<PatchInfo<Label>>& infos,
+  void EmitPcRelativeLinkerPatches(const ArenaDeque<X86PcRelativePatchInfo>& infos,
                                    ArenaVector<LinkerPatch>* linker_patches);
 
+  Register GetInvokeStaticOrDirectExtraParameter(HInvokeStaticOrDirect* invoke, Register temp);
+
   // Labels for each block that will be compiled.
   Label* block_labels_;  // Indexed by block id.
   Label frame_entry_label_;
@@ -616,13 +630,15 @@
   const X86InstructionSetFeatures& isa_features_;
 
   // PC-relative DexCache access info.
-  ArenaDeque<PatchInfo<Label>> pc_relative_dex_cache_patches_;
+  ArenaDeque<X86PcRelativePatchInfo> pc_relative_dex_cache_patches_;
   // Patch locations for patchoat where the linker doesn't do any other work.
   ArenaDeque<Label> simple_patches_;
   // String patch locations; type depends on configuration (app .bss or boot image PIC/non-PIC).
-  ArenaDeque<PatchInfo<Label>> string_patches_;
-  // Type patch locations.
-  ArenaDeque<PatchInfo<Label>> type_patches_;
+  ArenaDeque<X86PcRelativePatchInfo> string_patches_;
+  // Type patch locations for boot image; type depends on configuration (boot image PIC/non-PIC).
+  ArenaDeque<X86PcRelativePatchInfo> boot_image_type_patches_;
+  // Type patch locations for kBssEntry.
+  ArenaDeque<X86PcRelativePatchInfo> type_bss_entry_patches_;
 
   // Patches for string root accesses in JIT compiled code.
   ArenaDeque<PatchInfo<Label>> jit_string_patches_;
@@ -637,11 +653,9 @@
   // Fixups for jump tables that need to be patched after the constant table is generated.
   ArenaVector<JumpTableRIPFixup*> fixups_to_jump_tables_;
 
-  // If there is a HX86ComputeBaseMethodAddress instruction in the graph
-  // (which shall be the sole instruction of this kind), subtracting this offset
-  // from the value contained in the out register of this HX86ComputeBaseMethodAddress
-  // instruction gives the address of the start of this method.
-  int32_t method_address_offset_;
+  // Maps a HX86ComputeBaseMethodAddress instruction id, to its offset in the
+  // compiled code.
+  ArenaSafeMap<uint32_t, int32_t> method_address_offset_;
 
   DISALLOW_COPY_AND_ASSIGN(CodeGeneratorX86);
 };
diff --git a/compiler/optimizing/code_generator_x86_64.cc b/compiler/optimizing/code_generator_x86_64.cc
index 2614735..c4caf4b 100644
--- a/compiler/optimizing/code_generator_x86_64.cc
+++ b/compiler/optimizing/code_generator_x86_64.cc
@@ -234,12 +234,12 @@
                           HInstruction* at,
                           uint32_t dex_pc,
                           bool do_clinit)
-      : SlowPathCode(at), cls_(cls), at_(at), dex_pc_(dex_pc), do_clinit_(do_clinit) {
+      : SlowPathCode(at), cls_(cls), dex_pc_(dex_pc), do_clinit_(do_clinit) {
     DCHECK(at->IsLoadClass() || at->IsClinitCheck());
   }
 
   void EmitNativeCode(CodeGenerator* codegen) OVERRIDE {
-    LocationSummary* locations = at_->GetLocations();
+    LocationSummary* locations = instruction_->GetLocations();
     CodeGeneratorX86_64* x86_64_codegen = down_cast<CodeGeneratorX86_64*>(codegen);
     __ Bind(GetEntryLabel());
 
@@ -249,7 +249,7 @@
     __ movl(CpuRegister(calling_convention.GetRegisterAt(0)),
             Immediate(cls_->GetTypeIndex().index_));
     x86_64_codegen->InvokeRuntime(do_clinit_ ? kQuickInitializeStaticStorage : kQuickInitializeType,
-                                  at_,
+                                  instruction_,
                                   dex_pc_,
                                   this);
     if (do_clinit_) {
@@ -266,6 +266,15 @@
     }
 
     RestoreLiveRegisters(codegen, locations);
+    // For HLoadClass/kBssEntry, store the resolved Class to the BSS entry.
+    DCHECK_EQ(instruction_->IsLoadClass(), cls_ == instruction_);
+    if (cls_ == instruction_ && cls_->GetLoadKind() == HLoadClass::LoadKind::kBssEntry) {
+      DCHECK(out.IsValid());
+      __ movl(Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset, /* no_rip */ false),
+              locations->Out().AsRegister<CpuRegister>());
+      Label* fixup_label = x86_64_codegen->NewTypeBssEntryPatch(cls_);
+      __ Bind(fixup_label);
+    }
     __ jmp(GetExitLabel());
   }
 
@@ -275,10 +284,6 @@
   // The class this slow path will load.
   HLoadClass* const cls_;
 
-  // The instruction where this slow path is happening.
-  // (Might be the load class or an initialization check).
-  HInstruction* const at_;
-
   // The dex PC of `at_`.
   const uint32_t dex_pc_;
 
@@ -300,9 +305,9 @@
     __ Bind(GetEntryLabel());
     SaveLiveRegisters(codegen, locations);
 
-    const uint32_t string_index = instruction_->AsLoadString()->GetStringIndex().index_;
+    const dex::StringIndex string_index = instruction_->AsLoadString()->GetStringIndex();
     // Custom calling convention: RAX serves as both input and output.
-    __ movl(CpuRegister(RAX), Immediate(string_index));
+    __ movl(CpuRegister(RAX), Immediate(string_index.index_));
     x86_64_codegen->InvokeRuntime(kQuickResolveString,
                                   instruction_,
                                   instruction_->GetDexPc(),
@@ -986,7 +991,7 @@
               Address::Absolute(kDummy32BitOffset, /* no_rip */ false));
       // Bind a new fixup label at the end of the "movl" insn.
       uint32_t offset = invoke->GetDexCacheArrayOffset();
-      __ Bind(NewPcRelativeDexCacheArrayPatch(invoke->GetDexFile(), offset));
+      __ Bind(NewPcRelativeDexCacheArrayPatch(invoke->GetDexFileForPcRelativeDexCache(), offset));
       break;
     }
     case HInvokeStaticOrDirect::MethodLoadKind::kDexCacheViaMethod: {
@@ -1079,9 +1084,15 @@
   __ Bind(&string_patches_.back().label);
 }
 
-void CodeGeneratorX86_64::RecordTypePatch(HLoadClass* load_class) {
-  type_patches_.emplace_back(load_class->GetDexFile(), load_class->GetTypeIndex().index_);
-  __ Bind(&type_patches_.back().label);
+void CodeGeneratorX86_64::RecordBootTypePatch(HLoadClass* load_class) {
+  boot_image_type_patches_.emplace_back(load_class->GetDexFile(),
+                                        load_class->GetTypeIndex().index_);
+  __ Bind(&boot_image_type_patches_.back().label);
+}
+
+Label* CodeGeneratorX86_64::NewTypeBssEntryPatch(HLoadClass* load_class) {
+  type_bss_entry_patches_.emplace_back(load_class->GetDexFile(), load_class->GetTypeIndex().index_);
+  return &type_bss_entry_patches_.back().label;
 }
 
 Label* CodeGeneratorX86_64::NewStringBssEntryPatch(HLoadString* load_string) {
@@ -1118,7 +1129,8 @@
       pc_relative_dex_cache_patches_.size() +
       simple_patches_.size() +
       string_patches_.size() +
-      type_patches_.size();
+      boot_image_type_patches_.size() +
+      type_bss_entry_patches_.size();
   linker_patches->reserve(size);
   EmitPcRelativeLinkerPatches<LinkerPatch::DexCacheArrayPatch>(pc_relative_dex_cache_patches_,
                                                                linker_patches);
@@ -1127,13 +1139,17 @@
     linker_patches->push_back(LinkerPatch::RecordPosition(literal_offset));
   }
   if (!GetCompilerOptions().IsBootImage()) {
+    DCHECK(boot_image_type_patches_.empty());
     EmitPcRelativeLinkerPatches<LinkerPatch::StringBssEntryPatch>(string_patches_, linker_patches);
   } else {
-    // These are always PC-relative, see GetSupportedLoadStringKind().
+    // These are always PC-relative, see GetSupportedLoadClassKind()/GetSupportedLoadStringKind().
+    EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(boot_image_type_patches_,
+                                                                linker_patches);
     EmitPcRelativeLinkerPatches<LinkerPatch::RelativeStringPatch>(string_patches_, linker_patches);
   }
-  // These are always PC-relative, see GetSupportedLoadClassKind().
-  EmitPcRelativeLinkerPatches<LinkerPatch::RelativeTypePatch>(type_patches_, linker_patches);
+  EmitPcRelativeLinkerPatches<LinkerPatch::TypeBssEntryPatch>(type_bss_entry_patches_,
+                                                              linker_patches);
+  DCHECK_EQ(size, linker_patches->size());
 }
 
 void CodeGeneratorX86_64::DumpCoreRegister(std::ostream& stream, int reg) const {
@@ -1214,7 +1230,8 @@
         pc_relative_dex_cache_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
         simple_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
         string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
-        type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+        boot_image_type_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
+        type_bss_entry_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
         fixups_to_jump_tables_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
         jit_string_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)),
         jit_class_patches_(graph->GetArena()->Adapter(kArenaAllocCodeGenerator)) {
@@ -1792,7 +1809,7 @@
         cond = X86_64IntegerCondition(condition->GetCondition());
       }
     } else {
-      // Must be a boolean condition, which needs to be compared to 0.
+      // Must be a Boolean condition, which needs to be compared to 0.
       CpuRegister cond_reg = locations->InAt(2).AsRegister<CpuRegister>();
       __ testl(cond_reg, cond_reg);
     }
@@ -2423,6 +2440,14 @@
   codegen_->RecordPcInfo(invoke, invoke->GetDexPc());
 }
 
+void LocationsBuilderX86_64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  HandleInvoke(invoke);
+}
+
+void InstructionCodeGeneratorX86_64::VisitInvokePolymorphic(HInvokePolymorphic* invoke) {
+  codegen_->GenerateInvokePolymorphicCall(invoke);
+}
+
 void LocationsBuilderX86_64::VisitNeg(HNeg* neg) {
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(neg, LocationSummary::kNoCall);
@@ -4063,21 +4088,16 @@
   LocationSummary* locations =
       new (GetGraph()->GetArena()) LocationSummary(instruction, LocationSummary::kCallOnMainOnly);
   InvokeRuntimeCallingConvention calling_convention;
-  locations->AddTemp(Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
   locations->SetOut(Location::RegisterLocation(RAX));
-  locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
-  locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(2)));
+  locations->SetInAt(0, Location::RegisterLocation(calling_convention.GetRegisterAt(0)));
+  locations->SetInAt(1, Location::RegisterLocation(calling_convention.GetRegisterAt(1)));
 }
 
 void InstructionCodeGeneratorX86_64::VisitNewArray(HNewArray* instruction) {
-  InvokeRuntimeCallingConvention calling_convention;
-  codegen_->Load64BitValue(CpuRegister(calling_convention.GetRegisterAt(0)),
-                           instruction->GetTypeIndex().index_);
   // Note: if heap poisoning is enabled, the entry point takes cares
   // of poisoning the reference.
-  codegen_->InvokeRuntime(instruction->GetEntrypoint(), instruction, instruction->GetDexPc());
-  CheckEntrypointTypes<kQuickAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*>();
-
+  codegen_->InvokeRuntime(kQuickAllocArrayResolved, instruction, instruction->GetDexPc());
+  CheckEntrypointTypes<kQuickAllocArrayResolved, void*, mirror::Class*, int32_t>();
   DCHECK(!codegen_->IsLeafMethod());
 }
 
@@ -4190,7 +4210,7 @@
 
 void CodeGeneratorX86_64::GenerateMemoryBarrier(MemBarrierKind kind) {
   /*
-   * According to the JSR-133 Cookbook, for x86 only StoreLoad/AnyAny barriers need memory fence.
+   * According to the JSR-133 Cookbook, for x86-64 only StoreLoad/AnyAny barriers need memory fence.
    * All other barriers (LoadAny, AnyStore, StoreStore) are nops due to the x86-64 memory model.
    * For those cases, all we need to ensure is that there is a scheduling barrier in place.
    */
@@ -5416,11 +5436,12 @@
       break;
     case HLoadClass::LoadKind::kBootImageAddress:
       break;
-    case HLoadClass::LoadKind::kJitTableAddress:
-      break;
-    case HLoadClass::LoadKind::kDexCachePcRelative:
+    case HLoadClass::LoadKind::kBssEntry:
       DCHECK(!Runtime::Current()->UseJitCompilation());
       break;
+    case HLoadClass::LoadKind::kJitTableAddress:
+      DCHECK(Runtime::Current()->UseJitCompilation());
+      break;
     case HLoadClass::LoadKind::kDexCacheViaMethod:
       break;
   }
@@ -5428,15 +5449,16 @@
 }
 
 void LocationsBuilderX86_64::VisitLoadClass(HLoadClass* cls) {
-  if (cls->NeedsAccessCheck()) {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
     InvokeRuntimeCallingConvention calling_convention;
-    CodeGenerator::CreateLoadClassLocationSummary(
+    CodeGenerator::CreateLoadClassRuntimeCallLocationSummary(
         cls,
         Location::RegisterLocation(calling_convention.GetRegisterAt(0)),
-        Location::RegisterLocation(RAX),
-        /* code_generator_supports_read_barrier */ true);
+        Location::RegisterLocation(RAX));
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
   const bool requires_read_barrier = kEmitCompilerReadBarrier && !cls->IsInBootImage();
   LocationSummary::CallKind call_kind = (cls->NeedsEnvironment() || requires_read_barrier)
@@ -5447,9 +5469,7 @@
     locations->SetCustomSlowPathCallerSaves(RegisterSet::Empty());  // No caller-save registers.
   }
 
-  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
-  if (load_kind == HLoadClass::LoadKind::kReferrersClass ||
-      load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+  if (load_kind == HLoadClass::LoadKind::kReferrersClass) {
     locations->SetInAt(0, Location::RequiresRegister());
   }
   locations->SetOut(Location::RequiresRegister());
@@ -5457,23 +5477,26 @@
 
 Label* CodeGeneratorX86_64::NewJitRootClassPatch(const DexFile& dex_file,
                                                  dex::TypeIndex dex_index,
-                                                 uint64_t address) {
-  jit_class_roots_.Overwrite(TypeReference(&dex_file, dex_index), address);
+                                                 Handle<mirror::Class> handle) {
+  jit_class_roots_.Overwrite(
+      TypeReference(&dex_file, dex_index), reinterpret_cast64<uint64_t>(handle.GetReference()));
   // Add a patch entry and return the label.
   jit_class_patches_.emplace_back(dex_file, dex_index.index_);
   PatchInfo<Label>* info = &jit_class_patches_.back();
   return &info->label;
 }
 
-void InstructionCodeGeneratorX86_64::VisitLoadClass(HLoadClass* cls) {
-  LocationSummary* locations = cls->GetLocations();
-  if (cls->NeedsAccessCheck()) {
-    codegen_->MoveConstant(locations->GetTemp(0), cls->GetTypeIndex().index_);
-    codegen_->InvokeRuntime(kQuickInitializeTypeAndVerifyAccess, cls, cls->GetDexPc());
-    CheckEntrypointTypes<kQuickInitializeTypeAndVerifyAccess, void*, uint32_t>();
+// NO_THREAD_SAFETY_ANALYSIS as we manipulate handles whose internal object we know does not
+// move.
+void InstructionCodeGeneratorX86_64::VisitLoadClass(HLoadClass* cls) NO_THREAD_SAFETY_ANALYSIS {
+  HLoadClass::LoadKind load_kind = cls->GetLoadKind();
+  if (load_kind == HLoadClass::LoadKind::kDexCacheViaMethod) {
+    codegen_->GenerateLoadClassRuntimeCall(cls);
     return;
   }
+  DCHECK(!cls->NeedsAccessCheck());
 
+  LocationSummary* locations = cls->GetLocations();
   Location out_loc = locations->Out();
   CpuRegister out = out_loc.AsRegister<CpuRegister>();
 
@@ -5481,7 +5504,7 @@
       ? kWithoutReadBarrier
       : kCompilerReadBarrierOption;
   bool generate_null_check = false;
-  switch (cls->GetLoadKind()) {
+  switch (load_kind) {
     case HLoadClass::LoadKind::kReferrersClass: {
       DCHECK(!cls->CanCallRuntime());
       DCHECK(!cls->MustGenerateClinitCheck());
@@ -5496,54 +5519,38 @@
       break;
     }
     case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
       __ leal(out, Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset, /* no_rip */ false));
-      codegen_->RecordTypePatch(cls);
+      codegen_->RecordBootTypePatch(cls);
       break;
     case HLoadClass::LoadKind::kBootImageAddress: {
       DCHECK_EQ(read_barrier_option, kWithoutReadBarrier);
-      DCHECK_NE(cls->GetAddress(), 0u);
-      uint32_t address = dchecked_integral_cast<uint32_t>(cls->GetAddress());
+      uint32_t address = dchecked_integral_cast<uint32_t>(
+          reinterpret_cast<uintptr_t>(cls->GetClass().Get()));
+      DCHECK_NE(address, 0u);
       __ movl(out, Immediate(address));  // Zero-extended.
       codegen_->RecordSimplePatch();
       break;
     }
+    case HLoadClass::LoadKind::kBssEntry: {
+      Address address = Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset,
+                                          /* no_rip */ false);
+      Label* fixup_label = codegen_->NewTypeBssEntryPatch(cls);
+      // /* GcRoot<mirror::Class> */ out = *address  /* PC-relative */
+      GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, read_barrier_option);
+      generate_null_check = true;
+      break;
+    }
     case HLoadClass::LoadKind::kJitTableAddress: {
       Address address = Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset,
                                           /* no_rip */ true);
       Label* fixup_label =
-          codegen_->NewJitRootClassPatch(cls->GetDexFile(), cls->GetTypeIndex(), cls->GetAddress());
+          codegen_->NewJitRootClassPatch(cls->GetDexFile(), cls->GetTypeIndex(), cls->GetClass());
       // /* GcRoot<mirror::Class> */ out = *address
       GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, kCompilerReadBarrierOption);
       break;
     }
-    case HLoadClass::LoadKind::kDexCachePcRelative: {
-      uint32_t offset = cls->GetDexCacheElementOffset();
-      Label* fixup_label = codegen_->NewPcRelativeDexCacheArrayPatch(cls->GetDexFile(), offset);
-      Address address = Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset,
-                                          /* no_rip */ false);
-      // /* GcRoot<mirror::Class> */ out = *address  /* PC-relative */
-      GenerateGcRootFieldLoad(cls, out_loc, address, fixup_label, read_barrier_option);
-      generate_null_check = !cls->IsInDexCache();
-      break;
-    }
-    case HLoadClass::LoadKind::kDexCacheViaMethod: {
-      // /* GcRoot<mirror::Class>[] */ out =
-      //        current_method.ptr_sized_fields_->dex_cache_resolved_types_
-      CpuRegister current_method = locations->InAt(0).AsRegister<CpuRegister>();
-      __ movq(out,
-              Address(current_method,
-                      ArtMethod::DexCacheResolvedTypesOffset(kX86_64PointerSize).Int32Value()));
-      // /* GcRoot<mirror::Class> */ out = out[type_index]
-      GenerateGcRootFieldLoad(
-          cls,
-          out_loc,
-          Address(out, CodeGenerator::GetCacheOffset(cls->GetTypeIndex().index_)),
-          /* fixup_label */ nullptr,
-          read_barrier_option);
-      generate_null_check = !cls->IsInDexCache();
-      break;
-    }
     default:
       LOG(FATAL) << "Unexpected load kind: " << cls->GetLoadKind();
       UNREACHABLE();
@@ -5599,11 +5606,11 @@
     case HLoadString::LoadKind::kBssEntry:
       DCHECK(!Runtime::Current()->UseJitCompilation());
       break;
-    case HLoadString::LoadKind::kDexCacheViaMethod:
-      break;
     case HLoadString::LoadKind::kJitTableAddress:
       DCHECK(Runtime::Current()->UseJitCompilation());
       break;
+    case HLoadString::LoadKind::kDexCacheViaMethod:
+      break;
   }
   return desired_string_load_kind;
 }
@@ -5649,6 +5656,7 @@
 
   switch (load->GetLoadKind()) {
     case HLoadString::LoadKind::kBootImageLinkTimePcRelative: {
+      DCHECK(codegen_->GetCompilerOptions().IsBootImage());
       __ leal(out, Address::Absolute(CodeGeneratorX86_64::kDummy32BitOffset, /* no_rip */ false));
       codegen_->RecordBootStringPatch(load);
       return;  // No dex cache slow path.
diff --git a/compiler/optimizing/code_generator_x86_64.h b/compiler/optimizing/code_generator_x86_64.h
index 32d006c..3438b81 100644
--- a/compiler/optimizing/code_generator_x86_64.h
+++ b/compiler/optimizing/code_generator_x86_64.h
@@ -409,13 +409,16 @@
 
   void RecordSimplePatch();
   void RecordBootStringPatch(HLoadString* load_string);
-  void RecordTypePatch(HLoadClass* load_class);
+  void RecordBootTypePatch(HLoadClass* load_class);
+  Label* NewTypeBssEntryPatch(HLoadClass* load_class);
   Label* NewStringBssEntryPatch(HLoadString* load_string);
   Label* NewPcRelativeDexCacheArrayPatch(const DexFile& dex_file, uint32_t element_offset);
   Label* NewJitRootStringPatch(const DexFile& dex_file,
                                dex::StringIndex dex_index,
                                Handle<mirror::String> handle);
-  Label* NewJitRootClassPatch(const DexFile& dex_file, dex::TypeIndex dex_index, uint64_t address);
+  Label* NewJitRootClassPatch(const DexFile& dex_file,
+                              dex::TypeIndex dex_index,
+                              Handle<mirror::Class> handle);
 
   void MoveFromReturnRegister(Location trg, Primitive::Type type) OVERRIDE;
 
@@ -604,8 +607,10 @@
   ArenaDeque<Label> simple_patches_;
   // String patch locations; type depends on configuration (app .bss or boot image PIC).
   ArenaDeque<PatchInfo<Label>> string_patches_;
-  // Type patch locations.
-  ArenaDeque<PatchInfo<Label>> type_patches_;
+  // Type patch locations for boot image (always PIC).
+  ArenaDeque<PatchInfo<Label>> boot_image_type_patches_;
+  // Type patch locations for kBssEntry.
+  ArenaDeque<PatchInfo<Label>> type_bss_entry_patches_;
 
   // Fixups for jump tables need to be handled specially.
   ArenaVector<JumpTableRIPFixup*> fixups_to_jump_tables_;
diff --git a/compiler/optimizing/dex_cache_array_fixups_arm.cc b/compiler/optimizing/dex_cache_array_fixups_arm.cc
index 10a36c6..cfcb276 100644
--- a/compiler/optimizing/dex_cache_array_fixups_arm.cc
+++ b/compiler/optimizing/dex_cache_array_fixups_arm.cc
@@ -59,29 +59,15 @@
   }
 
  private:
-  void VisitLoadClass(HLoadClass* load_class) OVERRIDE {
-    // If this is a load with PC-relative access to the dex cache types array,
-    // we need to add the dex cache arrays base as the special input.
-    if (load_class->GetLoadKind() == HLoadClass::LoadKind::kDexCachePcRelative) {
-      // Initialize base for target dex file if needed.
-      const DexFile& dex_file = load_class->GetDexFile();
-      HArmDexCacheArraysBase* base = GetOrCreateDexCacheArrayBase(dex_file);
-      // Update the element offset in base.
-      DexCacheArraysLayout layout(kArmPointerSize, &dex_file);
-      base->UpdateElementOffset(layout.TypeOffset(load_class->GetTypeIndex()));
-      // Add the special argument base to the load.
-      load_class->AddSpecialInput(base);
-    }
-  }
-
   void VisitInvokeStaticOrDirect(HInvokeStaticOrDirect* invoke) OVERRIDE {
     // If this is an invoke with PC-relative access to the dex cache methods array,
     // we need to add the dex cache arrays base as the special input.
     if (invoke->HasPcRelativeDexCache() &&
         !IsCallFreeIntrinsic<IntrinsicLocationsBuilderARMType>(invoke, codegen_)) {
-      HArmDexCacheArraysBase* base = GetOrCreateDexCacheArrayBase(invoke->GetDexFile());
+      HArmDexCacheArraysBase* base =
+          GetOrCreateDexCacheArrayBase(invoke, invoke->GetDexFileForPcRelativeDexCache());
       // Update the element offset in base.
-      DexCacheArraysLayout layout(kArmPointerSize, &invoke->GetDexFile());
+      DexCacheArraysLayout layout(kArmPointerSize, &invoke->GetDexFileForPcRelativeDexCache());
       base->UpdateElementOffset(layout.MethodOffset(invoke->GetDexMethodIndex()));
       // Add the special argument base to the method.
       DCHECK(!invoke->HasCurrentMethodInput());
@@ -89,21 +75,28 @@
     }
   }
 
-  HArmDexCacheArraysBase* GetOrCreateDexCacheArrayBase(const DexFile& dex_file) {
-    // Ensure we only initialize the pointer once for each dex file.
-    auto lb = dex_cache_array_bases_.lower_bound(&dex_file);
-    if (lb != dex_cache_array_bases_.end() &&
-        !dex_cache_array_bases_.key_comp()(&dex_file, lb->first)) {
-      return lb->second;
-    }
+  HArmDexCacheArraysBase* GetOrCreateDexCacheArrayBase(HInstruction* cursor,
+                                                       const DexFile& dex_file) {
+    if (GetGraph()->HasIrreducibleLoops()) {
+      HArmDexCacheArraysBase* base = new (GetGraph()->GetArena()) HArmDexCacheArraysBase(dex_file);
+      cursor->GetBlock()->InsertInstructionBefore(base, cursor);
+      return base;
+    } else {
+      // Ensure we only initialize the pointer once for each dex file.
+      auto lb = dex_cache_array_bases_.lower_bound(&dex_file);
+      if (lb != dex_cache_array_bases_.end() &&
+          !dex_cache_array_bases_.key_comp()(&dex_file, lb->first)) {
+        return lb->second;
+      }
 
-    // Insert the base at the start of the entry block, move it to a better
-    // position later in MoveBaseIfNeeded().
-    HArmDexCacheArraysBase* base = new (GetGraph()->GetArena()) HArmDexCacheArraysBase(dex_file);
-    HBasicBlock* entry_block = GetGraph()->GetEntryBlock();
-    entry_block->InsertInstructionBefore(base, entry_block->GetFirstInstruction());
-    dex_cache_array_bases_.PutBefore(lb, &dex_file, base);
-    return base;
+      // Insert the base at the start of the entry block, move it to a better
+      // position later in MoveBaseIfNeeded().
+      HArmDexCacheArraysBase* base = new (GetGraph()->GetArena()) HArmDexCacheArraysBase(dex_file);
+      HBasicBlock* entry_block = GetGraph()->GetEntryBlock();
+      entry_block->InsertInstructionBefore(base, entry_block->GetFirstInstruction());
+      dex_cache_array_bases_.PutBefore(lb, &dex_file, base);
+      return base;
+    }
   }
 
   CodeGeneratorARMType* codegen_;
@@ -114,11 +107,6 @@
 };
 
 void DexCacheArrayFixups::Run() {
-  if (graph_->HasIrreducibleLoops()) {
-    // Do not run this optimization, as irreducible loops do not work with an instruction
-    // that can be live-in at the irreducible loop header.
-    return;
-  }
   DexCacheArrayFixupsVisitor visitor(graph_, codegen_);
   visitor.VisitInsertionOrder();
   visitor.MoveBasesIfNeeded();
diff --git a/compiler/optimizing/dex_cache_array_fixups_mips.cc b/compiler/optimizing/dex_cache_array_fixups_mips.cc
index 31fff26..04a4294 100644
--- a/compiler/optimizing/dex_cache_array_fixups_mips.cc
+++ b/compiler/optimizing/dex_cache_array_fixups_mips.cc
@@ -53,30 +53,16 @@
   }
 
  private:
-  void VisitLoadClass(HLoadClass* load_class) OVERRIDE {
-    // If this is a load with PC-relative access to the dex cache types array,
-    // we need to add the dex cache arrays base as the special input.
-    if (load_class->GetLoadKind() == HLoadClass::LoadKind::kDexCachePcRelative) {
-      // Initialize base for target dex file if needed.
-      const DexFile& dex_file = load_class->GetDexFile();
-      HMipsDexCacheArraysBase* base = GetOrCreateDexCacheArrayBase(dex_file);
-      // Update the element offset in base.
-      DexCacheArraysLayout layout(kMipsPointerSize, &dex_file);
-      base->UpdateElementOffset(layout.TypeOffset(load_class->GetTypeIndex()));
-      // Add the special argument base to the load.
-      load_class->AddSpecialInput(base);
-    }
-  }
-
   void VisitInvokeStaticOrDirect(HInvokeStaticOrDirect* invoke) OVERRIDE {
     // If this is an invoke with PC-relative access to the dex cache methods array,
     // we need to add the dex cache arrays base as the special input.
     if (invoke->HasPcRelativeDexCache() &&
         !IsCallFreeIntrinsic<IntrinsicLocationsBuilderMIPS>(invoke, codegen_)) {
       // Initialize base for target method dex file if needed.
-      HMipsDexCacheArraysBase* base = GetOrCreateDexCacheArrayBase(invoke->GetDexFile());
+      HMipsDexCacheArraysBase* base =
+          GetOrCreateDexCacheArrayBase(invoke->GetDexFileForPcRelativeDexCache());
       // Update the element offset in base.
-      DexCacheArraysLayout layout(kMipsPointerSize, &invoke->GetDexFile());
+      DexCacheArraysLayout layout(kMipsPointerSize, &invoke->GetDexFileForPcRelativeDexCache());
       base->UpdateElementOffset(layout.MethodOffset(invoke->GetDexMethodIndex()));
       // Add the special argument base to the method.
       DCHECK(!invoke->HasCurrentMethodInput());
diff --git a/compiler/optimizing/graph_visualizer.cc b/compiler/optimizing/graph_visualizer.cc
index 09dcefa..f6fba88 100644
--- a/compiler/optimizing/graph_visualizer.cc
+++ b/compiler/optimizing/graph_visualizer.cc
@@ -464,6 +464,11 @@
     StartAttributeStream("intrinsic") << invoke->GetIntrinsic();
   }
 
+  void VisitInvokePolymorphic(HInvokePolymorphic* invoke) OVERRIDE {
+    VisitInvoke(invoke);
+    StartAttributeStream("invoke_type") << "InvokePolymorphic";
+  }
+
   void VisitInstanceFieldGet(HInstanceFieldGet* iget) OVERRIDE {
     StartAttributeStream("field_name") <<
         iget->GetFieldInfo().GetDexFile().PrettyField(iget->GetFieldInfo().GetFieldIndex(),
diff --git a/compiler/optimizing/gvn.cc b/compiler/optimizing/gvn.cc
index f5931a2..c93bc21 100644
--- a/compiler/optimizing/gvn.cc
+++ b/compiler/optimizing/gvn.cc
@@ -399,7 +399,7 @@
   ArenaVector<ValueSet*> sets_;
 
   // BitVector which serves as a fast-access map from block id to
-  // visited/unvisited boolean.
+  // visited/unvisited Boolean.
   ArenaBitVector visited_blocks_;
 
   DISALLOW_COPY_AND_ASSIGN(GlobalValueNumberer);
diff --git a/compiler/optimizing/induction_var_range.cc b/compiler/optimizing/induction_var_range.cc
index 6d8ae75..3973985 100644
--- a/compiler/optimizing/induction_var_range.cc
+++ b/compiler/optimizing/induction_var_range.cc
@@ -114,12 +114,7 @@
     }
   } else {
     *suitable = instruction;
-    while (instruction->IsArrayLength() ||
-           instruction->IsNullCheck() ||
-           instruction->IsNewArray()) {
-      instruction = instruction->InputAt(0);
-    }
-    return instruction == hint;
+    return HuntForDeclaration(instruction) == hint;
   }
   return false;
 }
@@ -629,7 +624,7 @@
     if (chase_hint_ == nullptr) {
       return is_min ? Value(0) : Value(std::numeric_limits<int32_t>::max());
     } else if (instruction->InputAt(0)->IsNewArray()) {
-      return GetFetch(instruction->InputAt(0)->InputAt(0), trip, in_body, is_min);
+      return GetFetch(instruction->InputAt(0)->AsNewArray()->GetLength(), trip, in_body, is_min);
     }
   } else if (instruction->IsTypeConversion()) {
     // Since analysis is 32-bit (or narrower), chase beyond widening along the path.
diff --git a/compiler/optimizing/induction_var_range_test.cc b/compiler/optimizing/induction_var_range_test.cc
index aa3e1aa..d81817f 100644
--- a/compiler/optimizing/induction_var_range_test.cc
+++ b/compiler/optimizing/induction_var_range_test.cc
@@ -697,13 +697,8 @@
 }
 
 TEST_F(InductionVarRangeTest, ArrayLengthAndHints) {
-  HInstruction* new_array = new (&allocator_)
-      HNewArray(x_,
-                graph_->GetCurrentMethod(),
-                0,
-                dex::TypeIndex(Primitive::kPrimInt),
-                graph_->GetDexFile(),
-                kQuickAllocArray);
+  // We pass a bogus constant for the class to avoid mocking one.
+  HInstruction* new_array = new (&allocator_) HNewArray(x_, x_, 0);
   entry_block_->AddInstruction(new_array);
   HInstruction* array_length = new (&allocator_) HArrayLength(new_array, 0);
   entry_block_->AddInstruction(array_length);
diff --git a/compiler/optimizing/inliner.cc b/compiler/optimizing/inliner.cc
index c970e5c..5d40f75 100644
--- a/compiler/optimizing/inliner.cc
+++ b/compiler/optimizing/inliner.cc
@@ -308,8 +308,10 @@
 }
 
 bool HInliner::TryInline(HInvoke* invoke_instruction) {
-  if (invoke_instruction->IsInvokeUnresolved()) {
-    return false;  // Don't bother to move further if we know the method is unresolved.
+  if (invoke_instruction->IsInvokeUnresolved() ||
+      invoke_instruction->IsInvokePolymorphic()) {
+    return false;  // Don't bother to move further if we know the method is unresolved or an
+                   // invoke-polymorphic.
   }
 
   ScopedObjectAccess soa(Thread::Current());
@@ -472,10 +474,10 @@
   HInstruction* receiver = invoke_instruction->InputAt(0);
   HInstruction* cursor = invoke_instruction->GetPrevious();
   HBasicBlock* bb_cursor = invoke_instruction->GetBlock();
-  Handle<mirror::Class> handle = handles_->NewHandle(GetMonomorphicType(classes));
+  Handle<mirror::Class> monomorphic_type = handles_->NewHandle(GetMonomorphicType(classes));
   if (!TryInlineAndReplace(invoke_instruction,
                            resolved_method,
-                           ReferenceTypeInfo::Create(handle, /* is_exact */ true),
+                           ReferenceTypeInfo::Create(monomorphic_type, /* is_exact */ true),
                            /* do_rtp */ false,
                            /* cha_devirtualize */ false)) {
     return false;
@@ -486,7 +488,7 @@
                cursor,
                bb_cursor,
                class_index,
-               GetMonomorphicType(classes),
+               monomorphic_type,
                invoke_instruction,
                /* with_deoptimization */ true);
 
@@ -531,11 +533,9 @@
                                      HInstruction* cursor,
                                      HBasicBlock* bb_cursor,
                                      dex::TypeIndex class_index,
-                                     mirror::Class* klass,
+                                     Handle<mirror::Class> klass,
                                      HInstruction* invoke_instruction,
                                      bool with_deoptimization) {
-  ScopedAssertNoThreadSuspension sants("Adding compiler type guard");
-
   ClassLinker* class_linker = caller_compilation_unit_.GetClassLinker();
   HInstanceFieldGet* receiver_class = BuildGetReceiverClass(
       class_linker, receiver, invoke_instruction->GetDexPc());
@@ -546,19 +546,20 @@
   }
 
   const DexFile& caller_dex_file = *caller_compilation_unit_.GetDexFile();
-  bool is_referrer = (klass == outermost_graph_->GetArtMethod()->GetDeclaringClass());
+  bool is_referrer = (klass.Get() == outermost_graph_->GetArtMethod()->GetDeclaringClass());
   // Note that we will just compare the classes, so we don't need Java semantics access checks.
   // Note that the type index and the dex file are relative to the method this type guard is
   // inlined into.
   HLoadClass* load_class = new (graph_->GetArena()) HLoadClass(graph_->GetCurrentMethod(),
                                                                class_index,
                                                                caller_dex_file,
+                                                               klass,
                                                                is_referrer,
                                                                invoke_instruction->GetDexPc(),
                                                                /* needs_access_check */ false);
   bb_cursor->InsertInstructionAfter(load_class, receiver_class);
   // Sharpen after adding the instruction, as the sharpening may remove inputs.
-  HSharpening::SharpenClass(load_class, klass, handles_, codegen_, compiler_driver_);
+  HSharpening::SharpenClass(load_class, codegen_, compiler_driver_);
 
   // TODO: Extend reference type propagation to understand the guard.
   HNotEqual* compare = new (graph_->GetArena()) HNotEqual(load_class, receiver_class);
@@ -635,7 +636,7 @@
                                            cursor,
                                            bb_cursor,
                                            class_index,
-                                           handle.Get(),
+                                           handle,
                                            invoke_instruction,
                                            deoptimize);
       if (deoptimize) {
@@ -1428,15 +1429,6 @@
         return false;
       }
 
-      if (current->IsNewArray() &&
-          (current->AsNewArray()->GetEntrypoint() == kQuickAllocArrayWithAccessCheck)) {
-        VLOG(compiler) << "Method " << callee_dex_file.PrettyMethod(method_index)
-                       << " could not be inlined because it is using an entrypoint"
-                       << " with access checks";
-        // Allocation entrypoint does not handle inlined frames.
-        return false;
-      }
-
       if (current->IsUnresolvedStaticFieldGet() ||
           current->IsUnresolvedInstanceFieldGet() ||
           current->IsUnresolvedStaticFieldSet() ||
@@ -1537,8 +1529,6 @@
     }
   }
 
-  PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
-
   // Iterate over the list of parameter types and test whether any of the
   // actual inputs has a more specific reference type than the type declared in
   // the signature.
@@ -1550,9 +1540,9 @@
        ++param_idx, ++input_idx) {
     HInstruction* input = invoke_instruction->InputAt(input_idx);
     if (input->GetType() == Primitive::kPrimNot) {
-      mirror::Class* param_cls = resolved_method->GetDexCacheResolvedType(
+      mirror::Class* param_cls = resolved_method->GetClassFromTypeIndex(
           param_list->GetTypeItem(param_idx).type_idx_,
-          pointer_size);
+          /* resolve */ false);
       if (IsReferenceTypeRefinement(GetClassRTI(param_cls),
                                     /* declared_can_be_null */ true,
                                     input)) {
@@ -1601,8 +1591,7 @@
         // TODO: we could be more precise by merging the phi inputs but that requires
         // some functionality from the reference type propagation.
         DCHECK(return_replacement->IsPhi());
-        PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
-        mirror::Class* cls = resolved_method->GetReturnType(false /* resolve */, pointer_size);
+        mirror::Class* cls = resolved_method->GetReturnType(false /* resolve */);
         return_replacement->SetReferenceTypeInfo(GetClassRTI(cls));
       }
     }
diff --git a/compiler/optimizing/inliner.h b/compiler/optimizing/inliner.h
index 4c0b990..11aacab 100644
--- a/compiler/optimizing/inliner.h
+++ b/compiler/optimizing/inliner.h
@@ -170,7 +170,7 @@
                              HInstruction* cursor,
                              HBasicBlock* bb_cursor,
                              dex::TypeIndex class_index,
-                             mirror::Class* klass,
+                             Handle<mirror::Class> klass,
                              HInstruction* invoke_instruction,
                              bool with_deoptimization)
     REQUIRES_SHARED(Locks::mutator_lock_);
diff --git a/compiler/optimizing/instruction_builder.cc b/compiler/optimizing/instruction_builder.cc
index 009d549..cac385c 100644
--- a/compiler/optimizing/instruction_builder.cc
+++ b/compiler/optimizing/instruction_builder.cc
@@ -207,10 +207,8 @@
     HEnvironment* environment = new (arena_) HEnvironment(
         arena_,
         current_locals_->size(),
-        graph_->GetDexFile(),
-        graph_->GetMethodIdx(),
+        graph_->GetArtMethod(),
         instruction->GetDexPc(),
-        graph_->GetInvokeType(),
         instruction);
     environment->CopyFrom(*current_locals_);
     instruction->SetRawEnvironment(environment);
@@ -906,50 +904,69 @@
                       false /* is_unresolved */);
 }
 
+bool HInstructionBuilder::BuildInvokePolymorphic(const Instruction& instruction ATTRIBUTE_UNUSED,
+                                                 uint32_t dex_pc,
+                                                 uint32_t method_idx,
+                                                 uint32_t proto_idx,
+                                                 uint32_t number_of_vreg_arguments,
+                                                 bool is_range,
+                                                 uint32_t* args,
+                                                 uint32_t register_index) {
+  const char* descriptor = dex_file_->GetShorty(proto_idx);
+  DCHECK_EQ(1 + ArtMethod::NumArgRegisters(descriptor), number_of_vreg_arguments);
+  Primitive::Type return_type = Primitive::GetType(descriptor[0]);
+  size_t number_of_arguments = strlen(descriptor);
+  HInvoke* invoke = new (arena_) HInvokePolymorphic(arena_,
+                                                    number_of_arguments,
+                                                    return_type,
+                                                    dex_pc,
+                                                    method_idx);
+  return HandleInvoke(invoke,
+                      number_of_vreg_arguments,
+                      args,
+                      register_index,
+                      is_range,
+                      descriptor,
+                      nullptr /* clinit_check */,
+                      false /* is_unresolved */);
+}
+
 bool HInstructionBuilder::BuildNewInstance(dex::TypeIndex type_index, uint32_t dex_pc) {
   ScopedObjectAccess soa(Thread::Current());
-  StackHandleScope<1> hs(soa.Self());
   Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
-  Handle<mirror::Class> resolved_class(hs.NewHandle(dex_cache->GetResolvedType(type_index)));
-  const DexFile& outer_dex_file = *outer_compilation_unit_->GetDexFile();
   Handle<mirror::DexCache> outer_dex_cache = outer_compilation_unit_->GetDexCache();
 
-  bool finalizable;
-  bool needs_access_check = NeedsAccessCheck(type_index, dex_cache, &finalizable);
-
-  // Only the access check entrypoint handles the finalizable class case. If we
-  // need access checks, then we haven't resolved the method and the class may
-  // again be finalizable.
-  QuickEntrypointEnum entrypoint = (finalizable || needs_access_check)
-      ? kQuickAllocObjectWithChecks
-      : kQuickAllocObjectInitialized;
-
   if (outer_dex_cache.Get() != dex_cache.Get()) {
     // We currently do not support inlining allocations across dex files.
     return false;
   }
 
-  HLoadClass* load_class = new (arena_) HLoadClass(
-      graph_->GetCurrentMethod(),
-      type_index,
-      outer_dex_file,
-      IsOutermostCompilingClass(type_index),
-      dex_pc,
-      needs_access_check);
+  HLoadClass* load_class = BuildLoadClass(type_index, dex_pc, /* check_access */ true);
 
-  AppendInstruction(load_class);
   HInstruction* cls = load_class;
-  if (!IsInitialized(resolved_class)) {
+  Handle<mirror::Class> klass = load_class->GetClass();
+
+  if (!IsInitialized(klass)) {
     cls = new (arena_) HClinitCheck(load_class, dex_pc);
     AppendInstruction(cls);
   }
 
+  // Only the access check entrypoint handles the finalizable class case. If we
+  // need access checks, then we haven't resolved the method and the class may
+  // again be finalizable.
+  QuickEntrypointEnum entrypoint = kQuickAllocObjectInitialized;
+  if (load_class->NeedsAccessCheck() || klass->IsFinalizable() || !klass->IsInstantiable()) {
+    entrypoint = kQuickAllocObjectWithChecks;
+  }
+
+  // Consider classes we haven't resolved as potentially finalizable.
+  bool finalizable = (klass.Get() == nullptr) || klass->IsFinalizable();
+
   AppendInstruction(new (arena_) HNewInstance(
       cls,
       dex_pc,
       type_index,
       *dex_compilation_unit_->GetDexFile(),
-      needs_access_check,
       finalizable,
       entrypoint));
   return true;
@@ -990,7 +1007,6 @@
       ArtMethod* resolved_method,
       uint32_t method_idx,
       HInvokeStaticOrDirect::ClinitCheckRequirement* clinit_check_requirement) {
-  const DexFile& outer_dex_file = *outer_compilation_unit_->GetDexFile();
   Thread* self = Thread::Current();
   StackHandleScope<2> hs(self);
   Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
@@ -1018,15 +1034,9 @@
     *clinit_check_requirement = HInvokeStaticOrDirect::ClinitCheckRequirement::kNone;
   } else if (storage_index.IsValid()) {
     *clinit_check_requirement = HInvokeStaticOrDirect::ClinitCheckRequirement::kExplicit;
-    HLoadClass* load_class = new (arena_) HLoadClass(
-        graph_->GetCurrentMethod(),
-        storage_index,
-        outer_dex_file,
-        is_outer_class,
-        dex_pc,
-        /*needs_access_check*/ false);
-    AppendInstruction(load_class);
-    clinit_check = new (arena_) HClinitCheck(load_class, dex_pc);
+    HLoadClass* cls = BuildLoadClass(
+        storage_index, dex_pc, /* check_access */ false, /* outer */ true);
+    clinit_check = new (arena_) HClinitCheck(cls, dex_pc);
     AppendInstruction(clinit_check);
   }
   return clinit_check;
@@ -1348,7 +1358,6 @@
   }
 
   Primitive::Type field_type = resolved_field->GetTypeAsPrimitiveType();
-  const DexFile& outer_dex_file = *outer_compilation_unit_->GetDexFile();
   Handle<mirror::DexCache> outer_dex_cache = outer_compilation_unit_->GetDexCache();
   Handle<mirror::Class> outer_class(hs.NewHandle(GetOutermostCompilingClass()));
 
@@ -1376,16 +1385,10 @@
     }
   }
 
-  HLoadClass* constant = new (arena_) HLoadClass(graph_->GetCurrentMethod(),
-                                                 storage_index,
-                                                 outer_dex_file,
-                                                 is_outer_class,
-                                                 dex_pc,
-                                                 /*needs_access_check*/ false);
-  AppendInstruction(constant);
+  HLoadClass* constant = BuildLoadClass(
+      storage_index, dex_pc, /* check_access */ false, /* outer */ true);
 
   HInstruction* cls = constant;
-
   Handle<mirror::Class> klass(hs.NewHandle(resolved_field->GetDeclaringClass()));
   if (!IsInitialized(klass)) {
     cls = new (arena_) HClinitCheck(constant, dex_pc);
@@ -1494,16 +1497,8 @@
                                               uint32_t* args,
                                               uint32_t register_index) {
   HInstruction* length = graph_->GetIntConstant(number_of_vreg_arguments, dex_pc);
-  bool finalizable;
-  QuickEntrypointEnum entrypoint = NeedsAccessCheck(type_index, &finalizable)
-      ? kQuickAllocArrayWithAccessCheck
-      : kQuickAllocArray;
-  HInstruction* object = new (arena_) HNewArray(length,
-                                                graph_->GetCurrentMethod(),
-                                                dex_pc,
-                                                type_index,
-                                                *dex_compilation_unit_->GetDexFile(),
-                                                entrypoint);
+  HLoadClass* cls = BuildLoadClass(type_index, dex_pc, /* check_access */ true);
+  HInstruction* object = new (arena_) HNewArray(cls, length, dex_pc);
   AppendInstruction(object);
 
   const char* descriptor = dex_file_->StringByTypeIdx(type_index);
@@ -1632,33 +1627,57 @@
   }
 }
 
+HLoadClass* HInstructionBuilder::BuildLoadClass(dex::TypeIndex type_index,
+                                                uint32_t dex_pc,
+                                                bool check_access,
+                                                bool outer) {
+  ScopedObjectAccess soa(Thread::Current());
+  const DexCompilationUnit* compilation_unit =
+      outer ? outer_compilation_unit_ : dex_compilation_unit_;
+  const DexFile& dex_file = *compilation_unit->GetDexFile();
+  StackHandleScope<1> hs(soa.Self());
+  Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+      soa.Decode<mirror::ClassLoader>(dex_compilation_unit_->GetClassLoader())));
+  Handle<mirror::Class> klass = handles_->NewHandle(compiler_driver_->ResolveClass(
+      soa, compilation_unit->GetDexCache(), class_loader, type_index, compilation_unit));
+
+  bool is_accessible = false;
+  if (!check_access) {
+    is_accessible = true;
+  } else if (klass.Get() != nullptr) {
+    if (klass->IsPublic()) {
+      is_accessible = true;
+    } else {
+      mirror::Class* compiling_class = GetCompilingClass();
+      if (compiling_class != nullptr && compiling_class->CanAccess(klass.Get())) {
+        is_accessible = true;
+      }
+    }
+  }
+
+  HLoadClass* load_class = new (arena_) HLoadClass(
+      graph_->GetCurrentMethod(),
+      type_index,
+      dex_file,
+      klass,
+      klass.Get() != nullptr && (klass.Get() == GetOutermostCompilingClass()),
+      dex_pc,
+      !is_accessible);
+
+  AppendInstruction(load_class);
+  return load_class;
+}
+
 void HInstructionBuilder::BuildTypeCheck(const Instruction& instruction,
                                          uint8_t destination,
                                          uint8_t reference,
                                          dex::TypeIndex type_index,
                                          uint32_t dex_pc) {
-  ScopedObjectAccess soa(Thread::Current());
-  StackHandleScope<1> hs(soa.Self());
-  const DexFile& dex_file = *dex_compilation_unit_->GetDexFile();
-  Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
-  Handle<mirror::Class> resolved_class(hs.NewHandle(dex_cache->GetResolvedType(type_index)));
-
-  bool can_access = compiler_driver_->CanAccessTypeWithoutChecks(
-      dex_compilation_unit_->GetDexMethodIndex(),
-      dex_cache,
-      type_index);
-
   HInstruction* object = LoadLocal(reference, Primitive::kPrimNot);
-  HLoadClass* cls = new (arena_) HLoadClass(
-      graph_->GetCurrentMethod(),
-      type_index,
-      dex_file,
-      IsOutermostCompilingClass(type_index),
-      dex_pc,
-      !can_access);
-  AppendInstruction(cls);
+  HLoadClass* cls = BuildLoadClass(type_index, dex_pc, /* check_access */ true);
 
-  TypeCheckKind check_kind = ComputeTypeCheckKind(resolved_class);
+  ScopedObjectAccess soa(Thread::Current());
+  TypeCheckKind check_kind = ComputeTypeCheckKind(cls->GetClass());
   if (instruction.Opcode() == Instruction::INSTANCE_OF) {
     AppendInstruction(new (arena_) HInstanceOf(object, cls, check_kind, dex_pc));
     UpdateLocal(destination, current_block_->GetLastInstruction());
@@ -1915,6 +1934,37 @@
       break;
     }
 
+    case Instruction::INVOKE_POLYMORPHIC: {
+      uint16_t method_idx = instruction.VRegB_45cc();
+      uint16_t proto_idx = instruction.VRegH_45cc();
+      uint32_t number_of_vreg_arguments = instruction.VRegA_45cc();
+      uint32_t args[5];
+      instruction.GetVarArgs(args);
+      return BuildInvokePolymorphic(instruction,
+                                    dex_pc,
+                                    method_idx,
+                                    proto_idx,
+                                    number_of_vreg_arguments,
+                                    false,
+                                    args,
+                                    -1);
+    }
+
+    case Instruction::INVOKE_POLYMORPHIC_RANGE: {
+      uint16_t method_idx = instruction.VRegB_4rcc();
+      uint16_t proto_idx = instruction.VRegH_4rcc();
+      uint32_t number_of_vreg_arguments = instruction.VRegA_4rcc();
+      uint32_t register_index = instruction.VRegC_4rcc();
+      return BuildInvokePolymorphic(instruction,
+                                    dex_pc,
+                                    method_idx,
+                                    proto_idx,
+                                    number_of_vreg_arguments,
+                                    true,
+                                    nullptr,
+                                    register_index);
+    }
+
     case Instruction::NEG_INT: {
       Unop_12x<HNeg>(instruction, Primitive::kPrimInt, dex_pc);
       break;
@@ -2448,16 +2498,8 @@
     case Instruction::NEW_ARRAY: {
       dex::TypeIndex type_index(instruction.VRegC_22c());
       HInstruction* length = LoadLocal(instruction.VRegB_22c(), Primitive::kPrimInt);
-      bool finalizable;
-      QuickEntrypointEnum entrypoint = NeedsAccessCheck(type_index, &finalizable)
-          ? kQuickAllocArrayWithAccessCheck
-          : kQuickAllocArray;
-      AppendInstruction(new (arena_) HNewArray(length,
-                                               graph_->GetCurrentMethod(),
-                                               dex_pc,
-                                               type_index,
-                                               *dex_compilation_unit_->GetDexFile(),
-                                               entrypoint));
+      HLoadClass* cls = BuildLoadClass(type_index, dex_pc, /* check_access */ true);
+      AppendInstruction(new (arena_) HNewArray(cls, length, dex_pc));
       UpdateLocal(instruction.VRegA_22c(), current_block_->GetLastInstruction());
       break;
     }
@@ -2631,21 +2673,7 @@
 
     case Instruction::CONST_CLASS: {
       dex::TypeIndex type_index(instruction.VRegB_21c());
-      // `CanAccessTypeWithoutChecks` will tell whether the method being
-      // built is trying to access its own class, so that the generated
-      // code can optimize for this case. However, the optimization does not
-      // work for inlining, so we use `IsOutermostCompilingClass` instead.
-      ScopedObjectAccess soa(Thread::Current());
-      Handle<mirror::DexCache> dex_cache = dex_compilation_unit_->GetDexCache();
-      bool can_access = compiler_driver_->CanAccessTypeWithoutChecks(
-          dex_compilation_unit_->GetDexMethodIndex(), dex_cache, type_index);
-      AppendInstruction(new (arena_) HLoadClass(
-          graph_->GetCurrentMethod(),
-          type_index,
-          *dex_file_,
-          IsOutermostCompilingClass(type_index),
-          dex_pc,
-          !can_access));
+      BuildLoadClass(type_index, dex_pc, /* check_access */ true);
       UpdateLocal(instruction.VRegA_21c(), current_block_->GetLastInstruction());
       break;
     }
diff --git a/compiler/optimizing/instruction_builder.h b/compiler/optimizing/instruction_builder.h
index f29e522..5efe950 100644
--- a/compiler/optimizing/instruction_builder.h
+++ b/compiler/optimizing/instruction_builder.h
@@ -46,9 +46,11 @@
                       CompilerDriver* driver,
                       const uint8_t* interpreter_metadata,
                       OptimizingCompilerStats* compiler_stats,
-                      Handle<mirror::DexCache> dex_cache)
+                      Handle<mirror::DexCache> dex_cache,
+                      VariableSizedHandleScope* handles)
       : arena_(graph->GetArena()),
         graph_(graph),
+        handles_(handles),
         dex_file_(dex_file),
         code_item_(code_item),
         return_type_(return_type),
@@ -175,6 +177,17 @@
                    uint32_t* args,
                    uint32_t register_index);
 
+  // Builds an invocation node for invoke-polymorphic and returns whether the
+  // instruction is supported.
+  bool BuildInvokePolymorphic(const Instruction& instruction,
+                              uint32_t dex_pc,
+                              uint32_t method_idx,
+                              uint32_t proto_idx,
+                              uint32_t number_of_vreg_arguments,
+                              bool is_range,
+                              uint32_t* args,
+                              uint32_t register_index);
+
   // Builds a new array node and the instructions that fill it.
   void BuildFilledNewArray(uint32_t dex_pc,
                            dex::TypeIndex type_index,
@@ -212,6 +225,14 @@
   // Builds an instruction sequence for a switch statement.
   void BuildSwitch(const Instruction& instruction, uint32_t dex_pc);
 
+  // Builds a `HLoadClass` loading the given `type_index`. If `outer` is true,
+  // this method will use the outer class's dex file to lookup the type at
+  // `type_index`.
+  HLoadClass* BuildLoadClass(dex::TypeIndex type_index,
+                             uint32_t dex_pc,
+                             bool check_access,
+                             bool outer = false);
+
   // Returns the outer-most compiling method's class.
   mirror::Class* GetOutermostCompilingClass() const;
 
@@ -271,6 +292,7 @@
 
   ArenaAllocator* const arena_;
   HGraph* const graph_;
+  VariableSizedHandleScope* handles_;
 
   // The dex file where the method being compiled is, and the bytecode data.
   const DexFile* const dex_file_;
diff --git a/compiler/optimizing/instruction_simplifier.cc b/compiler/optimizing/instruction_simplifier.cc
index 911bfb9..35f59cb 100644
--- a/compiler/optimizing/instruction_simplifier.cc
+++ b/compiler/optimizing/instruction_simplifier.cc
@@ -777,7 +777,7 @@
   // If the array is a NewArray with constant size, replace the array length
   // with the constant instruction. This helps the bounds check elimination phase.
   if (input->IsNewArray()) {
-    input = input->InputAt(0);
+    input = input->AsNewArray()->GetLength();
     if (input->IsIntConstant()) {
       instruction->ReplaceWith(input);
     }
@@ -1774,7 +1774,7 @@
   }
 
   if (potential_array->IsNewArray()) {
-    return potential_array->InputAt(0) == potential_length;
+    return potential_array->AsNewArray()->GetLength() == potential_length;
   }
 
   return false;
diff --git a/compiler/optimizing/intrinsics.cc b/compiler/optimizing/intrinsics.cc
index fc6ff7b..17d683f 100644
--- a/compiler/optimizing/intrinsics.cc
+++ b/compiler/optimizing/intrinsics.cc
@@ -145,7 +145,7 @@
           if (!CheckInvokeType(intrinsic, invoke)) {
             LOG(WARNING) << "Found an intrinsic with unexpected invoke type: "
                 << intrinsic << " for "
-                << invoke->GetDexFile().PrettyMethod(invoke->GetDexMethodIndex())
+                << art_method->PrettyMethod()
                 << invoke->DebugName();
           } else {
             invoke->SetIntrinsic(intrinsic,
diff --git a/compiler/optimizing/intrinsics_arm.cc b/compiler/optimizing/intrinsics_arm.cc
index 8f64fae..c262cf9 100644
--- a/compiler/optimizing/intrinsics_arm.cc
+++ b/compiler/optimizing/intrinsics_arm.cc
@@ -2592,6 +2592,58 @@
   __ Lsr(out, out, 5);
 }
 
+void IntrinsicLocationsBuilderARM::VisitReferenceGetReferent(HInvoke* invoke) {
+  if (kEmitCompilerReadBarrier) {
+    // Do not intrinsify this call with the read barrier configuration.
+    return;
+  }
+  LocationSummary* locations = new (arena_) LocationSummary(invoke,
+                                                            LocationSummary::kCallOnSlowPath,
+                                                            kIntrinsified);
+  locations->SetInAt(0, Location::RequiresRegister());
+  locations->SetOut(Location::SameAsFirstInput());
+  locations->AddTemp(Location::RequiresRegister());
+}
+
+void IntrinsicCodeGeneratorARM::VisitReferenceGetReferent(HInvoke* invoke) {
+  DCHECK(!kEmitCompilerReadBarrier);
+  ArmAssembler* const assembler = GetAssembler();
+  LocationSummary* locations = invoke->GetLocations();
+
+  Register obj = locations->InAt(0).AsRegister<Register>();
+  Register out = locations->Out().AsRegister<Register>();
+
+  SlowPathCode* slow_path = new (GetAllocator()) IntrinsicSlowPathARM(invoke);
+  codegen_->AddSlowPath(slow_path);
+
+  // Load ArtMethod first.
+  HInvokeStaticOrDirect* invoke_direct = invoke->AsInvokeStaticOrDirect();
+  DCHECK(invoke_direct != nullptr);
+  Register temp = codegen_->GenerateCalleeMethodStaticOrDirectCall(
+      invoke_direct, locations->GetTemp(0)).AsRegister<Register>();
+
+  // Now get declaring class.
+  __ ldr(temp, Address(temp, ArtMethod::DeclaringClassOffset().Int32Value()));
+
+  uint32_t slow_path_flag_offset = codegen_->GetReferenceSlowFlagOffset();
+  uint32_t disable_flag_offset = codegen_->GetReferenceDisableFlagOffset();
+  DCHECK_NE(slow_path_flag_offset, 0u);
+  DCHECK_NE(disable_flag_offset, 0u);
+  DCHECK_NE(slow_path_flag_offset, disable_flag_offset);
+
+  // Check static flags that prevent using intrinsic.
+  __ ldr(IP, Address(temp, disable_flag_offset));
+  __ ldr(temp, Address(temp, slow_path_flag_offset));
+  __ orr(IP, IP, ShifterOperand(temp));
+  __ CompareAndBranchIfNonZero(IP, slow_path->GetEntryLabel());
+
+  // Fast path.
+  __ ldr(out, Address(obj, mirror::Reference::ReferentOffset().Int32Value()));
+  codegen_->MaybeRecordImplicitNullCheck(invoke);
+  __ MaybeUnpoisonHeapReference(out);
+  __ Bind(slow_path->GetExitLabel());
+}
+
 UNIMPLEMENTED_INTRINSIC(ARM, MathMinDoubleDouble)
 UNIMPLEMENTED_INTRINSIC(ARM, MathMinFloatFloat)
 UNIMPLEMENTED_INTRINSIC(ARM, MathMaxDoubleDouble)
@@ -2605,7 +2657,6 @@
 UNIMPLEMENTED_INTRINSIC(ARM, MathRoundFloat)    // Could be done by changing rounding mode, maybe?
 UNIMPLEMENTED_INTRINSIC(ARM, UnsafeCASLong)     // High register pressure.
 UNIMPLEMENTED_INTRINSIC(ARM, SystemArrayCopyChar)
-UNIMPLEMENTED_INTRINSIC(ARM, ReferenceGetReferent)
 UNIMPLEMENTED_INTRINSIC(ARM, IntegerHighestOneBit)
 UNIMPLEMENTED_INTRINSIC(ARM, LongHighestOneBit)
 UNIMPLEMENTED_INTRINSIC(ARM, IntegerLowestOneBit)
diff --git a/compiler/optimizing/intrinsics_arm64.cc b/compiler/optimizing/intrinsics_arm64.cc
index d8a896e..bbf826c 100644
--- a/compiler/optimizing/intrinsics_arm64.cc
+++ b/compiler/optimizing/intrinsics_arm64.cc
@@ -2773,7 +2773,65 @@
   GenIsInfinite(invoke->GetLocations(), /* is64bit */ true, GetVIXLAssembler());
 }
 
-UNIMPLEMENTED_INTRINSIC(ARM64, ReferenceGetReferent)
+void IntrinsicLocationsBuilderARM64::VisitReferenceGetReferent(HInvoke* invoke) {
+  if (kEmitCompilerReadBarrier) {
+    // Do not intrinsify this call with the read barrier configuration.
+    return;
+  }
+  LocationSummary* locations = new (arena_) LocationSummary(invoke,
+                                                            LocationSummary::kCallOnSlowPath,
+                                                            kIntrinsified);
+  locations->SetInAt(0, Location::RequiresRegister());
+  locations->SetOut(Location::SameAsFirstInput());
+  locations->AddTemp(Location::RequiresRegister());
+}
+
+void IntrinsicCodeGeneratorARM64::VisitReferenceGetReferent(HInvoke* invoke) {
+  DCHECK(!kEmitCompilerReadBarrier);
+  MacroAssembler* masm = GetVIXLAssembler();
+  LocationSummary* locations = invoke->GetLocations();
+
+  Register obj = InputRegisterAt(invoke, 0);
+  Register out = OutputRegister(invoke);
+
+  SlowPathCodeARM64* slow_path = new (GetAllocator()) IntrinsicSlowPathARM64(invoke);
+  codegen_->AddSlowPath(slow_path);
+
+  // Load ArtMethod first.
+  HInvokeStaticOrDirect* invoke_direct = invoke->AsInvokeStaticOrDirect();
+  DCHECK(invoke_direct != nullptr);
+  Register temp0 = XRegisterFrom(codegen_->GenerateCalleeMethodStaticOrDirectCall(
+                                 invoke_direct, locations->GetTemp(0)));
+
+  // Now get declaring class.
+  __ Ldr(temp0.W(), MemOperand(temp0, ArtMethod::DeclaringClassOffset().Int32Value()));
+
+  uint32_t slow_path_flag_offset = codegen_->GetReferenceSlowFlagOffset();
+  uint32_t disable_flag_offset = codegen_->GetReferenceDisableFlagOffset();
+  DCHECK_NE(slow_path_flag_offset, 0u);
+  DCHECK_NE(disable_flag_offset, 0u);
+  DCHECK_NE(slow_path_flag_offset, disable_flag_offset);
+
+  // Check static flags that prevent using intrinsic.
+  if (slow_path_flag_offset == disable_flag_offset + 1) {
+    // Load two adjacent flags in one 64-bit load.
+    __ Ldr(temp0, MemOperand(temp0, disable_flag_offset));
+  } else {
+    UseScratchRegisterScope temps(masm);
+    Register temp1 = temps.AcquireW();
+    __ Ldr(temp1.W(), MemOperand(temp0, disable_flag_offset));
+    __ Ldr(temp0.W(), MemOperand(temp0, slow_path_flag_offset));
+    __ Orr(temp0, temp1, temp0);
+  }
+  __ Cbnz(temp0, slow_path->GetEntryLabel());
+
+  // Fast path.
+  __ Ldr(out, HeapOperand(obj, mirror::Reference::ReferentOffset().Int32Value()));
+  codegen_->MaybeRecordImplicitNullCheck(invoke);
+  codegen_->GetAssembler()->MaybeUnpoisonHeapReference(out);
+  __ Bind(slow_path->GetExitLabel());
+}
+
 UNIMPLEMENTED_INTRINSIC(ARM64, IntegerHighestOneBit)
 UNIMPLEMENTED_INTRINSIC(ARM64, LongHighestOneBit)
 UNIMPLEMENTED_INTRINSIC(ARM64, IntegerLowestOneBit)
diff --git a/compiler/optimizing/intrinsics_arm_vixl.cc b/compiler/optimizing/intrinsics_arm_vixl.cc
index 85e84d8..68c2d2e 100644
--- a/compiler/optimizing/intrinsics_arm_vixl.cc
+++ b/compiler/optimizing/intrinsics_arm_vixl.cc
@@ -2688,6 +2688,60 @@
   __ Lsr(out, out, 5);
 }
 
+void IntrinsicLocationsBuilderARMVIXL::VisitReferenceGetReferent(HInvoke* invoke) {
+  if (kEmitCompilerReadBarrier) {
+    // Do not intrinsify this call with the read barrier configuration.
+    return;
+  }
+  LocationSummary* locations = new (arena_) LocationSummary(invoke,
+                                                            LocationSummary::kCallOnSlowPath,
+                                                            kIntrinsified);
+  locations->SetInAt(0, Location::RequiresRegister());
+  locations->SetOut(Location::SameAsFirstInput());
+  locations->AddTemp(Location::RequiresRegister());
+}
+
+void IntrinsicCodeGeneratorARMVIXL::VisitReferenceGetReferent(HInvoke* invoke) {
+  DCHECK(!kEmitCompilerReadBarrier);
+  ArmVIXLAssembler* assembler = GetAssembler();
+  LocationSummary* locations = invoke->GetLocations();
+
+  vixl32::Register obj = InputRegisterAt(invoke, 0);
+  vixl32::Register out = OutputRegister(invoke);
+
+  SlowPathCodeARMVIXL* slow_path = new (GetAllocator()) IntrinsicSlowPathARMVIXL(invoke);
+  codegen_->AddSlowPath(slow_path);
+
+  // Load ArtMethod first.
+  HInvokeStaticOrDirect* invoke_direct = invoke->AsInvokeStaticOrDirect();
+  DCHECK(invoke_direct != nullptr);
+  vixl32::Register temp0 = RegisterFrom(codegen_->GenerateCalleeMethodStaticOrDirectCall(
+      invoke_direct, locations->GetTemp(0)));
+
+  // Now get declaring class.
+  __ Ldr(temp0, MemOperand(temp0, ArtMethod::DeclaringClassOffset().Int32Value()));
+
+  uint32_t slow_path_flag_offset = codegen_->GetReferenceSlowFlagOffset();
+  uint32_t disable_flag_offset = codegen_->GetReferenceDisableFlagOffset();
+  DCHECK_NE(slow_path_flag_offset, 0u);
+  DCHECK_NE(disable_flag_offset, 0u);
+  DCHECK_NE(slow_path_flag_offset, disable_flag_offset);
+
+  // Check static flags that prevent using intrinsic.
+  UseScratchRegisterScope temps(assembler->GetVIXLAssembler());
+  vixl32::Register temp1 = temps.Acquire();
+  __ Ldr(temp1, MemOperand(temp0, disable_flag_offset));
+  __ Ldr(temp0, MemOperand(temp0, slow_path_flag_offset));
+  __ Orr(temp0, temp1, temp0);
+  __ CompareAndBranchIfNonZero(temp0, slow_path->GetEntryLabel());
+
+  // Fast path.
+  __ Ldr(out, MemOperand(obj, mirror::Reference::ReferentOffset().Int32Value()));
+  codegen_->MaybeRecordImplicitNullCheck(invoke);
+  assembler->MaybeUnpoisonHeapReference(out);
+  __ Bind(slow_path->GetExitLabel());
+}
+
 UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathMinDoubleDouble)
 UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathMinFloatFloat)
 UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathMaxDoubleDouble)
@@ -2701,7 +2755,6 @@
 UNIMPLEMENTED_INTRINSIC(ARMVIXL, MathRoundFloat)    // Could be done by changing rounding mode, maybe?
 UNIMPLEMENTED_INTRINSIC(ARMVIXL, UnsafeCASLong)     // High register pressure.
 UNIMPLEMENTED_INTRINSIC(ARMVIXL, SystemArrayCopyChar)
-UNIMPLEMENTED_INTRINSIC(ARMVIXL, ReferenceGetReferent)
 UNIMPLEMENTED_INTRINSIC(ARMVIXL, IntegerHighestOneBit)
 UNIMPLEMENTED_INTRINSIC(ARMVIXL, LongHighestOneBit)
 UNIMPLEMENTED_INTRINSIC(ARMVIXL, IntegerLowestOneBit)
diff --git a/compiler/optimizing/intrinsics_mips.cc b/compiler/optimizing/intrinsics_mips.cc
index f1ae549..6cf9b83 100644
--- a/compiler/optimizing/intrinsics_mips.cc
+++ b/compiler/optimizing/intrinsics_mips.cc
@@ -1878,7 +1878,7 @@
                         // If we use 'value' directly, we would lose 'value'
                         // in the case that the store fails.  Whether the
                         // store succeeds, or fails, it will load the
-                        // correct boolean value into the 'out' register.
+                        // correct Boolean value into the 'out' register.
   // This test isn't really necessary. We only support Primitive::kPrimInt,
   // Primitive::kPrimNot, and we already verified that we're working on one
   // of those two types. It's left here in case the code needs to support
diff --git a/compiler/optimizing/intrinsics_mips64.cc b/compiler/optimizing/intrinsics_mips64.cc
index 3022e97..00a1fa1 100644
--- a/compiler/optimizing/intrinsics_mips64.cc
+++ b/compiler/optimizing/intrinsics_mips64.cc
@@ -1477,7 +1477,7 @@
                         // If we use 'value' directly, we would lose 'value'
                         // in the case that the store fails.  Whether the
                         // store succeeds, or fails, it will load the
-                        // correct boolean value into the 'out' register.
+                        // correct Boolean value into the 'out' register.
   if (type == Primitive::kPrimLong) {
     __ Scd(out, TMP);
   } else {
diff --git a/compiler/optimizing/intrinsics_x86.cc b/compiler/optimizing/intrinsics_x86.cc
index 922c3bc..e1b7ea5 100644
--- a/compiler/optimizing/intrinsics_x86.cc
+++ b/compiler/optimizing/intrinsics_x86.cc
@@ -356,23 +356,28 @@
   }
 }
 
-static void MathAbsFP(LocationSummary* locations,
+static void MathAbsFP(HInvoke* invoke,
                       bool is64bit,
                       X86Assembler* assembler,
                       CodeGeneratorX86* codegen) {
+  LocationSummary* locations = invoke->GetLocations();
   Location output = locations->Out();
 
   DCHECK(output.IsFpuRegister());
   if (locations->GetInputCount() == 2 && locations->InAt(1).IsValid()) {
+    HX86ComputeBaseMethodAddress* method_address =
+        invoke->InputAt(1)->AsX86ComputeBaseMethodAddress();
     DCHECK(locations->InAt(1).IsRegister());
     // We also have a constant area pointer.
     Register constant_area = locations->InAt(1).AsRegister<Register>();
     XmmRegister temp = locations->GetTemp(0).AsFpuRegister<XmmRegister>();
     if (is64bit) {
-      __ movsd(temp, codegen->LiteralInt64Address(INT64_C(0x7FFFFFFFFFFFFFFF), constant_area));
+      __ movsd(temp, codegen->LiteralInt64Address(
+          INT64_C(0x7FFFFFFFFFFFFFFF), method_address, constant_area));
       __ andpd(output.AsFpuRegister<XmmRegister>(), temp);
     } else {
-      __ movss(temp, codegen->LiteralInt32Address(INT32_C(0x7FFFFFFF), constant_area));
+      __ movss(temp, codegen->LiteralInt32Address(
+          INT32_C(0x7FFFFFFF), method_address, constant_area));
       __ andps(output.AsFpuRegister<XmmRegister>(), temp);
     }
   } else {
@@ -396,7 +401,7 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitMathAbsDouble(HInvoke* invoke) {
-  MathAbsFP(invoke->GetLocations(), /* is64bit */ true, GetAssembler(), codegen_);
+  MathAbsFP(invoke, /* is64bit */ true, GetAssembler(), codegen_);
 }
 
 void IntrinsicLocationsBuilderX86::VisitMathAbsFloat(HInvoke* invoke) {
@@ -404,7 +409,7 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitMathAbsFloat(HInvoke* invoke) {
-  MathAbsFP(invoke->GetLocations(), /* is64bit */ false, GetAssembler(), codegen_);
+  MathAbsFP(invoke, /* is64bit */ false, GetAssembler(), codegen_);
 }
 
 static void CreateAbsIntLocation(ArenaAllocator* arena, HInvoke* invoke) {
@@ -486,11 +491,12 @@
   GenAbsLong(invoke->GetLocations(), GetAssembler());
 }
 
-static void GenMinMaxFP(LocationSummary* locations,
+static void GenMinMaxFP(HInvoke* invoke,
                         bool is_min,
                         bool is_double,
                         X86Assembler* assembler,
                         CodeGeneratorX86* codegen) {
+  LocationSummary* locations = invoke->GetLocations();
   Location op1_loc = locations->InAt(0);
   Location op2_loc = locations->InAt(1);
   Location out_loc = locations->Out();
@@ -553,12 +559,14 @@
   __ Bind(&nan);
   // Do we have a constant area pointer?
   if (locations->GetInputCount() == 3 && locations->InAt(2).IsValid()) {
+    HX86ComputeBaseMethodAddress* method_address =
+        invoke->InputAt(2)->AsX86ComputeBaseMethodAddress();
     DCHECK(locations->InAt(2).IsRegister());
     Register constant_area = locations->InAt(2).AsRegister<Register>();
     if (is_double) {
-      __ movsd(out, codegen->LiteralInt64Address(kDoubleNaN, constant_area));
+      __ movsd(out, codegen->LiteralInt64Address(kDoubleNaN, method_address, constant_area));
     } else {
-      __ movss(out, codegen->LiteralInt32Address(kFloatNaN, constant_area));
+      __ movss(out, codegen->LiteralInt32Address(kFloatNaN, method_address, constant_area));
     }
   } else {
     if (is_double) {
@@ -608,7 +616,7 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitMathMinDoubleDouble(HInvoke* invoke) {
-  GenMinMaxFP(invoke->GetLocations(),
+  GenMinMaxFP(invoke,
               /* is_min */ true,
               /* is_double */ true,
               GetAssembler(),
@@ -620,7 +628,7 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitMathMinFloatFloat(HInvoke* invoke) {
-  GenMinMaxFP(invoke->GetLocations(),
+  GenMinMaxFP(invoke,
               /* is_min */ true,
               /* is_double */ false,
               GetAssembler(),
@@ -632,7 +640,7 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitMathMaxDoubleDouble(HInvoke* invoke) {
-  GenMinMaxFP(invoke->GetLocations(),
+  GenMinMaxFP(invoke,
               /* is_min */ false,
               /* is_double */ true,
               GetAssembler(),
@@ -644,7 +652,7 @@
 }
 
 void IntrinsicCodeGeneratorX86::VisitMathMaxFloatFloat(HInvoke* invoke) {
-  GenMinMaxFP(invoke->GetLocations(),
+  GenMinMaxFP(invoke,
               /* is_min */ false,
               /* is_double */ false,
               GetAssembler(),
@@ -905,10 +913,16 @@
   __ subss(t2, t1);
   if (locations->GetInputCount() == 2 && locations->InAt(1).IsValid()) {
     // Direct constant area available.
+    HX86ComputeBaseMethodAddress* method_address =
+        invoke->InputAt(1)->AsX86ComputeBaseMethodAddress();
     Register constant_area = locations->InAt(1).AsRegister<Register>();
-    __ comiss(t2, codegen_->LiteralInt32Address(bit_cast<int32_t, float>(0.5f), constant_area));
+    __ comiss(t2, codegen_->LiteralInt32Address(bit_cast<int32_t, float>(0.5f),
+                                                method_address,
+                                                constant_area));
     __ j(kBelow, &skip_incr);
-    __ addss(t1, codegen_->LiteralInt32Address(bit_cast<int32_t, float>(1.0f), constant_area));
+    __ addss(t1, codegen_->LiteralInt32Address(bit_cast<int32_t, float>(1.0f),
+                                               method_address,
+                                               constant_area));
     __ Bind(&skip_incr);
   } else {
     // No constant area: go through stack.
diff --git a/compiler/optimizing/load_store_elimination.cc b/compiler/optimizing/load_store_elimination.cc
index 2856c3e..2d3c00f 100644
--- a/compiler/optimizing/load_store_elimination.cc
+++ b/compiler/optimizing/load_store_elimination.cc
@@ -943,6 +943,10 @@
     HandleInvoke(invoke);
   }
 
+  void VisitInvokePolymorphic(HInvokePolymorphic* invoke) OVERRIDE {
+    HandleInvoke(invoke);
+  }
+
   void VisitClinitCheck(HClinitCheck* clinit) OVERRIDE {
     HandleInvoke(clinit);
   }
@@ -975,7 +979,7 @@
     }
     if (ref_info->IsSingletonAndRemovable() &&
         !new_instance->IsFinalizable() &&
-        !new_instance->NeedsAccessCheck()) {
+        !new_instance->NeedsChecks()) {
       singleton_new_instances_.push_back(new_instance);
     }
     ArenaVector<HInstruction*>& heap_values =
diff --git a/compiler/optimizing/nodes.cc b/compiler/optimizing/nodes.cc
index a6084eb..d15145e 100644
--- a/compiler/optimizing/nodes.cc
+++ b/compiler/optimizing/nodes.cc
@@ -2391,6 +2391,14 @@
   return !opt.GetDoesNotNeedEnvironment();
 }
 
+const DexFile& HInvokeStaticOrDirect::GetDexFileForPcRelativeDexCache() const {
+  ArtMethod* caller = GetEnvironment()->GetMethod();
+  ScopedObjectAccess soa(Thread::Current());
+  // `caller` is null for a top-level graph representing a method whose declaring
+  // class was not resolved.
+  return caller == nullptr ? GetBlock()->GetGraph()->GetDexFile() : *caller->GetDexFile();
+}
+
 bool HInvokeStaticOrDirect::NeedsDexCacheOfDeclaringClass() const {
   if (GetMethodLoadKind() != MethodLoadKind::kDexCacheViaMethod) {
     return false;
@@ -2434,17 +2442,6 @@
   }
 }
 
-// Helper for InstructionDataEquals to fetch the mirror Class out
-// from a kJitTableAddress LoadClass kind.
-// NO_THREAD_SAFETY_ANALYSIS because even though we're accessing
-// mirrors, they are stored in a variable size handle scope which is always
-// visited during a pause. Also, the only caller of this helper
-// only uses the mirror for pointer comparison.
-static inline mirror::Class* AsMirrorInternal(uint64_t address)
-    NO_THREAD_SAFETY_ANALYSIS {
-  return reinterpret_cast<StackReference<mirror::Class>*>(address)->AsMirrorPtr();
-}
-
 bool HLoadClass::InstructionDataEquals(const HInstruction* other) const {
   const HLoadClass* other_load_class = other->AsLoadClass();
   // TODO: To allow GVN for HLoadClass from different dex files, we should compare the type
@@ -2455,11 +2452,12 @@
   }
   switch (GetLoadKind()) {
     case LoadKind::kBootImageAddress:
-      return GetAddress() == other_load_class->GetAddress();
-    case LoadKind::kJitTableAddress:
-      return AsMirrorInternal(GetAddress()) == AsMirrorInternal(other_load_class->GetAddress());
+    case LoadKind::kJitTableAddress: {
+      ScopedObjectAccess soa(Thread::Current());
+      return GetClass().Get() == other_load_class->GetClass().Get();
+    }
     default:
-      DCHECK(HasTypeReference(GetLoadKind()) || HasDexCacheReference(GetLoadKind()));
+      DCHECK(HasTypeReference(GetLoadKind()));
       return IsSameDexFile(GetDexFile(), other_load_class->GetDexFile());
   }
 }
@@ -2490,10 +2488,10 @@
       return os << "BootImageLinkTimePcRelative";
     case HLoadClass::LoadKind::kBootImageAddress:
       return os << "BootImageAddress";
+    case HLoadClass::LoadKind::kBssEntry:
+      return os << "BssEntry";
     case HLoadClass::LoadKind::kJitTableAddress:
       return os << "JitTableAddress";
-    case HLoadClass::LoadKind::kDexCachePcRelative:
-      return os << "DexCachePcRelative";
     case HLoadClass::LoadKind::kDexCacheViaMethod:
       return os << "DexCacheViaMethod";
     default:
@@ -2502,17 +2500,6 @@
   }
 }
 
-// Helper for InstructionDataEquals to fetch the mirror String out
-// from a kJitTableAddress LoadString kind.
-// NO_THREAD_SAFETY_ANALYSIS because even though we're accessing
-// mirrors, they are stored in a variable size handle scope which is always
-// visited during a pause. Also, the only caller of this helper
-// only uses the mirror for pointer comparison.
-static inline mirror::String* AsMirrorInternal(Handle<mirror::String> handle)
-    NO_THREAD_SAFETY_ANALYSIS {
-  return handle.Get();
-}
-
 bool HLoadString::InstructionDataEquals(const HInstruction* other) const {
   const HLoadString* other_load_string = other->AsLoadString();
   // TODO: To allow GVN for HLoadString from different dex files, we should compare the strings
@@ -2523,8 +2510,10 @@
   }
   switch (GetLoadKind()) {
     case LoadKind::kBootImageAddress:
-    case LoadKind::kJitTableAddress:
-      return AsMirrorInternal(GetString()) == AsMirrorInternal(other_load_string->GetString());
+    case LoadKind::kJitTableAddress: {
+      ScopedObjectAccess soa(Thread::Current());
+      return GetString().Get() == other_load_string->GetString().Get();
+    }
     default:
       return IsSameDexFile(GetDexFile(), other_load_string->GetDexFile());
   }
@@ -2555,10 +2544,10 @@
       return os << "BootImageAddress";
     case HLoadString::LoadKind::kBssEntry:
       return os << "BssEntry";
-    case HLoadString::LoadKind::kDexCacheViaMethod:
-      return os << "DexCacheViaMethod";
     case HLoadString::LoadKind::kJitTableAddress:
       return os << "JitTableAddress";
+    case HLoadString::LoadKind::kDexCacheViaMethod:
+      return os << "DexCacheViaMethod";
     default:
       LOG(FATAL) << "Unknown HLoadString::LoadKind: " << static_cast<int>(rhs);
       UNREACHABLE();
diff --git a/compiler/optimizing/nodes.h b/compiler/optimizing/nodes.h
index bf13702..f0ea9e2 100644
--- a/compiler/optimizing/nodes.h
+++ b/compiler/optimizing/nodes.h
@@ -565,7 +565,7 @@
   ArtMethod* GetArtMethod() const { return art_method_; }
   void SetArtMethod(ArtMethod* method) { art_method_ = method; }
 
-  // Returns an instruction with the opposite boolean value from 'cond'.
+  // Returns an instruction with the opposite Boolean value from 'cond'.
   // The instruction has been inserted into the graph, either as a constant, or
   // before cursor.
   HInstruction* InsertOppositeCondition(HInstruction* cond, HInstruction* cursor);
@@ -1294,6 +1294,7 @@
   M(InvokeInterface, Invoke)                                            \
   M(InvokeStaticOrDirect, Invoke)                                       \
   M(InvokeVirtual, Invoke)                                              \
+  M(InvokePolymorphic, Invoke)                                          \
   M(LessThan, Condition)                                                \
   M(LessThanOrEqual, Condition)                                         \
   M(LoadClass, Instruction)                                             \
@@ -1723,28 +1724,22 @@
  public:
   HEnvironment(ArenaAllocator* arena,
                size_t number_of_vregs,
-               const DexFile& dex_file,
-               uint32_t method_idx,
+               ArtMethod* method,
                uint32_t dex_pc,
-               InvokeType invoke_type,
                HInstruction* holder)
      : vregs_(number_of_vregs, arena->Adapter(kArenaAllocEnvironmentVRegs)),
        locations_(number_of_vregs, arena->Adapter(kArenaAllocEnvironmentLocations)),
        parent_(nullptr),
-       dex_file_(dex_file),
-       method_idx_(method_idx),
+       method_(method),
        dex_pc_(dex_pc),
-       invoke_type_(invoke_type),
        holder_(holder) {
   }
 
   HEnvironment(ArenaAllocator* arena, const HEnvironment& to_copy, HInstruction* holder)
       : HEnvironment(arena,
                      to_copy.Size(),
-                     to_copy.GetDexFile(),
-                     to_copy.GetMethodIdx(),
+                     to_copy.GetMethod(),
                      to_copy.GetDexPc(),
-                     to_copy.GetInvokeType(),
                      holder) {}
 
   void SetAndCopyParentChain(ArenaAllocator* allocator, HEnvironment* parent) {
@@ -1793,16 +1788,8 @@
     return dex_pc_;
   }
 
-  uint32_t GetMethodIdx() const {
-    return method_idx_;
-  }
-
-  InvokeType GetInvokeType() const {
-    return invoke_type_;
-  }
-
-  const DexFile& GetDexFile() const {
-    return dex_file_;
+  ArtMethod* GetMethod() const {
+    return method_;
   }
 
   HInstruction* GetHolder() const {
@@ -1818,10 +1805,8 @@
   ArenaVector<HUserRecord<HEnvironment*>> vregs_;
   ArenaVector<Location> locations_;
   HEnvironment* parent_;
-  const DexFile& dex_file_;
-  const uint32_t method_idx_;
+  ArtMethod* method_;
   const uint32_t dex_pc_;
-  const InvokeType invoke_type_;
 
   // The instruction that holds this environment.
   HInstruction* const holder_;
@@ -3783,14 +3768,12 @@
                uint32_t dex_pc,
                dex::TypeIndex type_index,
                const DexFile& dex_file,
-               bool needs_access_check,
                bool finalizable,
                QuickEntrypointEnum entrypoint)
       : HExpression(Primitive::kPrimNot, SideEffects::CanTriggerGC(), dex_pc),
         type_index_(type_index),
         dex_file_(dex_file),
         entrypoint_(entrypoint) {
-    SetPackedFlag<kFlagNeedsAccessCheck>(needs_access_check);
     SetPackedFlag<kFlagFinalizable>(finalizable);
     SetRawInputAt(0, cls);
   }
@@ -3804,8 +3787,9 @@
   // Can throw errors when out-of-memory or if it's not instantiable/accessible.
   bool CanThrow() const OVERRIDE { return true; }
 
-  // Needs to call into runtime to make sure it's instantiable/accessible.
-  bool NeedsAccessCheck() const { return GetPackedFlag<kFlagNeedsAccessCheck>(); }
+  bool NeedsChecks() const {
+    return entrypoint_ == kQuickAllocObjectWithChecks;
+  }
 
   bool IsFinalizable() const { return GetPackedFlag<kFlagFinalizable>(); }
 
@@ -3817,13 +3801,21 @@
     entrypoint_ = entrypoint;
   }
 
+  HLoadClass* GetLoadClass() const {
+    HInstruction* input = InputAt(0);
+    if (input->IsClinitCheck()) {
+      input = input->InputAt(0);
+    }
+    DCHECK(input->IsLoadClass());
+    return input->AsLoadClass();
+  }
+
   bool IsStringAlloc() const;
 
   DECLARE_INSTRUCTION(NewInstance);
 
  private:
-  static constexpr size_t kFlagNeedsAccessCheck = kNumberOfExpressionPackedBits;
-  static constexpr size_t kFlagFinalizable = kFlagNeedsAccessCheck + 1;
+  static constexpr size_t kFlagFinalizable = kNumberOfExpressionPackedBits;
   static constexpr size_t kNumberOfNewInstancePackedBits = kFlagFinalizable + 1;
   static_assert(kNumberOfNewInstancePackedBits <= kMaxNumberOfPackedBits,
                 "Too many packed fields.");
@@ -3869,7 +3861,6 @@
   Primitive::Type GetType() const OVERRIDE { return GetPackedField<ReturnTypeField>(); }
 
   uint32_t GetDexMethodIndex() const { return dex_method_index_; }
-  const DexFile& GetDexFile() const { return GetEnvironment()->GetDexFile(); }
 
   InvokeType GetInvokeType() const {
     return GetPackedField<InvokeTypeField>();
@@ -3986,6 +3977,28 @@
   DISALLOW_COPY_AND_ASSIGN(HInvokeUnresolved);
 };
 
+class HInvokePolymorphic FINAL : public HInvoke {
+ public:
+  HInvokePolymorphic(ArenaAllocator* arena,
+                     uint32_t number_of_arguments,
+                     Primitive::Type return_type,
+                     uint32_t dex_pc,
+                     uint32_t dex_method_index)
+      : HInvoke(arena,
+                number_of_arguments,
+                0u /* number_of_other_inputs */,
+                return_type,
+                dex_pc,
+                dex_method_index,
+                nullptr,
+                kVirtual) {}
+
+  DECLARE_INSTRUCTION(InvokePolymorphic);
+
+ private:
+  DISALLOW_COPY_AND_ASSIGN(HInvokePolymorphic);
+};
+
 class HInvokeStaticOrDirect FINAL : public HInvoke {
  public:
   // Requirements of this method call regarding the class
@@ -4167,6 +4180,8 @@
     return dispatch_info_.method_load_data;
   }
 
+  const DexFile& GetDexFileForPcRelativeDexCache() const;
+
   ClinitCheckRequirement GetClinitCheckRequirement() const {
     return GetPackedField<ClinitCheckRequirementField>();
   }
@@ -4349,23 +4364,12 @@
 
 class HNewArray FINAL : public HExpression<2> {
  public:
-  HNewArray(HInstruction* length,
-            HCurrentMethod* current_method,
-            uint32_t dex_pc,
-            dex::TypeIndex type_index,
-            const DexFile& dex_file,
-            QuickEntrypointEnum entrypoint)
-      : HExpression(Primitive::kPrimNot, SideEffects::CanTriggerGC(), dex_pc),
-        type_index_(type_index),
-        dex_file_(dex_file),
-        entrypoint_(entrypoint) {
-    SetRawInputAt(0, length);
-    SetRawInputAt(1, current_method);
+  HNewArray(HInstruction* cls, HInstruction* length, uint32_t dex_pc)
+      : HExpression(Primitive::kPrimNot, SideEffects::CanTriggerGC(), dex_pc) {
+    SetRawInputAt(0, cls);
+    SetRawInputAt(1, length);
   }
 
-  dex::TypeIndex GetTypeIndex() const { return type_index_; }
-  const DexFile& GetDexFile() const { return dex_file_; }
-
   // Calls runtime so needs an environment.
   bool NeedsEnvironment() const OVERRIDE { return true; }
 
@@ -4374,15 +4378,18 @@
 
   bool CanBeNull() const OVERRIDE { return false; }
 
-  QuickEntrypointEnum GetEntrypoint() const { return entrypoint_; }
+  HLoadClass* GetLoadClass() const {
+    DCHECK(InputAt(0)->IsLoadClass());
+    return InputAt(0)->AsLoadClass();
+  }
+
+  HInstruction* GetLength() const {
+    return InputAt(1);
+  }
 
   DECLARE_INSTRUCTION(NewArray);
 
  private:
-  const dex::TypeIndex type_index_;
-  const DexFile& dex_file_;
-  const QuickEntrypointEnum entrypoint_;
-
   DISALLOW_COPY_AND_ASSIGN(HNewArray);
 };
 
@@ -5426,10 +5433,10 @@
   HBoundsCheck(HInstruction* index,
                HInstruction* length,
                uint32_t dex_pc,
-               uint32_t string_char_at_method_index = DexFile::kDexNoIndex)
-      : HExpression(index->GetType(), SideEffects::CanTriggerGC(), dex_pc),
-        string_char_at_method_index_(string_char_at_method_index) {
+               bool string_char_at = false)
+      : HExpression(index->GetType(), SideEffects::CanTriggerGC(), dex_pc) {
     DCHECK_EQ(Primitive::kPrimInt, Primitive::PrimitiveKind(index->GetType()));
+    SetPackedFlag<kFlagIsStringCharAt>(string_char_at);
     SetRawInputAt(0, index);
     SetRawInputAt(1, length);
   }
@@ -5443,22 +5450,14 @@
 
   bool CanThrow() const OVERRIDE { return true; }
 
-  bool IsStringCharAt() const { return GetStringCharAtMethodIndex() != DexFile::kDexNoIndex; }
-  uint32_t GetStringCharAtMethodIndex() const { return string_char_at_method_index_; }
+  bool IsStringCharAt() const { return GetPackedFlag<kFlagIsStringCharAt>(); }
 
   HInstruction* GetIndex() const { return InputAt(0); }
 
   DECLARE_INSTRUCTION(BoundsCheck);
 
  private:
-  // We treat a String as an array, creating the HBoundsCheck from String.charAt()
-  // intrinsic in the instruction simplifier. We want to include the String.charAt()
-  // in the stack trace if we actually throw the StringIndexOutOfBoundsException,
-  // so we need to create an HEnvironment which will be translated to an InlineInfo
-  // indicating the extra stack frame. Since we add this HEnvironment quite late,
-  // in the PrepareForRegisterAllocation pass, we need to remember the method index
-  // from the invoke as we don't want to look again at the dex bytecode.
-  uint32_t string_char_at_method_index_;  // DexFile::kDexNoIndex if regular array.
+  static constexpr size_t kFlagIsStringCharAt = kNumberOfExpressionPackedBits;
 
   DISALLOW_COPY_AND_ASSIGN(HBoundsCheck);
 };
@@ -5526,14 +5525,13 @@
     // GetIncludePatchInformation().
     kBootImageAddress,
 
+    // Load from an entry in the .bss section using a PC-relative load.
+    // Used for classes outside boot image when .bss is accessible with a PC-relative load.
+    kBssEntry,
+
     // Load from the root table associated with the JIT compiled method.
     kJitTableAddress,
 
-    // Load from resolved types array in the dex cache using a PC-relative load.
-    // Used for classes outside boot image when we know that we can access
-    // the dex cache arrays using a PC-relative load.
-    kDexCachePcRelative,
-
     // Load from resolved types array accessed through the class loaded from
     // the compiled method's own ArtMethod*. This is the default access type when
     // all other types are unavailable.
@@ -5545,6 +5543,7 @@
   HLoadClass(HCurrentMethod* current_method,
              dex::TypeIndex type_index,
              const DexFile& dex_file,
+             Handle<mirror::Class> klass,
              bool is_referrers_class,
              uint32_t dex_pc,
              bool needs_access_check)
@@ -5552,6 +5551,7 @@
         special_input_(HUserRecord<HInstruction*>(current_method)),
         type_index_(type_index),
         dex_file_(dex_file),
+        klass_(klass),
         loaded_class_rti_(ReferenceTypeInfo::CreateInvalid()) {
     // Referrers class should not need access check. We never inline unverified
     // methods so we can't possibly end up in this situation.
@@ -5560,14 +5560,11 @@
     SetPackedField<LoadKindField>(
         is_referrers_class ? LoadKind::kReferrersClass : LoadKind::kDexCacheViaMethod);
     SetPackedFlag<kFlagNeedsAccessCheck>(needs_access_check);
-    SetPackedFlag<kFlagIsInDexCache>(false);
     SetPackedFlag<kFlagIsInBootImage>(false);
     SetPackedFlag<kFlagGenerateClInitCheck>(false);
   }
 
-  void SetLoadKindWithAddress(LoadKind load_kind, uint64_t address) {
-    DCHECK(HasAddress(load_kind));
-    load_data_.address = address;
+  void SetLoadKind(LoadKind load_kind) {
     SetLoadKindInternal(load_kind);
   }
 
@@ -5580,15 +5577,6 @@
     SetLoadKindInternal(load_kind);
   }
 
-  void SetLoadKindWithDexCacheReference(LoadKind load_kind,
-                                        const DexFile& dex_file,
-                                        uint32_t element_index) {
-    DCHECK(HasDexCacheReference(load_kind));
-    DCHECK(IsSameDexFile(dex_file_, dex_file));
-    load_data_.dex_cache_element_index = element_index;
-    SetLoadKindInternal(load_kind);
-  }
-
   LoadKind GetLoadKind() const {
     return GetPackedField<LoadKindField>();
   }
@@ -5613,13 +5601,21 @@
   }
 
   bool CanCallRuntime() const {
-    return MustGenerateClinitCheck() ||
-           (!IsReferrersClass() && !IsInDexCache()) ||
-           NeedsAccessCheck();
+    return NeedsAccessCheck() ||
+           MustGenerateClinitCheck() ||
+           GetLoadKind() == LoadKind::kDexCacheViaMethod ||
+           GetLoadKind() == LoadKind::kBssEntry;
   }
 
   bool CanThrow() const OVERRIDE {
-    return CanCallRuntime();
+    return NeedsAccessCheck() ||
+           MustGenerateClinitCheck() ||
+           // If the class is in the boot image, the lookup in the runtime call cannot throw.
+           // This keeps CanThrow() consistent between non-PIC (using kBootImageAddress) and
+           // PIC and subsequently avoids a DCE behavior dependency on the PIC option.
+           ((GetLoadKind() == LoadKind::kDexCacheViaMethod ||
+             GetLoadKind() == LoadKind::kBssEntry) &&
+            !IsInBootImage());
   }
 
   ReferenceTypeInfo GetLoadedClassRTI() {
@@ -5635,15 +5631,8 @@
   dex::TypeIndex GetTypeIndex() const { return type_index_; }
   const DexFile& GetDexFile() const { return dex_file_; }
 
-  uint32_t GetDexCacheElementOffset() const;
-
-  uint64_t GetAddress() const {
-    DCHECK(HasAddress(GetLoadKind()));
-    return load_data_.address;
-  }
-
   bool NeedsDexCacheOfDeclaringClass() const OVERRIDE {
-    return !IsReferrersClass();
+    return GetLoadKind() == LoadKind::kDexCacheViaMethod;
   }
 
   static SideEffects SideEffectsForArchRuntimeCalls() {
@@ -5652,17 +5641,9 @@
 
   bool IsReferrersClass() const { return GetLoadKind() == LoadKind::kReferrersClass; }
   bool NeedsAccessCheck() const { return GetPackedFlag<kFlagNeedsAccessCheck>(); }
-  bool IsInDexCache() const { return GetPackedFlag<kFlagIsInDexCache>(); }
   bool IsInBootImage() const { return GetPackedFlag<kFlagIsInBootImage>(); }
   bool MustGenerateClinitCheck() const { return GetPackedFlag<kFlagGenerateClInitCheck>(); }
 
-  void MarkInDexCache() {
-    SetPackedFlag<kFlagIsInDexCache>(true);
-    DCHECK(!NeedsEnvironment());
-    RemoveEnvironment();
-    SetSideEffects(SideEffects::None());
-  }
-
   void MarkInBootImage() {
     SetPackedFlag<kFlagIsInBootImage>(true);
   }
@@ -5679,12 +5660,15 @@
     return Primitive::kPrimNot;
   }
 
+  Handle<mirror::Class> GetClass() const {
+    return klass_;
+  }
+
   DECLARE_INSTRUCTION(LoadClass);
 
  private:
   static constexpr size_t kFlagNeedsAccessCheck    = kNumberOfGenericPackedBits;
-  static constexpr size_t kFlagIsInDexCache        = kFlagNeedsAccessCheck + 1;
-  static constexpr size_t kFlagIsInBootImage       = kFlagIsInDexCache + 1;
+  static constexpr size_t kFlagIsInBootImage       = kFlagNeedsAccessCheck + 1;
   // Whether this instruction must generate the initialization check.
   // Used for code generation.
   static constexpr size_t kFlagGenerateClInitCheck = kFlagIsInBootImage + 1;
@@ -5696,35 +5680,24 @@
   using LoadKindField = BitField<LoadKind, kFieldLoadKind, kFieldLoadKindSize>;
 
   static bool HasTypeReference(LoadKind load_kind) {
-    return load_kind == LoadKind::kBootImageLinkTimeAddress ||
+    return load_kind == LoadKind::kReferrersClass ||
+        load_kind == LoadKind::kBootImageLinkTimeAddress ||
         load_kind == LoadKind::kBootImageLinkTimePcRelative ||
-        load_kind == LoadKind::kDexCacheViaMethod ||
-        load_kind == LoadKind::kReferrersClass;
-  }
-
-  static bool HasAddress(LoadKind load_kind) {
-    return load_kind == LoadKind::kBootImageAddress ||
-        load_kind == LoadKind::kJitTableAddress;
-  }
-
-  static bool HasDexCacheReference(LoadKind load_kind) {
-    return load_kind == LoadKind::kDexCachePcRelative;
+        load_kind == LoadKind::kBssEntry ||
+        load_kind == LoadKind::kDexCacheViaMethod;
   }
 
   void SetLoadKindInternal(LoadKind load_kind);
 
   // The special input is the HCurrentMethod for kDexCacheViaMethod or kReferrersClass.
   // For other load kinds it's empty or possibly some architecture-specific instruction
-  // for PC-relative loads, i.e. kDexCachePcRelative or kBootImageLinkTimePcRelative.
+  // for PC-relative loads, i.e. kBssEntry or kBootImageLinkTimePcRelative.
   HUserRecord<HInstruction*> special_input_;
 
   const dex::TypeIndex type_index_;
   const DexFile& dex_file_;
 
-  union {
-    uint32_t dex_cache_element_index;   // Only for dex cache reference.
-    uint64_t address;  // Up to 64-bit, needed for kJitTableAddress on 64-bit targets.
-  } load_data_;
+  Handle<mirror::Class> klass_;
 
   ReferenceTypeInfo loaded_class_rti_;
 
@@ -5733,19 +5706,13 @@
 std::ostream& operator<<(std::ostream& os, HLoadClass::LoadKind rhs);
 
 // Note: defined outside class to see operator<<(., HLoadClass::LoadKind).
-inline uint32_t HLoadClass::GetDexCacheElementOffset() const {
-  DCHECK(HasDexCacheReference(GetLoadKind())) << GetLoadKind();
-  return load_data_.dex_cache_element_index;
-}
-
-// Note: defined outside class to see operator<<(., HLoadClass::LoadKind).
 inline void HLoadClass::AddSpecialInput(HInstruction* special_input) {
   // The special input is used for PC-relative loads on some architectures,
   // including literal pool loads, which are PC-relative too.
   DCHECK(GetLoadKind() == LoadKind::kBootImageLinkTimePcRelative ||
-         GetLoadKind() == LoadKind::kDexCachePcRelative ||
          GetLoadKind() == LoadKind::kBootImageLinkTimeAddress ||
-         GetLoadKind() == LoadKind::kBootImageAddress) << GetLoadKind();
+         GetLoadKind() == LoadKind::kBootImageAddress ||
+         GetLoadKind() == LoadKind::kBssEntry) << GetLoadKind();
   DCHECK(special_input_.GetInstruction() == nullptr);
   special_input_ = HUserRecord<HInstruction*>(special_input);
   special_input->AddUseAt(this, 0);
@@ -5773,15 +5740,15 @@
     // Used for strings outside boot image when .bss is accessible with a PC-relative load.
     kBssEntry,
 
+    // Load from the root table associated with the JIT compiled method.
+    kJitTableAddress,
+
     // Load from resolved strings array accessed through the class loaded from
     // the compiled method's own ArtMethod*. This is the default access type when
     // all other types are unavailable.
     kDexCacheViaMethod,
 
-    // Load from the root table associated with the JIT compiled method.
-    kJitTableAddress,
-
-    kLast = kJitTableAddress,
+    kLast = kDexCacheViaMethod,
   };
 
   HLoadString(HCurrentMethod* current_method,
@@ -5873,7 +5840,7 @@
 
   // The special input is the HCurrentMethod for kDexCacheViaMethod.
   // For other load kinds it's empty or possibly some architecture-specific instruction
-  // for PC-relative loads, i.e. kDexCachePcRelative or kBootImageLinkTimePcRelative.
+  // for PC-relative loads, i.e. kBssEntry or kBootImageLinkTimePcRelative.
   HUserRecord<HInstruction*> special_input_;
 
   dex::StringIndex string_index_;
@@ -5925,7 +5892,10 @@
 
   bool CanThrow() const OVERRIDE { return true; }
 
-  HLoadClass* GetLoadClass() const { return InputAt(0)->AsLoadClass(); }
+  HLoadClass* GetLoadClass() const {
+    DCHECK(InputAt(0)->IsLoadClass());
+    return InputAt(0)->AsLoadClass();
+  }
 
   DECLARE_INSTRUCTION(ClinitCheck);
 
@@ -6791,6 +6761,23 @@
   std::copy_backward(blocks->begin() + after + 1u, blocks->begin() + old_size, blocks->end());
 }
 
+/*
+ * Hunt "under the hood" of array lengths (leading to array references),
+ * null checks (also leading to array references), and new arrays
+ * (leading to the actual length). This makes it more likely related
+ * instructions become actually comparable.
+ */
+inline HInstruction* HuntForDeclaration(HInstruction* instruction) {
+  while (instruction->IsArrayLength() ||
+         instruction->IsNullCheck() ||
+         instruction->IsNewArray()) {
+    instruction = instruction->IsNewArray()
+        ? instruction->AsNewArray()->GetLength()
+        : instruction->InputAt(0);
+  }
+  return instruction;
+}
+
 }  // namespace art
 
 #endif  // ART_COMPILER_OPTIMIZING_NODES_H_
diff --git a/compiler/optimizing/nodes_test.cc b/compiler/optimizing/nodes_test.cc
index 5d9a652..7686ba8 100644
--- a/compiler/optimizing/nodes_test.cc
+++ b/compiler/optimizing/nodes_test.cc
@@ -52,7 +52,7 @@
   exit_block->AddInstruction(new (&allocator) HExit());
 
   HEnvironment* environment = new (&allocator) HEnvironment(
-      &allocator, 1, graph->GetDexFile(), graph->GetMethodIdx(), 0, kStatic, null_check);
+      &allocator, 1, graph->GetArtMethod(), 0, null_check);
   null_check->SetRawEnvironment(environment);
   environment->SetRawEnvAt(0, parameter);
   parameter->AddEnvUseAt(null_check->GetEnvironment(), 0);
@@ -137,7 +137,7 @@
   ASSERT_TRUE(parameter1->GetUses().HasExactlyOneElement());
 
   HEnvironment* environment = new (&allocator) HEnvironment(
-      &allocator, 1, graph->GetDexFile(), graph->GetMethodIdx(), 0, kStatic, with_environment);
+      &allocator, 1, graph->GetArtMethod(), 0, with_environment);
   ArenaVector<HInstruction*> array(allocator.Adapter());
   array.push_back(parameter1);
 
@@ -148,13 +148,13 @@
   ASSERT_TRUE(parameter1->GetEnvUses().HasExactlyOneElement());
 
   HEnvironment* parent1 = new (&allocator) HEnvironment(
-      &allocator, 1, graph->GetDexFile(), graph->GetMethodIdx(), 0, kStatic, nullptr);
+      &allocator, 1, graph->GetArtMethod(), 0, nullptr);
   parent1->CopyFrom(array);
 
   ASSERT_EQ(parameter1->GetEnvUses().SizeSlow(), 2u);
 
   HEnvironment* parent2 = new (&allocator) HEnvironment(
-      &allocator, 1, graph->GetDexFile(), graph->GetMethodIdx(), 0, kStatic, nullptr);
+      &allocator, 1, graph->GetArtMethod(), 0, nullptr);
   parent2->CopyFrom(array);
   parent1->SetAndCopyParentChain(&allocator, parent2);
 
diff --git a/compiler/optimizing/nodes_x86.h b/compiler/optimizing/nodes_x86.h
index fa47976..75893c3 100644
--- a/compiler/optimizing/nodes_x86.h
+++ b/compiler/optimizing/nodes_x86.h
@@ -71,6 +71,10 @@
     SetRawInputAt(1, method_base);
   }
 
+  HX86ComputeBaseMethodAddress* GetBaseMethodAddress() const {
+    return InputAt(1)->AsX86ComputeBaseMethodAddress();
+  }
+
   DECLARE_INSTRUCTION(X86FPNeg);
 
  private:
diff --git a/compiler/optimizing/pc_relative_fixups_mips.cc b/compiler/optimizing/pc_relative_fixups_mips.cc
index e321b9e..a0fdde1 100644
--- a/compiler/optimizing/pc_relative_fixups_mips.cc
+++ b/compiler/optimizing/pc_relative_fixups_mips.cc
@@ -62,8 +62,9 @@
     HLoadClass::LoadKind load_kind = load_class->GetLoadKind();
     switch (load_kind) {
       case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
-      case HLoadClass::LoadKind::kBootImageAddress:
       case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
+      case HLoadClass::LoadKind::kBootImageAddress:
+      case HLoadClass::LoadKind::kBssEntry:
         // Add a base register for PC-relative literals on R2.
         InitializePCRelativeBasePointer();
         load_class->AddSpecialInput(base_);
diff --git a/compiler/optimizing/pc_relative_fixups_x86.cc b/compiler/optimizing/pc_relative_fixups_x86.cc
index b1fdb17..a1c916f 100644
--- a/compiler/optimizing/pc_relative_fixups_x86.cc
+++ b/compiler/optimizing/pc_relative_fixups_x86.cc
@@ -83,9 +83,9 @@
   void VisitLoadClass(HLoadClass* load_class) OVERRIDE {
     HLoadClass::LoadKind load_kind = load_class->GetLoadKind();
     if (load_kind == HLoadClass::LoadKind::kBootImageLinkTimePcRelative ||
-        load_kind == HLoadClass::LoadKind::kDexCachePcRelative) {
-      InitializePCRelativeBasePointer();
-      load_class->AddSpecialInput(base_);
+        load_kind == HLoadClass::LoadKind::kBssEntry) {
+      HX86ComputeBaseMethodAddress* method_address = GetPCRelativeBasePointer(load_class);
+      load_class->AddSpecialInput(method_address);
     }
   }
 
@@ -93,8 +93,8 @@
     HLoadString::LoadKind load_kind = load_string->GetLoadKind();
     if (load_kind == HLoadString::LoadKind::kBootImageLinkTimePcRelative ||
         load_kind == HLoadString::LoadKind::kBssEntry) {
-      InitializePCRelativeBasePointer();
-      load_string->AddSpecialInput(base_);
+      HX86ComputeBaseMethodAddress* method_address = GetPCRelativeBasePointer(load_string);
+      load_string->AddSpecialInput(method_address);
     }
   }
 
@@ -132,13 +132,13 @@
   void VisitNeg(HNeg* neg) OVERRIDE {
     if (Primitive::IsFloatingPointType(neg->GetType())) {
       // We need to replace the HNeg with a HX86FPNeg in order to address the constant area.
-      InitializePCRelativeBasePointer();
+      HX86ComputeBaseMethodAddress* method_address = GetPCRelativeBasePointer(neg);
       HGraph* graph = GetGraph();
       HBasicBlock* block = neg->GetBlock();
       HX86FPNeg* x86_fp_neg = new (graph->GetArena()) HX86FPNeg(
           neg->GetType(),
           neg->InputAt(0),
-          base_,
+          method_address,
           neg->GetDexPc());
       block->ReplaceAndRemoveInstructionWith(neg, x86_fp_neg);
     }
@@ -151,35 +151,44 @@
     }
     // We need to replace the HPackedSwitch with a HX86PackedSwitch in order to
     // address the constant area.
-    InitializePCRelativeBasePointer();
+    HX86ComputeBaseMethodAddress* method_address = GetPCRelativeBasePointer(switch_insn);
     HGraph* graph = GetGraph();
     HBasicBlock* block = switch_insn->GetBlock();
     HX86PackedSwitch* x86_switch = new (graph->GetArena()) HX86PackedSwitch(
         switch_insn->GetStartValue(),
         switch_insn->GetNumEntries(),
         switch_insn->InputAt(0),
-        base_,
+        method_address,
         switch_insn->GetDexPc());
     block->ReplaceAndRemoveInstructionWith(switch_insn, x86_switch);
   }
 
-  void InitializePCRelativeBasePointer() {
-    // Ensure we only initialize the pointer once.
-    if (base_ != nullptr) {
-      return;
+  HX86ComputeBaseMethodAddress* GetPCRelativeBasePointer(HInstruction* cursor) {
+    bool has_irreducible_loops = GetGraph()->HasIrreducibleLoops();
+    if (!has_irreducible_loops) {
+      // Ensure we only initialize the pointer once.
+      if (base_ != nullptr) {
+        return base_;
+      }
     }
     // Insert the base at the start of the entry block, move it to a better
     // position later in MoveBaseIfNeeded().
-    base_ = new (GetGraph()->GetArena()) HX86ComputeBaseMethodAddress();
-    HBasicBlock* entry_block = GetGraph()->GetEntryBlock();
-    entry_block->InsertInstructionBefore(base_, entry_block->GetFirstInstruction());
-    DCHECK(base_ != nullptr);
+    HX86ComputeBaseMethodAddress* method_address =
+        new (GetGraph()->GetArena()) HX86ComputeBaseMethodAddress();
+    if (has_irreducible_loops) {
+      cursor->GetBlock()->InsertInstructionBefore(method_address, cursor);
+    } else {
+      HBasicBlock* entry_block = GetGraph()->GetEntryBlock();
+      entry_block->InsertInstructionBefore(method_address, entry_block->GetFirstInstruction());
+      base_ = method_address;
+    }
+    return method_address;
   }
 
   void ReplaceInput(HInstruction* insn, HConstant* value, int input_index, bool materialize) {
-    InitializePCRelativeBasePointer();
+    HX86ComputeBaseMethodAddress* method_address = GetPCRelativeBasePointer(insn);
     HX86LoadFromConstantTable* load_constant =
-        new (GetGraph()->GetArena()) HX86LoadFromConstantTable(base_, value);
+        new (GetGraph()->GetArena()) HX86LoadFromConstantTable(method_address, value);
     if (!materialize) {
       load_constant->MarkEmittedAtUseSite();
     }
@@ -204,9 +213,9 @@
     if (invoke_static_or_direct != nullptr &&
         invoke_static_or_direct->HasPcRelativeDexCache() &&
         !IsCallFreeIntrinsic<IntrinsicLocationsBuilderX86>(invoke, codegen_)) {
-      InitializePCRelativeBasePointer();
-      // Add the extra parameter base_.
-      invoke_static_or_direct->AddSpecialInput(base_);
+      HX86ComputeBaseMethodAddress* method_address = GetPCRelativeBasePointer(invoke);
+      // Add the extra parameter.
+      invoke_static_or_direct->AddSpecialInput(method_address);
       base_added = true;
     }
 
@@ -231,8 +240,8 @@
         if (!base_added) {
           DCHECK(invoke_static_or_direct != nullptr);
           DCHECK(!invoke_static_or_direct->HasCurrentMethodInput());
-          InitializePCRelativeBasePointer();
-          invoke_static_or_direct->AddSpecialInput(base_);
+          HX86ComputeBaseMethodAddress* method_address = GetPCRelativeBasePointer(invoke);
+          invoke_static_or_direct->AddSpecialInput(method_address);
         }
         break;
       default:
@@ -243,16 +252,12 @@
   CodeGeneratorX86* codegen_;
 
   // The generated HX86ComputeBaseMethodAddress in the entry block needed as an
-  // input to the HX86LoadFromConstantTable instructions.
+  // input to the HX86LoadFromConstantTable instructions. Only set for
+  // graphs with reducible loops.
   HX86ComputeBaseMethodAddress* base_;
 };
 
 void PcRelativeFixups::Run() {
-  if (graph_->HasIrreducibleLoops()) {
-    // Do not run this optimization, as irreducible loops do not work with an instruction
-    // that can be live-in at the irreducible loop header.
-    return;
-  }
   PCRelativeHandlerVisitor visitor(graph_, codegen_);
   visitor.VisitInsertionOrder();
   visitor.MoveBaseIfNeeded();
diff --git a/compiler/optimizing/prepare_for_register_allocation.cc b/compiler/optimizing/prepare_for_register_allocation.cc
index db7c1fb..efbaf6c 100644
--- a/compiler/optimizing/prepare_for_register_allocation.cc
+++ b/compiler/optimizing/prepare_for_register_allocation.cc
@@ -16,6 +16,9 @@
 
 #include "prepare_for_register_allocation.h"
 
+#include "jni_internal.h"
+#include "well_known_classes.h"
+
 namespace art {
 
 void PrepareForRegisterAllocation::Run() {
@@ -42,16 +45,12 @@
   if (check->IsStringCharAt()) {
     // Add a fake environment for String.charAt() inline info as we want
     // the exception to appear as being thrown from there.
-    const DexFile& dex_file = check->GetEnvironment()->GetDexFile();
-    DCHECK_STREQ(dex_file.PrettyMethod(check->GetStringCharAtMethodIndex()).c_str(),
-                 "char java.lang.String.charAt(int)");
+    ArtMethod* char_at_method = jni::DecodeArtMethod(WellKnownClasses::java_lang_String_charAt);
     ArenaAllocator* arena = GetGraph()->GetArena();
     HEnvironment* environment = new (arena) HEnvironment(arena,
                                                          /* number_of_vregs */ 0u,
-                                                         dex_file,
-                                                         check->GetStringCharAtMethodIndex(),
+                                                         char_at_method,
                                                          /* dex_pc */ DexFile::kDexNoIndex,
-                                                         kVirtual,
                                                          check);
     check->InsertRawEnvironment(environment);
   }
@@ -199,8 +198,7 @@
       return false;
     }
     if (user_environment->GetDexPc() != input_environment->GetDexPc() ||
-        user_environment->GetMethodIdx() != input_environment->GetMethodIdx() ||
-        !IsSameDexFile(user_environment->GetDexFile(), input_environment->GetDexFile())) {
+        user_environment->GetMethod() != input_environment->GetMethod()) {
       return false;
     }
     user_environment = user_environment->GetParent();
diff --git a/compiler/optimizing/reference_type_propagation.cc b/compiler/optimizing/reference_type_propagation.cc
index f8a4469..b02f250 100644
--- a/compiler/optimizing/reference_type_propagation.cc
+++ b/compiler/optimizing/reference_type_propagation.cc
@@ -295,13 +295,13 @@
   }
 
   if (check->IsIf()) {
-    HBasicBlock* trueBlock = check->IsEqual()
+    HBasicBlock* trueBlock = compare->IsEqual()
         ? check->AsIf()->IfTrueSuccessor()
         : check->AsIf()->IfFalseSuccessor();
     BoundTypeIn(receiver, trueBlock, /* start_instruction */ nullptr, class_rti);
   } else {
     DCHECK(check->IsDeoptimize());
-    if (check->IsEqual()) {
+    if (compare->IsEqual()) {
       BoundTypeIn(receiver, check->GetBlock(), check, class_rti);
     }
   }
@@ -499,18 +499,19 @@
   if (instr->IsInvokeStaticOrDirect() && instr->AsInvokeStaticOrDirect()->IsStringInit()) {
     // Calls to String.<init> are replaced with a StringFactory.
     if (kIsDebugBuild) {
-      HInvoke* invoke = instr->AsInvoke();
+      HInvokeStaticOrDirect* invoke = instr->AsInvokeStaticOrDirect();
       ClassLinker* cl = Runtime::Current()->GetClassLinker();
       Thread* self = Thread::Current();
       StackHandleScope<2> hs(self);
+      const DexFile& dex_file = *invoke->GetTargetMethod().dex_file;
       Handle<mirror::DexCache> dex_cache(
-          hs.NewHandle(FindDexCacheWithHint(self, invoke->GetDexFile(), hint_dex_cache_)));
+          hs.NewHandle(FindDexCacheWithHint(self, dex_file, hint_dex_cache_)));
       // Use a null loader. We should probably use the compiling method's class loader,
       // but then we would need to pass it to RTPVisitor just for this debug check. Since
       // the method is from the String class, the null loader is good enough.
       Handle<mirror::ClassLoader> loader;
       ArtMethod* method = cl->ResolveMethod<ClassLinker::kNoICCECheckForCache>(
-          invoke->GetDexFile(), invoke->GetDexMethodIndex(), dex_cache, loader, nullptr, kDirect);
+          dex_file, invoke->GetDexMethodIndex(), dex_cache, loader, nullptr, kDirect);
       DCHECK(method != nullptr);
       mirror::Class* declaring_class = method->GetDeclaringClass();
       DCHECK(declaring_class != nullptr);
@@ -547,11 +548,13 @@
 }
 
 void ReferenceTypePropagation::RTPVisitor::VisitNewInstance(HNewInstance* instr) {
-  UpdateReferenceTypeInfo(instr, instr->GetTypeIndex(), instr->GetDexFile(), /* is_exact */ true);
+  ScopedObjectAccess soa(Thread::Current());
+  SetClassAsTypeInfo(instr, instr->GetLoadClass()->GetClass().Get(), /* is_exact */ true);
 }
 
 void ReferenceTypePropagation::RTPVisitor::VisitNewArray(HNewArray* instr) {
-  UpdateReferenceTypeInfo(instr, instr->GetTypeIndex(), instr->GetDexFile(), /* is_exact */ true);
+  ScopedObjectAccess soa(Thread::Current());
+  SetClassAsTypeInfo(instr, instr->GetLoadClass()->GetClass().Get(), /* is_exact */ true);
 }
 
 static mirror::Class* GetClassFromDexCache(Thread* self,
@@ -619,14 +622,10 @@
 
 void ReferenceTypePropagation::RTPVisitor::VisitLoadClass(HLoadClass* instr) {
   ScopedObjectAccess soa(Thread::Current());
-  // Get type from dex cache assuming it was populated by the verifier.
-  mirror::Class* resolved_class = GetClassFromDexCache(soa.Self(),
-                                                       instr->GetDexFile(),
-                                                       instr->GetTypeIndex(),
-                                                       hint_dex_cache_);
-  if (IsAdmissible(resolved_class)) {
+  Handle<mirror::Class> resolved_class = instr->GetClass();
+  if (IsAdmissible(resolved_class.Get())) {
     instr->SetLoadedClassRTI(ReferenceTypeInfo::Create(
-        handle_cache_->NewHandle(resolved_class), /* is_exact */ true));
+        resolved_class, /* is_exact */ true));
   }
   instr->SetReferenceTypeInfo(
       ReferenceTypeInfo::Create(handle_cache_->GetClassClassHandle(), /* is_exact */ true));
@@ -843,12 +842,8 @@
   }
 
   ScopedObjectAccess soa(Thread::Current());
-  ClassLinker* cl = Runtime::Current()->GetClassLinker();
-  mirror::DexCache* dex_cache =
-      FindDexCacheWithHint(soa.Self(), instr->GetDexFile(), hint_dex_cache_);
-  PointerSize pointer_size = cl->GetImagePointerSize();
-  ArtMethod* method = dex_cache->GetResolvedMethod(instr->GetDexMethodIndex(), pointer_size);
-  mirror::Class* klass = (method == nullptr) ? nullptr : method->GetReturnType(false, pointer_size);
+  ArtMethod* method = instr->GetResolvedMethod();
+  mirror::Class* klass = (method == nullptr) ? nullptr : method->GetReturnType(/* resolve */ false);
   SetClassAsTypeInfo(instr, klass, /* is_exact */ false);
 }
 
diff --git a/compiler/optimizing/sharpening.cc b/compiler/optimizing/sharpening.cc
index dc8ee23..c529410 100644
--- a/compiler/optimizing/sharpening.cc
+++ b/compiler/optimizing/sharpening.cc
@@ -133,99 +133,18 @@
 
 void HSharpening::ProcessLoadClass(HLoadClass* load_class) {
   ScopedObjectAccess soa(Thread::Current());
-  StackHandleScope<1> hs(soa.Self());
-  Runtime* runtime = Runtime::Current();
-  ClassLinker* class_linker = runtime->GetClassLinker();
-  const DexFile& dex_file = load_class->GetDexFile();
-  dex::TypeIndex type_index = load_class->GetTypeIndex();
-  Handle<mirror::DexCache> dex_cache = IsSameDexFile(dex_file, *compilation_unit_.GetDexFile())
-      ? compilation_unit_.GetDexCache()
-      : hs.NewHandle(class_linker->FindDexCache(soa.Self(), dex_file));
-  mirror::Class* cls = dex_cache->GetResolvedType(type_index);
-  SharpenClass(load_class, cls, handles_, codegen_, compiler_driver_);
+  SharpenClass(load_class, codegen_, compiler_driver_);
 }
 
 void HSharpening::SharpenClass(HLoadClass* load_class,
-                               mirror::Class* klass,
-                               VariableSizedHandleScope* handles,
                                CodeGenerator* codegen,
                                CompilerDriver* compiler_driver) {
-  ScopedAssertNoThreadSuspension sants("Sharpening class in compiler");
+  Handle<mirror::Class> klass = load_class->GetClass();
   DCHECK(load_class->GetLoadKind() == HLoadClass::LoadKind::kDexCacheViaMethod ||
          load_class->GetLoadKind() == HLoadClass::LoadKind::kReferrersClass)
       << load_class->GetLoadKind();
-  DCHECK(!load_class->IsInDexCache()) << "HLoadClass should not be optimized before sharpening.";
   DCHECK(!load_class->IsInBootImage()) << "HLoadClass should not be optimized before sharpening.";
 
-  const DexFile& dex_file = load_class->GetDexFile();
-  dex::TypeIndex type_index = load_class->GetTypeIndex();
-
-  bool is_in_dex_cache = false;
-  bool is_in_boot_image = false;
-  HLoadClass::LoadKind desired_load_kind = static_cast<HLoadClass::LoadKind>(-1);
-  uint64_t address = 0u;  // Class or dex cache element address.
-  Runtime* runtime = Runtime::Current();
-  if (codegen->GetCompilerOptions().IsBootImage()) {
-    // Compiling boot image. Check if the class is a boot image class.
-    DCHECK(!runtime->UseJitCompilation());
-    if (!compiler_driver->GetSupportBootImageFixup()) {
-      // MIPS64 or compiler_driver_test. Do not sharpen.
-      desired_load_kind = HLoadClass::LoadKind::kDexCacheViaMethod;
-    } else if ((klass != nullptr) && compiler_driver->IsImageClass(
-        dex_file.StringDataByIdx(dex_file.GetTypeId(type_index).descriptor_idx_))) {
-      is_in_boot_image = true;
-      is_in_dex_cache = true;
-      desired_load_kind = codegen->GetCompilerOptions().GetCompilePic()
-          ? HLoadClass::LoadKind::kBootImageLinkTimePcRelative
-          : HLoadClass::LoadKind::kBootImageLinkTimeAddress;
-    } else {
-      // Not a boot image class. We must go through the dex cache.
-      DCHECK(ContainsElement(compiler_driver->GetDexFilesForOatFile(), &dex_file));
-      desired_load_kind = HLoadClass::LoadKind::kDexCachePcRelative;
-    }
-  } else {
-    is_in_boot_image = (klass != nullptr) && runtime->GetHeap()->ObjectIsInBootImageSpace(klass);
-    if (runtime->UseJitCompilation()) {
-      // TODO: Make sure we don't set the "compile PIC" flag for JIT as that's bogus.
-      // DCHECK(!codegen_->GetCompilerOptions().GetCompilePic());
-      is_in_dex_cache = (klass != nullptr);
-      if (is_in_boot_image) {
-        // TODO: Use direct pointers for all non-moving spaces, not just boot image. Bug: 29530787
-        desired_load_kind = HLoadClass::LoadKind::kBootImageAddress;
-        address = reinterpret_cast64<uint64_t>(klass);
-      } else if (is_in_dex_cache) {
-        desired_load_kind = HLoadClass::LoadKind::kJitTableAddress;
-        // We store in the address field the location of the stack reference maintained
-        // by the handle. We do this now so that the code generation does not need to figure
-        // out which class loader to use.
-        address = reinterpret_cast<uint64_t>(handles->NewHandle(klass).GetReference());
-      } else {
-        // Class not loaded yet. This happens when the dex code requesting
-        // this `HLoadClass` hasn't been executed in the interpreter.
-        // Fallback to the dex cache.
-        // TODO(ngeoffray): Generate HDeoptimize instead.
-        desired_load_kind = HLoadClass::LoadKind::kDexCacheViaMethod;
-      }
-    } else if (is_in_boot_image && !codegen->GetCompilerOptions().GetCompilePic()) {
-      // AOT app compilation. Check if the class is in the boot image.
-      desired_load_kind = HLoadClass::LoadKind::kBootImageAddress;
-      address = reinterpret_cast64<uint64_t>(klass);
-    } else {
-      // Not JIT and either the klass is not in boot image or we are compiling in PIC mode.
-      // Use PC-relative load from the dex cache if the dex file belongs
-      // to the oat file that we're currently compiling.
-      desired_load_kind =
-          ContainsElement(compiler_driver->GetDexFilesForOatFile(), &load_class->GetDexFile())
-              ? HLoadClass::LoadKind::kDexCachePcRelative
-              : HLoadClass::LoadKind::kDexCacheViaMethod;
-    }
-  }
-  DCHECK_NE(desired_load_kind, static_cast<HLoadClass::LoadKind>(-1));
-
-  if (is_in_boot_image) {
-    load_class->MarkInBootImage();
-  }
-
   if (load_class->NeedsAccessCheck()) {
     // We need to call the runtime anyway, so we simply get the class as that call's return value.
     return;
@@ -239,29 +158,73 @@
     return;
   }
 
-  if (is_in_dex_cache) {
-    load_class->MarkInDexCache();
+  const DexFile& dex_file = load_class->GetDexFile();
+  dex::TypeIndex type_index = load_class->GetTypeIndex();
+
+  bool is_in_boot_image = false;
+  HLoadClass::LoadKind desired_load_kind = static_cast<HLoadClass::LoadKind>(-1);
+  Runtime* runtime = Runtime::Current();
+  if (codegen->GetCompilerOptions().IsBootImage()) {
+    // Compiling boot image. Check if the class is a boot image class.
+    DCHECK(!runtime->UseJitCompilation());
+    if (!compiler_driver->GetSupportBootImageFixup()) {
+      // compiler_driver_test. Do not sharpen.
+      desired_load_kind = HLoadClass::LoadKind::kDexCacheViaMethod;
+    } else if ((klass.Get() != nullptr) && compiler_driver->IsImageClass(
+        dex_file.StringDataByIdx(dex_file.GetTypeId(type_index).descriptor_idx_))) {
+      is_in_boot_image = true;
+      desired_load_kind = codegen->GetCompilerOptions().GetCompilePic()
+          ? HLoadClass::LoadKind::kBootImageLinkTimePcRelative
+          : HLoadClass::LoadKind::kBootImageLinkTimeAddress;
+    } else {
+      // Not a boot image class.
+      DCHECK(ContainsElement(compiler_driver->GetDexFilesForOatFile(), &dex_file));
+      desired_load_kind = HLoadClass::LoadKind::kBssEntry;
+    }
+  } else {
+    is_in_boot_image = (klass.Get() != nullptr) &&
+        runtime->GetHeap()->ObjectIsInBootImageSpace(klass.Get());
+    if (runtime->UseJitCompilation()) {
+      // TODO: Make sure we don't set the "compile PIC" flag for JIT as that's bogus.
+      // DCHECK(!codegen_->GetCompilerOptions().GetCompilePic());
+      if (is_in_boot_image) {
+        // TODO: Use direct pointers for all non-moving spaces, not just boot image. Bug: 29530787
+        desired_load_kind = HLoadClass::LoadKind::kBootImageAddress;
+      } else if (klass.Get() != nullptr) {
+        desired_load_kind = HLoadClass::LoadKind::kJitTableAddress;
+      } else {
+        // Class not loaded yet. This happens when the dex code requesting
+        // this `HLoadClass` hasn't been executed in the interpreter.
+        // Fallback to the dex cache.
+        // TODO(ngeoffray): Generate HDeoptimize instead.
+        desired_load_kind = HLoadClass::LoadKind::kDexCacheViaMethod;
+      }
+    } else if (is_in_boot_image && !codegen->GetCompilerOptions().GetCompilePic()) {
+      // AOT app compilation. Check if the class is in the boot image.
+      desired_load_kind = HLoadClass::LoadKind::kBootImageAddress;
+    } else {
+      // Not JIT and either the klass is not in boot image or we are compiling in PIC mode.
+      desired_load_kind = HLoadClass::LoadKind::kBssEntry;
+    }
+  }
+  DCHECK_NE(desired_load_kind, static_cast<HLoadClass::LoadKind>(-1));
+
+  if (is_in_boot_image) {
+    load_class->MarkInBootImage();
   }
 
   HLoadClass::LoadKind load_kind = codegen->GetSupportedLoadClassKind(desired_load_kind);
   switch (load_kind) {
     case HLoadClass::LoadKind::kBootImageLinkTimeAddress:
     case HLoadClass::LoadKind::kBootImageLinkTimePcRelative:
+    case HLoadClass::LoadKind::kBssEntry:
     case HLoadClass::LoadKind::kDexCacheViaMethod:
       load_class->SetLoadKindWithTypeReference(load_kind, dex_file, type_index);
       break;
     case HLoadClass::LoadKind::kBootImageAddress:
     case HLoadClass::LoadKind::kJitTableAddress:
-      DCHECK_NE(address, 0u);
-      load_class->SetLoadKindWithAddress(load_kind, address);
+      load_class->SetLoadKind(load_kind);
       break;
-    case HLoadClass::LoadKind::kDexCachePcRelative: {
-      PointerSize pointer_size = InstructionSetPointerSize(codegen->GetInstructionSet());
-      DexCacheArraysLayout layout(pointer_size, &dex_file);
-      size_t element_index = layout.TypeOffset(type_index);
-      load_class->SetLoadKindWithDexCacheReference(load_kind, dex_file, element_index);
-      break;
-    }
     default:
       LOG(FATAL) << "Unexpected load kind: " << load_kind;
       UNREACHABLE();
@@ -274,7 +237,7 @@
   const DexFile& dex_file = load_string->GetDexFile();
   dex::StringIndex string_index = load_string->GetStringIndex();
 
-  HLoadString::LoadKind desired_load_kind = HLoadString::LoadKind::kDexCacheViaMethod;
+  HLoadString::LoadKind desired_load_kind = static_cast<HLoadString::LoadKind>(-1);
   {
     Runtime* runtime = Runtime::Current();
     ClassLinker* class_linker = runtime->GetClassLinker();
@@ -297,8 +260,8 @@
             ? HLoadString::LoadKind::kBootImageLinkTimePcRelative
             : HLoadString::LoadKind::kBootImageLinkTimeAddress;
       } else {
-        // MIPS64 or compiler_driver_test. Do not sharpen.
-        DCHECK_EQ(desired_load_kind, HLoadString::LoadKind::kDexCacheViaMethod);
+        // compiler_driver_test. Do not sharpen.
+        desired_load_kind = HLoadString::LoadKind::kDexCacheViaMethod;
       }
     } else if (runtime->UseJitCompilation()) {
       // TODO: Make sure we don't set the "compile PIC" flag for JIT as that's bogus.
@@ -310,6 +273,8 @@
         } else {
           desired_load_kind = HLoadString::LoadKind::kJitTableAddress;
         }
+      } else {
+        desired_load_kind = HLoadString::LoadKind::kDexCacheViaMethod;
       }
     } else {
       // AOT app compilation. Try to lookup the string without allocating if not found.
@@ -326,6 +291,7 @@
       load_string->SetString(handles_->NewHandle(string));
     }
   }
+  DCHECK_NE(desired_load_kind, static_cast<HLoadString::LoadKind>(-1));
 
   HLoadString::LoadKind load_kind = codegen_->GetSupportedLoadStringKind(desired_load_kind);
   load_string->SetLoadKind(load_kind);
diff --git a/compiler/optimizing/sharpening.h b/compiler/optimizing/sharpening.h
index ae5ccb3..ae3d83e 100644
--- a/compiler/optimizing/sharpening.h
+++ b/compiler/optimizing/sharpening.h
@@ -49,8 +49,6 @@
 
   // Used internally but also by the inliner.
   static void SharpenClass(HLoadClass* load_class,
-                           mirror::Class* klass,
-                           VariableSizedHandleScope* handles,
                            CodeGenerator* codegen,
                            CompilerDriver* compiler_driver)
     REQUIRES_SHARED(Locks::mutator_lock_);
diff --git a/compiler/optimizing/stack_map_stream.cc b/compiler/optimizing/stack_map_stream.cc
index fc8af64..a9a1e6f 100644
--- a/compiler/optimizing/stack_map_stream.cc
+++ b/compiler/optimizing/stack_map_stream.cc
@@ -13,8 +13,13 @@
  * See the License for the specific language governing permissions and
  * limitations under the License.
  */
+
 #include "stack_map_stream.h"
 
+#include "art_method.h"
+#include "runtime.h"
+#include "scoped_thread_state_change-inl.h"
+
 namespace art {
 
 void StackMapStream::BeginStackMapEntry(uint32_t dex_pc,
@@ -26,7 +31,7 @@
   DCHECK_EQ(0u, current_entry_.dex_pc) << "EndStackMapEntry not called after BeginStackMapEntry";
   DCHECK_NE(dex_pc, static_cast<uint32_t>(-1)) << "invalid dex_pc";
   current_entry_.dex_pc = dex_pc;
-  current_entry_.native_pc_offset = native_pc_offset;
+  current_entry_.native_pc_code_offset = CodeOffset::FromOffset(native_pc_offset, instruction_set_);
   current_entry_.register_mask = register_mask;
   current_entry_.sp_mask = sp_mask;
   current_entry_.num_dex_registers = num_dex_registers;
@@ -98,15 +103,27 @@
   current_dex_register_++;
 }
 
-void StackMapStream::BeginInlineInfoEntry(uint32_t method_index,
+static bool EncodeArtMethodInInlineInfo(ArtMethod* method ATTRIBUTE_UNUSED) {
+  // Note: the runtime is null only for unit testing.
+  return Runtime::Current() == nullptr || !Runtime::Current()->IsAotCompiler();
+}
+
+void StackMapStream::BeginInlineInfoEntry(ArtMethod* method,
                                           uint32_t dex_pc,
-                                          InvokeType invoke_type,
-                                          uint32_t num_dex_registers) {
+                                          uint32_t num_dex_registers,
+                                          const DexFile* outer_dex_file) {
   DCHECK(!in_inline_frame_);
   in_inline_frame_ = true;
-  current_inline_info_.method_index = method_index;
+  if (EncodeArtMethodInInlineInfo(method)) {
+    current_inline_info_.method = method;
+  } else {
+    if (dex_pc != static_cast<uint32_t>(-1) && kIsDebugBuild) {
+      ScopedObjectAccess soa(Thread::Current());
+      DCHECK(IsSameDexFile(*outer_dex_file, *method->GetDexFile()));
+    }
+    current_inline_info_.method_index = method->GetDexMethodIndexUnchecked();
+  }
   current_inline_info_.dex_pc = dex_pc;
-  current_inline_info_.invoke_type = invoke_type;
   current_inline_info_.num_dex_registers = num_dex_registers;
   current_inline_info_.dex_register_locations_start_index = dex_register_locations_.size();
   if (num_dex_registers != 0) {
@@ -127,10 +144,10 @@
   current_inline_info_ = InlineInfoEntry();
 }
 
-uint32_t StackMapStream::ComputeMaxNativePcOffset() const {
-  uint32_t max_native_pc_offset = 0u;
+CodeOffset StackMapStream::ComputeMaxNativePcCodeOffset() const {
+  CodeOffset max_native_pc_offset;
   for (const StackMapEntry& entry : stack_maps_) {
-    max_native_pc_offset = std::max(max_native_pc_offset, entry.native_pc_offset);
+    max_native_pc_offset = std::max(max_native_pc_offset, entry.native_pc_code_offset);
   }
   return max_native_pc_offset;
 }
@@ -140,8 +157,9 @@
   dex_register_maps_size_ = ComputeDexRegisterMapsSize();
   ComputeInlineInfoEncoding();  // needs dex_register_maps_size_.
   inline_info_size_ = inline_infos_.size() * inline_info_encoding_.GetEntrySize();
-  uint32_t max_native_pc_offset = ComputeMaxNativePcOffset();
-  size_t stack_map_size = stack_map_encoding_.SetFromSizes(max_native_pc_offset,
+  CodeOffset max_native_pc_offset = ComputeMaxNativePcCodeOffset();
+  // The stack map contains compressed native offsets.
+  size_t stack_map_size = stack_map_encoding_.SetFromSizes(max_native_pc_offset.CompressedValue(),
                                                            dex_pc_max_,
                                                            dex_register_maps_size_,
                                                            inline_info_size_,
@@ -229,25 +247,32 @@
 void StackMapStream::ComputeInlineInfoEncoding() {
   uint32_t method_index_max = 0;
   uint32_t dex_pc_max = DexFile::kDexNoIndex;
-  uint32_t invoke_type_max = 0;
+  uint32_t extra_data_max = 0;
 
   uint32_t inline_info_index = 0;
   for (const StackMapEntry& entry : stack_maps_) {
     for (size_t j = 0; j < entry.inlining_depth; ++j) {
       InlineInfoEntry inline_entry = inline_infos_[inline_info_index++];
-      method_index_max = std::max(method_index_max, inline_entry.method_index);
+      if (inline_entry.method == nullptr) {
+        method_index_max = std::max(method_index_max, inline_entry.method_index);
+        extra_data_max = std::max(extra_data_max, 1u);
+      } else {
+        method_index_max = std::max(
+            method_index_max, High32Bits(reinterpret_cast<uintptr_t>(inline_entry.method)));
+        extra_data_max = std::max(
+            extra_data_max, Low32Bits(reinterpret_cast<uintptr_t>(inline_entry.method)));
+      }
       if (inline_entry.dex_pc != DexFile::kDexNoIndex &&
           (dex_pc_max == DexFile::kDexNoIndex || dex_pc_max < inline_entry.dex_pc)) {
         dex_pc_max = inline_entry.dex_pc;
       }
-      invoke_type_max = std::max(invoke_type_max, static_cast<uint32_t>(inline_entry.invoke_type));
     }
   }
   DCHECK_EQ(inline_info_index, inline_infos_.size());
 
   inline_info_encoding_.SetFromSizes(method_index_max,
                                      dex_pc_max,
-                                     invoke_type_max,
+                                     extra_data_max,
                                      dex_register_maps_size_);
 }
 
@@ -295,7 +320,7 @@
     StackMapEntry entry = stack_maps_[i];
 
     stack_map.SetDexPc(stack_map_encoding_, entry.dex_pc);
-    stack_map.SetNativePcOffset(stack_map_encoding_, entry.native_pc_offset);
+    stack_map.SetNativePcCodeOffset(stack_map_encoding_, entry.native_pc_code_offset);
     stack_map.SetRegisterMask(stack_map_encoding_, entry.register_mask);
     size_t number_of_stack_mask_bits = stack_map.GetNumberOfStackMaskBits(stack_map_encoding_);
     if (entry.sp_mask != nullptr) {
@@ -354,9 +379,20 @@
       DCHECK_LE(entry.inline_infos_start_index + entry.inlining_depth, inline_infos_.size());
       for (size_t depth = 0; depth < entry.inlining_depth; ++depth) {
         InlineInfoEntry inline_entry = inline_infos_[depth + entry.inline_infos_start_index];
-        inline_info.SetMethodIndexAtDepth(inline_info_encoding_, depth, inline_entry.method_index);
+        if (inline_entry.method != nullptr) {
+          inline_info.SetMethodIndexAtDepth(
+              inline_info_encoding_,
+              depth,
+              High32Bits(reinterpret_cast<uintptr_t>(inline_entry.method)));
+          inline_info.SetExtraDataAtDepth(
+              inline_info_encoding_,
+              depth,
+              Low32Bits(reinterpret_cast<uintptr_t>(inline_entry.method)));
+        } else {
+          inline_info.SetMethodIndexAtDepth(inline_info_encoding_, depth, inline_entry.method_index);
+          inline_info.SetExtraDataAtDepth(inline_info_encoding_, depth, 1);
+        }
         inline_info.SetDexPcAtDepth(inline_info_encoding_, depth, inline_entry.dex_pc);
-        inline_info.SetInvokeTypeAtDepth(inline_info_encoding_, depth, inline_entry.invoke_type);
         if (inline_entry.num_dex_registers == 0) {
           // No dex map available.
           inline_info.SetDexRegisterMapOffsetAtDepth(inline_info_encoding_,
@@ -511,7 +547,8 @@
     StackMapEntry entry = stack_maps_[s];
 
     // Check main stack map fields.
-    DCHECK_EQ(stack_map.GetNativePcOffset(stack_map_encoding), entry.native_pc_offset);
+    DCHECK_EQ(stack_map.GetNativePcOffset(stack_map_encoding, instruction_set_),
+              entry.native_pc_code_offset.Uint32Value(instruction_set_));
     DCHECK_EQ(stack_map.GetDexPc(stack_map_encoding), entry.dex_pc);
     DCHECK_EQ(stack_map.GetRegisterMask(stack_map_encoding), entry.register_mask);
     size_t num_stack_mask_bits = stack_map.GetNumberOfStackMaskBits(stack_map_encoding);
@@ -544,10 +581,13 @@
         InlineInfoEntry inline_entry = inline_infos_[inline_info_index];
         DCHECK_EQ(inline_info.GetDexPcAtDepth(encoding.inline_info_encoding, d),
                   inline_entry.dex_pc);
-        DCHECK_EQ(inline_info.GetMethodIndexAtDepth(encoding.inline_info_encoding, d),
-                  inline_entry.method_index);
-        DCHECK_EQ(inline_info.GetInvokeTypeAtDepth(encoding.inline_info_encoding, d),
-                  inline_entry.invoke_type);
+        if (inline_info.EncodesArtMethodAtDepth(encoding.inline_info_encoding, d)) {
+          DCHECK_EQ(inline_info.GetArtMethodAtDepth(encoding.inline_info_encoding, d),
+                    inline_entry.method);
+        } else {
+          DCHECK_EQ(inline_info.GetMethodIndexAtDepth(encoding.inline_info_encoding, d),
+                    inline_entry.method_index);
+        }
 
         CheckDexRegisterMap(code_info,
                             code_info.GetDexRegisterMapAtDepth(
diff --git a/compiler/optimizing/stack_map_stream.h b/compiler/optimizing/stack_map_stream.h
index 53a9795..8fec472 100644
--- a/compiler/optimizing/stack_map_stream.h
+++ b/compiler/optimizing/stack_map_stream.h
@@ -59,8 +59,10 @@
  */
 class StackMapStream : public ValueObject {
  public:
-  explicit StackMapStream(ArenaAllocator* allocator)
+  explicit StackMapStream(ArenaAllocator* allocator,
+                          InstructionSet instruction_set)
       : allocator_(allocator),
+        instruction_set_(instruction_set),
         stack_maps_(allocator->Adapter(kArenaAllocStackMapStream)),
         location_catalog_entries_(allocator->Adapter(kArenaAllocStackMapStream)),
         location_catalog_entries_indices_(allocator->Adapter(kArenaAllocStackMapStream)),
@@ -95,7 +97,7 @@
   // See runtime/stack_map.h to know what these fields contain.
   struct StackMapEntry {
     uint32_t dex_pc;
-    uint32_t native_pc_offset;
+    CodeOffset native_pc_code_offset;
     uint32_t register_mask;
     BitVector* sp_mask;
     uint32_t num_dex_registers;
@@ -109,8 +111,8 @@
 
   struct InlineInfoEntry {
     uint32_t dex_pc;  // DexFile::kDexNoIndex for intrinsified native methods.
+    ArtMethod* method;
     uint32_t method_index;
-    InvokeType invoke_type;
     uint32_t num_dex_registers;
     BitVector* live_dex_registers_mask;
     size_t dex_register_locations_start_index;
@@ -126,10 +128,10 @@
 
   void AddDexRegisterEntry(DexRegisterLocation::Kind kind, int32_t value);
 
-  void BeginInlineInfoEntry(uint32_t method_index,
+  void BeginInlineInfoEntry(ArtMethod* method,
                             uint32_t dex_pc,
-                            InvokeType invoke_type,
-                            uint32_t num_dex_registers);
+                            uint32_t num_dex_registers,
+                            const DexFile* outer_dex_file = nullptr);
   void EndInlineInfoEntry();
 
   size_t GetNumberOfStackMaps() const {
@@ -141,11 +143,9 @@
   }
 
   void SetStackMapNativePcOffset(size_t i, uint32_t native_pc_offset) {
-    stack_maps_[i].native_pc_offset = native_pc_offset;
+    stack_maps_[i].native_pc_code_offset = CodeOffset::FromOffset(native_pc_offset, instruction_set_);
   }
 
-  uint32_t ComputeMaxNativePcOffset() const;
-
   // Prepares the stream to fill in a memory region. Must be called before FillIn.
   // Returns the size (in bytes) needed to store this stream.
   size_t PrepareForFillIn();
@@ -158,6 +158,8 @@
   size_t ComputeDexRegisterMapsSize() const;
   void ComputeInlineInfoEncoding();
 
+  CodeOffset ComputeMaxNativePcCodeOffset() const;
+
   // Returns the index of an entry with the same dex register map as the current_entry,
   // or kNoSameDexMapFound if no such entry exists.
   size_t FindEntryWithTheSameDexMap();
@@ -175,6 +177,7 @@
   void CheckCodeInfo(MemoryRegion region) const;
 
   ArenaAllocator* allocator_;
+  const InstructionSet instruction_set_;
   ArenaVector<StackMapEntry> stack_maps_;
 
   // A catalog of unique [location_kind, register_value] pairs (per method).
diff --git a/compiler/optimizing/stack_map_test.cc b/compiler/optimizing/stack_map_test.cc
index 967fd96..f68695b 100644
--- a/compiler/optimizing/stack_map_test.cc
+++ b/compiler/optimizing/stack_map_test.cc
@@ -16,6 +16,7 @@
 
 #include "stack_map.h"
 
+#include "art_method.h"
 #include "base/arena_bit_vector.h"
 #include "stack_map_stream.h"
 
@@ -46,7 +47,7 @@
 TEST(StackMapTest, Test1) {
   ArenaPool pool;
   ArenaAllocator arena(&pool);
-  StackMapStream stream(&arena);
+  StackMapStream stream(&arena, kRuntimeISA);
 
   ArenaBitVector sp_mask(&arena, 0, false);
   size_t number_of_dex_registers = 2;
@@ -77,7 +78,7 @@
   ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForDexPc(0, encoding)));
   ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(64, encoding)));
   ASSERT_EQ(0u, stack_map.GetDexPc(encoding.stack_map_encoding));
-  ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding));
+  ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
   ASSERT_EQ(0x3u, stack_map.GetRegisterMask(encoding.stack_map_encoding));
 
   ASSERT_TRUE(CheckStackMask(stack_map, encoding.stack_map_encoding, sp_mask));
@@ -127,7 +128,8 @@
 TEST(StackMapTest, Test2) {
   ArenaPool pool;
   ArenaAllocator arena(&pool);
-  StackMapStream stream(&arena);
+  StackMapStream stream(&arena, kRuntimeISA);
+  ArtMethod art_method;
 
   ArenaBitVector sp_mask1(&arena, 0, true);
   sp_mask1.SetBit(2);
@@ -137,9 +139,9 @@
   stream.BeginStackMapEntry(0, 64, 0x3, &sp_mask1, number_of_dex_registers, 2);
   stream.AddDexRegisterEntry(Kind::kInStack, 0);         // Short location.
   stream.AddDexRegisterEntry(Kind::kConstant, -2);       // Large location.
-  stream.BeginInlineInfoEntry(82, 3, kDirect, number_of_dex_registers_in_inline_info);
+  stream.BeginInlineInfoEntry(&art_method, 3, number_of_dex_registers_in_inline_info);
   stream.EndInlineInfoEntry();
-  stream.BeginInlineInfoEntry(42, 2, kStatic, number_of_dex_registers_in_inline_info);
+  stream.BeginInlineInfoEntry(&art_method, 2, number_of_dex_registers_in_inline_info);
   stream.EndInlineInfoEntry();
   stream.EndStackMapEntry();
 
@@ -191,7 +193,7 @@
     ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForDexPc(0, encoding)));
     ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(64, encoding)));
     ASSERT_EQ(0u, stack_map.GetDexPc(encoding.stack_map_encoding));
-    ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding));
+    ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
     ASSERT_EQ(0x3u, stack_map.GetRegisterMask(encoding.stack_map_encoding));
 
     ASSERT_TRUE(CheckStackMask(stack_map, encoding.stack_map_encoding, sp_mask1));
@@ -238,12 +240,10 @@
     ASSERT_TRUE(stack_map.HasInlineInfo(encoding.stack_map_encoding));
     InlineInfo inline_info = code_info.GetInlineInfoOf(stack_map, encoding);
     ASSERT_EQ(2u, inline_info.GetDepth(encoding.inline_info_encoding));
-    ASSERT_EQ(82u, inline_info.GetMethodIndexAtDepth(encoding.inline_info_encoding, 0));
-    ASSERT_EQ(42u, inline_info.GetMethodIndexAtDepth(encoding.inline_info_encoding, 1));
     ASSERT_EQ(3u, inline_info.GetDexPcAtDepth(encoding.inline_info_encoding, 0));
     ASSERT_EQ(2u, inline_info.GetDexPcAtDepth(encoding.inline_info_encoding, 1));
-    ASSERT_EQ(kDirect, inline_info.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 0));
-    ASSERT_EQ(kStatic, inline_info.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 1));
+    ASSERT_TRUE(inline_info.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 0));
+    ASSERT_TRUE(inline_info.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 1));
   }
 
   // Second stack map.
@@ -252,7 +252,7 @@
     ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForDexPc(1u, encoding)));
     ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(128u, encoding)));
     ASSERT_EQ(1u, stack_map.GetDexPc(encoding.stack_map_encoding));
-    ASSERT_EQ(128u, stack_map.GetNativePcOffset(encoding.stack_map_encoding));
+    ASSERT_EQ(128u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
     ASSERT_EQ(0xFFu, stack_map.GetRegisterMask(encoding.stack_map_encoding));
 
     ASSERT_TRUE(CheckStackMask(stack_map, encoding.stack_map_encoding, sp_mask2));
@@ -306,7 +306,7 @@
     ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForDexPc(2u, encoding)));
     ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(192u, encoding)));
     ASSERT_EQ(2u, stack_map.GetDexPc(encoding.stack_map_encoding));
-    ASSERT_EQ(192u, stack_map.GetNativePcOffset(encoding.stack_map_encoding));
+    ASSERT_EQ(192u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
     ASSERT_EQ(0xABu, stack_map.GetRegisterMask(encoding.stack_map_encoding));
 
     ASSERT_TRUE(CheckStackMask(stack_map, encoding.stack_map_encoding, sp_mask3));
@@ -360,7 +360,7 @@
     ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForDexPc(3u, encoding)));
     ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(256u, encoding)));
     ASSERT_EQ(3u, stack_map.GetDexPc(encoding.stack_map_encoding));
-    ASSERT_EQ(256u, stack_map.GetNativePcOffset(encoding.stack_map_encoding));
+    ASSERT_EQ(256u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
     ASSERT_EQ(0xCDu, stack_map.GetRegisterMask(encoding.stack_map_encoding));
 
     ASSERT_TRUE(CheckStackMask(stack_map, encoding.stack_map_encoding, sp_mask4));
@@ -412,7 +412,7 @@
 TEST(StackMapTest, TestNonLiveDexRegisters) {
   ArenaPool pool;
   ArenaAllocator arena(&pool);
-  StackMapStream stream(&arena);
+  StackMapStream stream(&arena, kRuntimeISA);
 
   ArenaBitVector sp_mask(&arena, 0, false);
   uint32_t number_of_dex_registers = 2;
@@ -442,7 +442,7 @@
   ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForDexPc(0, encoding)));
   ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(64, encoding)));
   ASSERT_EQ(0u, stack_map.GetDexPc(encoding.stack_map_encoding));
-  ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding));
+  ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
   ASSERT_EQ(0x3u, stack_map.GetRegisterMask(encoding.stack_map_encoding));
 
   ASSERT_TRUE(stack_map.HasDexRegisterMap(encoding.stack_map_encoding));
@@ -491,7 +491,7 @@
 TEST(StackMapTest, DexRegisterMapOffsetOverflow) {
   ArenaPool pool;
   ArenaAllocator arena(&pool);
-  StackMapStream stream(&arena);
+  StackMapStream stream(&arena, kRuntimeISA);
 
   ArenaBitVector sp_mask(&arena, 0, false);
   uint32_t number_of_dex_registers = 1024;
@@ -554,7 +554,7 @@
 TEST(StackMapTest, TestShareDexRegisterMap) {
   ArenaPool pool;
   ArenaAllocator arena(&pool);
-  StackMapStream stream(&arena);
+  StackMapStream stream(&arena, kRuntimeISA);
 
   ArenaBitVector sp_mask(&arena, 0, false);
   uint32_t number_of_dex_registers = 2;
@@ -612,7 +612,7 @@
 TEST(StackMapTest, TestNoDexRegisterMap) {
   ArenaPool pool;
   ArenaAllocator arena(&pool);
-  StackMapStream stream(&arena);
+  StackMapStream stream(&arena, kRuntimeISA);
 
   ArenaBitVector sp_mask(&arena, 0, false);
   uint32_t number_of_dex_registers = 0;
@@ -620,7 +620,7 @@
   stream.EndStackMapEntry();
 
   number_of_dex_registers = 1;
-  stream.BeginStackMapEntry(1, 67, 0x4, &sp_mask, number_of_dex_registers, 0);
+  stream.BeginStackMapEntry(1, 68, 0x4, &sp_mask, number_of_dex_registers, 0);
   stream.EndStackMapEntry();
 
   size_t size = stream.PrepareForFillIn();
@@ -641,7 +641,7 @@
   ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForDexPc(0, encoding)));
   ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(64, encoding)));
   ASSERT_EQ(0u, stack_map.GetDexPc(encoding.stack_map_encoding));
-  ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding));
+  ASSERT_EQ(64u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
   ASSERT_EQ(0x3u, stack_map.GetRegisterMask(encoding.stack_map_encoding));
 
   ASSERT_FALSE(stack_map.HasDexRegisterMap(encoding.stack_map_encoding));
@@ -649,9 +649,9 @@
 
   stack_map = code_info.GetStackMapAt(1, encoding);
   ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForDexPc(1, encoding)));
-  ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(67, encoding)));
+  ASSERT_TRUE(stack_map.Equals(code_info.GetStackMapForNativePcOffset(68, encoding)));
   ASSERT_EQ(1u, stack_map.GetDexPc(encoding.stack_map_encoding));
-  ASSERT_EQ(67u, stack_map.GetNativePcOffset(encoding.stack_map_encoding));
+  ASSERT_EQ(68u, stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA));
   ASSERT_EQ(0x4u, stack_map.GetRegisterMask(encoding.stack_map_encoding));
 
   ASSERT_FALSE(stack_map.HasDexRegisterMap(encoding.stack_map_encoding));
@@ -661,7 +661,8 @@
 TEST(StackMapTest, InlineTest) {
   ArenaPool pool;
   ArenaAllocator arena(&pool);
-  StackMapStream stream(&arena);
+  StackMapStream stream(&arena, kRuntimeISA);
+  ArtMethod art_method;
 
   ArenaBitVector sp_mask1(&arena, 0, true);
   sp_mask1.SetBit(2);
@@ -672,10 +673,10 @@
   stream.AddDexRegisterEntry(Kind::kInStack, 0);
   stream.AddDexRegisterEntry(Kind::kConstant, 4);
 
-  stream.BeginInlineInfoEntry(42, 2, kStatic, 1);
+  stream.BeginInlineInfoEntry(&art_method, 2, 1);
   stream.AddDexRegisterEntry(Kind::kInStack, 8);
   stream.EndInlineInfoEntry();
-  stream.BeginInlineInfoEntry(82, 3, kStatic, 3);
+  stream.BeginInlineInfoEntry(&art_method, 3, 3);
   stream.AddDexRegisterEntry(Kind::kInStack, 16);
   stream.AddDexRegisterEntry(Kind::kConstant, 20);
   stream.AddDexRegisterEntry(Kind::kInRegister, 15);
@@ -688,15 +689,15 @@
   stream.AddDexRegisterEntry(Kind::kInStack, 56);
   stream.AddDexRegisterEntry(Kind::kConstant, 0);
 
-  stream.BeginInlineInfoEntry(42, 2, kDirect, 1);
+  stream.BeginInlineInfoEntry(&art_method, 2, 1);
   stream.AddDexRegisterEntry(Kind::kInStack, 12);
   stream.EndInlineInfoEntry();
-  stream.BeginInlineInfoEntry(82, 3, kStatic, 3);
+  stream.BeginInlineInfoEntry(&art_method, 3, 3);
   stream.AddDexRegisterEntry(Kind::kInStack, 80);
   stream.AddDexRegisterEntry(Kind::kConstant, 10);
   stream.AddDexRegisterEntry(Kind::kInRegister, 5);
   stream.EndInlineInfoEntry();
-  stream.BeginInlineInfoEntry(52, 5, kVirtual, 0);
+  stream.BeginInlineInfoEntry(&art_method, 5, 0);
   stream.EndInlineInfoEntry();
 
   stream.EndStackMapEntry();
@@ -712,12 +713,12 @@
   stream.AddDexRegisterEntry(Kind::kInStack, 56);
   stream.AddDexRegisterEntry(Kind::kConstant, 0);
 
-  stream.BeginInlineInfoEntry(42, 2, kVirtual, 0);
+  stream.BeginInlineInfoEntry(&art_method, 2, 0);
   stream.EndInlineInfoEntry();
-  stream.BeginInlineInfoEntry(52, 5, kInterface, 1);
+  stream.BeginInlineInfoEntry(&art_method, 5, 1);
   stream.AddDexRegisterEntry(Kind::kInRegister, 2);
   stream.EndInlineInfoEntry();
-  stream.BeginInlineInfoEntry(52, 10, kStatic, 2);
+  stream.BeginInlineInfoEntry(&art_method, 10, 2);
   stream.AddDexRegisterEntry(Kind::kNone, 0);
   stream.AddDexRegisterEntry(Kind::kInRegister, 3);
   stream.EndInlineInfoEntry();
@@ -743,11 +744,9 @@
     InlineInfo if0 = ci.GetInlineInfoOf(sm0, encoding);
     ASSERT_EQ(2u, if0.GetDepth(encoding.inline_info_encoding));
     ASSERT_EQ(2u, if0.GetDexPcAtDepth(encoding.inline_info_encoding, 0));
-    ASSERT_EQ(42u, if0.GetMethodIndexAtDepth(encoding.inline_info_encoding, 0));
-    ASSERT_EQ(kStatic, if0.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 0));
+    ASSERT_TRUE(if0.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 0));
     ASSERT_EQ(3u, if0.GetDexPcAtDepth(encoding.inline_info_encoding, 1));
-    ASSERT_EQ(82u, if0.GetMethodIndexAtDepth(encoding.inline_info_encoding, 1));
-    ASSERT_EQ(kStatic, if0.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 1));
+    ASSERT_TRUE(if0.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 1));
 
     DexRegisterMap dex_registers1 = ci.GetDexRegisterMapAtDepth(0, if0, encoding, 1);
     ASSERT_EQ(8, dex_registers1.GetStackOffsetInBytes(0, 1, ci, encoding));
@@ -769,14 +768,11 @@
     InlineInfo if1 = ci.GetInlineInfoOf(sm1, encoding);
     ASSERT_EQ(3u, if1.GetDepth(encoding.inline_info_encoding));
     ASSERT_EQ(2u, if1.GetDexPcAtDepth(encoding.inline_info_encoding, 0));
-    ASSERT_EQ(42u, if1.GetMethodIndexAtDepth(encoding.inline_info_encoding, 0));
-    ASSERT_EQ(kDirect, if1.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 0));
+    ASSERT_TRUE(if1.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 0));
     ASSERT_EQ(3u, if1.GetDexPcAtDepth(encoding.inline_info_encoding, 1));
-    ASSERT_EQ(82u, if1.GetMethodIndexAtDepth(encoding.inline_info_encoding, 1));
-    ASSERT_EQ(kStatic, if1.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 1));
+    ASSERT_TRUE(if1.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 1));
     ASSERT_EQ(5u, if1.GetDexPcAtDepth(encoding.inline_info_encoding, 2));
-    ASSERT_EQ(52u, if1.GetMethodIndexAtDepth(encoding.inline_info_encoding, 2));
-    ASSERT_EQ(kVirtual, if1.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 2));
+    ASSERT_TRUE(if1.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 2));
 
     DexRegisterMap dex_registers1 = ci.GetDexRegisterMapAtDepth(0, if1, encoding, 1);
     ASSERT_EQ(12, dex_registers1.GetStackOffsetInBytes(0, 1, ci, encoding));
@@ -810,14 +806,11 @@
     InlineInfo if2 = ci.GetInlineInfoOf(sm3, encoding);
     ASSERT_EQ(3u, if2.GetDepth(encoding.inline_info_encoding));
     ASSERT_EQ(2u, if2.GetDexPcAtDepth(encoding.inline_info_encoding, 0));
-    ASSERT_EQ(42u, if2.GetMethodIndexAtDepth(encoding.inline_info_encoding, 0));
-    ASSERT_EQ(kVirtual, if2.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 0));
+    ASSERT_TRUE(if2.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 0));
     ASSERT_EQ(5u, if2.GetDexPcAtDepth(encoding.inline_info_encoding, 1));
-    ASSERT_EQ(52u, if2.GetMethodIndexAtDepth(encoding.inline_info_encoding, 1));
-    ASSERT_EQ(kInterface, if2.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 1));
+    ASSERT_TRUE(if2.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 1));
     ASSERT_EQ(10u, if2.GetDexPcAtDepth(encoding.inline_info_encoding, 2));
-    ASSERT_EQ(52u, if2.GetMethodIndexAtDepth(encoding.inline_info_encoding, 2));
-    ASSERT_EQ(kStatic, if2.GetInvokeTypeAtDepth(encoding.inline_info_encoding, 2));
+    ASSERT_TRUE(if2.EncodesArtMethodAtDepth(encoding.inline_info_encoding, 2));
 
     ASSERT_FALSE(if2.HasDexRegisterMapAtDepth(encoding.inline_info_encoding, 0));
 
@@ -830,4 +823,20 @@
   }
 }
 
+TEST(StackMapTest, CodeOffsetTest) {
+  // Test minimum alignments, encoding, and decoding.
+  CodeOffset offset_thumb2 = CodeOffset::FromOffset(kThumb2InstructionAlignment, kThumb2);
+  CodeOffset offset_arm64 = CodeOffset::FromOffset(kArm64InstructionAlignment, kArm64);
+  CodeOffset offset_x86 = CodeOffset::FromOffset(kX86InstructionAlignment, kX86);
+  CodeOffset offset_x86_64 = CodeOffset::FromOffset(kX86_64InstructionAlignment, kX86_64);
+  CodeOffset offset_mips = CodeOffset::FromOffset(kMipsInstructionAlignment, kMips);
+  CodeOffset offset_mips64 = CodeOffset::FromOffset(kMips64InstructionAlignment, kMips64);
+  EXPECT_EQ(offset_thumb2.Uint32Value(kThumb2), kThumb2InstructionAlignment);
+  EXPECT_EQ(offset_arm64.Uint32Value(kArm64), kArm64InstructionAlignment);
+  EXPECT_EQ(offset_x86.Uint32Value(kX86), kX86InstructionAlignment);
+  EXPECT_EQ(offset_x86_64.Uint32Value(kX86_64), kX86_64InstructionAlignment);
+  EXPECT_EQ(offset_mips.Uint32Value(kMips), kMipsInstructionAlignment);
+  EXPECT_EQ(offset_mips64.Uint32Value(kMips64), kMips64InstructionAlignment);
+}
+
 }  // namespace art
diff --git a/compiler/utils/assembler_thumb_test_expected.cc.inc b/compiler/utils/assembler_thumb_test_expected.cc.inc
index a3fce02..f132e27 100644
--- a/compiler/utils/assembler_thumb_test_expected.cc.inc
+++ b/compiler/utils/assembler_thumb_test_expected.cc.inc
@@ -5610,7 +5610,7 @@
   " 214:	ecbd 8a10 	vpop	{s16-s31}\n",
   " 218:	e8bd 8de0 	ldmia.w	sp!, {r5, r6, r7, r8, sl, fp, pc}\n",
   " 21c:	4660      	mov	r0, ip\n",
-  " 21e:	f8d9 c2ac 	ldr.w	ip, [r9, #684]	; 0x2ac\n",
+  " 21e:	f8d9 c2a4 	ldr.w	ip, [r9, #676]	; 0x2a4\n",
   " 222:	47e0      	blx	ip\n",
   nullptr
 };
diff --git a/compiler/utils/mips64/assembler_mips64_test.cc b/compiler/utils/mips64/assembler_mips64_test.cc
index f2cbebb..74b8f06 100644
--- a/compiler/utils/mips64/assembler_mips64_test.cc
+++ b/compiler/utils/mips64/assembler_mips64_test.cc
@@ -283,6 +283,38 @@
 // FP Operations //
 ///////////////////
 
+TEST_F(AssemblerMIPS64Test, AddS) {
+  DriverStr(RepeatFFF(&mips64::Mips64Assembler::AddS, "add.s ${reg1}, ${reg2}, ${reg3}"), "add.s");
+}
+
+TEST_F(AssemblerMIPS64Test, AddD) {
+  DriverStr(RepeatFFF(&mips64::Mips64Assembler::AddD, "add.d ${reg1}, ${reg2}, ${reg3}"), "add.d");
+}
+
+TEST_F(AssemblerMIPS64Test, SubS) {
+  DriverStr(RepeatFFF(&mips64::Mips64Assembler::SubS, "sub.s ${reg1}, ${reg2}, ${reg3}"), "sub.s");
+}
+
+TEST_F(AssemblerMIPS64Test, SubD) {
+  DriverStr(RepeatFFF(&mips64::Mips64Assembler::SubD, "sub.d ${reg1}, ${reg2}, ${reg3}"), "sub.d");
+}
+
+TEST_F(AssemblerMIPS64Test, MulS) {
+  DriverStr(RepeatFFF(&mips64::Mips64Assembler::MulS, "mul.s ${reg1}, ${reg2}, ${reg3}"), "mul.s");
+}
+
+TEST_F(AssemblerMIPS64Test, MulD) {
+  DriverStr(RepeatFFF(&mips64::Mips64Assembler::MulD, "mul.d ${reg1}, ${reg2}, ${reg3}"), "mul.d");
+}
+
+TEST_F(AssemblerMIPS64Test, DivS) {
+  DriverStr(RepeatFFF(&mips64::Mips64Assembler::DivS, "div.s ${reg1}, ${reg2}, ${reg3}"), "div.s");
+}
+
+TEST_F(AssemblerMIPS64Test, DivD) {
+  DriverStr(RepeatFFF(&mips64::Mips64Assembler::DivD, "div.d ${reg1}, ${reg2}, ${reg3}"), "div.d");
+}
+
 TEST_F(AssemblerMIPS64Test, SqrtS) {
   DriverStr(RepeatFF(&mips64::Mips64Assembler::SqrtS, "sqrt.s ${reg1}, ${reg2}"), "sqrt.s");
 }
@@ -567,6 +599,26 @@
   DriverStr(RepeatRF(&mips64::Mips64Assembler::Dmtc1, "dmtc1 ${reg1}, ${reg2}"), "Dmtc1");
 }
 
+TEST_F(AssemblerMIPS64Test, Lwc1) {
+  DriverStr(RepeatFRIb(&mips64::Mips64Assembler::Lwc1, -16, "lwc1 ${reg1}, {imm}(${reg2})"),
+            "lwc1");
+}
+
+TEST_F(AssemblerMIPS64Test, Ldc1) {
+  DriverStr(RepeatFRIb(&mips64::Mips64Assembler::Ldc1, -16, "ldc1 ${reg1}, {imm}(${reg2})"),
+            "ldc1");
+}
+
+TEST_F(AssemblerMIPS64Test, Swc1) {
+  DriverStr(RepeatFRIb(&mips64::Mips64Assembler::Swc1, -16, "swc1 ${reg1}, {imm}(${reg2})"),
+            "swc1");
+}
+
+TEST_F(AssemblerMIPS64Test, Sdc1) {
+  DriverStr(RepeatFRIb(&mips64::Mips64Assembler::Sdc1, -16, "sdc1 ${reg1}, {imm}(${reg2})"),
+            "sdc1");
+}
+
 ////////////////
 // CALL / JMP //
 ////////////////
@@ -850,6 +902,16 @@
   DriverStr(RepeatRIb(&mips64::Mips64Assembler::Ldpc, 18, code), "Ldpc");
 }
 
+TEST_F(AssemblerMIPS64Test, Auipc) {
+  DriverStr(RepeatRIb(&mips64::Mips64Assembler::Auipc, 16, "auipc ${reg}, {imm}"), "Auipc");
+}
+
+TEST_F(AssemblerMIPS64Test, Addiupc) {
+  // The comment from the Lwpc() test applies to this Addiupc() test as well.
+  const char* code = ".set imm, {imm}\naddiupc ${reg}, (imm - ((imm & 0x40000) << 1)) << 2";
+  DriverStr(RepeatRIb(&mips64::Mips64Assembler::Addiupc, 19, code), "Addiupc");
+}
+
 TEST_F(AssemblerMIPS64Test, LoadFarthestNearLabelAddress) {
   mips64::Mips64Label label;
   __ LoadLabelAddress(mips64::V0, &label);
@@ -1079,6 +1141,188 @@
   EXPECT_EQ(__ GetLabelLocation(literal->GetLabel()), (5 + kAdduCount) * 4);
 }
 
+TEST_F(AssemblerMIPS64Test, Addu) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Addu, "addu ${reg1}, ${reg2}, ${reg3}"), "addu");
+}
+
+TEST_F(AssemblerMIPS64Test, Addiu) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Addiu, -16, "addiu ${reg1}, ${reg2}, {imm}"),
+            "addiu");
+}
+
+TEST_F(AssemblerMIPS64Test, Daddu) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Daddu, "daddu ${reg1}, ${reg2}, ${reg3}"), "daddu");
+}
+
+TEST_F(AssemblerMIPS64Test, Daddiu) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Daddiu, -16, "daddiu ${reg1}, ${reg2}, {imm}"),
+            "daddiu");
+}
+
+TEST_F(AssemblerMIPS64Test, Subu) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Subu, "subu ${reg1}, ${reg2}, ${reg3}"), "subu");
+}
+
+TEST_F(AssemblerMIPS64Test, Dsubu) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Dsubu, "dsubu ${reg1}, ${reg2}, ${reg3}"), "dsubu");
+}
+
+TEST_F(AssemblerMIPS64Test, MulR6) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::MulR6, "mul ${reg1}, ${reg2}, ${reg3}"), "mulR6");
+}
+
+TEST_F(AssemblerMIPS64Test, DivR6) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::DivR6, "div ${reg1}, ${reg2}, ${reg3}"), "divR6");
+}
+
+TEST_F(AssemblerMIPS64Test, ModR6) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::ModR6, "mod ${reg1}, ${reg2}, ${reg3}"), "modR6");
+}
+
+TEST_F(AssemblerMIPS64Test, DivuR6) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::DivuR6, "divu ${reg1}, ${reg2}, ${reg3}"),
+            "divuR6");
+}
+
+TEST_F(AssemblerMIPS64Test, ModuR6) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::ModuR6, "modu ${reg1}, ${reg2}, ${reg3}"),
+            "moduR6");
+}
+
+TEST_F(AssemblerMIPS64Test, Dmul) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Dmul, "dmul ${reg1}, ${reg2}, ${reg3}"), "dmul");
+}
+
+TEST_F(AssemblerMIPS64Test, Ddiv) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Ddiv, "ddiv ${reg1}, ${reg2}, ${reg3}"), "ddiv");
+}
+
+TEST_F(AssemblerMIPS64Test, Dmod) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Dmod, "dmod ${reg1}, ${reg2}, ${reg3}"), "dmod");
+}
+
+TEST_F(AssemblerMIPS64Test, Ddivu) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Ddivu, "ddivu ${reg1}, ${reg2}, ${reg3}"), "ddivu");
+}
+
+TEST_F(AssemblerMIPS64Test, Dmodu) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Dmodu, "dmodu ${reg1}, ${reg2}, ${reg3}"), "dmodu");
+}
+
+TEST_F(AssemblerMIPS64Test, And) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::And, "and ${reg1}, ${reg2}, ${reg3}"), "and");
+}
+
+TEST_F(AssemblerMIPS64Test, Andi) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Andi, 16, "andi ${reg1}, ${reg2}, {imm}"), "andi");
+}
+
+TEST_F(AssemblerMIPS64Test, Or) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Or, "or ${reg1}, ${reg2}, ${reg3}"), "or");
+}
+
+TEST_F(AssemblerMIPS64Test, Ori) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Ori, 16, "ori ${reg1}, ${reg2}, {imm}"), "ori");
+}
+
+TEST_F(AssemblerMIPS64Test, Xor) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Xor, "xor ${reg1}, ${reg2}, ${reg3}"), "xor");
+}
+
+TEST_F(AssemblerMIPS64Test, Xori) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Xori, 16, "xori ${reg1}, ${reg2}, {imm}"), "xori");
+}
+
+TEST_F(AssemblerMIPS64Test, Nor) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Nor, "nor ${reg1}, ${reg2}, ${reg3}"), "nor");
+}
+
+TEST_F(AssemblerMIPS64Test, Lb) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Lb, -16, "lb ${reg1}, {imm}(${reg2})"), "lb");
+}
+
+TEST_F(AssemblerMIPS64Test, Lh) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Lh, -16, "lh ${reg1}, {imm}(${reg2})"), "lh");
+}
+
+TEST_F(AssemblerMIPS64Test, Lw) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Lw, -16, "lw ${reg1}, {imm}(${reg2})"), "lw");
+}
+
+TEST_F(AssemblerMIPS64Test, Ld) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Ld, -16, "ld ${reg1}, {imm}(${reg2})"), "ld");
+}
+
+TEST_F(AssemblerMIPS64Test, Lbu) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Lbu, -16, "lbu ${reg1}, {imm}(${reg2})"), "lbu");
+}
+
+TEST_F(AssemblerMIPS64Test, Lhu) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Lhu, -16, "lhu ${reg1}, {imm}(${reg2})"), "lhu");
+}
+
+TEST_F(AssemblerMIPS64Test, Lwu) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Lwu, -16, "lwu ${reg1}, {imm}(${reg2})"), "lwu");
+}
+
+TEST_F(AssemblerMIPS64Test, Lui) {
+  DriverStr(RepeatRIb(&mips64::Mips64Assembler::Lui, 16, "lui ${reg}, {imm}"), "lui");
+}
+
+TEST_F(AssemblerMIPS64Test, Dahi) {
+  DriverStr(RepeatRIb(&mips64::Mips64Assembler::Dahi, 16, "dahi ${reg}, ${reg}, {imm}"), "dahi");
+}
+
+TEST_F(AssemblerMIPS64Test, Dati) {
+  DriverStr(RepeatRIb(&mips64::Mips64Assembler::Dati, 16, "dati ${reg}, ${reg}, {imm}"), "dati");
+}
+
+TEST_F(AssemblerMIPS64Test, Sb) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Sb, -16, "sb ${reg1}, {imm}(${reg2})"), "sb");
+}
+
+TEST_F(AssemblerMIPS64Test, Sh) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Sh, -16, "sh ${reg1}, {imm}(${reg2})"), "sh");
+}
+
+TEST_F(AssemblerMIPS64Test, Sw) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Sw, -16, "sw ${reg1}, {imm}(${reg2})"), "sw");
+}
+
+TEST_F(AssemblerMIPS64Test, Sd) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Sd, -16, "sd ${reg1}, {imm}(${reg2})"), "sd");
+}
+
+TEST_F(AssemblerMIPS64Test, Slt) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Slt, "slt ${reg1}, ${reg2}, ${reg3}"), "slt");
+}
+
+TEST_F(AssemblerMIPS64Test, Sltu) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Sltu, "sltu ${reg1}, ${reg2}, ${reg3}"), "sltu");
+}
+
+TEST_F(AssemblerMIPS64Test, Slti) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Slti, -16, "slti ${reg1}, ${reg2}, {imm}"),
+            "slti");
+}
+
+TEST_F(AssemblerMIPS64Test, Sltiu) {
+  DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Sltiu, -16, "sltiu ${reg1}, ${reg2}, {imm}"),
+            "sltiu");
+}
+
+TEST_F(AssemblerMIPS64Test, Move) {
+  DriverStr(RepeatRR(&mips64::Mips64Assembler::Move, "or ${reg1}, ${reg2}, $zero"), "move");
+}
+
+TEST_F(AssemblerMIPS64Test, Clear) {
+  DriverStr(RepeatR(&mips64::Mips64Assembler::Clear, "or ${reg}, $zero, $zero"), "clear");
+}
+
+TEST_F(AssemblerMIPS64Test, Not) {
+  DriverStr(RepeatRR(&mips64::Mips64Assembler::Not, "nor ${reg1}, ${reg2}, $zero"), "not");
+}
+
 TEST_F(AssemblerMIPS64Test, Bitswap) {
   DriverStr(RepeatRR(&mips64::Mips64Assembler::Bitswap, "bitswap ${reg1}, ${reg2}"), "bitswap");
 }
@@ -1230,6 +1474,18 @@
             "dsra32");
 }
 
+TEST_F(AssemblerMIPS64Test, Dsllv) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Dsllv, "dsllv ${reg1}, ${reg2}, ${reg3}"), "dsllv");
+}
+
+TEST_F(AssemblerMIPS64Test, Dsrlv) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Dsrlv, "dsrlv ${reg1}, ${reg2}, ${reg3}"), "dsrlv");
+}
+
+TEST_F(AssemblerMIPS64Test, Dsrav) {
+  DriverStr(RepeatRRR(&mips64::Mips64Assembler::Dsrav, "dsrav ${reg1}, ${reg2}, ${reg3}"), "dsrav");
+}
+
 TEST_F(AssemblerMIPS64Test, Sc) {
   DriverStr(RepeatRRIb(&mips64::Mips64Assembler::Sc, -9, "sc ${reg1}, {imm}(${reg2})"), "sc");
 }
diff --git a/compiler/utils/x86/assembler_x86.cc b/compiler/utils/x86/assembler_x86.cc
index cd30872..d3b15ac 100644
--- a/compiler/utils/x86/assembler_x86.cc
+++ b/compiler/utils/x86/assembler_x86.cc
@@ -350,6 +350,38 @@
 }
 
 
+void X86Assembler::movaps(XmmRegister dst, const Address& src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x0F);
+  EmitUint8(0x28);
+  EmitOperand(dst, src);
+}
+
+
+void X86Assembler::movups(XmmRegister dst, const Address& src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x0F);
+  EmitUint8(0x10);
+  EmitOperand(dst, src);
+}
+
+
+void X86Assembler::movaps(const Address& dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x0F);
+  EmitUint8(0x29);
+  EmitOperand(src, dst);
+}
+
+
+void X86Assembler::movups(const Address& dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x0F);
+  EmitUint8(0x11);
+  EmitOperand(src, dst);
+}
+
+
 void X86Assembler::movss(XmmRegister dst, const Address& src) {
   AssemblerBuffer::EnsureCapacity ensured(&buffer_);
   EmitUint8(0xF3);
@@ -467,6 +499,83 @@
 }
 
 
+void X86Assembler::addps(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x0F);
+  EmitUint8(0x58);
+  EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::subps(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x0F);
+  EmitUint8(0x5C);
+  EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::mulps(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x0F);
+  EmitUint8(0x59);
+  EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::divps(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x0F);
+  EmitUint8(0x5E);
+  EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::movapd(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitUint8(0x0F);
+  EmitUint8(0x28);
+  EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::movapd(XmmRegister dst, const Address& src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitUint8(0x0F);
+  EmitUint8(0x28);
+  EmitOperand(dst, src);
+}
+
+
+void X86Assembler::movupd(XmmRegister dst, const Address& src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitUint8(0x0F);
+  EmitUint8(0x10);
+  EmitOperand(dst, src);
+}
+
+
+void X86Assembler::movapd(const Address& dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitUint8(0x0F);
+  EmitUint8(0x29);
+  EmitOperand(src, dst);
+}
+
+
+void X86Assembler::movupd(const Address& dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitUint8(0x0F);
+  EmitUint8(0x11);
+  EmitOperand(src, dst);
+}
+
+
 void X86Assembler::flds(const Address& src) {
   AssemblerBuffer::EnsureCapacity ensured(&buffer_);
   EmitUint8(0xD9);
@@ -638,6 +747,42 @@
 }
 
 
+void X86Assembler::addpd(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitUint8(0x0F);
+  EmitUint8(0x58);
+  EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::subpd(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitUint8(0x0F);
+  EmitUint8(0x5C);
+  EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::mulpd(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitUint8(0x0F);
+  EmitUint8(0x59);
+  EmitXmmRegisterOperand(dst, src);
+}
+
+
+void X86Assembler::divpd(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitUint8(0x0F);
+  EmitUint8(0x5E);
+  EmitXmmRegisterOperand(dst, src);
+}
+
+
 void X86Assembler::cvtsi2ss(XmmRegister dst, Register src) {
   AssemblerBuffer::EnsureCapacity ensured(&buffer_);
   EmitUint8(0xF3);
diff --git a/compiler/utils/x86/assembler_x86.h b/compiler/utils/x86/assembler_x86.h
index 114986b..a93616c 100644
--- a/compiler/utils/x86/assembler_x86.h
+++ b/compiler/utils/x86/assembler_x86.h
@@ -371,7 +371,12 @@
 
   void setb(Condition condition, Register dst);
 
-  void movaps(XmmRegister dst, XmmRegister src);
+  void movaps(XmmRegister dst, XmmRegister src);     // move
+  void movaps(XmmRegister dst, const Address& src);  // load aligned
+  void movups(XmmRegister dst, const Address& src);  // load unaligned
+  void movaps(const Address& dst, XmmRegister src);  // store aligned
+  void movups(const Address& dst, XmmRegister src);  // store unaligned
+
   void movss(XmmRegister dst, const Address& src);
   void movss(const Address& dst, XmmRegister src);
   void movss(XmmRegister dst, XmmRegister src);
@@ -388,6 +393,17 @@
   void divss(XmmRegister dst, XmmRegister src);
   void divss(XmmRegister dst, const Address& src);
 
+  void addps(XmmRegister dst, XmmRegister src);  // no addr variant (for now)
+  void subps(XmmRegister dst, XmmRegister src);
+  void mulps(XmmRegister dst, XmmRegister src);
+  void divps(XmmRegister dst, XmmRegister src);
+
+  void movapd(XmmRegister dst, XmmRegister src);     // move
+  void movapd(XmmRegister dst, const Address& src);  // load aligned
+  void movupd(XmmRegister dst, const Address& src);  // load unaligned
+  void movapd(const Address& dst, XmmRegister src);  // store aligned
+  void movupd(const Address& dst, XmmRegister src);  // store unaligned
+
   void movsd(XmmRegister dst, const Address& src);
   void movsd(const Address& dst, XmmRegister src);
   void movsd(XmmRegister dst, XmmRegister src);
@@ -409,6 +425,11 @@
   void divsd(XmmRegister dst, XmmRegister src);
   void divsd(XmmRegister dst, const Address& src);
 
+  void addpd(XmmRegister dst, XmmRegister src);  // no addr variant (for now)
+  void subpd(XmmRegister dst, XmmRegister src);
+  void mulpd(XmmRegister dst, XmmRegister src);
+  void divpd(XmmRegister dst, XmmRegister src);
+
   void cvtsi2ss(XmmRegister dst, Register src);
   void cvtsi2sd(XmmRegister dst, Register src);
 
diff --git a/compiler/utils/x86/assembler_x86_test.cc b/compiler/utils/x86/assembler_x86_test.cc
index 9bae6c2..4d60a12 100644
--- a/compiler/utils/x86/assembler_x86_test.cc
+++ b/compiler/utils/x86/assembler_x86_test.cc
@@ -423,6 +423,98 @@
   DriverStr(expected, "TestlAddressImmediate");
 }
 
+TEST_F(AssemblerX86Test, Movaps) {
+  DriverStr(RepeatFF(&x86::X86Assembler::movaps, "movaps %{reg2}, %{reg1}"), "movaps");
+}
+
+TEST_F(AssemblerX86Test, MovapsAddr) {
+  GetAssembler()->movaps(x86::XmmRegister(x86::XMM0), x86::Address(x86::Register(x86::ESP), 4));
+  GetAssembler()->movaps(x86::Address(x86::Register(x86::ESP), 2), x86::XmmRegister(x86::XMM1));
+  const char* expected =
+    "movaps 0x4(%ESP), %xmm0\n"
+    "movaps %xmm1, 0x2(%ESP)\n";
+  DriverStr(expected, "movaps_address");
+}
+
+TEST_F(AssemblerX86Test, MovupsAddr) {
+  GetAssembler()->movups(x86::XmmRegister(x86::XMM0), x86::Address(x86::Register(x86::ESP), 4));
+  GetAssembler()->movups(x86::Address(x86::Register(x86::ESP), 2), x86::XmmRegister(x86::XMM1));
+  const char* expected =
+    "movups 0x4(%ESP), %xmm0\n"
+    "movups %xmm1, 0x2(%ESP)\n";
+  DriverStr(expected, "movups_address");
+}
+
+TEST_F(AssemblerX86Test, Movapd) {
+  DriverStr(RepeatFF(&x86::X86Assembler::movapd, "movapd %{reg2}, %{reg1}"), "movapd");
+}
+
+TEST_F(AssemblerX86Test, MovapdAddr) {
+  GetAssembler()->movapd(x86::XmmRegister(x86::XMM0), x86::Address(x86::Register(x86::ESP), 4));
+  GetAssembler()->movapd(x86::Address(x86::Register(x86::ESP), 2), x86::XmmRegister(x86::XMM1));
+  const char* expected =
+    "movapd 0x4(%ESP), %xmm0\n"
+    "movapd %xmm1, 0x2(%ESP)\n";
+  DriverStr(expected, "movapd_address");
+}
+
+TEST_F(AssemblerX86Test, MovupdAddr) {
+  GetAssembler()->movupd(x86::XmmRegister(x86::XMM0), x86::Address(x86::Register(x86::ESP), 4));
+  GetAssembler()->movupd(x86::Address(x86::Register(x86::ESP), 2), x86::XmmRegister(x86::XMM1));
+  const char* expected =
+    "movupd 0x4(%ESP), %xmm0\n"
+    "movupd %xmm1, 0x2(%ESP)\n";
+  DriverStr(expected, "movupd_address");
+}
+
+TEST_F(AssemblerX86Test, AddPS) {
+  GetAssembler()->addps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+  const char* expected = "addps %xmm1, %xmm0\n";
+  DriverStr(expected, "addps");
+}
+
+TEST_F(AssemblerX86Test, AddPD) {
+  GetAssembler()->addpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+  const char* expected = "addpd %xmm1, %xmm0\n";
+  DriverStr(expected, "addpd");
+}
+
+TEST_F(AssemblerX86Test, SubPS) {
+  GetAssembler()->subps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+  const char* expected = "subps %xmm1, %xmm0\n";
+  DriverStr(expected, "subps");
+}
+
+TEST_F(AssemblerX86Test, SubPD) {
+  GetAssembler()->subpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+  const char* expected = "subpd %xmm1, %xmm0\n";
+  DriverStr(expected, "subpd");
+}
+
+TEST_F(AssemblerX86Test, MulPS) {
+  GetAssembler()->mulps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+  const char* expected = "mulps %xmm1, %xmm0\n";
+  DriverStr(expected, "mulps");
+}
+
+TEST_F(AssemblerX86Test, MulPD) {
+  GetAssembler()->mulpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+  const char* expected = "mulpd %xmm1, %xmm0\n";
+  DriverStr(expected, "mulpd");
+}
+
+TEST_F(AssemblerX86Test, DivPS) {
+  GetAssembler()->divps(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+  const char* expected = "divps %xmm1, %xmm0\n";
+  DriverStr(expected, "divps");
+}
+
+TEST_F(AssemblerX86Test, DivPD) {
+  GetAssembler()->divpd(x86::XmmRegister(x86::XMM0), x86::XmmRegister(x86::XMM1));
+  const char* expected = "divpd %xmm1, %xmm0\n";
+  DriverStr(expected, "divpd");
+}
+
 /////////////////
 // Near labels //
 /////////////////
diff --git a/compiler/utils/x86_64/assembler_x86_64.cc b/compiler/utils/x86_64/assembler_x86_64.cc
index e9a0607..2366b68 100644
--- a/compiler/utils/x86_64/assembler_x86_64.cc
+++ b/compiler/utils/x86_64/assembler_x86_64.cc
@@ -386,6 +386,42 @@
 }
 
 
+void X86_64Assembler::movaps(XmmRegister dst, const Address& src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x28);
+  EmitOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movups(XmmRegister dst, const Address& src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x10);
+  EmitOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movaps(const Address& dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitOptionalRex32(src, dst);
+  EmitUint8(0x0F);
+  EmitUint8(0x29);
+  EmitOperand(src.LowBits(), dst);
+}
+
+
+void X86_64Assembler::movups(const Address& dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitOptionalRex32(src, dst);
+  EmitUint8(0x0F);
+  EmitUint8(0x11);
+  EmitOperand(src.LowBits(), dst);
+}
+
+
 void X86_64Assembler::movss(XmmRegister dst, const Address& src) {
   AssemblerBuffer::EnsureCapacity ensured(&buffer_);
   EmitUint8(0xF3);
@@ -539,6 +575,42 @@
 }
 
 
+void X86_64Assembler::addps(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x58);
+  EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::subps(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x5C);
+  EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::mulps(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x59);
+  EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::divps(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x5E);
+  EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
 void X86_64Assembler::flds(const Address& src) {
   AssemblerBuffer::EnsureCapacity ensured(&buffer_);
   EmitUint8(0xD9);
@@ -560,6 +632,56 @@
 }
 
 
+void X86_64Assembler::movapd(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x28);
+  EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movapd(XmmRegister dst, const Address& src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x28);
+  EmitOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movupd(XmmRegister dst, const Address& src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x10);
+  EmitOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::movapd(const Address& dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitOptionalRex32(src, dst);
+  EmitUint8(0x0F);
+  EmitUint8(0x29);
+  EmitOperand(src.LowBits(), dst);
+}
+
+
+void X86_64Assembler::movupd(const Address& dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitOptionalRex32(src, dst);
+  EmitUint8(0x0F);
+  EmitUint8(0x11);
+  EmitOperand(src.LowBits(), dst);
+}
+
+
 void X86_64Assembler::movsd(XmmRegister dst, const Address& src) {
   AssemblerBuffer::EnsureCapacity ensured(&buffer_);
   EmitUint8(0xF2);
@@ -670,6 +792,46 @@
 }
 
 
+void X86_64Assembler::addpd(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x58);
+  EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::subpd(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x5C);
+  EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::mulpd(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x59);
+  EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
+void X86_64Assembler::divpd(XmmRegister dst, XmmRegister src) {
+  AssemblerBuffer::EnsureCapacity ensured(&buffer_);
+  EmitUint8(0x66);
+  EmitOptionalRex32(dst, src);
+  EmitUint8(0x0F);
+  EmitUint8(0x5E);
+  EmitXmmRegisterOperand(dst.LowBits(), src);
+}
+
+
 void X86_64Assembler::cvtsi2ss(XmmRegister dst, CpuRegister src) {
   cvtsi2ss(dst, src, false);
 }
diff --git a/compiler/utils/x86_64/assembler_x86_64.h b/compiler/utils/x86_64/assembler_x86_64.h
index acad86d..5923a41 100644
--- a/compiler/utils/x86_64/assembler_x86_64.h
+++ b/compiler/utils/x86_64/assembler_x86_64.h
@@ -390,7 +390,11 @@
   void leaq(CpuRegister dst, const Address& src);
   void leal(CpuRegister dst, const Address& src);
 
-  void movaps(XmmRegister dst, XmmRegister src);
+  void movaps(XmmRegister dst, XmmRegister src);     // move
+  void movaps(XmmRegister dst, const Address& src);  // load aligned
+  void movups(XmmRegister dst, const Address& src);  // load unaligned
+  void movaps(const Address& dst, XmmRegister src);  // store aligned
+  void movups(const Address& dst, XmmRegister src);  // store unaligned
 
   void movss(XmmRegister dst, const Address& src);
   void movss(const Address& dst, XmmRegister src);
@@ -413,6 +417,17 @@
   void divss(XmmRegister dst, XmmRegister src);
   void divss(XmmRegister dst, const Address& src);
 
+  void addps(XmmRegister dst, XmmRegister src);  // no addr variant (for now)
+  void subps(XmmRegister dst, XmmRegister src);
+  void mulps(XmmRegister dst, XmmRegister src);
+  void divps(XmmRegister dst, XmmRegister src);
+
+  void movapd(XmmRegister dst, XmmRegister src);     // move
+  void movapd(XmmRegister dst, const Address& src);  // load aligned
+  void movupd(XmmRegister dst, const Address& src);  // load unaligned
+  void movapd(const Address& dst, XmmRegister src);  // store aligned
+  void movupd(const Address& dst, XmmRegister src);  // store unaligned
+
   void movsd(XmmRegister dst, const Address& src);
   void movsd(const Address& dst, XmmRegister src);
   void movsd(XmmRegister dst, XmmRegister src);
@@ -426,6 +441,11 @@
   void divsd(XmmRegister dst, XmmRegister src);
   void divsd(XmmRegister dst, const Address& src);
 
+  void addpd(XmmRegister dst, XmmRegister src);  // no addr variant (for now)
+  void subpd(XmmRegister dst, XmmRegister src);
+  void mulpd(XmmRegister dst, XmmRegister src);
+  void divpd(XmmRegister dst, XmmRegister src);
+
   void cvtsi2ss(XmmRegister dst, CpuRegister src);  // Note: this is the r/m32 version.
   void cvtsi2ss(XmmRegister dst, CpuRegister src, bool is64bit);
   void cvtsi2ss(XmmRegister dst, const Address& src, bool is64bit);
diff --git a/compiler/utils/x86_64/assembler_x86_64_test.cc b/compiler/utils/x86_64/assembler_x86_64_test.cc
index ff01429..2812c34 100644
--- a/compiler/utils/x86_64/assembler_x86_64_test.cc
+++ b/compiler/utils/x86_64/assembler_x86_64_test.cc
@@ -986,10 +986,50 @@
   DriverStr(RepeatFF(&x86_64::X86_64Assembler::movaps, "movaps %{reg2}, %{reg1}"), "movaps");
 }
 
+TEST_F(AssemblerX86_64Test, MovapsAddr) {
+  GetAssembler()->movaps(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 4));
+  GetAssembler()->movaps(x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 2), x86_64::XmmRegister(x86_64::XMM1));
+  const char* expected =
+    "movaps 0x4(%RSP), %xmm0\n"
+    "movaps %xmm1, 0x2(%RSP)\n";
+  DriverStr(expected, "movaps_address");
+}
+
+TEST_F(AssemblerX86_64Test, MovupsAddr) {
+  GetAssembler()->movups(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 4));
+  GetAssembler()->movups(x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 2), x86_64::XmmRegister(x86_64::XMM1));
+  const char* expected =
+    "movups 0x4(%RSP), %xmm0\n"
+    "movups %xmm1, 0x2(%RSP)\n";
+  DriverStr(expected, "movups_address");
+}
+
 TEST_F(AssemblerX86_64Test, Movss) {
   DriverStr(RepeatFF(&x86_64::X86_64Assembler::movss, "movss %{reg2}, %{reg1}"), "movss");
 }
 
+TEST_F(AssemblerX86_64Test, Movapd) {
+  DriverStr(RepeatFF(&x86_64::X86_64Assembler::movapd, "movapd %{reg2}, %{reg1}"), "movapd");
+}
+
+TEST_F(AssemblerX86_64Test, MovapdAddr) {
+  GetAssembler()->movapd(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 4));
+  GetAssembler()->movapd(x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 2), x86_64::XmmRegister(x86_64::XMM1));
+  const char* expected =
+    "movapd 0x4(%RSP), %xmm0\n"
+    "movapd %xmm1, 0x2(%RSP)\n";
+  DriverStr(expected, "movapd_address");
+}
+
+TEST_F(AssemblerX86_64Test, MovupdAddr) {
+  GetAssembler()->movupd(x86_64::XmmRegister(x86_64::XMM0), x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 4));
+  GetAssembler()->movupd(x86_64::Address(x86_64::CpuRegister(x86_64::RSP), 2), x86_64::XmmRegister(x86_64::XMM1));
+  const char* expected =
+    "movupd 0x4(%RSP), %xmm0\n"
+    "movupd %xmm1, 0x2(%RSP)\n";
+  DriverStr(expected, "movupd_address");
+}
+
 TEST_F(AssemblerX86_64Test, Movsd) {
   DriverStr(RepeatFF(&x86_64::X86_64Assembler::movsd, "movsd %{reg2}, %{reg1}"), "movsd");
 }
@@ -1010,6 +1050,14 @@
   DriverStr(RepeatFF(&x86_64::X86_64Assembler::addsd, "addsd %{reg2}, %{reg1}"), "addsd");
 }
 
+TEST_F(AssemblerX86_64Test, Addps) {
+  DriverStr(RepeatFF(&x86_64::X86_64Assembler::addps, "addps %{reg2}, %{reg1}"), "addps");
+}
+
+TEST_F(AssemblerX86_64Test, Addpd) {
+  DriverStr(RepeatFF(&x86_64::X86_64Assembler::addpd, "addpd %{reg2}, %{reg1}"), "addpd");
+}
+
 TEST_F(AssemblerX86_64Test, Subss) {
   DriverStr(RepeatFF(&x86_64::X86_64Assembler::subss, "subss %{reg2}, %{reg1}"), "subss");
 }
@@ -1018,6 +1066,14 @@
   DriverStr(RepeatFF(&x86_64::X86_64Assembler::subsd, "subsd %{reg2}, %{reg1}"), "subsd");
 }
 
+TEST_F(AssemblerX86_64Test, Subps) {
+  DriverStr(RepeatFF(&x86_64::X86_64Assembler::subps, "subps %{reg2}, %{reg1}"), "subps");
+}
+
+TEST_F(AssemblerX86_64Test, Subpd) {
+  DriverStr(RepeatFF(&x86_64::X86_64Assembler::subpd, "subpd %{reg2}, %{reg1}"), "subpd");
+}
+
 TEST_F(AssemblerX86_64Test, Mulss) {
   DriverStr(RepeatFF(&x86_64::X86_64Assembler::mulss, "mulss %{reg2}, %{reg1}"), "mulss");
 }
@@ -1026,6 +1082,14 @@
   DriverStr(RepeatFF(&x86_64::X86_64Assembler::mulsd, "mulsd %{reg2}, %{reg1}"), "mulsd");
 }
 
+TEST_F(AssemblerX86_64Test, Mulps) {
+  DriverStr(RepeatFF(&x86_64::X86_64Assembler::mulps, "mulps %{reg2}, %{reg1}"), "mulps");
+}
+
+TEST_F(AssemblerX86_64Test, Mulpd) {
+  DriverStr(RepeatFF(&x86_64::X86_64Assembler::mulpd, "mulpd %{reg2}, %{reg1}"), "mulpd");
+}
+
 TEST_F(AssemblerX86_64Test, Divss) {
   DriverStr(RepeatFF(&x86_64::X86_64Assembler::divss, "divss %{reg2}, %{reg1}"), "divss");
 }
@@ -1034,6 +1098,14 @@
   DriverStr(RepeatFF(&x86_64::X86_64Assembler::divsd, "divsd %{reg2}, %{reg1}"), "divsd");
 }
 
+TEST_F(AssemblerX86_64Test, Divps) {
+  DriverStr(RepeatFF(&x86_64::X86_64Assembler::divps, "divps %{reg2}, %{reg1}"), "divps");
+}
+
+TEST_F(AssemblerX86_64Test, Divpd) {
+  DriverStr(RepeatFF(&x86_64::X86_64Assembler::divpd, "divpd %{reg2}, %{reg1}"), "divpd");
+}
+
 TEST_F(AssemblerX86_64Test, Cvtsi2ss) {
   DriverStr(RepeatFr(&x86_64::X86_64Assembler::cvtsi2ss, "cvtsi2ss %{reg2}, %{reg1}"), "cvtsi2ss");
 }
diff --git a/compiler/verifier_deps_test.cc b/compiler/verifier_deps_test.cc
index 4f06a91..5fc9972 100644
--- a/compiler/verifier_deps_test.cc
+++ b/compiler/verifier_deps_test.cc
@@ -1414,7 +1414,14 @@
       ASSERT_FALSE(decoded_deps.ValidateDependencies(new_class_loader, soa.Self()));
     }
 
-    {
+    // The two tests below make sure that fiddling with the method kind
+    // (static, virtual, interface) is detected by `ValidateDependencies`.
+
+    // An interface method lookup can succeed with a virtual method lookup on the same class.
+    // That's OK, as we only want to make sure there is a method being defined with the right
+    // flags. Therefore, polluting the interface methods with virtual methods does not have
+    // to fail verification.
+    if (resolution_kind != kVirtualMethodResolution) {
       VerifierDeps decoded_deps(dex_files_, ArrayRef<const uint8_t>(buffer));
       VerifierDeps::DexFileDeps* deps = decoded_deps.GetDexFileDeps(*primary_dex_file_);
       bool found = false;
@@ -1433,7 +1440,8 @@
       ASSERT_FALSE(decoded_deps.ValidateDependencies(new_class_loader, soa.Self()));
     }
 
-    {
+    // See comment above that applies the same way.
+    if (resolution_kind != kInterfaceMethodResolution) {
       VerifierDeps decoded_deps(dex_files_, ArrayRef<const uint8_t>(buffer));
       VerifierDeps::DexFileDeps* deps = decoded_deps.GetDexFileDeps(*primary_dex_file_);
       bool found = false;
diff --git a/dex2oat/dex2oat.cc b/dex2oat/dex2oat.cc
index 21b03eb..e8a92c1 100644
--- a/dex2oat/dex2oat.cc
+++ b/dex2oat/dex2oat.cc
@@ -64,7 +64,7 @@
 #include "gc/space/space-inl.h"
 #include "image_writer.h"
 #include "interpreter/unstarted_runtime.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "leb128.h"
 #include "linker/buffered_output_stream.h"
 #include "linker/file_output_stream.h"
@@ -1095,6 +1095,8 @@
         compiler_options_->GetNativeDebuggable() ? OatHeader::kTrueValue : OatHeader::kFalseValue);
     key_value_store_->Put(OatHeader::kCompilerFilter,
         CompilerFilter::NameOfFilter(compiler_options_->GetCompilerFilter()));
+    key_value_store_->Put(OatHeader::kConcurrentCopying,
+                          kUseReadBarrier ? OatHeader::kTrueValue : OatHeader::kFalseValue);
   }
 
   // Parse the arguments from the command line. In case of an unrecognized option or impossible
diff --git a/dex2oat/dex2oat_test.cc b/dex2oat/dex2oat_test.cc
index cdb3b9f..e86e560 100644
--- a/dex2oat/dex2oat_test.cc
+++ b/dex2oat/dex2oat_test.cc
@@ -30,7 +30,7 @@
 #include "base/macros.h"
 #include "dex_file-inl.h"
 #include "dex2oat_environment_test.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "oat.h"
 #include "oat_file.h"
 #include "utils.h"
diff --git a/dexlayout/dex_ir.h b/dexlayout/dex_ir.h
index a2d1190..e2ee940 100644
--- a/dexlayout/dex_ir.h
+++ b/dexlayout/dex_ir.h
@@ -741,7 +741,7 @@
   uint32_t GetAccessFlags() const { return access_flags_; }
   const TypeId* Superclass() const { return superclass_; }
   const TypeIdVector* Interfaces()
-      { return interfaces_ == nullptr ? nullptr: interfaces_->GetTypeList(); }
+      { return interfaces_ == nullptr ? nullptr : interfaces_->GetTypeList(); }
   uint32_t InterfacesOffset() { return interfaces_ == nullptr ? 0 : interfaces_->GetOffset(); }
   const StringId* SourceFile() const { return source_file_; }
   AnnotationsDirectoryItem* Annotations() const { return annotations_; }
diff --git a/dexlayout/dex_visualize.cc b/dexlayout/dex_visualize.cc
index 02274b2..75d47e4 100644
--- a/dexlayout/dex_visualize.cc
+++ b/dexlayout/dex_visualize.cc
@@ -31,7 +31,7 @@
 
 #include "dex_ir.h"
 #include "dexlayout.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 
 namespace art {
 
diff --git a/dexlayout/dexlayout.cc b/dexlayout/dexlayout.cc
index cac6090..1add6bf 100644
--- a/dexlayout/dexlayout.cc
+++ b/dexlayout/dexlayout.cc
@@ -37,7 +37,7 @@
 #include "dex_instruction-inl.h"
 #include "dex_visualize.h"
 #include "dex_writer.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "mem_map.h"
 #include "os.h"
 #include "utils.h"
diff --git a/dexlayout/dexlayout_main.cc b/dexlayout/dexlayout_main.cc
index 5f8a118..ad599ae 100644
--- a/dexlayout/dexlayout_main.cc
+++ b/dexlayout/dexlayout_main.cc
@@ -30,7 +30,7 @@
 #include <fcntl.h>
 
 #include "base/logging.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "runtime.h"
 #include "mem_map.h"
 
diff --git a/dexoptanalyzer/Android.bp b/dexoptanalyzer/Android.bp
new file mode 100644
index 0000000..cf4c99e
--- /dev/null
+++ b/dexoptanalyzer/Android.bp
@@ -0,0 +1,68 @@
+//
+// Copyright (C) 2017 The Android Open Source Project
+//
+// Licensed under the Apache License, Version 2.0 (the "License");
+// you may not use this file except in compliance with the License.
+// You may obtain a copy of the License at
+//
+//      http://www.apache.org/licenses/LICENSE-2.0
+//
+// Unless required by applicable law or agreed to in writing, software
+// distributed under the License is distributed on an "AS IS" BASIS,
+// WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+// See the License for the specific language governing permissions and
+// limitations under the License.
+//
+
+cc_defaults {
+    name: "dexoptanalyzer-defaults",
+    host_supported: true,
+    defaults: ["art_defaults"],
+    srcs: [
+        "dexoptanalyzer.cc",
+    ],
+
+    target: {
+        android: {
+            compile_multilib: "prefer32",
+        },
+    },
+
+    include_dirs: [
+        "art/cmdline",
+    ],
+
+    shared_libs: [
+        "libbase",
+    ],
+}
+
+art_cc_binary {
+    name: "dexoptanalyzer",
+    defaults: ["dexoptanalyzer-defaults"],
+    shared_libs: [
+        "libart",
+    ],
+}
+
+art_cc_binary {
+    name: "dexoptanalyzerd",
+    defaults: [
+        "dexoptanalyzer-defaults",
+        "art_debug_defaults",
+    ],
+    shared_libs: [
+        "libartd",
+    ],
+}
+
+art_cc_test {
+    name: "art_dexoptanalyzer_tests",
+    defaults: [
+        "art_gtest_defaults",
+    ],
+    shared_libs: [
+        "libbacktrace"
+    ],
+    srcs: ["dexoptanalyzer_test.cc"],
+}
diff --git a/dexoptanalyzer/dexoptanalyzer.cc b/dexoptanalyzer/dexoptanalyzer.cc
new file mode 100644
index 0000000..965e407
--- /dev/null
+++ b/dexoptanalyzer/dexoptanalyzer.cc
@@ -0,0 +1,265 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <string>
+
+#include "android-base/stringprintf.h"
+#include "android-base/strings.h"
+#include "compiler_filter.h"
+#include "dex_file.h"
+#include "noop_compiler_callbacks.h"
+#include "oat_file_assistant.h"
+#include "os.h"
+#include "runtime.h"
+#include "thread-inl.h"
+#include "utils.h"
+
+namespace art {
+
+// See OatFileAssistant docs for the meaning of the valid return codes.
+enum ReturnCodes {
+  kNoDexOptNeeded = 0,
+  kDex2OatFromScratch = 1,
+  kDex2OatForBootImageOat = 2,
+  kDex2OatForFilterOat = 3,
+  kDex2OatForRelocationOat = 4,
+  kDex2OatForBootImageOdex = 5,
+  kDex2OatForFilterOdex = 6,
+  kDex2OatForRelocationOdex = 7,
+
+  kErrorInvalidArguments = 101,
+  kErrorCannotCreateRuntime = 102,
+  kErrorUnknownDexOptNeeded = 103
+};
+
+static int original_argc;
+static char** original_argv;
+
+static std::string CommandLine() {
+  std::vector<std::string> command;
+  for (int i = 0; i < original_argc; ++i) {
+    command.push_back(original_argv[i]);
+  }
+  return android::base::Join(command, ' ');
+}
+
+static void UsageErrorV(const char* fmt, va_list ap) {
+  std::string error;
+  android::base::StringAppendV(&error, fmt, ap);
+  LOG(ERROR) << error;
+}
+
+static void UsageError(const char* fmt, ...) {
+  va_list ap;
+  va_start(ap, fmt);
+  UsageErrorV(fmt, ap);
+  va_end(ap);
+}
+
+NO_RETURN static void Usage(const char *fmt, ...) {
+  va_list ap;
+  va_start(ap, fmt);
+  UsageErrorV(fmt, ap);
+  va_end(ap);
+
+  UsageError("Command: %s", CommandLine().c_str());
+  UsageError("  Performs a dexopt analysis on the given dex file and returns whether or not");
+  UsageError("  the dex file needs to be dexopted.");
+  UsageError("Usage: dexoptanalyzer [options]...");
+  UsageError("");
+  UsageError("  --dex-file=<filename>: the dex file which should be analyzed.");
+  UsageError("");
+  UsageError("  --isa=<string>: the instruction set for which the analysis should be performed.");
+  UsageError("");
+  UsageError("  --compiler-filter=<string>: the target compiler filter to be used as reference");
+  UsageError("       when deciding if the dex file needs to be optimized.");
+  UsageError("");
+  UsageError("  --assume-profile-changed: assumes the profile information has changed");
+  UsageError("       when deciding if the dex file needs to be optimized.");
+  UsageError("");
+  UsageError("  --image=<filename>: optional, the image to be used to decide if the associated");
+  UsageError("       oat file is up to date. Defaults to $ANDROID_ROOT/framework/boot.art.");
+  UsageError("       Example: --image=/system/framework/boot.art");
+  UsageError("");
+  UsageError("  --android-data=<directory>: optional, the directory which should be used as");
+  UsageError("       android-data. By default ANDROID_DATA env variable is used.");
+  UsageError("");
+  UsageError("Return code:");
+  UsageError("  To make it easier to integrate with the internal tools this command will make");
+  UsageError("    available its result (dexoptNeeded) as the exit/return code. i.e. it will not");
+  UsageError("    return 0 for success and a non zero values for errors as the conventional");
+  UsageError("    commands. The following return codes are possible:");
+  UsageError("        kNoDexOptNeeded = 0");
+  UsageError("        kDex2OatFromScratch = 1");
+  UsageError("        kDex2OatForBootImageOat = 2");
+  UsageError("        kDex2OatForFilterOat = 3");
+  UsageError("        kDex2OatForRelocationOat = 4");
+  UsageError("        kDex2OatForBootImageOdex = 5");
+  UsageError("        kDex2OatForFilterOdex = 6");
+  UsageError("        kDex2OatForRelocationOdex = 7");
+
+  UsageError("        kErrorInvalidArguments = 101");
+  UsageError("        kErrorCannotCreateRuntime = 102");
+  UsageError("        kErrorUnknownDexOptNeeded = 103");
+  UsageError("");
+
+  exit(kErrorInvalidArguments);
+}
+
+class DexoptAnalyzer FINAL {
+ public:
+  DexoptAnalyzer() : assume_profile_changed_(false) {}
+
+  void ParseArgs(int argc, char **argv) {
+    original_argc = argc;
+    original_argv = argv;
+
+    InitLogging(argv, Runtime::Aborter);
+    // Skip over the command name.
+    argv++;
+    argc--;
+
+    if (argc == 0) {
+      Usage("No arguments specified");
+    }
+
+    for (int i = 0; i < argc; ++i) {
+      const StringPiece option(argv[i]);
+      if (option == "--assume-profile-changed") {
+        assume_profile_changed_ = true;
+      } else if (option.starts_with("--dex-file=")) {
+        dex_file_ = option.substr(strlen("--dex-file=")).ToString();
+      } else if (option.starts_with("--compiler-filter=")) {
+        std::string filter_str = option.substr(strlen("--compiler-filter=")).ToString();
+        if (!CompilerFilter::ParseCompilerFilter(filter_str.c_str(), &compiler_filter_)) {
+          Usage("Invalid compiler filter '%s'", option.data());
+        }
+      } else if (option.starts_with("--isa=")) {
+        std::string isa_str = option.substr(strlen("--isa=")).ToString();
+        isa_ = GetInstructionSetFromString(isa_str.c_str());
+        if (isa_ == kNone) {
+          Usage("Invalid isa '%s'", option.data());
+        }
+      } else if (option.starts_with("--image=")) {
+        image_ = option.substr(strlen("--image=")).ToString();
+      } else if (option.starts_with("--android-data=")) {
+        // Overwrite android-data if needed (oat file assistant relies on a valid directory to
+        // compute dalvik-cache folder). This is mostly used in tests.
+        std::string new_android_data = option.substr(strlen("--android-data=")).ToString();
+        setenv("ANDROID_DATA", new_android_data.c_str(), 1);
+      } else {
+        Usage("Unknown argument '%s'", option.data());
+      }
+    }
+
+    if (image_.empty()) {
+      // If we don't receive the image, try to use the default one.
+      // Tests may specify a different image (e.g. core image).
+      std::string error_msg;
+      image_ = GetDefaultBootImageLocation(&error_msg);
+
+      if (image_.empty()) {
+        LOG(ERROR) << error_msg;
+        Usage("--image unspecified and ANDROID_ROOT not set or image file does not exist.");
+      }
+    }
+  }
+
+  bool CreateRuntime() {
+    RuntimeOptions options;
+    // The image could be custom, so make sure we explicitly pass it.
+    std::string img = "-Ximage:" + image_;
+    options.push_back(std::make_pair(img.c_str(), nullptr));
+    // The instruction set of the image should match the instruction set we will test.
+    const void* isa_opt = reinterpret_cast<const void*>(GetInstructionSetString(isa_));
+    options.push_back(std::make_pair("imageinstructionset", isa_opt));
+     // Disable libsigchain. We don't don't need it to evaluate DexOptNeeded status.
+    options.push_back(std::make_pair("-Xno-sig-chain", nullptr));
+    // Pretend we are a compiler so that we can re-use the same infrastructure to load a different
+    // ISA image and minimize the amount of things that get started.
+    NoopCompilerCallbacks callbacks;
+    options.push_back(std::make_pair("compilercallbacks", &callbacks));
+    // Make sure we don't attempt to relocate. The tool should only retrieve the DexOptNeeded
+    // status and not attempt to relocate the boot image.
+    options.push_back(std::make_pair("-Xnorelocate", nullptr));
+
+    if (!Runtime::Create(options, false)) {
+      LOG(ERROR) << "Unable to initialize runtime";
+      return false;
+    }
+    // Runtime::Create acquired the mutator_lock_ that is normally given away when we
+    // Runtime::Start. Give it away now.
+    Thread::Current()->TransitionFromRunnableToSuspended(kNative);
+
+    return true;
+  }
+
+  int GetDexOptNeeded() {
+    // If the file does not exist there's nothing to do.
+    // This is a fast path to avoid creating the runtime (b/34385298).
+    if (!OS::FileExists(dex_file_.c_str())) {
+      return kNoDexOptNeeded;
+    }
+    if (!CreateRuntime()) {
+      return kErrorCannotCreateRuntime;
+    }
+    OatFileAssistant oat_file_assistant(dex_file_.c_str(), isa_, /*load_executable*/ false);
+    // Always treat elements of the bootclasspath as up-to-date.
+    // TODO(calin): this check should be in OatFileAssistant.
+    if (oat_file_assistant.IsInBootClassPath()) {
+      return kNoDexOptNeeded;
+    }
+    int dexoptNeeded = oat_file_assistant.GetDexOptNeeded(
+        compiler_filter_, assume_profile_changed_);
+
+    // Convert OatFileAssitant codes to dexoptanalyzer codes.
+    switch (dexoptNeeded) {
+      case OatFileAssistant::kNoDexOptNeeded: return kNoDexOptNeeded;
+      case OatFileAssistant::kDex2OatFromScratch: return kDex2OatFromScratch;
+      case OatFileAssistant::kDex2OatForBootImage: return kDex2OatForBootImageOat;
+      case OatFileAssistant::kDex2OatForFilter: return kDex2OatForFilterOat;
+      case OatFileAssistant::kDex2OatForRelocation: return kDex2OatForRelocationOat;
+
+      case -OatFileAssistant::kDex2OatForBootImage: return kDex2OatForBootImageOdex;
+      case -OatFileAssistant::kDex2OatForFilter: return kDex2OatForFilterOdex;
+      case -OatFileAssistant::kDex2OatForRelocation: return kDex2OatForRelocationOdex;
+      default:
+        LOG(ERROR) << "Unknown dexoptNeeded " << dexoptNeeded;
+        return kErrorUnknownDexOptNeeded;
+    }
+  }
+
+ private:
+  std::string dex_file_;
+  InstructionSet isa_;
+  CompilerFilter::Filter compiler_filter_;
+  bool assume_profile_changed_;
+  std::string image_;
+};
+
+static int dexoptAnalyze(int argc, char** argv) {
+  DexoptAnalyzer analyzer;
+
+  // Parse arguments. Argument mistakes will lead to exit(kErrorInvalidArguments) in UsageError.
+  analyzer.ParseArgs(argc, argv);
+  return analyzer.GetDexOptNeeded();
+}
+
+}  // namespace art
+
+int main(int argc, char **argv) {
+  return art::dexoptAnalyze(argc, argv);
+}
diff --git a/dexoptanalyzer/dexoptanalyzer_test.cc b/dexoptanalyzer/dexoptanalyzer_test.cc
new file mode 100644
index 0000000..57d3f1f
--- /dev/null
+++ b/dexoptanalyzer/dexoptanalyzer_test.cc
@@ -0,0 +1,311 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <gtest/gtest.h>
+
+#include "arch/instruction_set.h"
+#include "compiler_filter.h"
+#include "dexopt_test.h"
+
+namespace art {
+
+class DexoptAnalyzerTest : public DexoptTest {
+ protected:
+  std::string GetDexoptAnalyzerCmd() {
+    std::string file_path = GetTestAndroidRoot();
+    file_path += "/bin/dexoptanalyzer";
+    if (kIsDebugBuild) {
+      file_path += "d";
+    }
+    EXPECT_TRUE(OS::FileExists(file_path.c_str())) << file_path << " should be a valid file path";
+    return file_path;
+  }
+
+  int Analyze(const std::string& dex_file,
+              CompilerFilter::Filter compiler_filter,
+              bool assume_profile_changed) {
+    std::string dexoptanalyzer_cmd = GetDexoptAnalyzerCmd();
+    std::vector<std::string> argv_str;
+    argv_str.push_back(dexoptanalyzer_cmd);
+    argv_str.push_back("--dex-file=" + dex_file);
+    argv_str.push_back("--isa=" + std::string(GetInstructionSetString(kRuntimeISA)));
+    argv_str.push_back("--compiler-filter=" + CompilerFilter::NameOfFilter(compiler_filter));
+    if (assume_profile_changed) {
+      argv_str.push_back("--assume-profile-changed");
+    }
+    argv_str.push_back("--image=" + GetImageLocation());
+    argv_str.push_back("--android-data=" + android_data_);
+
+    std::string error;
+    return ExecAndReturnCode(argv_str, &error);
+  }
+
+  int DexoptanalyzerToOatFileAssistant(int dexoptanalyzerResult) {
+    switch (dexoptanalyzerResult) {
+      case 0: return OatFileAssistant::kNoDexOptNeeded;
+      case 1: return OatFileAssistant::kDex2OatFromScratch;
+      case 2: return OatFileAssistant::kDex2OatForBootImage;
+      case 3: return OatFileAssistant::kDex2OatForFilter;
+      case 4: return OatFileAssistant::kDex2OatForRelocation;
+      case 5: return -OatFileAssistant::kDex2OatForBootImage;
+      case 6: return -OatFileAssistant::kDex2OatForFilter;
+      case 7: return -OatFileAssistant::kDex2OatForRelocation;
+      default: return dexoptanalyzerResult;
+    }
+  }
+
+  // Verify that the output of dexoptanalyzer for the given arguments is the same
+  // as the output of OatFileAssistant::GetDexOptNeeded.
+  void Verify(const std::string& dex_file,
+              CompilerFilter::Filter compiler_filter,
+              bool assume_profile_changed = false) {
+    int dexoptanalyzerResult = Analyze(dex_file, compiler_filter, assume_profile_changed);
+    dexoptanalyzerResult = DexoptanalyzerToOatFileAssistant(dexoptanalyzerResult);
+    OatFileAssistant oat_file_assistant(dex_file.c_str(), kRuntimeISA, /*load_executable*/ false);
+    int assistantResult = oat_file_assistant.GetDexOptNeeded(
+        compiler_filter, assume_profile_changed);
+    EXPECT_EQ(assistantResult, dexoptanalyzerResult);
+  }
+};
+
+// The tests below exercise the same test case from oat_file_assistant_test.cc.
+
+// Case: We have a DEX file, but no OAT file for it.
+TEST_F(DexoptAnalyzerTest, DexNoOat) {
+  std::string dex_location = GetScratchDir() + "/DexNoOat.jar";
+  Copy(GetDexSrc1(), dex_location);
+
+  Verify(dex_location, CompilerFilter::kSpeed);
+  Verify(dex_location, CompilerFilter::kVerifyAtRuntime);
+  Verify(dex_location, CompilerFilter::kInterpretOnly);
+  Verify(dex_location, CompilerFilter::kSpeedProfile);
+}
+
+// Case: We have a DEX file and up-to-date OAT file for it.
+TEST_F(DexoptAnalyzerTest, OatUpToDate) {
+  std::string dex_location = GetScratchDir() + "/OatUpToDate.jar";
+  Copy(GetDexSrc1(), dex_location);
+  GenerateOatForTest(dex_location.c_str(), CompilerFilter::kSpeed);
+
+  Verify(dex_location, CompilerFilter::kSpeed);
+  Verify(dex_location, CompilerFilter::kInterpretOnly);
+  Verify(dex_location, CompilerFilter::kVerifyAtRuntime);
+  Verify(dex_location, CompilerFilter::kEverything);
+}
+
+// Case: We have a DEX file and speed-profile OAT file for it.
+TEST_F(DexoptAnalyzerTest, ProfileOatUpToDate) {
+  std::string dex_location = GetScratchDir() + "/ProfileOatUpToDate.jar";
+  Copy(GetDexSrc1(), dex_location);
+  GenerateOatForTest(dex_location.c_str(), CompilerFilter::kSpeedProfile);
+
+  Verify(dex_location, CompilerFilter::kSpeedProfile, false);
+  Verify(dex_location, CompilerFilter::kInterpretOnly, false);
+  Verify(dex_location, CompilerFilter::kSpeedProfile, true);
+  Verify(dex_location, CompilerFilter::kInterpretOnly, true);
+}
+
+// Case: We have a MultiDEX file and up-to-date OAT file for it.
+TEST_F(DexoptAnalyzerTest, MultiDexOatUpToDate) {
+  std::string dex_location = GetScratchDir() + "/MultiDexOatUpToDate.jar";
+  Copy(GetMultiDexSrc1(), dex_location);
+  GenerateOatForTest(dex_location.c_str(), CompilerFilter::kSpeed);
+
+  Verify(dex_location, CompilerFilter::kSpeed, false);
+}
+
+// Case: We have a MultiDEX file where the secondary dex file is out of date.
+TEST_F(DexoptAnalyzerTest, MultiDexSecondaryOutOfDate) {
+  std::string dex_location = GetScratchDir() + "/MultiDexSecondaryOutOfDate.jar";
+
+  // Compile code for GetMultiDexSrc1.
+  Copy(GetMultiDexSrc1(), dex_location);
+  GenerateOatForTest(dex_location.c_str(), CompilerFilter::kSpeed);
+
+  // Now overwrite the dex file with GetMultiDexSrc2 so the secondary checksum
+  // is out of date.
+  Copy(GetMultiDexSrc2(), dex_location);
+
+  Verify(dex_location, CompilerFilter::kSpeed, false);
+}
+
+
+// Case: We have a DEX file and an OAT file out of date with respect to the
+// dex checksum.
+TEST_F(DexoptAnalyzerTest, OatDexOutOfDate) {
+  std::string dex_location = GetScratchDir() + "/OatDexOutOfDate.jar";
+
+  // We create a dex, generate an oat for it, then overwrite the dex with a
+  // different dex to make the oat out of date.
+  Copy(GetDexSrc1(), dex_location);
+  GenerateOatForTest(dex_location.c_str(), CompilerFilter::kSpeed);
+  Copy(GetDexSrc2(), dex_location);
+
+  Verify(dex_location, CompilerFilter::kVerifyAtRuntime);
+  Verify(dex_location, CompilerFilter::kSpeed);
+}
+
+// Case: We have a DEX file and an OAT file out of date with respect to the
+// boot image.
+TEST_F(DexoptAnalyzerTest, OatImageOutOfDate) {
+  std::string dex_location = GetScratchDir() + "/OatImageOutOfDate.jar";
+
+  Copy(GetDexSrc1(), dex_location);
+  GenerateOatForTest(dex_location.c_str(),
+                     CompilerFilter::kSpeed,
+                     /*relocate*/true,
+                     /*pic*/false,
+                     /*with_alternate_image*/true);
+
+  Verify(dex_location, CompilerFilter::kVerifyAtRuntime);
+  Verify(dex_location, CompilerFilter::kInterpretOnly);
+  Verify(dex_location, CompilerFilter::kSpeed);
+}
+
+// Case: We have a DEX file and a verify-at-runtime OAT file out of date with
+// respect to the boot image.
+// It shouldn't matter that the OAT file is out of date, because it is
+// verify-at-runtime.
+TEST_F(DexoptAnalyzerTest, OatVerifyAtRuntimeImageOutOfDate) {
+  std::string dex_location = GetScratchDir() + "/OatVerifyAtRuntimeImageOutOfDate.jar";
+
+  Copy(GetDexSrc1(), dex_location);
+  GenerateOatForTest(dex_location.c_str(),
+                     CompilerFilter::kVerifyAtRuntime,
+                     /*relocate*/true,
+                     /*pic*/false,
+                     /*with_alternate_image*/true);
+
+  Verify(dex_location, CompilerFilter::kVerifyAtRuntime);
+  Verify(dex_location, CompilerFilter::kInterpretOnly);
+}
+
+// Case: We have a DEX file and an ODEX file, but no OAT file.
+TEST_F(DexoptAnalyzerTest, DexOdexNoOat) {
+  std::string dex_location = GetScratchDir() + "/DexOdexNoOat.jar";
+  std::string odex_location = GetOdexDir() + "/DexOdexNoOat.odex";
+
+  Copy(GetDexSrc1(), dex_location);
+  GenerateOdexForTest(dex_location, odex_location, CompilerFilter::kSpeed);
+
+  Verify(dex_location, CompilerFilter::kVerifyAtRuntime);
+  Verify(dex_location, CompilerFilter::kSpeed);
+}
+
+// Case: We have a stripped DEX file and a PIC ODEX file, but no OAT file.
+TEST_F(DexoptAnalyzerTest, StrippedDexOdexNoOat) {
+  std::string dex_location = GetScratchDir() + "/StrippedDexOdexNoOat.jar";
+  std::string odex_location = GetOdexDir() + "/StrippedDexOdexNoOat.odex";
+
+  Copy(GetDexSrc1(), dex_location);
+  GeneratePicOdexForTest(dex_location, odex_location, CompilerFilter::kSpeed);
+
+  // Strip the dex file
+  Copy(GetStrippedDexSrc1(), dex_location);
+
+  Verify(dex_location, CompilerFilter::kSpeed);
+}
+
+// Case: We have a stripped DEX file, a PIC ODEX file, and an out-of-date OAT file.
+TEST_F(DexoptAnalyzerTest, StrippedDexOdexOat) {
+  std::string dex_location = GetScratchDir() + "/StrippedDexOdexOat.jar";
+  std::string odex_location = GetOdexDir() + "/StrippedDexOdexOat.odex";
+
+  // Create the oat file from a different dex file so it looks out of date.
+  Copy(GetDexSrc2(), dex_location);
+  GenerateOatForTest(dex_location.c_str(), CompilerFilter::kSpeed);
+
+  // Create the odex file
+  Copy(GetDexSrc1(), dex_location);
+  GeneratePicOdexForTest(dex_location, odex_location, CompilerFilter::kSpeed);
+
+  // Strip the dex file.
+  Copy(GetStrippedDexSrc1(), dex_location);
+
+  Verify(dex_location, CompilerFilter::kVerifyAtRuntime);
+  Verify(dex_location, CompilerFilter::kSpeed);
+  Verify(dex_location, CompilerFilter::kEverything);
+}
+
+// Case: We have a stripped (or resource-only) DEX file, no ODEX file and no
+// OAT file. Expect: The status is kNoDexOptNeeded.
+TEST_F(DexoptAnalyzerTest, ResourceOnlyDex) {
+  std::string dex_location = GetScratchDir() + "/ResourceOnlyDex.jar";
+
+  Copy(GetStrippedDexSrc1(), dex_location);
+
+  Verify(dex_location, CompilerFilter::kSpeed);
+  Verify(dex_location, CompilerFilter::kVerifyAtRuntime);
+  Verify(dex_location, CompilerFilter::kInterpretOnly);
+}
+
+// Case: We have a DEX file, an ODEX file and an OAT file, where the ODEX and
+// OAT files both have patch delta of 0.
+TEST_F(DexoptAnalyzerTest, OdexOatOverlap) {
+  std::string dex_location = GetScratchDir() + "/OdexOatOverlap.jar";
+  std::string odex_location = GetOdexDir() + "/OdexOatOverlap.odex";
+  std::string oat_location = GetOdexDir() + "/OdexOatOverlap.oat";
+
+  Copy(GetDexSrc1(), dex_location);
+  GenerateOdexForTest(dex_location, odex_location, CompilerFilter::kSpeed);
+
+  // Create the oat file by copying the odex so they are located in the same
+  // place in memory.
+  Copy(odex_location, oat_location);
+
+  Verify(dex_location, CompilerFilter::kSpeed);
+}
+
+// Case: We have a DEX file and a PIC ODEX file, but no OAT file.
+TEST_F(DexoptAnalyzerTest, DexPicOdexNoOat) {
+  std::string dex_location = GetScratchDir() + "/DexPicOdexNoOat.jar";
+  std::string odex_location = GetOdexDir() + "/DexPicOdexNoOat.odex";
+
+  Copy(GetDexSrc1(), dex_location);
+  GeneratePicOdexForTest(dex_location, odex_location, CompilerFilter::kSpeed);
+
+  Verify(dex_location, CompilerFilter::kSpeed);
+  Verify(dex_location, CompilerFilter::kEverything);
+}
+
+// Case: We have a DEX file and a VerifyAtRuntime ODEX file, but no OAT file..
+TEST_F(DexoptAnalyzerTest, DexVerifyAtRuntimeOdexNoOat) {
+  std::string dex_location = GetScratchDir() + "/DexVerifyAtRuntimeOdexNoOat.jar";
+  std::string odex_location = GetOdexDir() + "/DexVerifyAtRuntimeOdexNoOat.odex";
+
+  Copy(GetDexSrc1(), dex_location);
+  GenerateOdexForTest(dex_location, odex_location, CompilerFilter::kVerifyAtRuntime);
+
+  Verify(dex_location, CompilerFilter::kVerifyAtRuntime);
+  Verify(dex_location, CompilerFilter::kSpeed);
+}
+
+// Case: Non-standard extension for dex file.
+TEST_F(DexoptAnalyzerTest, LongDexExtension) {
+  std::string dex_location = GetScratchDir() + "/LongDexExtension.jarx";
+  Copy(GetDexSrc1(), dex_location);
+
+  Verify(dex_location, CompilerFilter::kSpeed);
+}
+
+// Case: Very short, non-existent Dex location.
+TEST_F(DexoptAnalyzerTest, ShortDexLocation) {
+  std::string dex_location = "/xx";
+
+  Verify(dex_location, CompilerFilter::kSpeed);
+}
+
+}  // namespace art
diff --git a/oatdump/oatdump.cc b/oatdump/oatdump.cc
index 148ee88..69901c1 100644
--- a/oatdump/oatdump.cc
+++ b/oatdump/oatdump.cc
@@ -529,6 +529,12 @@
       }
     }
 
+    {
+      os << "OAT FILE STATS:\n";
+      VariableIndentationOutputStream vios(&os);
+      stats_.Dump(vios);
+    }
+
     os << std::flush;
     return success;
   }
@@ -574,6 +580,116 @@
     return nullptr;
   }
 
+  struct Stats {
+    enum ByteKind {
+      kByteKindCode,
+      kByteKindQuickMethodHeader,
+      kByteKindCodeInfoLocationCatalog,
+      kByteKindCodeInfoDexRegisterMap,
+      kByteKindCodeInfoInlineInfo,
+      kByteKindCodeInfoEncoding,
+      kByteKindCodeInfoOther,
+      kByteKindStackMapNativePc,
+      kByteKindStackMapDexPc,
+      kByteKindStackMapDexRegisterMap,
+      kByteKindStackMapInlineInfo,
+      kByteKindStackMapRegisterMask,
+      kByteKindStackMapMask,
+      kByteKindStackMapOther,
+      kByteKindCount,
+      kByteKindStackMapFirst = kByteKindCodeInfoOther,
+      kByteKindStackMapLast = kByteKindStackMapOther,
+    };
+    int64_t bits[kByteKindCount] = {};
+    // Since code has deduplication, seen tracks already seen pointers to avoid double counting
+    // deduplicated code and tables.
+    std::unordered_set<const void*> seen;
+
+    // Returns true if it was newly added.
+    bool AddBitsIfUnique(ByteKind kind, int64_t count, const void* address) {
+      if (seen.insert(address).second == true) {
+        // True means the address was not already in the set.
+        AddBits(kind, count);
+        return true;
+      }
+      return false;
+    }
+
+    void AddBits(ByteKind kind, int64_t count) {
+      bits[kind] += count;
+    }
+
+    void Dump(VariableIndentationOutputStream& os) {
+      const int64_t sum = std::accumulate(bits, bits + kByteKindCount, 0u);
+      os.Stream() << "Dumping cumulative use of " << sum / kBitsPerByte << " accounted bytes\n";
+      if (sum > 0) {
+        const int64_t stack_map_bits = std::accumulate(bits + kByteKindStackMapFirst,
+                                                       bits + kByteKindStackMapLast + 1,
+                                                       0u);
+        Dump(os, "Code                           ", bits[kByteKindCode], sum);
+        Dump(os, "QuickMethodHeader              ", bits[kByteKindQuickMethodHeader], sum);
+        Dump(os, "CodeInfoEncoding               ", bits[kByteKindCodeInfoEncoding], sum);
+        Dump(os, "CodeInfoLocationCatalog        ", bits[kByteKindCodeInfoLocationCatalog], sum);
+        Dump(os, "CodeInfoDexRegisterMap         ", bits[kByteKindCodeInfoDexRegisterMap], sum);
+        Dump(os, "CodeInfoInlineInfo             ", bits[kByteKindCodeInfoInlineInfo], sum);
+        Dump(os, "CodeInfoStackMap               ", stack_map_bits, sum);
+        {
+          ScopedIndentation indent1(&os);
+          Dump(os,
+               "StackMapNativePc             ",
+               bits[kByteKindStackMapNativePc],
+               stack_map_bits,
+               "stack map");
+          Dump(os,
+               "StackMapDexPcEncoding        ",
+               bits[kByteKindStackMapDexPc],
+               stack_map_bits,
+               "stack map");
+          Dump(os,
+               "StackMapDexRegisterMap       ",
+               bits[kByteKindStackMapDexRegisterMap],
+               stack_map_bits,
+               "stack map");
+          Dump(os,
+               "StackMapInlineInfo           ",
+               bits[kByteKindStackMapInlineInfo],
+               stack_map_bits,
+               "stack map");
+          Dump(os,
+               "StackMapRegisterMaskEncoding ",
+               bits[kByteKindStackMapRegisterMask],
+               stack_map_bits,
+               "stack map");
+          Dump(os,
+               "StackMapMask                 ",
+               bits[kByteKindStackMapMask],
+               stack_map_bits,
+               "stack map");
+          Dump(os,
+               "StackMapOther                ",
+               bits[kByteKindStackMapOther],
+               stack_map_bits,
+               "stack map");
+        }
+      }
+      os.Stream() << "\n" << std::flush;
+    }
+
+   private:
+    void Dump(VariableIndentationOutputStream& os,
+              const char* name,
+              int64_t size,
+              int64_t total,
+              const char* sum_of = "total") {
+      const double percent = (static_cast<double>(size) / static_cast<double>(total)) * 100;
+      os.Stream() << StringPrintf("%s = %8" PRId64 " (%2.0f%% of %s)\n",
+                                  name,
+                                  size / kBitsPerByte,
+                                  percent,
+                                  sum_of);
+    }
+  };
+
  private:
   void AddAllOffsets() {
     // We don't know the length of the code for each method, but we need to know where to stop
@@ -1046,7 +1162,9 @@
       vios->Stream() << "OatQuickMethodHeader ";
       uint32_t method_header_offset = oat_method.GetOatQuickMethodHeaderOffset();
       const OatQuickMethodHeader* method_header = oat_method.GetOatQuickMethodHeader();
-
+      stats_.AddBitsIfUnique(Stats::kByteKindQuickMethodHeader,
+                             sizeof(*method_header) * kBitsPerByte,
+                             method_header);
       if (options_.absolute_addresses_) {
         vios->Stream() << StringPrintf("%p ", method_header);
       }
@@ -1118,6 +1236,7 @@
         const void* code = oat_method.GetQuickCode();
         uint32_t aligned_code_begin = AlignCodeOffset(code_offset);
         uint64_t aligned_code_end = aligned_code_begin + code_size;
+        stats_.AddBitsIfUnique(Stats::kByteKindCode, code_size * kBitsPerByte, code);
 
         if (options_.absolute_addresses_) {
           vios->Stream() << StringPrintf("%p ", code);
@@ -1223,7 +1342,8 @@
     code_info.Dump(vios,
                    oat_method.GetCodeOffset(),
                    code_item.registers_size_,
-                   options_.dump_code_info_stack_maps_);
+                   options_.dump_code_info_stack_maps_,
+                   instruction_set_);
   }
 
   void DumpVregLocations(std::ostream& os, const OatFile::OatMethod& oat_method,
@@ -1329,21 +1449,22 @@
   // For identical native PCs, the order from the CodeInfo is preserved.
   class StackMapsHelper {
    public:
-    explicit StackMapsHelper(const uint8_t* raw_code_info)
+    explicit StackMapsHelper(const uint8_t* raw_code_info, InstructionSet instruction_set)
         : code_info_(raw_code_info),
           encoding_(code_info_.ExtractEncoding()),
           number_of_stack_maps_(code_info_.GetNumberOfStackMaps(encoding_)),
           indexes_(),
-          offset_(static_cast<size_t>(-1)),
-          stack_map_index_(0u) {
+          offset_(static_cast<uint32_t>(-1)),
+          stack_map_index_(0u),
+          instruction_set_(instruction_set) {
       if (number_of_stack_maps_ != 0u) {
         // Check if native PCs are ordered.
         bool ordered = true;
         StackMap last = code_info_.GetStackMapAt(0u, encoding_);
         for (size_t i = 1; i != number_of_stack_maps_; ++i) {
           StackMap current = code_info_.GetStackMapAt(i, encoding_);
-          if (last.GetNativePcOffset(encoding_.stack_map_encoding) >
-              current.GetNativePcOffset(encoding_.stack_map_encoding)) {
+          if (last.GetNativePcOffset(encoding_.stack_map_encoding, instruction_set) >
+              current.GetNativePcOffset(encoding_.stack_map_encoding, instruction_set)) {
             ordered = false;
             break;
           }
@@ -1359,14 +1480,17 @@
                     indexes_.end(),
                     [this](size_t lhs, size_t rhs) {
                       StackMap left = code_info_.GetStackMapAt(lhs, encoding_);
-                      uint32_t left_pc = left.GetNativePcOffset(encoding_.stack_map_encoding);
+                      uint32_t left_pc = left.GetNativePcOffset(encoding_.stack_map_encoding,
+                                                                instruction_set_);
                       StackMap right = code_info_.GetStackMapAt(rhs, encoding_);
-                      uint32_t right_pc = right.GetNativePcOffset(encoding_.stack_map_encoding);
+                      uint32_t right_pc = right.GetNativePcOffset(encoding_.stack_map_encoding,
+                                                                  instruction_set_);
                       // If the PCs are the same, compare indexes to preserve the original order.
                       return (left_pc < right_pc) || (left_pc == right_pc && lhs < rhs);
                     });
         }
-        offset_ = GetStackMapAt(0).GetNativePcOffset(encoding_.stack_map_encoding);
+        offset_ = GetStackMapAt(0).GetNativePcOffset(encoding_.stack_map_encoding,
+                                                     instruction_set_);
       }
     }
 
@@ -1378,7 +1502,7 @@
       return encoding_;
     }
 
-    size_t GetOffset() const {
+    uint32_t GetOffset() const {
       return offset_;
     }
 
@@ -1389,8 +1513,9 @@
     void Next() {
       ++stack_map_index_;
       offset_ = (stack_map_index_ == number_of_stack_maps_)
-          ? static_cast<size_t>(-1)
-          : GetStackMapAt(stack_map_index_).GetNativePcOffset(encoding_.stack_map_encoding);
+          ? static_cast<uint32_t>(-1)
+          : GetStackMapAt(stack_map_index_).GetNativePcOffset(encoding_.stack_map_encoding,
+                                                              instruction_set_);
     }
 
    private:
@@ -1406,8 +1531,9 @@
     const CodeInfoEncoding encoding_;
     const size_t number_of_stack_maps_;
     dchecked_vector<size_t> indexes_;  // Used if stack map native PCs are not ordered.
-    size_t offset_;
+    uint32_t offset_;
     size_t stack_map_index_;
+    const InstructionSet instruction_set_;
   };
 
   void DumpCode(VariableIndentationOutputStream* vios,
@@ -1423,7 +1549,61 @@
       return;
     } else if (!bad_input && IsMethodGeneratedByOptimizingCompiler(oat_method, code_item)) {
       // The optimizing compiler outputs its CodeInfo data in the vmap table.
-      StackMapsHelper helper(oat_method.GetVmapTable());
+      StackMapsHelper helper(oat_method.GetVmapTable(), instruction_set_);
+      {
+        CodeInfoEncoding encoding(helper.GetEncoding());
+        StackMapEncoding stack_map_encoding(encoding.stack_map_encoding);
+        // helper.GetCodeInfo().GetStackMapAt(0, encoding).;
+        const size_t num_stack_maps = encoding.number_of_stack_maps;
+        std::vector<uint8_t> size_vector;
+        encoding.Compress(&size_vector);
+        if (stats_.AddBitsIfUnique(Stats::kByteKindCodeInfoEncoding,
+                                   size_vector.size() * kBitsPerByte,
+                                   oat_method.GetVmapTable())) {
+          stats_.AddBits(
+              Stats::kByteKindStackMapNativePc,
+              stack_map_encoding.GetNativePcEncoding().BitSize() * num_stack_maps);
+          stats_.AddBits(
+              Stats::kByteKindStackMapDexPc,
+              stack_map_encoding.GetDexPcEncoding().BitSize() * num_stack_maps);
+          stats_.AddBits(
+              Stats::kByteKindStackMapDexRegisterMap,
+              stack_map_encoding.GetDexRegisterMapEncoding().BitSize() * num_stack_maps);
+          stats_.AddBits(
+              Stats::kByteKindStackMapInlineInfo,
+              stack_map_encoding.GetInlineInfoEncoding().BitSize() * num_stack_maps);
+          stats_.AddBits(
+              Stats::kByteKindStackMapRegisterMask,
+              stack_map_encoding.GetRegisterMaskEncoding().BitSize() * num_stack_maps);
+          const size_t stack_mask_bits = encoding.stack_map_size_in_bytes * kBitsPerByte -
+              stack_map_encoding.GetStackMaskBitOffset();
+          stats_.AddBits(
+              Stats::kByteKindStackMapMask,
+              stack_mask_bits * num_stack_maps);
+          const size_t stack_map_bits =
+              stack_map_encoding.GetStackMaskBitOffset() + stack_mask_bits;
+          stats_.AddBits(
+              Stats::kByteKindStackMapOther,
+              (encoding.stack_map_size_in_bytes * kBitsPerByte - stack_map_bits) * num_stack_maps);
+          const size_t stack_map_bytes = helper.GetCodeInfo().GetStackMapsSize(encoding);
+          const size_t location_catalog_bytes =
+              helper.GetCodeInfo().GetDexRegisterLocationCatalogSize(encoding);
+          stats_.AddBits(Stats::kByteKindCodeInfoLocationCatalog,
+                         kBitsPerByte * location_catalog_bytes);
+          const size_t dex_register_bytes =
+              helper.GetCodeInfo().GetDexRegisterMapsSize(encoding, code_item->registers_size_);
+          stats_.AddBits(
+              Stats::kByteKindCodeInfoDexRegisterMap,
+              kBitsPerByte * dex_register_bytes);
+          const size_t inline_info_bytes =
+              encoding.non_header_size -
+              stack_map_bytes -
+              location_catalog_bytes -
+              dex_register_bytes;
+          stats_.AddBits(Stats::kByteKindCodeInfoInlineInfo,
+                         inline_info_bytes * kBitsPerByte);
+        }
+      }
       const uint8_t* quick_native_pc = reinterpret_cast<const uint8_t*>(quick_code);
       size_t offset = 0;
       while (offset < code_size) {
@@ -1436,7 +1616,8 @@
                          helper.GetCodeInfo(),
                          helper.GetEncoding(),
                          oat_method.GetCodeOffset(),
-                         code_item->registers_size_);
+                         code_item->registers_size_,
+                         instruction_set_);
           do {
             helper.Next();
             // There may be multiple stack maps at a given PC. We display only the first one.
@@ -1460,6 +1641,7 @@
   const InstructionSet instruction_set_;
   std::set<uintptr_t> offsets_;
   Disassembler* disassembler_;
+  Stats stats_;
 };
 
 class ImageDumper {
@@ -1776,7 +1958,7 @@
         os << StringPrintf("%d (0x%x)\n", field->GetShort(obj), field->GetShort(obj));
         break;
       case Primitive::kPrimBoolean:
-        os << StringPrintf("%s (0x%x)\n", field->GetBoolean(obj)? "true" : "false",
+        os << StringPrintf("%s (0x%x)\n", field->GetBoolean(obj) ? "true" : "false",
             field->GetBoolean(obj));
         break;
       case Primitive::kPrimByte:
@@ -2132,7 +2314,6 @@
 
     size_t managed_code_bytes;
     size_t managed_code_bytes_ignoring_deduplication;
-    size_t managed_to_native_code_bytes;
     size_t native_to_managed_code_bytes;
     size_t class_initializer_code_bytes;
     size_t large_initializer_code_bytes;
@@ -2161,7 +2342,6 @@
           alignment_bytes(0),
           managed_code_bytes(0),
           managed_code_bytes_ignoring_deduplication(0),
-          managed_to_native_code_bytes(0),
           native_to_managed_code_bytes(0),
           class_initializer_code_bytes(0),
           large_initializer_code_bytes(0),
@@ -2359,7 +2539,6 @@
 
       os << StringPrintf("oat_file_bytes               = %8zd\n"
                          "managed_code_bytes           = %8zd (%2.0f%% of oat file bytes)\n"
-                         "managed_to_native_code_bytes = %8zd (%2.0f%% of oat file bytes)\n"
                          "native_to_managed_code_bytes = %8zd (%2.0f%% of oat file bytes)\n\n"
                          "class_initializer_code_bytes = %8zd (%2.0f%% of oat file bytes)\n"
                          "large_initializer_code_bytes = %8zd (%2.0f%% of oat file bytes)\n"
@@ -2367,8 +2546,6 @@
                          oat_file_bytes,
                          managed_code_bytes,
                          PercentOfOatBytes(managed_code_bytes),
-                         managed_to_native_code_bytes,
-                         PercentOfOatBytes(managed_to_native_code_bytes),
                          native_to_managed_code_bytes,
                          PercentOfOatBytes(native_to_managed_code_bytes),
                          class_initializer_code_bytes,
diff --git a/oatdump/oatdump_test.cc b/oatdump/oatdump_test.cc
index e77d03b..ba57d18 100644
--- a/oatdump/oatdump_test.cc
+++ b/oatdump/oatdump_test.cc
@@ -102,6 +102,7 @@
         // Code and dex code do not show up if list only.
         expected_prefixes.push_back("DEX CODE:");
         expected_prefixes.push_back("CODE:");
+        expected_prefixes.push_back("CodeInfoEncoding");
       }
       if (mode == kModeArt) {
         exec_argv.push_back("--image=" + core_art_location_);
diff --git a/patchoat/patchoat.cc b/patchoat/patchoat.cc
index 7ae13a5..9a73830 100644
--- a/patchoat/patchoat.cc
+++ b/patchoat/patchoat.cc
@@ -790,8 +790,6 @@
   copy->SetDeclaringClass(RelocatedAddressOfPointer(object->GetDeclaringClass()));
   copy->SetDexCacheResolvedMethods(
       RelocatedAddressOfPointer(object->GetDexCacheResolvedMethods(pointer_size)), pointer_size);
-  copy->SetDexCacheResolvedTypes(
-      RelocatedAddressOfPointer(object->GetDexCacheResolvedTypes(pointer_size)), pointer_size);
   copy->SetEntryPointFromQuickCompiledCodePtrSize(RelocatedAddressOfPointer(
       object->GetEntryPointFromQuickCompiledCodePtrSize(pointer_size)), pointer_size);
   // No special handling for IMT conflict table since all pointers are moved by the same offset.
diff --git a/profman/profile_assistant.h b/profman/profile_assistant.h
index d3c75b8..be703ab 100644
--- a/profman/profile_assistant.h
+++ b/profman/profile_assistant.h
@@ -21,7 +21,7 @@
 #include <vector>
 
 #include "base/scoped_flock.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 
 namespace art {
 
diff --git a/profman/profile_assistant_test.cc b/profman/profile_assistant_test.cc
index 776c31a..2f40fef 100644
--- a/profman/profile_assistant_test.cc
+++ b/profman/profile_assistant_test.cc
@@ -19,7 +19,7 @@
 #include "base/unix_file/fd_file.h"
 #include "common_runtime_test.h"
 #include "profile_assistant.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "utils.h"
 
 namespace art {
diff --git a/profman/profman.cc b/profman/profman.cc
index e538407..ffebb6a 100644
--- a/profman/profman.cc
+++ b/profman/profman.cc
@@ -34,7 +34,7 @@
 #include "base/time_utils.h"
 #include "base/unix_file/fd_file.h"
 #include "dex_file.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "runtime.h"
 #include "utils.h"
 #include "zip_archive.h"
diff --git a/runtime/Android.bp b/runtime/Android.bp
index 86019bf..7f98513 100644
--- a/runtime/Android.bp
+++ b/runtime/Android.bp
@@ -112,7 +112,7 @@
         "jit/debugger_interface.cc",
         "jit/jit.cc",
         "jit/jit_code_cache.cc",
-        "jit/offline_profiling_info.cc",
+        "jit/profile_compilation_info.cc",
         "jit/profiling_info.cc",
         "jit/profile_saver.cc",
         "jni_internal.cc",
@@ -184,6 +184,7 @@
         "reference_table.cc",
         "reflection.cc",
         "runtime.cc",
+        "runtime_callbacks.cc",
         "runtime_options.cc",
         "signal_catcher.cc",
         "stack.cc",
@@ -473,10 +474,14 @@
 art_cc_library {
     name: "libart-runtime-gtest",
     defaults: ["libart-gtest-defaults"],
-    srcs: ["common_runtime_test.cc"],
+    srcs: [
+        "common_runtime_test.cc",
+        "dexopt_test.cc"
+    ],
     shared_libs: [
         "libartd",
         "libbase",
+        "libbacktrace"
     ],
 }
 
@@ -563,6 +568,7 @@
         "parsed_options_test.cc",
         "prebuilt_tools_test.cc",
         "reference_table_test.cc",
+        "runtime_callbacks_test.cc",
         "thread_pool_test.cc",
         "transaction_test.cc",
         "type_lookup_table_test.cc",
diff --git a/runtime/arch/arm/quick_entrypoints_arm.S b/runtime/arch/arm/quick_entrypoints_arm.S
index 61d1607..db1cad6 100644
--- a/runtime/arch/arm/quick_entrypoints_arm.S
+++ b/runtime/arch/arm/quick_entrypoints_arm.S
@@ -856,27 +856,6 @@
 #endif  // USE_READ_BARRIER
 .endm
 
-    /*
-     * Entry from managed code for array put operations of objects where the value being stored
-     * needs to be checked for compatibility.
-     * r0 = array, r1 = index, r2 = value
-     */
-ENTRY art_quick_aput_obj_with_null_and_bound_check
-    tst r0, r0
-    bne art_quick_aput_obj_with_bound_check
-    b art_quick_throw_null_pointer_exception
-END art_quick_aput_obj_with_null_and_bound_check
-
-    .hidden art_quick_aput_obj_with_bound_check
-ENTRY art_quick_aput_obj_with_bound_check
-    ldr r3, [r0, #MIRROR_ARRAY_LENGTH_OFFSET]
-    cmp r3, r1
-    bhi art_quick_aput_obj
-    mov r0, r1
-    mov r1, r3
-    b art_quick_throw_array_bounds
-END art_quick_aput_obj_with_bound_check
-
 #ifdef USE_READ_BARRIER
     .extern artReadBarrierSlow
 #endif
@@ -2010,3 +1989,83 @@
 READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg09, r9
 READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg10, r10
 READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg11, r11
+
+.extern artInvokePolymorphic
+ENTRY art_quick_invoke_polymorphic
+    SETUP_SAVE_REFS_AND_ARGS_FRAME r2
+    mov     r2, r9                 @ pass Thread::Current
+    mov     r3, sp                 @ pass SP
+    mov     r0, #0                 @ initialize 64-bit JValue as zero.
+    str     r0, [sp, #-4]!
+    .cfi_adjust_cfa_offset 4
+    str     r0, [sp, #-4]!
+    .cfi_adjust_cfa_offset 4
+    mov     r0, sp                 @ pass JValue for return result as first argument.
+    bl      artInvokePolymorphic   @ artInvokePolymorphic(JValue, receiver, Thread*, SP)
+    sub     r0, 'A'                @ return value is descriptor of handle's return type.
+    cmp     r0, 'Z' - 'A'          @ check if value is in bounds of handler table
+    bgt     .Lcleanup_and_return   @ and clean-up if not.
+    adr     r1, .Lhandler_table
+    tbb     [r0, r1]               @ branch to handler for return value based on return type.
+
+.Lstart_of_handlers:
+.Lstore_boolean_result:
+    ldrb    r0, [sp]               @ Copy boolean value to return value of this function.
+    b       .Lcleanup_and_return
+.Lstore_char_result:
+    ldrh    r0, [sp]               @ Copy char value to return value of this function.
+    b       .Lcleanup_and_return
+.Lstore_float_result:
+    vldr    s0, [sp]               @ Copy float value from JValue result to the context restored by
+    vstr    s0, [sp, #16]          @ RESTORE_SAVE_REFS_AND_ARGS_FRAME.
+    b       .Lcleanup_and_return
+.Lstore_double_result:
+    vldr    d0, [sp]               @ Copy double value from JValue result to the context restored by
+    vstr    d0, [sp, #16]          @ RESTORE_SAVE_REFS_AND_ARGS_FRAME.
+    b       .Lcleanup_and_return
+.Lstore_long_result:
+    ldr     r1, [sp, #4]           @ Copy the upper bits from JValue result to the context restored by
+    str     r1, [sp, #80]          @ RESTORE_SAVE_REFS_AND_ARGS_FRAME.
+    // Fall-through for lower bits.
+.Lstore_int_result:
+    ldr     r0, [sp]               @ Copy int value to return value of this function.
+    // Fall-through to clean up and return.
+.Lcleanup_and_return:
+    add     sp, #8
+    .cfi_adjust_cfa_offset -8
+    RESTORE_SAVE_REFS_AND_ARGS_FRAME
+    RETURN_OR_DELIVER_PENDING_EXCEPTION_REG r2
+
+.macro HANDLER_TABLE_OFFSET handler_label
+    .byte (\handler_label - .Lstart_of_handlers) / 2
+.endm
+
+.Lhandler_table:
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // A
+    HANDLER_TABLE_OFFSET(.Lstore_int_result)      // B (byte)
+    HANDLER_TABLE_OFFSET(.Lstore_char_result)     // C (char)
+    HANDLER_TABLE_OFFSET(.Lstore_double_result)   // D (double)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // E
+    HANDLER_TABLE_OFFSET(.Lstore_float_result)    // F (float)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // G
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // H
+    HANDLER_TABLE_OFFSET(.Lstore_int_result)      // I (int)
+    HANDLER_TABLE_OFFSET(.Lstore_long_result)     // J (long)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // K
+    HANDLER_TABLE_OFFSET(.Lstore_int_result)      // L (object)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // M
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // N
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // O
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // P
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // Q
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // R
+    HANDLER_TABLE_OFFSET(.Lstore_int_result)      // S (short)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // T
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // U
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // V (void)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // W
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // X
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // Y
+    HANDLER_TABLE_OFFSET(.Lstore_boolean_result)  // Z (boolean)
+.purgem HANDLER_TABLE_OFFSET
+END art_quick_invoke_polymorphic
diff --git a/runtime/arch/arm/quick_method_frame_info_arm.h b/runtime/arch/arm/quick_method_frame_info_arm.h
index 4b23c77..35f1948 100644
--- a/runtime/arch/arm/quick_method_frame_info_arm.h
+++ b/runtime/arch/arm/quick_method_frame_info_arm.h
@@ -62,7 +62,7 @@
 
 constexpr uint32_t ArmCalleeSaveFpSpills(Runtime::CalleeSaveType type) {
   return kArmCalleeSaveFpAlwaysSpills | kArmCalleeSaveFpRefSpills |
-      (type == Runtime::kSaveRefsAndArgs ? kArmCalleeSaveFpArgSpills: 0) |
+      (type == Runtime::kSaveRefsAndArgs ? kArmCalleeSaveFpArgSpills : 0) |
       (type == Runtime::kSaveAllCalleeSaves ? kArmCalleeSaveFpAllSpills : 0) |
       (type == Runtime::kSaveEverything ? kArmCalleeSaveFpEverythingSpills : 0);
 }
diff --git a/runtime/arch/arm64/instruction_set_features_arm64.cc b/runtime/arch/arm64/instruction_set_features_arm64.cc
index c598743..01bd177 100644
--- a/runtime/arch/arm64/instruction_set_features_arm64.cc
+++ b/runtime/arch/arm64/instruction_set_features_arm64.cc
@@ -33,7 +33,16 @@
     const std::string& variant, std::string* error_msg) {
   // Look for variants that need a fix for a53 erratum 835769.
   static const char* arm64_variants_with_a53_835769_bug[] = {
-      "default", "generic", "cortex-a53"  // Pessimistically assume all generic ARM64s are A53s.
+      // Pessimistically assume all generic CPUs are cortex-a53.
+      "default",
+      "generic",
+      "cortex-a53",
+      "cortex-a53.a57",
+      "cortex-a53.a72",
+      // Pessimistically assume all "big" cortex CPUs are paired with a cortex-a53.
+      "cortex-a57",
+      "cortex-a72",
+      "cortex-a73",
   };
   bool needs_a53_835769_fix = FindVariantInArray(arm64_variants_with_a53_835769_bug,
                                                  arraysize(arm64_variants_with_a53_835769_bug),
@@ -42,7 +51,10 @@
   if (!needs_a53_835769_fix) {
     // Check to see if this is an expected variant.
     static const char* arm64_known_variants[] = {
-        "denver64", "kryo", "exynos-m1"
+        "cortex-a35",
+        "exynos-m1",
+        "denver64",
+        "kryo"
     };
     if (!FindVariantInArray(arm64_known_variants, arraysize(arm64_known_variants), variant)) {
       std::ostringstream os;
diff --git a/runtime/arch/arm64/instruction_set_features_arm64_test.cc b/runtime/arch/arm64/instruction_set_features_arm64_test.cc
index cefa499..91cb58f 100644
--- a/runtime/arch/arm64/instruction_set_features_arm64_test.cc
+++ b/runtime/arch/arm64/instruction_set_features_arm64_test.cc
@@ -30,6 +30,40 @@
   EXPECT_TRUE(arm64_features->Equals(arm64_features.get()));
   EXPECT_STREQ("a53", arm64_features->GetFeatureString().c_str());
   EXPECT_EQ(arm64_features->AsBitmap(), 1U);
+
+  std::unique_ptr<const InstructionSetFeatures> cortex_a57_features(
+      InstructionSetFeatures::FromVariant(kArm64, "cortex-a57", &error_msg));
+  ASSERT_TRUE(cortex_a57_features.get() != nullptr) << error_msg;
+  EXPECT_EQ(cortex_a57_features->GetInstructionSet(), kArm64);
+  EXPECT_TRUE(cortex_a57_features->Equals(cortex_a57_features.get()));
+  EXPECT_STREQ("a53", cortex_a57_features->GetFeatureString().c_str());
+  EXPECT_EQ(cortex_a57_features->AsBitmap(), 1U);
+
+  std::unique_ptr<const InstructionSetFeatures> cortex_a73_features(
+      InstructionSetFeatures::FromVariant(kArm64, "cortex-a73", &error_msg));
+  ASSERT_TRUE(cortex_a73_features.get() != nullptr) << error_msg;
+  EXPECT_EQ(cortex_a73_features->GetInstructionSet(), kArm64);
+  EXPECT_TRUE(cortex_a73_features->Equals(cortex_a73_features.get()));
+  EXPECT_STREQ("a53", cortex_a73_features->GetFeatureString().c_str());
+  EXPECT_EQ(cortex_a73_features->AsBitmap(), 1U);
+
+  std::unique_ptr<const InstructionSetFeatures> cortex_a35_features(
+      InstructionSetFeatures::FromVariant(kArm64, "cortex-a35", &error_msg));
+  ASSERT_TRUE(cortex_a35_features.get() != nullptr) << error_msg;
+  EXPECT_EQ(cortex_a35_features->GetInstructionSet(), kArm64);
+  EXPECT_TRUE(cortex_a35_features->Equals(cortex_a35_features.get()));
+  EXPECT_STREQ("-a53", cortex_a35_features->GetFeatureString().c_str());
+  EXPECT_EQ(cortex_a35_features->AsBitmap(), 0U);
+
+  std::unique_ptr<const InstructionSetFeatures> kryo_features(
+      InstructionSetFeatures::FromVariant(kArm64, "kryo", &error_msg));
+  ASSERT_TRUE(kryo_features.get() != nullptr) << error_msg;
+  EXPECT_EQ(kryo_features->GetInstructionSet(), kArm64);
+  EXPECT_TRUE(kryo_features->Equals(kryo_features.get()));
+  EXPECT_TRUE(kryo_features->Equals(cortex_a35_features.get()));
+  EXPECT_FALSE(kryo_features->Equals(cortex_a57_features.get()));
+  EXPECT_STREQ("-a53", kryo_features->GetFeatureString().c_str());
+  EXPECT_EQ(kryo_features->AsBitmap(), 0U);
 }
 
 }  // namespace art
diff --git a/runtime/arch/arm64/quick_entrypoints_arm64.S b/runtime/arch/arm64/quick_entrypoints_arm64.S
index 8b1e038..00518e1 100644
--- a/runtime/arch/arm64/quick_entrypoints_arm64.S
+++ b/runtime/arch/arm64/quick_entrypoints_arm64.S
@@ -1404,33 +1404,6 @@
 #endif  // USE_READ_BARRIER
 .endm
 
-    /*
-     * Entry from managed code for array put operations of objects where the value being stored
-     * needs to be checked for compatibility.
-     * x0 = array, x1 = index, x2 = value
-     *
-     * Currently all values should fit into w0/w1/w2, and w1 always will as indices are 32b. We
-     * assume, though, that the upper 32b are zeroed out. At least for x1/w1 we can do better by
-     * using index-zero-extension in load/stores.
-     *
-     * Temporaries: x3, x4
-     * TODO: x4 OK? ip seems wrong here.
-     */
-ENTRY art_quick_aput_obj_with_null_and_bound_check
-    tst x0, x0
-    bne art_quick_aput_obj_with_bound_check
-    b art_quick_throw_null_pointer_exception
-END art_quick_aput_obj_with_null_and_bound_check
-
-ENTRY art_quick_aput_obj_with_bound_check
-    ldr w3, [x0, #MIRROR_ARRAY_LENGTH_OFFSET]
-    cmp w3, w1
-    bhi art_quick_aput_obj
-    mov x0, x1
-    mov x1, x3
-    b art_quick_throw_array_bounds
-END art_quick_aput_obj_with_bound_check
-
 #ifdef USE_READ_BARRIER
     .extern artReadBarrierSlow
 #endif
@@ -1672,11 +1645,7 @@
 // GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region_tlab, RegionTLAB)
 // GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_tlab, RegionTLAB) implemented in asm
 // GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab, RegionTLAB)
@@ -1764,13 +1733,6 @@
 
 
 // The common fast path code for art_quick_alloc_array_region_tlab.
-.macro ALLOC_ARRAY_TLAB_FAST_PATH slowPathLabel, xClass, wClass, xCount, wCount, xTemp0, wTemp0, xTemp1, wTemp1, xTemp2, wTemp2
-    // Check null class
-    cbz    \wClass, \slowPathLabel
-    ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED \slowPathLabel, \xClass, \wClass, \xCount, \wCount, \xTemp0, \wTemp0, \xTemp1, \wTemp1, \xTemp2, \wTemp2
-.endm
-
-// The common fast path code for art_quick_alloc_array_region_tlab.
 .macro ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED slowPathLabel, xClass, wClass, xCount, wCount, xTemp0, wTemp0, xTemp1, wTemp1, xTemp2, wTemp2
     // Array classes are never finalizable or uninitialized, no need to check.
     ldr    \wTemp0, [\xClass, #MIRROR_CLASS_COMPONENT_TYPE_OFFSET] // Load component type
@@ -1907,64 +1869,31 @@
 // TODO: We could use this macro for the normal tlab allocator too.
 
 // The common code for art_quick_alloc_array_*region_tlab
-.macro GENERATE_ALLOC_ARRAY_REGION_TLAB name, entrypoint, fast_path, is_resolved
+.macro GENERATE_ALLOC_ARRAY_REGION_TLAB name, entrypoint, fast_path
 ENTRY \name
     // Fast path array allocation for region tlab allocation.
-    // x0: uint32_t type_idx
+    // x0: mirror::Class* type
     // x1: int32_t component_count
-    // x2: ArtMethod* method
-    // x3-x7: free.
+    // x2-x7: free.
 #if !defined(USE_READ_BARRIER)
     mvn    x0, xzr                                            // Read barrier must be enabled here.
     ret                                                       // Return -1.
 #endif
-.if \is_resolved
     mov    x3, x0
-    // If already resolved, class is stored in x0
-.else
-    ldr    x3, [x2, #ART_METHOD_DEX_CACHE_TYPES_OFFSET_64]    // Load dex cache resolved types array
-                                                              // Load the class (x2)
-    ldr    w3, [x3, x0, lsl #COMPRESSED_REFERENCE_SIZE_SHIFT]
-.endif
-    // Most common case: GC is not marking.
-    ldr    w4, [xSELF, #THREAD_IS_GC_MARKING_OFFSET]
-    cbnz   x4, .Lmarking\name
-.Ldo_allocation\name:
     \fast_path .Lslow_path\name, x3, w3, x1, w1, x4, w4, x5, w5, x6, w6
-.Lmarking\name:
-    // GC is marking, check the lock word of the class for the mark bit.
-    // If the class is null, go slow path. The check is required to read the lock word.
-    cbz    w3, .Lslow_path\name
-    // Class is not null, check mark bit in lock word.
-    ldr    w4, [x3, #MIRROR_OBJECT_LOCK_WORD_OFFSET]
-    // If the bit is not zero, do the allocation.
-    tbnz   w4, #LOCK_WORD_MARK_BIT_SHIFT, .Ldo_allocation\name
-                                                              // The read barrier slow path. Mark
-                                                              // the class.
-    stp    x0, x1, [sp, #-32]!                                // Save registers (x0, x1, x2, lr).
-    stp    x2, xLR, [sp, #16]
-    mov    x0, x3                                             // Pass the class as the first param.
-    bl     artReadBarrierMark
-    mov    x3, x0                                             // Get the (marked) class back.
-    ldp    x2, xLR, [sp, #16]
-    ldp    x0, x1, [sp], #32                                  // Restore registers.
-    b      .Ldo_allocation\name
 .Lslow_path\name:
-    // x0: uint32_t type_idx / mirror::Class* klass (if resolved)
+    // x0: mirror::Class* klass
     // x1: int32_t component_count
-    // x2: ArtMethod* method
-    // x3: Thread* self
+    // x2: Thread* self
     SETUP_SAVE_REFS_ONLY_FRAME        // save callee saves in case of GC
-    mov    x3, xSELF                  // pass Thread::Current
+    mov    x2, xSELF                  // pass Thread::Current
     bl     \entrypoint
     RESTORE_SAVE_REFS_ONLY_FRAME
     RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
 END \name
 .endm
 
-GENERATE_ALLOC_ARRAY_REGION_TLAB art_quick_alloc_array_region_tlab, artAllocArrayFromCodeRegionTLAB, ALLOC_ARRAY_TLAB_FAST_PATH, 0
-// TODO: art_quick_alloc_array_resolved_region_tlab seems to not get called. Investigate compiler.
-GENERATE_ALLOC_ARRAY_REGION_TLAB art_quick_alloc_array_resolved_region_tlab, artAllocArrayFromCodeResolvedRegionTLAB, ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED, 1
+GENERATE_ALLOC_ARRAY_REGION_TLAB art_quick_alloc_array_resolved_region_tlab, artAllocArrayFromCodeResolvedRegionTLAB, ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED
 
     /*
      * Called by managed code when the thread has been asked to suspend.
@@ -2567,3 +2496,82 @@
 READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg27, w27, x27
 READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg28, w28, x28
 READ_BARRIER_MARK_REG art_quick_read_barrier_mark_reg29, w29, x29
+
+.extern artInvokePolymorphic
+ENTRY art_quick_invoke_polymorphic
+    SETUP_SAVE_REFS_AND_ARGS_FRAME                // Save callee saves in case allocation triggers GC.
+    mov     x2, xSELF
+    mov     x3, sp
+    INCREASE_FRAME 16                             // Reserve space for JValue result.
+    str     xzr, [sp, #0]                         // Initialize result to zero.
+    mov     x0, sp                                // Set r0 to point to result.
+    bl      artInvokePolymorphic                  // ArtInvokePolymorphic(result, receiver, thread, save_area)
+    uxtb    w0, w0                                // Result is the return type descriptor as a char.
+    sub     w0, w0, 'A'                           // Convert to zero based index.
+    cmp     w0, 'Z' - 'A'
+    bhi     .Lcleanup_and_return                  // Clean-up if out-of-bounds.
+    adrp    x1, .Lhandler_table                   // Compute address of handler table.
+    add     x1, x1, :lo12:.Lhandler_table
+    ldrb    w0, [x1, w0, uxtw]                    // Lookup handler offset in handler table.
+    adr     x1, .Lstart_of_handlers
+    add     x0, x1, w0, sxtb #2                   // Convert relative offset to absolute address.
+    br      x0                                    // Branch to handler.
+
+.Lstart_of_handlers:
+.Lstore_boolean_result:
+    ldrb    w0, [sp]
+    b       .Lcleanup_and_return
+.Lstore_char_result:
+    ldrh    w0, [sp]
+    b       .Lcleanup_and_return
+.Lstore_float_result:
+    ldr     s0, [sp]
+    str     s0, [sp, #32]
+    b       .Lcleanup_and_return
+.Lstore_double_result:
+    ldr     d0, [sp]
+    str     d0, [sp, #32]
+    b       .Lcleanup_and_return
+.Lstore_long_result:
+    ldr     x0, [sp]
+    // Fall-through
+.Lcleanup_and_return:
+    DECREASE_FRAME 16
+    RESTORE_SAVE_REFS_AND_ARGS_FRAME
+    RETURN_OR_DELIVER_PENDING_EXCEPTION_X1
+
+    .section    .rodata                           // Place handler table in read-only section away from text.
+    .align  2
+.macro HANDLER_TABLE_OFFSET handler_label
+    .byte (\handler_label - .Lstart_of_handlers) / 4
+.endm
+.Lhandler_table:
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // A
+    HANDLER_TABLE_OFFSET(.Lstore_long_result)     // B (byte)
+    HANDLER_TABLE_OFFSET(.Lstore_char_result)     // C (char)
+    HANDLER_TABLE_OFFSET(.Lstore_double_result)   // D (double)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // E
+    HANDLER_TABLE_OFFSET(.Lstore_float_result)    // F (float)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // G
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // H
+    HANDLER_TABLE_OFFSET(.Lstore_long_result)     // I (int)
+    HANDLER_TABLE_OFFSET(.Lstore_long_result)     // J (long)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // K
+    HANDLER_TABLE_OFFSET(.Lstore_long_result)     // L (object - references are compressed and only 32-bits)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // M
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // N
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // O
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // P
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // Q
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // R
+    HANDLER_TABLE_OFFSET(.Lstore_long_result)     // S (short)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // T
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // U
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // V (void)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // W
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // X
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)    // Y
+    HANDLER_TABLE_OFFSET(.Lstore_boolean_result)  // Z (boolean)
+    .text
+
+END  art_quick_invoke_polymorphic
diff --git a/runtime/arch/arm64/quick_method_frame_info_arm64.h b/runtime/arch/arm64/quick_method_frame_info_arm64.h
index 36f283b..32d9d08 100644
--- a/runtime/arch/arm64/quick_method_frame_info_arm64.h
+++ b/runtime/arch/arm64/quick_method_frame_info_arm64.h
@@ -85,7 +85,7 @@
 
 constexpr uint32_t Arm64CalleeSaveFpSpills(Runtime::CalleeSaveType type) {
   return kArm64CalleeSaveFpAlwaysSpills | kArm64CalleeSaveFpRefSpills |
-      (type == Runtime::kSaveRefsAndArgs ? kArm64CalleeSaveFpArgSpills: 0) |
+      (type == Runtime::kSaveRefsAndArgs ? kArm64CalleeSaveFpArgSpills : 0) |
       (type == Runtime::kSaveAllCalleeSaves ? kArm64CalleeSaveFpAllSpills : 0) |
       (type == Runtime::kSaveEverything ? kArm64CalleeSaveFpEverythingSpills : 0);
 }
diff --git a/runtime/arch/code_offset.h b/runtime/arch/code_offset.h
new file mode 100644
index 0000000..ab04b1e
--- /dev/null
+++ b/runtime/arch/code_offset.h
@@ -0,0 +1,92 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_RUNTIME_ARCH_CODE_OFFSET_H_
+#define ART_RUNTIME_ARCH_CODE_OFFSET_H_
+
+#include <iosfwd>
+
+#include "base/bit_utils.h"
+#include "base/logging.h"
+#include "instruction_set.h"
+
+namespace art {
+
+// CodeOffset is a holder for compressed code offsets. Since some architectures have alignment
+// requirements it is possible to compress code offsets to reduce stack map sizes.
+class CodeOffset {
+ public:
+  ALWAYS_INLINE static CodeOffset FromOffset(uint32_t offset, InstructionSet isa = kRuntimeISA) {
+    return CodeOffset(offset / GetInstructionSetInstructionAlignment(isa));
+  }
+
+  ALWAYS_INLINE static CodeOffset FromCompressedOffset(uint32_t offset) {
+    return CodeOffset(offset);
+  }
+
+  ALWAYS_INLINE uint32_t Uint32Value(InstructionSet isa = kRuntimeISA) const {
+    uint32_t decoded = value_ * GetInstructionSetInstructionAlignment(isa);
+    DCHECK_GE(decoded, value_) << "Integer overflow";
+    return decoded;
+  }
+
+  // Return compressed internal value.
+  ALWAYS_INLINE uint32_t CompressedValue() const {
+    return value_;
+  }
+
+  ALWAYS_INLINE CodeOffset() = default;
+  ALWAYS_INLINE CodeOffset(const CodeOffset&) = default;
+  ALWAYS_INLINE CodeOffset& operator=(const CodeOffset&) = default;
+  ALWAYS_INLINE CodeOffset& operator=(CodeOffset&&) = default;
+
+ private:
+  ALWAYS_INLINE explicit CodeOffset(uint32_t value) : value_(value) {}
+
+  uint32_t value_ = 0u;
+};
+
+inline bool operator==(const CodeOffset& a, const CodeOffset& b) {
+  return a.CompressedValue() == b.CompressedValue();
+}
+
+inline bool operator!=(const CodeOffset& a, const CodeOffset& b) {
+  return !(a == b);
+}
+
+inline bool operator<(const CodeOffset& a, const CodeOffset& b) {
+  return a.CompressedValue() < b.CompressedValue();
+}
+
+inline bool operator<=(const CodeOffset& a, const CodeOffset& b) {
+  return a.CompressedValue() <= b.CompressedValue();
+}
+
+inline bool operator>(const CodeOffset& a, const CodeOffset& b) {
+  return a.CompressedValue() > b.CompressedValue();
+}
+
+inline bool operator>=(const CodeOffset& a, const CodeOffset& b) {
+  return a.CompressedValue() >= b.CompressedValue();
+}
+
+inline std::ostream& operator<<(std::ostream& os, const CodeOffset& offset) {
+  return os << offset.Uint32Value();
+}
+
+}  // namespace art
+
+#endif  // ART_RUNTIME_ARCH_CODE_OFFSET_H_
diff --git a/runtime/arch/instruction_set.h b/runtime/arch/instruction_set.h
index 4a8bea4..99aea62 100644
--- a/runtime/arch/instruction_set.h
+++ b/runtime/arch/instruction_set.h
@@ -75,6 +75,14 @@
 // X86 instruction alignment. This is the recommended alignment for maximum performance.
 static constexpr size_t kX86Alignment = 16;
 
+// Different than code alignment since code alignment is only first instruction of method.
+static constexpr size_t kThumb2InstructionAlignment = 2;
+static constexpr size_t kArm64InstructionAlignment = 4;
+static constexpr size_t kX86InstructionAlignment = 1;
+static constexpr size_t kX86_64InstructionAlignment = 1;
+static constexpr size_t kMipsInstructionAlignment = 2;
+static constexpr size_t kMips64InstructionAlignment = 2;
+
 const char* GetInstructionSetString(InstructionSet isa);
 
 // Note: Returns kNone when the string cannot be parsed to a known value.
@@ -106,6 +114,17 @@
   }
 }
 
+ALWAYS_INLINE static inline constexpr size_t GetInstructionSetInstructionAlignment(
+    InstructionSet isa) {
+  return (isa == kThumb2 || isa == kArm) ? kThumb2InstructionAlignment :
+         (isa == kArm64) ? kArm64InstructionAlignment :
+         (isa == kX86) ? kX86InstructionAlignment :
+         (isa == kX86_64) ? kX86_64InstructionAlignment :
+         (isa == kMips) ? kMipsInstructionAlignment :
+         (isa == kMips64) ? kMips64InstructionAlignment :
+         0;  // Invalid case, but constexpr doesn't support asserts.
+}
+
 static inline bool IsValidInstructionSet(InstructionSet isa) {
   switch (isa) {
     case kArm:
diff --git a/runtime/arch/instruction_set_test.cc b/runtime/arch/instruction_set_test.cc
index 5aae93a..b251b57 100644
--- a/runtime/arch/instruction_set_test.cc
+++ b/runtime/arch/instruction_set_test.cc
@@ -44,6 +44,15 @@
   EXPECT_STREQ("none", GetInstructionSetString(kNone));
 }
 
+TEST(InstructionSetTest, GetInstructionSetInstructionAlignment) {
+  EXPECT_EQ(GetInstructionSetInstructionAlignment(kThumb2), kThumb2InstructionAlignment);
+  EXPECT_EQ(GetInstructionSetInstructionAlignment(kArm64), kArm64InstructionAlignment);
+  EXPECT_EQ(GetInstructionSetInstructionAlignment(kX86), kX86InstructionAlignment);
+  EXPECT_EQ(GetInstructionSetInstructionAlignment(kX86_64), kX86_64InstructionAlignment);
+  EXPECT_EQ(GetInstructionSetInstructionAlignment(kMips), kMipsInstructionAlignment);
+  EXPECT_EQ(GetInstructionSetInstructionAlignment(kMips64), kMips64InstructionAlignment);
+}
+
 TEST(InstructionSetTest, TestRoundTrip) {
   EXPECT_EQ(kRuntimeISA, GetInstructionSetFromString(GetInstructionSetString(kRuntimeISA)));
 }
diff --git a/runtime/arch/mips/entrypoints_init_mips.cc b/runtime/arch/mips/entrypoints_init_mips.cc
index 5c56923..36f9ea7 100644
--- a/runtime/arch/mips/entrypoints_init_mips.cc
+++ b/runtime/arch/mips/entrypoints_init_mips.cc
@@ -142,16 +142,8 @@
   static_assert(!IsDirectEntrypoint(kQuickGetObjStatic), "Non-direct C stub marked direct.");
 
   // Array
-  qpoints->pAputObjectWithNullAndBoundCheck = art_quick_aput_obj_with_null_and_bound_check;
-  static_assert(!IsDirectEntrypoint(kQuickAputObjectWithNullAndBoundCheck),
-                "Non-direct C stub marked direct.");
-  qpoints->pAputObjectWithBoundCheck = art_quick_aput_obj_with_bound_check;
-  static_assert(!IsDirectEntrypoint(kQuickAputObjectWithBoundCheck),
-                "Non-direct C stub marked direct.");
   qpoints->pAputObject = art_quick_aput_obj;
   static_assert(!IsDirectEntrypoint(kQuickAputObject), "Non-direct C stub marked direct.");
-  qpoints->pHandleFillArrayData = art_quick_handle_fill_data;
-  static_assert(!IsDirectEntrypoint(kQuickHandleFillArrayData), "Non-direct C stub marked direct.");
 
   // JNI
   qpoints->pJniMethodStart = JniMethodStart;
@@ -262,6 +254,7 @@
       art_quick_invoke_virtual_trampoline_with_access_check;
   static_assert(!IsDirectEntrypoint(kQuickInvokeVirtualTrampolineWithAccessCheck),
                 "Non-direct C stub marked direct.");
+  qpoints->pInvokePolymorphic = art_quick_invoke_polymorphic;
 
   // Thread
   qpoints->pTestSuspend = art_quick_test_suspend;
diff --git a/runtime/arch/mips/quick_entrypoints_mips.S b/runtime/arch/mips/quick_entrypoints_mips.S
index 964ea56..76218fb 100644
--- a/runtime/arch/mips/quick_entrypoints_mips.S
+++ b/runtime/arch/mips/quick_entrypoints_mips.S
@@ -1389,28 +1389,6 @@
 #endif  // USE_READ_BARRIER
 .endm
 
-    /*
-     * Entry from managed code for array put operations of objects where the value being stored
-     * needs to be checked for compatibility.
-     * a0 = array, a1 = index, a2 = value
-     */
-ENTRY art_quick_aput_obj_with_null_and_bound_check
-    bnez    $a0, .Lart_quick_aput_obj_with_bound_check_gp_set
-    nop
-    b art_quick_throw_null_pointer_exception
-    nop
-END art_quick_aput_obj_with_null_and_bound_check
-
-ENTRY art_quick_aput_obj_with_bound_check
-    lw $t0, MIRROR_ARRAY_LENGTH_OFFSET($a0)
-    sltu $t1, $a1, $t0
-    bnez $t1, .Lart_quick_aput_obj_gp_set
-    nop
-    move $a0, $a1
-    b art_quick_throw_array_bounds
-    move $a1, $t0
-END art_quick_aput_obj_with_bound_check
-
 #ifdef USE_READ_BARRIER
     .extern artReadBarrierSlow
 #endif
@@ -2230,7 +2208,7 @@
   li    $v0, -1         #     return -1;
 
   sll   $v0, $a2, 1     # $a0 += $a2 * 2
-  addu  $a0, $a0, $v0   #  "  "   "  " "
+  addu  $a0, $a0, $v0   #  "  ditto  "
   move  $v0, $a2        # Set i to fromIndex.
 
 1:
@@ -2280,3 +2258,59 @@
   j      $ra
   nop
 END art_quick_string_compareto
+
+.extern artInvokePolymorphic
+ENTRY art_quick_invoke_polymorphic
+    SETUP_SAVE_REFS_AND_ARGS_FRAME
+    move  $a2, rSELF                          # Make $a2 an alias for the current Thread.
+    addiu $a3, $sp, ARG_SLOT_SIZE             # Make $a3 a pointer to the saved frame context.
+    sw    $zero, 20($sp)                      # Initialize JValue result.
+    sw    $zero, 16($sp)
+    la    $t9, artInvokePolymorphic
+    jalr  $t9                                 # (result, receiver, Thread*, context)
+    addiu $a0, $sp, 16                        # Make $a0 a pointer to the JValue result
+.macro MATCH_RETURN_TYPE c, handler
+    li    $t0, \c
+    beq   $v0, $t0, \handler
+.endm
+    MATCH_RETURN_TYPE 'V', .Lcleanup_and_return
+    MATCH_RETURN_TYPE 'L', .Lstore_int_result
+    MATCH_RETURN_TYPE 'I', .Lstore_int_result
+    MATCH_RETURN_TYPE 'J', .Lstore_long_result
+    MATCH_RETURN_TYPE 'B', .Lstore_int_result
+    MATCH_RETURN_TYPE 'C', .Lstore_char_result
+    MATCH_RETURN_TYPE 'D', .Lstore_double_result
+    MATCH_RETURN_TYPE 'F', .Lstore_float_result
+    MATCH_RETURN_TYPE 'S', .Lstore_int_result
+    MATCH_RETURN_TYPE 'Z', .Lstore_boolean_result
+.purgem MATCH_RETURN_TYPE
+    nop
+    b .Lcleanup_and_return
+    nop
+.Lstore_boolean_result:
+    b .Lcleanup_and_return
+    lbu   $v0, 16($sp)                        # Move byte from JValue result to return value register.
+.Lstore_char_result:
+    b .Lcleanup_and_return
+    lhu   $v0, 16($sp)                        # Move char from JValue result to return value register.
+.Lstore_double_result:
+.Lstore_float_result:
+    LDu   $f0, $f1, 16, $sp, $t0              # Move double/float from JValue result to return value register.
+    b .Lcleanup_and_return
+    nop
+.Lstore_long_result:
+    lw    $v1, 20($sp)                        # Move upper bits from JValue result to return value register.
+    // Fall-through for lower bits.
+.Lstore_int_result:
+    lw    $v0, 16($sp)                        # Move lower bits from JValue result to return value register.
+    // Fall-through to clean up and return.
+.Lcleanup_and_return:
+    lw    $t7, THREAD_EXCEPTION_OFFSET(rSELF) # Load Thread::Current()->exception_
+    RESTORE_SAVE_REFS_AND_ARGS_FRAME
+    bnez  $t7, 1f                             # Success if no exception is pending.
+    nop
+    jalr  $zero, $ra
+    nop
+1:
+    DELIVER_PENDING_EXCEPTION
+END art_quick_invoke_polymorphic
diff --git a/runtime/arch/mips64/instruction_set_features_mips64.cc b/runtime/arch/mips64/instruction_set_features_mips64.cc
index 5606c1d..5757906 100644
--- a/runtime/arch/mips64/instruction_set_features_mips64.cc
+++ b/runtime/arch/mips64/instruction_set_features_mips64.cc
@@ -70,7 +70,7 @@
 }
 
 std::string Mips64InstructionSetFeatures::GetFeatureString() const {
-  return "";
+  return "default";
 }
 
 std::unique_ptr<const InstructionSetFeatures>
diff --git a/runtime/arch/mips64/instruction_set_features_mips64_test.cc b/runtime/arch/mips64/instruction_set_features_mips64_test.cc
index 1d03794..380c4e5 100644
--- a/runtime/arch/mips64/instruction_set_features_mips64_test.cc
+++ b/runtime/arch/mips64/instruction_set_features_mips64_test.cc
@@ -27,7 +27,7 @@
   ASSERT_TRUE(mips64_features.get() != nullptr) << error_msg;
   EXPECT_EQ(mips64_features->GetInstructionSet(), kMips64);
   EXPECT_TRUE(mips64_features->Equals(mips64_features.get()));
-  EXPECT_STREQ("", mips64_features->GetFeatureString().c_str());
+  EXPECT_STREQ("default", mips64_features->GetFeatureString().c_str());
   EXPECT_EQ(mips64_features->AsBitmap(), 0U);
 }
 
diff --git a/runtime/arch/mips64/quick_entrypoints_mips64.S b/runtime/arch/mips64/quick_entrypoints_mips64.S
index 2a18d53..b53fd10 100644
--- a/runtime/arch/mips64/quick_entrypoints_mips64.S
+++ b/runtime/arch/mips64/quick_entrypoints_mips64.S
@@ -1360,29 +1360,6 @@
 #endif  // USE_READ_BARRIER
 .endm
 
-    /*
-     * Entry from managed code for array put operations of objects where the value being stored
-     * needs to be checked for compatibility.
-     * a0 = array, a1 = index, a2 = value
-     */
-ENTRY art_quick_aput_obj_with_null_and_bound_check
-    bne    $a0, $zero, .Lart_quick_aput_obj_with_bound_check_gp_set
-    nop
-    b art_quick_throw_null_pointer_exception
-    .cpreturn                       # Restore gp from t8 in branch delay slot.
-END art_quick_aput_obj_with_null_and_bound_check
-
-ENTRY art_quick_aput_obj_with_bound_check
-    lwu  $t0, MIRROR_ARRAY_LENGTH_OFFSET($a0)
-    sltu $t1, $a1, $t0
-    bne  $t1, $zero, .Lart_quick_aput_obj_gp_set
-    nop
-    move $a0, $a1
-    move $a1, $t0
-    b art_quick_throw_array_bounds
-    .cpreturn                       # Restore gp from t8 in branch delay slot.
-END art_quick_aput_obj_with_bound_check
-
 ENTRY art_quick_aput_obj
     beq  $a2, $zero, .Ldo_aput_null
     nop
@@ -2105,7 +2082,7 @@
   li    $v0,-1          #     return -1;
 
   sll   $v0,$a2,1       # $a0 += $a2 * 2
-  daddu $a0,$a0,$v0     #  "  "   "  " "
+  daddu $a0,$a0,$v0     #  "  ditto  "
   move  $v0,$a2         # Set i to fromIndex.
 
 1:
@@ -2124,4 +2101,61 @@
   nop
 END art_quick_indexof
 
+.extern artInvokePolymorphic
+ENTRY art_quick_invoke_polymorphic
+    SETUP_SAVE_REFS_AND_ARGS_FRAME
+    move   $a2, rSELF                          # Make $a2 an alias for the current Thread.
+    move   $a3, $sp                            # Make $a3 a pointer to the saved frame context.
+    daddiu $sp, $sp, -8                        # Reserve space for JValue result.
+    .cfi_adjust_cfa_offset 8
+    sd     $zero, 0($sp)                       # Initialize JValue result.
+    jal    artInvokePolymorphic                # (result, receiver, Thread*, context)
+    move   $a0, $sp                            # Make $a0 a pointer to the JValue result
+.macro MATCH_RETURN_TYPE c, handler
+    li     $t0, \c
+    beq    $v0, $t0, \handler
+.endm
+    MATCH_RETURN_TYPE 'V', .Lcleanup_and_return
+    MATCH_RETURN_TYPE 'L', .Lstore_ref_result
+    MATCH_RETURN_TYPE 'I', .Lstore_long_result
+    MATCH_RETURN_TYPE 'J', .Lstore_long_result
+    MATCH_RETURN_TYPE 'B', .Lstore_long_result
+    MATCH_RETURN_TYPE 'C', .Lstore_char_result
+    MATCH_RETURN_TYPE 'D', .Lstore_double_result
+    MATCH_RETURN_TYPE 'F', .Lstore_float_result
+    MATCH_RETURN_TYPE 'S', .Lstore_long_result
+    MATCH_RETURN_TYPE 'Z', .Lstore_boolean_result
+.purgem MATCH_RETURN_TYPE
+    nop
+    b .Lcleanup_and_return
+    nop
+.Lstore_boolean_result:
+    b      .Lcleanup_and_return
+    lbu    $v0, 0($sp)                         # Move byte from JValue result to return value register.
+.Lstore_char_result:
+    b      .Lcleanup_and_return
+    lhu    $v0, 0($sp)                         # Move char from JValue result to return value register.
+.Lstore_double_result:
+.Lstore_float_result:
+    b      .Lcleanup_and_return
+    l.d    $f0, 0($sp)                         # Move double/float from JValue result to return value register.
+.Lstore_ref_result:
+    b      .Lcleanup_and_return
+    lwu    $v0, 0($sp)                         # Move zero extended lower 32-bits to return value register.
+.Lstore_long_result:
+    ld     $v0, 0($sp)                         # Move long from JValue result to return value register.
+    // Fall-through to clean up and return.
+.Lcleanup_and_return:
+    daddiu $sp, $sp, 8                         # Remove space for JValue result.
+    .cfi_adjust_cfa_offset -8
+    ld     $t0, THREAD_EXCEPTION_OFFSET(rSELF) # Load Thread::Current()->exception_
+    RESTORE_SAVE_REFS_AND_ARGS_FRAME
+    bnez   $t0, 1f                             # Success if no exception is pending.
+    nop
+    jalr   $zero, $ra
+    nop
+1:
+    DELIVER_PENDING_EXCEPTION
+END art_quick_invoke_polymorphic
+
   .set pop
diff --git a/runtime/arch/mips64/quick_method_frame_info_mips64.h b/runtime/arch/mips64/quick_method_frame_info_mips64.h
index 397776e..d774473 100644
--- a/runtime/arch/mips64/quick_method_frame_info_mips64.h
+++ b/runtime/arch/mips64/quick_method_frame_info_mips64.h
@@ -78,7 +78,7 @@
 
 constexpr uint32_t Mips64CalleeSaveFpSpills(Runtime::CalleeSaveType type) {
   return kMips64CalleeSaveFpRefSpills |
-      (type == Runtime::kSaveRefsAndArgs ? kMips64CalleeSaveFpArgSpills: 0) |
+      (type == Runtime::kSaveRefsAndArgs ? kMips64CalleeSaveFpArgSpills : 0) |
       (type == Runtime::kSaveAllCalleeSaves ? kMips64CalleeSaveFpAllSpills : 0) |
       (type == Runtime::kSaveEverything ? kMips64CalleeSaveFpEverythingSpills : 0);
 }
diff --git a/runtime/arch/quick_alloc_entrypoints.S b/runtime/arch/quick_alloc_entrypoints.S
index abd9046..e79dc60 100644
--- a/runtime/arch/quick_alloc_entrypoints.S
+++ b/runtime/arch/quick_alloc_entrypoints.S
@@ -22,17 +22,8 @@
 // Called by managed code to allocate an object when the caller doesn't know whether it has access
 // to the created type.
 ONE_ARG_DOWNCALL art_quick_alloc_object_with_checks\c_suffix, artAllocObjectFromCodeWithChecks\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-// Called by managed code to allocate an array.
-THREE_ARG_DOWNCALL art_quick_alloc_array\c_suffix, artAllocArrayFromCode\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
 // Called by managed code to allocate an array of a resolve class.
-THREE_ARG_DOWNCALL art_quick_alloc_array_resolved\c_suffix, artAllocArrayFromCodeResolved\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-// Called by managed code to allocate an array when the caller doesn't know whether it has access
-// to the created type.
-THREE_ARG_DOWNCALL art_quick_alloc_array_with_access_check\c_suffix, artAllocArrayFromCodeWithAccessCheck\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-// Called by managed code to allocate an array in a special case for FILLED_NEW_ARRAY.
-THREE_ARG_DOWNCALL art_quick_check_and_alloc_array\c_suffix, artCheckAndAllocArrayFromCode\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-// Called by managed code to allocate an array in a special case for FILLED_NEW_ARRAY.
-THREE_ARG_DOWNCALL art_quick_check_and_alloc_array_with_access_check\c_suffix, artCheckAndAllocArrayFromCodeWithAccessCheck\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
+TWO_ARG_DOWNCALL art_quick_alloc_array_resolved\c_suffix, artAllocArrayFromCodeResolved\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
 // Called by managed code to allocate a string from bytes
 FOUR_ARG_DOWNCALL art_quick_alloc_string_from_bytes\c_suffix, artAllocStringFromBytesFromCode\cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
 // Called by managed code to allocate a string from chars
@@ -65,16 +56,8 @@
   ONE_ARG_DOWNCALL art_quick_alloc_object_initialized ## c_suffix, artAllocObjectFromCodeInitialized ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
 #define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(c_suffix, cxx_suffix) \
   ONE_ARG_DOWNCALL art_quick_alloc_object_with_checks ## c_suffix, artAllocObjectFromCodeWithChecks ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-#define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(c_suffix, cxx_suffix) \
-  THREE_ARG_DOWNCALL art_quick_alloc_array ## c_suffix, artAllocArrayFromCode ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
 #define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(c_suffix, cxx_suffix) \
-  THREE_ARG_DOWNCALL art_quick_alloc_array_resolved ## c_suffix, artAllocArrayFromCodeResolved ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-#define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(c_suffix, cxx_suffix) \
-  THREE_ARG_DOWNCALL art_quick_alloc_array_with_access_check ## c_suffix, artAllocArrayFromCodeWithAccessCheck ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-#define GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(c_suffix, cxx_suffix) \
-  THREE_ARG_DOWNCALL art_quick_check_and_alloc_array ## c_suffix, artCheckAndAllocArrayFromCode ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
-#define GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(c_suffix, cxx_suffix) \
-  THREE_ARG_DOWNCALL art_quick_check_and_alloc_array_with_access_check ## c_suffix, artCheckAndAllocArrayFromCodeWithAccessCheck ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
+  TWO_ARG_DOWNCALL art_quick_alloc_array_resolved ## c_suffix, artAllocArrayFromCodeResolved ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
 #define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(c_suffix, cxx_suffix) \
   FOUR_ARG_DOWNCALL art_quick_alloc_string_from_bytes ## c_suffix, artAllocStringFromBytesFromCode ## cxx_suffix, RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER
 #define GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(c_suffix, cxx_suffix) \
@@ -92,11 +75,7 @@
 // GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab, RegionTLAB)
@@ -107,11 +86,7 @@
 // GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_tlab, TLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_tlab, TLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_tlab, TLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_tlab, TLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_tlab, TLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_tlab, TLAB)
@@ -126,11 +101,7 @@
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_dlmalloc, DlMalloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_dlmalloc, DlMalloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_dlmalloc, DlMalloc)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_dlmalloc, DlMalloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_dlmalloc, DlMalloc)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_dlmalloc, DlMalloc)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_dlmalloc, DlMalloc)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_dlmalloc, DlMalloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_dlmalloc, DlMalloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_dlmalloc, DlMalloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_dlmalloc, DlMalloc)
@@ -138,11 +109,7 @@
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_dlmalloc_instrumented, DlMallocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_dlmalloc_instrumented, DlMallocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_dlmalloc_instrumented, DlMallocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_dlmalloc_instrumented, DlMallocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_dlmalloc_instrumented, DlMallocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_dlmalloc_instrumented, DlMallocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_dlmalloc_instrumented, DlMallocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_dlmalloc_instrumented, DlMallocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_dlmalloc_instrumented, DlMallocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_dlmalloc_instrumented, DlMallocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_dlmalloc_instrumented, DlMallocInstrumented)
@@ -151,11 +118,7 @@
 // GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_rosalloc, RosAlloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_rosalloc, RosAlloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_rosalloc, RosAlloc)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_rosalloc, RosAlloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_rosalloc, RosAlloc)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_rosalloc, RosAlloc)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_rosalloc, RosAlloc)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_rosalloc, RosAlloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_rosalloc, RosAlloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_rosalloc, RosAlloc)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_rosalloc, RosAlloc)
@@ -163,11 +126,7 @@
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_rosalloc_instrumented, RosAllocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_rosalloc_instrumented, RosAllocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_rosalloc_instrumented, RosAllocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_rosalloc_instrumented, RosAllocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_rosalloc_instrumented, RosAllocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_rosalloc_instrumented, RosAllocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_rosalloc_instrumented, RosAllocInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_rosalloc_instrumented, RosAllocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_rosalloc_instrumented, RosAllocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_rosalloc_instrumented, RosAllocInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_rosalloc_instrumented, RosAllocInstrumented)
@@ -175,11 +134,7 @@
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_bump_pointer, BumpPointer)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_bump_pointer, BumpPointer)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_bump_pointer, BumpPointer)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_bump_pointer, BumpPointer)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_bump_pointer, BumpPointer)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_bump_pointer, BumpPointer)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_bump_pointer, BumpPointer)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_bump_pointer, BumpPointer)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_bump_pointer, BumpPointer)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_bump_pointer, BumpPointer)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_bump_pointer, BumpPointer)
@@ -187,11 +142,7 @@
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_bump_pointer_instrumented, BumpPointerInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_bump_pointer_instrumented, BumpPointerInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_bump_pointer_instrumented, BumpPointerInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_bump_pointer_instrumented, BumpPointerInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_bump_pointer_instrumented, BumpPointerInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_bump_pointer_instrumented, BumpPointerInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_bump_pointer_instrumented, BumpPointerInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_bump_pointer_instrumented, BumpPointerInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_bump_pointer_instrumented, BumpPointerInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_bump_pointer_instrumented, BumpPointerInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_bump_pointer_instrumented, BumpPointerInstrumented)
@@ -199,11 +150,7 @@
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_tlab_instrumented, TLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_tlab_instrumented, TLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_tlab_instrumented, TLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_tlab_instrumented, TLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab_instrumented, TLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab_instrumented, TLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_tlab_instrumented, TLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab_instrumented, TLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_tlab_instrumented, TLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_tlab_instrumented, TLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_tlab_instrumented, TLABInstrumented)
@@ -211,11 +158,7 @@
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region, Region)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region, Region)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region, Region)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region, Region)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region, Region)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region, Region)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region, Region)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region, Region)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region, Region)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region, Region)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region, Region)
@@ -223,11 +166,7 @@
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region_instrumented, RegionInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region_instrumented, RegionInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region_instrumented, RegionInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_instrumented, RegionInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_instrumented, RegionInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_instrumented, RegionInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region_instrumented, RegionInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_instrumented, RegionInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region_instrumented, RegionInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region_instrumented, RegionInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_instrumented, RegionInstrumented)
@@ -235,11 +174,7 @@
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region_tlab_instrumented, RegionTLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region_tlab_instrumented, RegionTLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region_tlab_instrumented, RegionTLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_tlab_instrumented, RegionTLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_tlab_instrumented, RegionTLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab_instrumented, RegionTLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region_tlab_instrumented, RegionTLABInstrumented)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab_instrumented, RegionTLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region_tlab_instrumented, RegionTLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region_tlab_instrumented, RegionTLABInstrumented)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab_instrumented, RegionTLABInstrumented)
diff --git a/runtime/arch/stub_test.cc b/runtime/arch/stub_test.cc
index ee65fa8..547b57e 100644
--- a/runtime/arch/stub_test.cc
+++ b/runtime/arch/stub_test.cc
@@ -908,139 +908,6 @@
 #endif
 }
 
-
-TEST_F(StubTest, APutObj) {
-#if defined(__i386__) || defined(__arm__) || defined(__aarch64__) || defined(__mips__) || \
-    (defined(__x86_64__) && !defined(__APPLE__))
-  Thread* self = Thread::Current();
-
-  // Do not check non-checked ones, we'd need handlers and stuff...
-  const uintptr_t art_quick_aput_obj_with_null_and_bound_check =
-      StubTest::GetEntrypoint(self, kQuickAputObjectWithNullAndBoundCheck);
-
-  // Create an object
-  ScopedObjectAccess soa(self);
-  // garbage is created during ClassLinker::Init
-
-  StackHandleScope<5> hs(soa.Self());
-  Handle<mirror::Class> c(
-      hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "Ljava/lang/Object;")));
-  Handle<mirror::Class> ca(
-      hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "[Ljava/lang/String;")));
-
-  // Build a string array of size 1
-  Handle<mirror::ObjectArray<mirror::Object>> array(
-      hs.NewHandle(mirror::ObjectArray<mirror::Object>::Alloc(soa.Self(), ca.Get(), 10)));
-
-  // Build a string -> should be assignable
-  Handle<mirror::String> str_obj(
-      hs.NewHandle(mirror::String::AllocFromModifiedUtf8(soa.Self(), "hello, world!")));
-
-  // Build a generic object -> should fail assigning
-  Handle<mirror::Object> obj_obj(hs.NewHandle(c->AllocObject(soa.Self())));
-
-  // Play with it...
-
-  // 1) Success cases
-  // 1.1) Assign str_obj to array[0..3]
-
-  EXPECT_FALSE(self->IsExceptionPending());
-
-  Invoke3(reinterpret_cast<size_t>(array.Get()), 0U, reinterpret_cast<size_t>(str_obj.Get()),
-          art_quick_aput_obj_with_null_and_bound_check, self);
-
-  EXPECT_FALSE(self->IsExceptionPending());
-  EXPECT_EQ(str_obj.Get(), array->Get(0));
-
-  Invoke3(reinterpret_cast<size_t>(array.Get()), 1U, reinterpret_cast<size_t>(str_obj.Get()),
-          art_quick_aput_obj_with_null_and_bound_check, self);
-
-  EXPECT_FALSE(self->IsExceptionPending());
-  EXPECT_EQ(str_obj.Get(), array->Get(1));
-
-  Invoke3(reinterpret_cast<size_t>(array.Get()), 2U, reinterpret_cast<size_t>(str_obj.Get()),
-          art_quick_aput_obj_with_null_and_bound_check, self);
-
-  EXPECT_FALSE(self->IsExceptionPending());
-  EXPECT_EQ(str_obj.Get(), array->Get(2));
-
-  Invoke3(reinterpret_cast<size_t>(array.Get()), 3U, reinterpret_cast<size_t>(str_obj.Get()),
-          art_quick_aput_obj_with_null_and_bound_check, self);
-
-  EXPECT_FALSE(self->IsExceptionPending());
-  EXPECT_EQ(str_obj.Get(), array->Get(3));
-
-  // 1.2) Assign null to array[0..3]
-
-  Invoke3(reinterpret_cast<size_t>(array.Get()), 0U, reinterpret_cast<size_t>(nullptr),
-          art_quick_aput_obj_with_null_and_bound_check, self);
-
-  EXPECT_FALSE(self->IsExceptionPending());
-  EXPECT_EQ(nullptr, array->Get(0));
-
-  Invoke3(reinterpret_cast<size_t>(array.Get()), 1U, reinterpret_cast<size_t>(nullptr),
-          art_quick_aput_obj_with_null_and_bound_check, self);
-
-  EXPECT_FALSE(self->IsExceptionPending());
-  EXPECT_EQ(nullptr, array->Get(1));
-
-  Invoke3(reinterpret_cast<size_t>(array.Get()), 2U, reinterpret_cast<size_t>(nullptr),
-          art_quick_aput_obj_with_null_and_bound_check, self);
-
-  EXPECT_FALSE(self->IsExceptionPending());
-  EXPECT_EQ(nullptr, array->Get(2));
-
-  Invoke3(reinterpret_cast<size_t>(array.Get()), 3U, reinterpret_cast<size_t>(nullptr),
-          art_quick_aput_obj_with_null_and_bound_check, self);
-
-  EXPECT_FALSE(self->IsExceptionPending());
-  EXPECT_EQ(nullptr, array->Get(3));
-
-  // TODO: Check _which_ exception is thrown. Then make 3) check that it's the right check order.
-
-  // 2) Failure cases (str into str[])
-  // 2.1) Array = null
-  // TODO: Throwing NPE needs actual DEX code
-
-//  Invoke3(reinterpret_cast<size_t>(nullptr), 0U, reinterpret_cast<size_t>(str_obj.Get()),
-//          reinterpret_cast<uintptr_t>(&art_quick_aput_obj_with_null_and_bound_check), self);
-//
-//  EXPECT_TRUE(self->IsExceptionPending());
-//  self->ClearException();
-
-  // 2.2) Index < 0
-
-  Invoke3(reinterpret_cast<size_t>(array.Get()), static_cast<size_t>(-1),
-          reinterpret_cast<size_t>(str_obj.Get()),
-          art_quick_aput_obj_with_null_and_bound_check, self);
-
-  EXPECT_TRUE(self->IsExceptionPending());
-  self->ClearException();
-
-  // 2.3) Index > 0
-
-  Invoke3(reinterpret_cast<size_t>(array.Get()), 10U, reinterpret_cast<size_t>(str_obj.Get()),
-          art_quick_aput_obj_with_null_and_bound_check, self);
-
-  EXPECT_TRUE(self->IsExceptionPending());
-  self->ClearException();
-
-  // 3) Failure cases (obj into str[])
-
-  Invoke3(reinterpret_cast<size_t>(array.Get()), 0U, reinterpret_cast<size_t>(obj_obj.Get()),
-          art_quick_aput_obj_with_null_and_bound_check, self);
-
-  EXPECT_TRUE(self->IsExceptionPending());
-  self->ClearException();
-
-  // Tests done.
-#else
-  LOG(INFO) << "Skipping aput_obj as I don't know how to do that on " << kRuntimeISA;
-  // Force-print to std::cout so it's also outside the logcat.
-  std::cout << "Skipping aput_obj as I don't know how to do that on " << kRuntimeISA << std::endl;
-#endif
-}
-
 TEST_F(StubTest, AllocObject) {
 #if defined(__i386__) || defined(__arm__) || defined(__aarch64__) || defined(__mips__) || \
     (defined(__x86_64__) && !defined(__APPLE__))
@@ -1171,39 +1038,14 @@
   ScopedObjectAccess soa(self);
   // garbage is created during ClassLinker::Init
 
-  StackHandleScope<2> hs(self);
+  StackHandleScope<1> hs(self);
   Handle<mirror::Class> c(
       hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "[Ljava/lang/Object;")));
 
-  // Needed to have a linked method.
-  Handle<mirror::Class> c_obj(
-      hs.NewHandle(class_linker_->FindSystemClass(soa.Self(), "Ljava/lang/Object;")));
-
   // Play with it...
 
   EXPECT_FALSE(self->IsExceptionPending());
 
-  // For some reason this does not work, as the type_idx is artificial and outside what the
-  // resolved types of c_obj allow...
-
-  if ((false)) {
-    // Use an arbitrary method from c to use as referrer
-    size_t result = Invoke3(
-        static_cast<size_t>(c->GetDexTypeIndex().index_),    // type_idx
-        10U,
-        // arbitrary
-        reinterpret_cast<size_t>(c_obj->GetVirtualMethod(0, kRuntimePointerSize)),
-        StubTest::GetEntrypoint(self, kQuickAllocArray),
-        self);
-
-    EXPECT_FALSE(self->IsExceptionPending());
-    EXPECT_NE(reinterpret_cast<size_t>(nullptr), result);
-    mirror::Array* obj = reinterpret_cast<mirror::Array*>(result);
-    EXPECT_EQ(c.Get(), obj->GetClass());
-    VerifyObject(obj);
-    EXPECT_EQ(obj->GetLength(), 10);
-  }
-
   {
     // We can use null in the second argument as we do not need a method here (not used in
     // resolved/initialized cases)
diff --git a/runtime/arch/x86/quick_entrypoints_x86.S b/runtime/arch/x86/quick_entrypoints_x86.S
index 62c29cf..c420259 100644
--- a/runtime/arch/x86/quick_entrypoints_x86.S
+++ b/runtime/arch/x86/quick_entrypoints_x86.S
@@ -468,7 +468,7 @@
      * The helper will attempt to locate the target and return a 64-bit result in r0/r1 consisting
      * of the target Method* in r0 and method->code_ in r1.
      *
-     * If unsuccessful, the helper will return null/null will bea pending exception in the
+     * If unsuccessful, the helper will return null/null and there will be a pending exception in the
      * thread and we branch to another stub to deliver it.
      *
      * On success this wrapper will restore arguments and *jump* to the target, leaving the lr
@@ -1352,26 +1352,6 @@
 #endif  // USE_READ_BARRIER
 END_MACRO
 
-    /*
-     * Entry from managed code for array put operations of objects where the value being stored
-     * needs to be checked for compatibility.
-     * eax = array, ecx = index, edx = value
-     */
-DEFINE_FUNCTION art_quick_aput_obj_with_null_and_bound_check
-    testl %eax, %eax
-    jnz SYMBOL(art_quick_aput_obj_with_bound_check)
-    jmp SYMBOL(art_quick_throw_null_pointer_exception)
-END_FUNCTION art_quick_aput_obj_with_null_and_bound_check
-
-DEFINE_FUNCTION art_quick_aput_obj_with_bound_check
-    movl MIRROR_ARRAY_LENGTH_OFFSET(%eax), %ebx
-    cmpl %ebx, %ecx
-    jb SYMBOL(art_quick_aput_obj)
-    mov %ecx, %eax
-    mov %ebx, %ecx
-    jmp SYMBOL(art_quick_throw_array_bounds)
-END_FUNCTION art_quick_aput_obj_with_bound_check
-
 DEFINE_FUNCTION art_quick_aput_obj
     test %edx, %edx              // store of null
     jz .Ldo_aput_null
@@ -2223,5 +2203,99 @@
     jmp *%ebx
 END_FUNCTION art_quick_osr_stub
 
+DEFINE_FUNCTION art_quick_invoke_polymorphic
+    SETUP_SAVE_REFS_AND_ARGS_FRAME  ebx, ebx       // Save frame.
+    mov %esp, %edx                                 // Remember SP.
+    subl LITERAL(16), %esp                         // Make space for JValue result.
+    CFI_ADJUST_CFA_OFFSET(16)
+    movl LITERAL(0), (%esp)                        // Initialize result to zero.
+    movl LITERAL(0), 4(%esp)
+    mov %esp, %eax                                 // Store pointer to JValue result in eax.
+    PUSH edx                                       // pass SP
+    pushl %fs:THREAD_SELF_OFFSET                   // pass Thread::Current()
+    CFI_ADJUST_CFA_OFFSET(4)
+    PUSH ecx                                       // pass receiver (method handle)
+    PUSH eax                                       // pass JResult
+    call SYMBOL(artInvokePolymorphic)              // (result, receiver, Thread*, SP)
+    subl LITERAL('A'), %eax                        // Eliminate out of bounds options
+    cmpb LITERAL('Z' - 'A'), %al
+    ja .Lcleanup_and_return
+    movzbl %al, %eax
+    call .Lput_eip_in_ecx
+.Lbranch_start:
+    movl %ecx, %edx
+    add $(.Lhandler_table - .Lbranch_start), %edx  // Make EDX point to handler_table.
+    leal (%edx, %eax, 2), %eax                     // Calculate address of entry in table.
+    movzwl (%eax), %eax                            // Lookup relative branch in table.
+    addl %ecx, %eax                                // Add EIP relative offset.
+    jmp *%eax                                      // Branch to handler.
+
+    // Handlers for different return types.
+.Lstore_boolean_result:
+    movzbl 16(%esp), %eax                          // Copy boolean result to the accumulator.
+    jmp .Lcleanup_and_return
+.Lstore_char_result:
+    movzwl 16(%esp), %eax                          // Copy char result to the accumulator.
+    jmp .Lcleanup_and_return
+.Lstore_float_result:
+    movd 16(%esp), %xmm0                           // Copy float result to the context restored by
+    movd %xmm0, 36(%esp)                           // RESTORE_SAVE_REFS_ONLY_FRAME.
+    jmp .Lcleanup_and_return
+.Lstore_double_result:
+    movsd 16(%esp), %xmm0                          // Copy double result to the context restored by
+    movsd %xmm0, 36(%esp)                          // RESTORE_SAVE_REFS_ONLY_FRAME.
+    jmp .Lcleanup_and_return
+.Lstore_long_result:
+    movl 20(%esp), %edx                            // Copy upper-word of result to the context restored by
+    movl %edx, 72(%esp)                            // RESTORE_SAVE_REFS_ONLY_FRAME.
+    // Fall-through for lower bits.
+.Lstore_int_result:
+    movl 16(%esp), %eax                            // Copy int result to the accumulator.
+    // Fall-through to clean up and return.
+.Lcleanup_and_return:
+    addl LITERAL(32), %esp                         // Pop arguments and stack allocated JValue result.
+    CFI_ADJUST_CFA_OFFSET(-32)
+    RESTORE_SAVE_REFS_AND_ARGS_FRAME
+    RETURN_OR_DELIVER_PENDING_EXCEPTION
+
+.Lput_eip_in_ecx:                                  // Internal function that puts address of
+    movl 0(%esp), %ecx                             // next instruction into ECX when CALL
+    ret
+
+    // Handler table to handlers for given type.
+.Lhandler_table:
+MACRO1(HANDLER_TABLE_ENTRY, handler_label)
+    // NB some tools require 16-bits for relocations. Shouldn't need adjusting.
+    .word RAW_VAR(handler_label) - .Lbranch_start
+END_MACRO
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // A
+    HANDLER_TABLE_ENTRY(.Lstore_int_result)        // B (byte)
+    HANDLER_TABLE_ENTRY(.Lstore_char_result)       // C (char)
+    HANDLER_TABLE_ENTRY(.Lstore_double_result)     // D (double)
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // E
+    HANDLER_TABLE_ENTRY(.Lstore_float_result)      // F (float)
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // G
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // H
+    HANDLER_TABLE_ENTRY(.Lstore_int_result)        // I (int)
+    HANDLER_TABLE_ENTRY(.Lstore_long_result)       // J (long)
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // K
+    HANDLER_TABLE_ENTRY(.Lstore_int_result)        // L (object)
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // M
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // N
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // O
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // P
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // Q
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // R
+    HANDLER_TABLE_ENTRY(.Lstore_int_result)        // S (short)
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // T
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // U
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // V (void)
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // W
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // X
+    HANDLER_TABLE_ENTRY(.Lcleanup_and_return)      // Y
+    HANDLER_TABLE_ENTRY(.Lstore_boolean_result)    // Z (boolean)
+
+END_FUNCTION art_quick_invoke_polymorphic
+
     // TODO: implement these!
 UNIMPLEMENTED art_quick_memcmp16
diff --git a/runtime/arch/x86_64/quick_entrypoints_x86_64.S b/runtime/arch/x86_64/quick_entrypoints_x86_64.S
index facd563..46bee39 100644
--- a/runtime/arch/x86_64/quick_entrypoints_x86_64.S
+++ b/runtime/arch/x86_64/quick_entrypoints_x86_64.S
@@ -986,11 +986,7 @@
 // GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_RESOLVED(_region_tlab, RegionTLAB)
 // GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-// GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_tlab, RegionTLAB)
 // GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_region_tlab, RegionTLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_region_tlab, RegionTLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_region_tlab, RegionTLAB)
@@ -999,9 +995,6 @@
 // GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_INITIALIZED(_tlab, TLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_OBJECT_WITH_ACCESS_CHECK(_tlab, TLAB)
 // GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY(_tlab, TLAB)
-GENERATE_ALLOC_ENTRYPOINTS_CHECK_AND_ALLOC_ARRAY_WITH_ACCESS_CHECK(_tlab, TLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_BYTES(_tlab, TLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_CHARS(_tlab, TLAB)
 GENERATE_ALLOC_ENTRYPOINTS_ALLOC_STRING_FROM_STRING(_tlab, TLAB)
@@ -1119,12 +1112,11 @@
 END_MACRO
 
 // The fast path code for art_quick_alloc_array_region_tlab.
-// Inputs: RDI: uint32_t type_idx, RSI: int32_t component_count, RDX: ArtMethod* method
-// Temps: RCX: the class, r8, r9
+// Inputs: RDI: the class, RSI: int32_t component_count
+// Free temps: RCX, RDX, R8, R9
 // Output: RAX: return value.
 MACRO1(ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED, slowPathLabel)
-    movq %rcx, %r8                                             // Save class for later
-    movl MIRROR_CLASS_COMPONENT_TYPE_OFFSET(%rcx), %ecx        // Load component type.
+    movl MIRROR_CLASS_COMPONENT_TYPE_OFFSET(%rdi), %ecx        // Load component type.
     UNPOISON_HEAP_REF ecx
     movl MIRROR_CLASS_OBJECT_PRIMITIVE_TYPE_OFFSET(%rcx), %ecx // Load primitive type.
     shrq LITERAL(PRIMITIVE_TYPE_SIZE_SHIFT_SHIFT), %rcx        // Get component size shift.
@@ -1151,8 +1143,8 @@
                                                                // Store the class pointer in the
                                                                // header.
                                                                // No fence needed for x86.
-    POISON_HEAP_REF r8d
-    movl %r8d, MIRROR_OBJECT_CLASS_OFFSET(%rax)
+    POISON_HEAP_REF edi
+    movl %edi, MIRROR_OBJECT_CLASS_OFFSET(%rax)
     movl %esi, MIRROR_ARRAY_LENGTH_OFFSET(%rax)
     ret                                                        // Fast path succeeded.
 END_MACRO
@@ -1173,8 +1165,8 @@
 MACRO1(ALLOC_ARRAY_TLAB_SLOW_PATH, cxx_name)
     SETUP_SAVE_REFS_ONLY_FRAME                                 // save ref containing registers for GC
     // Outgoing argument set up
-    movq %gs:THREAD_SELF_OFFSET, %rcx                          // pass Thread::Current()
-    call CALLVAR(cxx_name)                                     // cxx_name(arg0, arg1, arg2, Thread*)
+    movq %gs:THREAD_SELF_OFFSET, %rdx                          // pass Thread::Current()
+    call CALLVAR(cxx_name)                                     // cxx_name(arg0, arg1, Thread*)
     RESTORE_SAVE_REFS_ONLY_FRAME                               // restore frame up to return address
     RETURN_IF_RESULT_IS_NON_ZERO_OR_DELIVER                    // return or deliver exception
 END_MACRO
@@ -1199,73 +1191,21 @@
     ALLOC_OBJECT_TLAB_SLOW_PATH artAllocObjectFromCodeInitializedTLAB
 END_FUNCTION art_quick_alloc_object_initialized_tlab
 
-// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_tlab, TLAB).
-DEFINE_FUNCTION art_quick_alloc_array_tlab
-    // RDI: uint32_t type_idx, RSI: int32_t component_count, RDX: ArtMethod*
-    // RCX: klass, R8, R9: free. RAX: return val.
-    movq ART_METHOD_DEX_CACHE_TYPES_OFFSET_64(%rdx), %rcx      // Load dex cache resolved types array
-    movl 0(%rcx, %rdi, COMPRESSED_REFERENCE_SIZE), %ecx        // Load the class
-    testl %ecx, %ecx
-    jz .Lart_quick_alloc_array_tlab_slow_path
-    ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_tlab_slow_path
-.Lart_quick_alloc_array_tlab_slow_path:
-    ALLOC_ARRAY_TLAB_SLOW_PATH artAllocArrayFromCodeTLAB
-END_FUNCTION art_quick_alloc_array_tlab
-
 // A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_tlab, TLAB).
 DEFINE_FUNCTION art_quick_alloc_array_resolved_tlab
-    // RDI: mirror::Class* klass, RSI: int32_t component_count, RDX: ArtMethod*
-    // RCX: mirror::Class* klass, R8, R9: free. RAX: return val.
-    movq %rdi, %rcx
-    // Already resolved, no null check.
+    // RDI: mirror::Class* klass, RSI: int32_t component_count
+    // RDX, RCX, R8, R9: free. RAX: return val.
     ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_resolved_tlab_slow_path
 .Lart_quick_alloc_array_resolved_tlab_slow_path:
     ALLOC_ARRAY_TLAB_SLOW_PATH artAllocArrayFromCodeResolvedTLAB
 END_FUNCTION art_quick_alloc_array_resolved_tlab
 
-// A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY(_region_tlab, RegionTLAB).
-DEFINE_FUNCTION art_quick_alloc_array_region_tlab
-    // Fast path region tlab allocation.
-    // RDI: uint32_t type_idx, RSI: int32_t component_count, RDX: ArtMethod*
-    // RCX: klass, R8, R9: free. RAX: return val.
-    ASSERT_USE_READ_BARRIER
-    movq ART_METHOD_DEX_CACHE_TYPES_OFFSET_64(%rdx), %rcx      // Load dex cache resolved types array
-    movl 0(%rcx, %rdi, COMPRESSED_REFERENCE_SIZE), %ecx        // Load the class
-    // Null check so that we can load the lock word.
-    testl %ecx, %ecx
-    jz .Lart_quick_alloc_array_region_tlab_slow_path
-    // Since we have allocation entrypoint switching, we know the GC is marking.
-    // Check the mark bit, if it is 0, do the read barrier mark.
-    testl LITERAL(LOCK_WORD_MARK_BIT_MASK_SHIFTED), MIRROR_OBJECT_LOCK_WORD_OFFSET(%ecx)
-    jz .Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path
-.Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path_exit:
-    ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_region_tlab_slow_path
-.Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path:
-    // The read barrier slow path. Mark the class.
-    PUSH rdi
-    PUSH rsi
-    PUSH rdx
-    // Outgoing argument set up
-    movq %rcx, %rdi                                            // Pass the class as the first param.
-    call SYMBOL(artReadBarrierMark)                            // cxx_name(mirror::Object* obj)
-    movq %rax, %rcx
-    POP rdx
-    POP rsi
-    POP rdi
-    jmp .Lart_quick_alloc_array_region_tlab_class_load_read_barrier_slow_path_exit
-.Lart_quick_alloc_array_region_tlab_slow_path:
-    ALLOC_ARRAY_TLAB_SLOW_PATH artAllocArrayFromCodeRegionTLAB
-END_FUNCTION art_quick_alloc_array_region_tlab
-
 // A hand-written override for GENERATE_ALLOC_ENTRYPOINTS_ALLOC_ARRAY_RESOLVED(_region_tlab, RegionTLAB).
 DEFINE_FUNCTION art_quick_alloc_array_resolved_region_tlab
     // Fast path region tlab allocation.
-    // RDI: mirror::Class* klass, RSI: int32_t component_count, RDX: ArtMethod*
-    // RCX: mirror::Class* klass, R8, R9: free. RAX: return val.
+    // RDI: mirror::Class* klass, RSI: int32_t component_count
+    // RCX, RDX, R8, R9: free. RAX: return val.
     ASSERT_USE_READ_BARRIER
-    movq %rdi, %rcx
-    // Caller is responsible for read barrier.
-    // Already resolved, no null check.
     ALLOC_ARRAY_TLAB_FAST_PATH_RESOLVED .Lart_quick_alloc_array_resolved_region_tlab_slow_path
 .Lart_quick_alloc_array_resolved_region_tlab_slow_path:
     ALLOC_ARRAY_TLAB_SLOW_PATH artAllocArrayFromCodeResolvedRegionTLAB
@@ -1466,7 +1406,7 @@
      * 64b PUSH/POP and 32b argument.
      * TODO: When read barrier has a fast path, add heap unpoisoning support for the fast path.
      *
-     * As with art_quick_aput_obj* functions, the 64b versions are in comments.
+     * As with art_quick_aput_obj function, the 64b versions are in comments.
      */
 MACRO4(READ_BARRIER, obj_reg, offset, dest_reg32, dest_reg64)
 #ifdef USE_READ_BARRIER
@@ -1503,46 +1443,6 @@
 #endif  // USE_READ_BARRIER
 END_MACRO
 
-    /*
-     * Entry from managed code for array put operations of objects where the value being stored
-     * needs to be checked for compatibility.
-     *
-     * Currently all the parameters should fit into the 32b portions of the registers. Index always
-     * will. So we optimize for a tighter encoding. The 64b versions are in comments.
-     *
-     * rdi(edi) = array, rsi(esi) = index, rdx(edx) = value
-     */
-DEFINE_FUNCTION art_quick_aput_obj_with_null_and_bound_check
-#if defined(__APPLE__)
-    int3
-    int3
-#else
-    testl %edi, %edi
-//  testq %rdi, %rdi
-    jnz art_quick_aput_obj_with_bound_check
-    jmp art_quick_throw_null_pointer_exception
-#endif  // __APPLE__
-END_FUNCTION art_quick_aput_obj_with_null_and_bound_check
-
-
-DEFINE_FUNCTION art_quick_aput_obj_with_bound_check
-#if defined(__APPLE__)
-    int3
-    int3
-#else
-    movl MIRROR_ARRAY_LENGTH_OFFSET(%edi), %ecx
-//  movl MIRROR_ARRAY_LENGTH_OFFSET(%rdi), %ecx  // This zero-extends, so value(%rcx)=value(%ecx)
-    cmpl %ecx, %esi
-    jb art_quick_aput_obj
-    mov %esi, %edi
-//  mov %rsi, %rdi
-    mov %ecx, %esi
-//  mov %rcx, %rsi
-    jmp art_quick_throw_array_bounds
-#endif  // __APPLE__
-END_FUNCTION art_quick_aput_obj_with_bound_check
-
-
 DEFINE_FUNCTION art_quick_aput_obj
     testl %edx, %edx                // store of null
 //  test %rdx, %rdx
@@ -2394,3 +2294,79 @@
     rep movsb                     // while (rcx--) { *rdi++ = *rsi++ }
     jmp *%rdx
 END_FUNCTION art_quick_osr_stub
+
+DEFINE_FUNCTION art_quick_invoke_polymorphic
+    SETUP_SAVE_REFS_AND_ARGS_FRAME                 // save callee saves
+    movq %gs:THREAD_SELF_OFFSET, %rdx              // pass Thread
+    movq %rsp, %rcx                                // pass SP
+    subq LITERAL(16), %rsp                         // make space for JValue result
+    CFI_ADJUST_CFA_OFFSET(16)
+    movq LITERAL(0), (%rsp)                        // initialize result
+    movq %rsp, %rdi                                // store pointer to JValue result
+    call SYMBOL(artInvokePolymorphic)              // artInvokePolymorphic(result, receiver, Thread*, SP)
+                                                   // save the code pointer
+    subq LITERAL('A'), %rax                        // Convert type descriptor character value to a zero based index.
+    cmpb LITERAL('Z' - 'A'), %al                   // Eliminate out of bounds options
+    ja .Lcleanup_and_return
+    movzbq %al, %rax
+    leaq .Lhandler_table(%rip), %rcx               // Get the address of the handler table
+    movslq (%rcx, %rax, 4), %rax                   // Lookup handler offset relative to table
+    addq %rcx, %rax                                // Add table address to yield handler address.
+    jmpq *%rax                                     // Jump to handler.
+
+.align 4
+.Lhandler_table:                                   // Table of type descriptor to handlers.
+MACRO1(HANDLER_TABLE_OFFSET, handle_label)
+    // NB some tools require 32-bits for relocations. Shouldn't need adjusting.
+    .long RAW_VAR(handle_label) - .Lhandler_table
+END_MACRO
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // A
+    HANDLER_TABLE_OFFSET(.Lstore_long_result)      // B (byte)
+    HANDLER_TABLE_OFFSET(.Lstore_char_result)      // C (char)
+    HANDLER_TABLE_OFFSET(.Lstore_double_result)    // D (double)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // E
+    HANDLER_TABLE_OFFSET(.Lstore_float_result)     // F (float)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // G
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // H
+    HANDLER_TABLE_OFFSET(.Lstore_long_result)      // I (int)
+    HANDLER_TABLE_OFFSET(.Lstore_long_result)      // J (long)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // K
+    HANDLER_TABLE_OFFSET(.Lstore_long_result)      // L (object - references are compressed and only 32-bits)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // M
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // N
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // O
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // P
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // Q
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // R
+    HANDLER_TABLE_OFFSET(.Lstore_long_result)      // S (short)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // T
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // U
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // V (void)
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // W
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // X
+    HANDLER_TABLE_OFFSET(.Lcleanup_and_return)     // Y
+    HANDLER_TABLE_OFFSET(.Lstore_boolean_result)   // Z (boolean)
+
+.Lstore_boolean_result:
+    movzbq (%rsp), %rax                            // Copy boolean result to the accumulator
+    jmp .Lcleanup_and_return
+.Lstore_char_result:
+    movzwq (%rsp), %rax                            // Copy char result to the accumulator
+    jmp .Lcleanup_and_return
+.Lstore_float_result:
+    movd (%rsp), %xmm0                             // Copy float result to the context restored by
+    movd %xmm0, 32(%rsp)                           // RESTORE_SAVE_REFS_AND_ARGS_FRAME.
+    jmp .Lcleanup_and_return
+.Lstore_double_result:
+    movsd (%rsp), %xmm0                            // Copy double result to the context restored by
+    movsd %xmm0, 32(%rsp)                          // RESTORE_SAVE_REFS_AND_ARGS_FRAME.
+    jmp .Lcleanup_and_return
+.Lstore_long_result:
+    movq (%rsp), %rax                              // Copy long result to the accumulator.
+     // Fall-through
+.Lcleanup_and_return:
+    addq LITERAL(16), %rsp                         // Pop space for JValue result.
+    CFI_ADJUST_CFA_OFFSET(16)
+    RESTORE_SAVE_REFS_AND_ARGS_FRAME
+    RETURN_OR_DELIVER_PENDING_EXCEPTION
+END_FUNCTION art_quick_invoke_polymorphic
diff --git a/runtime/art_field-inl.h b/runtime/art_field-inl.h
index b9f688d..917db3e 100644
--- a/runtime/art_field-inl.h
+++ b/runtime/art_field-inl.h
@@ -52,7 +52,7 @@
 }
 
 inline MemberOffset ArtField::GetOffset() {
-  DCHECK(GetDeclaringClass()->IsResolved() || GetDeclaringClass()->IsErroneous());
+  DCHECK(GetDeclaringClass()->IsResolved());
   return MemberOffset(offset_);
 }
 
diff --git a/runtime/art_method-inl.h b/runtime/art_method-inl.h
index 96976d9..a35c7ab 100644
--- a/runtime/art_method-inl.h
+++ b/runtime/art_method-inl.h
@@ -109,8 +109,7 @@
 }
 
 inline uint16_t ArtMethod::GetMethodIndex() {
-  DCHECK(IsRuntimeMethod() || GetDeclaringClass()->IsResolved() ||
-         GetDeclaringClass()->IsErroneous());
+  DCHECK(IsRuntimeMethod() || GetDeclaringClass()->IsResolved());
   return method_index_;
 }
 
@@ -121,7 +120,7 @@
 inline uint32_t ArtMethod::GetDexMethodIndex() {
   DCHECK(IsRuntimeMethod() || GetDeclaringClass()->IsIdxLoaded() ||
          GetDeclaringClass()->IsErroneous());
-  return dex_method_index_;
+  return GetDexMethodIndexUnchecked();
 }
 
 inline ArtMethod** ArtMethod::GetDexCacheResolvedMethods(PointerSize pointer_size) {
@@ -175,47 +174,15 @@
       other->GetDexCacheResolvedMethods(pointer_size);
 }
 
-inline GcRoot<mirror::Class>* ArtMethod::GetDexCacheResolvedTypes(PointerSize pointer_size) {
-  return GetNativePointer<GcRoot<mirror::Class>*>(DexCacheResolvedTypesOffset(pointer_size),
-                                                  pointer_size);
-}
-
-template <bool kWithCheck>
-inline mirror::Class* ArtMethod::GetDexCacheResolvedType(dex::TypeIndex type_index,
-                                                         PointerSize pointer_size) {
-  if (kWithCheck) {
-    mirror::DexCache* dex_cache = GetInterfaceMethodIfProxy(pointer_size)->GetDexCache();
-    if (UNLIKELY(type_index.index_ >= dex_cache->NumResolvedTypes())) {
-      ThrowArrayIndexOutOfBoundsException(type_index.index_, dex_cache->NumResolvedTypes());
-      return nullptr;
-    }
-  }
-  mirror::Class* klass = GetDexCacheResolvedTypes(pointer_size)[type_index.index_].Read();
-  return (klass != nullptr && !klass->IsErroneous()) ? klass : nullptr;
-}
-
-inline bool ArtMethod::HasDexCacheResolvedTypes(PointerSize pointer_size) {
-  return GetDexCacheResolvedTypes(pointer_size) != nullptr;
-}
-
-inline bool ArtMethod::HasSameDexCacheResolvedTypes(GcRoot<mirror::Class>* other_cache,
-                                                    PointerSize pointer_size) {
-  return GetDexCacheResolvedTypes(pointer_size) == other_cache;
-}
-
-inline bool ArtMethod::HasSameDexCacheResolvedTypes(ArtMethod* other, PointerSize pointer_size) {
-  return GetDexCacheResolvedTypes(pointer_size) == other->GetDexCacheResolvedTypes(pointer_size);
-}
-
-inline mirror::Class* ArtMethod::GetClassFromTypeIndex(dex::TypeIndex type_idx,
-                                                       bool resolve,
-                                                       PointerSize pointer_size) {
-  mirror::Class* type = GetDexCacheResolvedType(type_idx, pointer_size);
-  if (type == nullptr && resolve) {
-    type = Runtime::Current()->GetClassLinker()->ResolveType(type_idx, this);
+inline mirror::Class* ArtMethod::GetClassFromTypeIndex(dex::TypeIndex type_idx, bool resolve) {
+  ObjPtr<mirror::DexCache> dex_cache = GetDexCache();
+  ObjPtr<mirror::Class> type = dex_cache->GetResolvedType(type_idx);
+  if (UNLIKELY(type == nullptr) && resolve) {
+    ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+    type = class_linker->ResolveType(type_idx, this);
     CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
   }
-  return type;
+  return type.Ptr();
 }
 
 inline bool ArtMethod::CheckIncompatibleClassChange(InvokeType type) {
@@ -333,9 +300,9 @@
   return GetDexFile()->GetCodeItem(GetCodeItemOffset());
 }
 
-inline bool ArtMethod::IsResolvedTypeIdx(dex::TypeIndex type_idx, PointerSize pointer_size) {
+inline bool ArtMethod::IsResolvedTypeIdx(dex::TypeIndex type_idx) {
   DCHECK(!IsProxyMethod());
-  return GetDexCacheResolvedType(type_idx, pointer_size) != nullptr;
+  return GetClassFromTypeIndex(type_idx, /* resolve */ false) != nullptr;
 }
 
 inline int32_t ArtMethod::GetLineNumFromDexPC(uint32_t dex_pc) {
@@ -430,23 +397,13 @@
                    pointer_size);
 }
 
-inline void ArtMethod::SetDexCacheResolvedTypes(GcRoot<mirror::Class>* new_dex_cache_types,
-                                                PointerSize pointer_size) {
-  SetNativePointer(DexCacheResolvedTypesOffset(pointer_size), new_dex_cache_types, pointer_size);
-}
-
-inline mirror::Class* ArtMethod::GetReturnType(bool resolve, PointerSize pointer_size) {
+inline mirror::Class* ArtMethod::GetReturnType(bool resolve) {
   DCHECK(!IsProxyMethod());
   const DexFile* dex_file = GetDexFile();
   const DexFile::MethodId& method_id = dex_file->GetMethodId(GetDexMethodIndex());
   const DexFile::ProtoId& proto_id = dex_file->GetMethodPrototype(method_id);
   dex::TypeIndex return_type_idx = proto_id.return_type_idx_;
-  mirror::Class* type = GetDexCacheResolvedType(return_type_idx, pointer_size);
-  if (type == nullptr && resolve) {
-    type = Runtime::Current()->GetClassLinker()->ResolveType(return_type_idx, this);
-    CHECK(type != nullptr || Thread::Current()->IsExceptionPending());
-  }
-  return type;
+  return GetClassFromTypeIndex(return_type_idx, resolve);
 }
 
 inline bool ArtMethod::HasSingleImplementation() {
@@ -530,11 +487,6 @@
   if (old_methods != new_methods) {
     SetDexCacheResolvedMethods(new_methods, pointer_size);
   }
-  GcRoot<mirror::Class>* old_types = GetDexCacheResolvedTypes(pointer_size);
-  GcRoot<mirror::Class>* new_types = visitor(old_types);
-  if (old_types != new_types) {
-    SetDexCacheResolvedTypes(new_types, pointer_size);
-  }
 }
 
 template <ReadBarrierOption kReadBarrierOption, typename Visitor>
diff --git a/runtime/art_method.cc b/runtime/art_method.cc
index dfc7837..a3d9ba6 100644
--- a/runtime/art_method.cc
+++ b/runtime/art_method.cc
@@ -236,7 +236,6 @@
   // Default to handler not found.
   uint32_t found_dex_pc = DexFile::kDexNoIndex;
   // Iterate over the catch handlers associated with dex_pc.
-  PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
   for (CatchHandlerIterator it(*code_item, dex_pc); it.HasNext(); it.Next()) {
     dex::TypeIndex iter_type_idx = it.GetHandlerTypeIndex();
     // Catch all case
@@ -245,9 +244,7 @@
       break;
     }
     // Does this catch exception type apply?
-    mirror::Class* iter_exception_type = GetClassFromTypeIndex(iter_type_idx,
-                                                               true /* resolve */,
-                                                               pointer_size);
+    mirror::Class* iter_exception_type = GetClassFromTypeIndex(iter_type_idx, true /* resolve */);
     if (UNLIKELY(iter_exception_type == nullptr)) {
       // Now have a NoClassDefFoundError as exception. Ignore in case the exception class was
       // removed by a pro-guard like tool.
@@ -722,21 +719,7 @@
 }
 
 std::string ArtMethod::JniShortName() {
-  std::string class_name(GetDeclaringClassDescriptor());
-  // Remove the leading 'L' and trailing ';'...
-  CHECK_EQ(class_name[0], 'L') << class_name;
-  CHECK_EQ(class_name[class_name.size() - 1], ';') << class_name;
-  class_name.erase(0, 1);
-  class_name.erase(class_name.size() - 1, 1);
-
-  std::string method_name(GetName());
-
-  std::string short_name;
-  short_name += "Java_";
-  short_name += MangleForJni(class_name);
-  short_name += "_";
-  short_name += MangleForJni(method_name);
-  return short_name;
+  return GetJniShortName(GetDeclaringClassDescriptor(), GetName());
 }
 
 std::string ArtMethod::JniLongName() {
diff --git a/runtime/art_method.h b/runtime/art_method.h
index 11dcc35..17f343d 100644
--- a/runtime/art_method.h
+++ b/runtime/art_method.h
@@ -131,12 +131,12 @@
     return (GetAccessFlags() & kAccStatic) != 0;
   }
 
-  // Returns true if the method is a constructor.
+  // Returns true if the method is a constructor according to access flags.
   bool IsConstructor() {
     return (GetAccessFlags() & kAccConstructor) != 0;
   }
 
-  // Returns true if the method is a class initializer.
+  // Returns true if the method is a class initializer according to access flags.
   bool IsClassInitializer() {
     return IsConstructor() && IsStatic();
   }
@@ -322,6 +322,9 @@
   // Number of 32bit registers that would be required to hold all the arguments
   static size_t NumArgRegisters(const StringPiece& shorty);
 
+  ALWAYS_INLINE uint32_t GetDexMethodIndexUnchecked() {
+    return dex_method_index_;
+  }
   ALWAYS_INLINE uint32_t GetDexMethodIndex() REQUIRES_SHARED(Locks::mutator_lock_);
 
   void SetDexMethodIndex(uint32_t new_idx) {
@@ -348,22 +351,8 @@
   bool HasSameDexCacheResolvedMethods(ArtMethod** other_cache, PointerSize pointer_size)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
-  template <bool kWithCheck = true>
-  mirror::Class* GetDexCacheResolvedType(dex::TypeIndex type_idx, PointerSize pointer_size)
-      REQUIRES_SHARED(Locks::mutator_lock_);
-  void SetDexCacheResolvedTypes(GcRoot<mirror::Class>* new_dex_cache_types,
-                                PointerSize pointer_size)
-      REQUIRES_SHARED(Locks::mutator_lock_);
-  bool HasDexCacheResolvedTypes(PointerSize pointer_size) REQUIRES_SHARED(Locks::mutator_lock_);
-  bool HasSameDexCacheResolvedTypes(ArtMethod* other, PointerSize pointer_size)
-      REQUIRES_SHARED(Locks::mutator_lock_);
-  bool HasSameDexCacheResolvedTypes(GcRoot<mirror::Class>* other_cache, PointerSize pointer_size)
-      REQUIRES_SHARED(Locks::mutator_lock_);
-
   // Get the Class* from the type index into this method's dex cache.
-  mirror::Class* GetClassFromTypeIndex(dex::TypeIndex type_idx,
-                                       bool resolve,
-                                       PointerSize pointer_size)
+  mirror::Class* GetClassFromTypeIndex(dex::TypeIndex type_idx, bool resolve)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
   // Returns true if this method has the same name and signature of the other method.
@@ -414,12 +403,6 @@
             * static_cast<size_t>(pointer_size));
   }
 
-  static MemberOffset DexCacheResolvedTypesOffset(PointerSize pointer_size) {
-    return MemberOffset(PtrSizedFieldsOffset(pointer_size) + OFFSETOF_MEMBER(
-        PtrSizedFields, dex_cache_resolved_types_) / sizeof(void*)
-            * static_cast<size_t>(pointer_size));
-  }
-
   static MemberOffset DataOffset(PointerSize pointer_size) {
     return MemberOffset(PtrSizedFieldsOffset(pointer_size) + OFFSETOF_MEMBER(
         PtrSizedFields, data_) / sizeof(void*) * static_cast<size_t>(pointer_size));
@@ -555,8 +538,7 @@
 
   const DexFile::CodeItem* GetCodeItem() REQUIRES_SHARED(Locks::mutator_lock_);
 
-  bool IsResolvedTypeIdx(dex::TypeIndex type_idx, PointerSize pointer_size)
-      REQUIRES_SHARED(Locks::mutator_lock_);
+  bool IsResolvedTypeIdx(dex::TypeIndex type_idx) REQUIRES_SHARED(Locks::mutator_lock_);
 
   int32_t GetLineNumFromDexPC(uint32_t dex_pc) REQUIRES_SHARED(Locks::mutator_lock_);
 
@@ -577,8 +559,7 @@
 
   // May cause thread suspension due to GetClassFromTypeIdx calling ResolveType this caused a large
   // number of bugs at call sites.
-  mirror::Class* GetReturnType(bool resolve, PointerSize pointer_size)
-      REQUIRES_SHARED(Locks::mutator_lock_);
+  mirror::Class* GetReturnType(bool resolve) REQUIRES_SHARED(Locks::mutator_lock_);
 
   mirror::ClassLoader* GetClassLoader() REQUIRES_SHARED(Locks::mutator_lock_);
 
@@ -608,9 +589,6 @@
   void CopyFrom(ArtMethod* src, PointerSize image_pointer_size)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
-  ALWAYS_INLINE GcRoot<mirror::Class>* GetDexCacheResolvedTypes(PointerSize pointer_size)
-      REQUIRES_SHARED(Locks::mutator_lock_);
-
   // Note, hotness_counter_ updates are non-atomic but it doesn't need to be precise.  Also,
   // given that the counter is only 16 bits wide we can expect wrap-around in some
   // situations.  Consumers of hotness_count_ must be able to deal with that.
@@ -657,8 +635,6 @@
   std::string JniLongName()
       REQUIRES_SHARED(Locks::mutator_lock_);
 
-
-
   // Update heap objects and non-entrypoint pointers by the passed in visitor for image relocation.
   // Does not use read barrier.
   template <typename Visitor>
@@ -707,9 +683,6 @@
     // Short cuts to declaring_class_->dex_cache_ member for fast compiled code access.
     ArtMethod** dex_cache_resolved_methods_;
 
-    // Short cuts to declaring_class_->dex_cache_ member for fast compiled code access.
-    GcRoot<mirror::Class>* dex_cache_resolved_types_;
-
     // Pointer to JNI function registered to this method, or a function to resolve the JNI function,
     // or the profiling data for non-native methods, or an ImtConflictTable.
     void* data_;
diff --git a/runtime/asm_support.h b/runtime/asm_support.h
index bfdddf7..ed83f1c 100644
--- a/runtime/asm_support.h
+++ b/runtime/asm_support.h
@@ -90,7 +90,7 @@
             art::Thread::SelfOffset<POINTER_SIZE>().Int32Value())
 
 // Offset of field Thread::tlsPtr_.thread_local_pos.
-#define THREAD_LOCAL_POS_OFFSET (THREAD_CARD_TABLE_OFFSET + 198 * __SIZEOF_POINTER__)
+#define THREAD_LOCAL_POS_OFFSET (THREAD_CARD_TABLE_OFFSET + 34 * __SIZEOF_POINTER__)
 ADD_TEST_EQ(THREAD_LOCAL_POS_OFFSET,
             art::Thread::ThreadLocalPosOffset<POINTER_SIZE>().Int32Value())
 // Offset of field Thread::tlsPtr_.thread_local_end.
@@ -101,8 +101,10 @@
 #define THREAD_LOCAL_OBJECTS_OFFSET (THREAD_LOCAL_END_OFFSET + __SIZEOF_POINTER__)
 ADD_TEST_EQ(THREAD_LOCAL_OBJECTS_OFFSET,
             art::Thread::ThreadLocalObjectsOffset<POINTER_SIZE>().Int32Value())
+
 // Offset of field Thread::tlsPtr_.mterp_current_ibase.
-#define THREAD_CURRENT_IBASE_OFFSET (THREAD_LOCAL_OBJECTS_OFFSET + __SIZEOF_SIZE_T__)
+#define THREAD_CURRENT_IBASE_OFFSET \
+    (THREAD_LOCAL_OBJECTS_OFFSET + __SIZEOF_SIZE_T__ + (1 + 157) * __SIZEOF_POINTER__)
 ADD_TEST_EQ(THREAD_CURRENT_IBASE_OFFSET,
             art::Thread::MterpCurrentIBaseOffset<POINTER_SIZE>().Int32Value())
 // Offset of field Thread::tlsPtr_.mterp_default_ibase.
diff --git a/runtime/atomic.h b/runtime/atomic.h
index e2a7259..090e56a 100644
--- a/runtime/atomic.h
+++ b/runtime/atomic.h
@@ -201,6 +201,11 @@
     return this->load(std::memory_order_acquire);
   }
 
+  // Disable optimizations for Atomic::LoadJavaData on x86 devices.
+  // Bug: http://b/34287931
+#if defined(DISABLE_LOAD_JAVA_DATA_OPTIMIZATIONS)
+  #pragma clang optimize off
+#endif
   // Word tearing allowed, but may race.
   // TODO: Optimize?
   // There has been some discussion of eventually disallowing word
@@ -208,6 +213,9 @@
   T LoadJavaData() const {
     return this->load(std::memory_order_relaxed);
   }
+#if defined(DISABLE_LOAD_JAVA_DATA_OPTIMIZATIONS)
+  #pragma clang optimize on
+#endif
 
   // Load from memory with a total ordering.
   // Corresponds exactly to a Java volatile load.
diff --git a/runtime/base/mutex.cc b/runtime/base/mutex.cc
index 9116097..e05a85a 100644
--- a/runtime/base/mutex.cc
+++ b/runtime/base/mutex.cc
@@ -46,6 +46,7 @@
 ReaderWriterMutex* Locks::heap_bitmap_lock_ = nullptr;
 Mutex* Locks::instrument_entrypoints_lock_ = nullptr;
 Mutex* Locks::intern_table_lock_ = nullptr;
+Mutex* Locks::jni_function_table_lock_ = nullptr;
 Mutex* Locks::jni_libraries_lock_ = nullptr;
 Mutex* Locks::logging_lock_ = nullptr;
 Mutex* Locks::mem_maps_lock_ = nullptr;
@@ -957,6 +958,7 @@
     DCHECK(verifier_deps_lock_ != nullptr);
     DCHECK(host_dlopen_handles_lock_ != nullptr);
     DCHECK(intern_table_lock_ != nullptr);
+    DCHECK(jni_function_table_lock_ != nullptr);
     DCHECK(jni_libraries_lock_ != nullptr);
     DCHECK(logging_lock_ != nullptr);
     DCHECK(mutator_lock_ != nullptr);
@@ -1098,6 +1100,10 @@
     DCHECK(jni_weak_globals_lock_ == nullptr);
     jni_weak_globals_lock_ = new Mutex("JNI weak global reference table lock", current_lock_level);
 
+    UPDATE_CURRENT_LOCK_LEVEL(kJniFunctionTableLock);
+    DCHECK(jni_function_table_lock_ == nullptr);
+    jni_function_table_lock_ = new Mutex("JNI function table lock", current_lock_level);
+
     UPDATE_CURRENT_LOCK_LEVEL(kAbortLock);
     DCHECK(abort_lock_ == nullptr);
     abort_lock_ = new Mutex("abort lock", current_lock_level, true);
diff --git a/runtime/base/mutex.h b/runtime/base/mutex.h
index 2adeb8c..21dd437 100644
--- a/runtime/base/mutex.h
+++ b/runtime/base/mutex.h
@@ -68,6 +68,7 @@
   kRosAllocBulkFreeLock,
   kMarkSweepMarkStackLock,
   kTransactionLogLock,
+  kJniFunctionTableLock,
   kJniWeakGlobalsLock,
   kJniGlobalsLock,
   kReferenceQueueSoftReferencesLock,
@@ -698,8 +699,11 @@
   // Guard accesses to the JNI Weak Global Reference table.
   static Mutex* jni_weak_globals_lock_ ACQUIRED_AFTER(jni_globals_lock_);
 
+  // Guard accesses to the JNI function table override.
+  static Mutex* jni_function_table_lock_ ACQUIRED_AFTER(jni_weak_globals_lock_);
+
   // Have an exclusive aborting thread.
-  static Mutex* abort_lock_ ACQUIRED_AFTER(jni_weak_globals_lock_);
+  static Mutex* abort_lock_ ACQUIRED_AFTER(jni_function_table_lock_);
 
   // Allow mutual exclusion when manipulating Thread::suspend_count_.
   // TODO: Does the trade-off of a per-thread lock make sense?
diff --git a/runtime/class_linker-inl.h b/runtime/class_linker-inl.h
index 5fc5f1a..2e17dd8 100644
--- a/runtime/class_linker-inl.h
+++ b/runtime/class_linker-inl.h
@@ -25,7 +25,6 @@
 #include "mirror/class_loader.h"
 #include "mirror/dex_cache-inl.h"
 #include "mirror/iftable.h"
-#include "mirror/throwable.h"
 #include "mirror/object_array.h"
 #include "handle_scope-inl.h"
 #include "scoped_thread_state_change-inl.h"
@@ -90,25 +89,16 @@
   if (kIsDebugBuild) {
     Thread::Current()->AssertNoPendingException();
   }
-  ObjPtr<mirror::Class> resolved_type =
-      referrer->GetDexCacheResolvedType(type_idx, image_pointer_size_);
+  ObjPtr<mirror::Class> resolved_type = referrer->GetDexCache()->GetResolvedType(type_idx);
   if (UNLIKELY(resolved_type == nullptr)) {
     StackHandleScope<2> hs(Thread::Current());
-    // There could be an out of bounds exception from GetDexCacheResolvedType, don't call
-    // ResolveType for this case.
-    if (LIKELY(!hs.Self()->IsExceptionPending())) {
-      ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass();
-      Handle<mirror::DexCache> dex_cache(hs.NewHandle(declaring_class->GetDexCache()));
-      Handle<mirror::ClassLoader> class_loader(hs.NewHandle(declaring_class->GetClassLoader()));
-      const DexFile& dex_file = *dex_cache->GetDexFile();
-      resolved_type = ResolveType(dex_file, type_idx, dex_cache, class_loader);
-      // Note: We cannot check here to see whether we added the type to the cache. The type
-      //       might be an erroneous class, which results in it being hidden from us.
-    } else {
-      // Make sure its an array out of bounds exception.
-      DCHECK(hs.Self()->GetException()->GetClass()->DescriptorEquals(
-          "Ljava/lang/ArrayIndexOutOfBoundsException;"));
-    }
+    ObjPtr<mirror::Class> declaring_class = referrer->GetDeclaringClass();
+    Handle<mirror::DexCache> dex_cache(hs.NewHandle(declaring_class->GetDexCache()));
+    Handle<mirror::ClassLoader> class_loader(hs.NewHandle(declaring_class->GetClassLoader()));
+    const DexFile& dex_file = *dex_cache->GetDexFile();
+    resolved_type = ResolveType(dex_file, type_idx, dex_cache, class_loader);
+    // Note: We cannot check here to see whether we added the type to the cache. The type
+    //       might be an erroneous class, which results in it being hidden from us.
   }
   return resolved_type.Ptr();
 }
@@ -256,8 +246,8 @@
     // Locate the dex cache of the original interface/Object
     for (const DexCacheData& data : dex_caches_) {
       if (!self->IsJWeakCleared(data.weak_root) &&
-          proxy_method->HasSameDexCacheResolvedTypes(data.resolved_types,
-                                                     image_pointer_size_)) {
+          proxy_method->HasSameDexCacheResolvedMethods(data.resolved_methods,
+                                                       image_pointer_size_)) {
         ObjPtr<mirror::DexCache> dex_cache =
             ObjPtr<mirror::DexCache>::DownCast(self->DecodeJObject(data.weak_root));
         if (dex_cache != nullptr) {
diff --git a/runtime/class_linker.cc b/runtime/class_linker.cc
index 035cead..efbce3d 100644
--- a/runtime/class_linker.cc
+++ b/runtime/class_linker.cc
@@ -14,11 +14,18 @@
  * limitations under the License.
  */
 
+// Disable optimizations for Atomic::LoadJavaData on x86 devices.
+// Bug: http://b/34287931
+#if defined(__i386__)
+#define DISABLE_LOAD_JAVA_DATA_OPTIMIZATIONS
+#endif
+
 #include "class_linker.h"
 
 #include <algorithm>
 #include <deque>
 #include <iostream>
+#include <map>
 #include <memory>
 #include <queue>
 #include <string>
@@ -65,7 +72,7 @@
 #include "interpreter/interpreter.h"
 #include "jit/jit.h"
 #include "jit/jit_code_cache.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "jni_internal.h"
 #include "leb128.h"
 #include "linear_alloc.h"
@@ -96,6 +103,7 @@
 #include "object_lock.h"
 #include "os.h"
 #include "runtime.h"
+#include "runtime_callbacks.h"
 #include "ScopedLocalRef.h"
 #include "scoped_thread_state_change-inl.h"
 #include "thread-inl.h"
@@ -351,7 +359,7 @@
       array_iftable_(nullptr),
       find_array_class_cache_next_victim_(0),
       init_done_(false),
-      log_new_class_table_roots_(false),
+      log_new_roots_(false),
       intern_table_(intern_table),
       quick_resolution_trampoline_(nullptr),
       quick_imt_conflict_trampoline_(nullptr),
@@ -1099,23 +1107,7 @@
   explicit FixupArtMethodArrayVisitor(const ImageHeader& header) : header_(header) {}
 
   virtual void Visit(ArtMethod* method) REQUIRES_SHARED(Locks::mutator_lock_) {
-    GcRoot<mirror::Class>* resolved_types = method->GetDexCacheResolvedTypes(kRuntimePointerSize);
     const bool is_copied = method->IsCopied();
-    if (resolved_types != nullptr) {
-      bool in_image_space = false;
-      if (kIsDebugBuild || is_copied) {
-        in_image_space = header_.GetImageSection(ImageHeader::kSectionDexCacheArrays).Contains(
-            reinterpret_cast<const uint8_t*>(resolved_types) - header_.GetImageBegin());
-      }
-      // Must be in image space for non-miranda method.
-      DCHECK(is_copied || in_image_space)
-          << resolved_types << " is not in image starting at "
-          << reinterpret_cast<void*>(header_.GetImageBegin());
-      if (!is_copied || in_image_space) {
-        method->SetDexCacheResolvedTypes(method->GetDexCache()->GetResolvedTypes(),
-                                         kRuntimePointerSize);
-      }
-    }
     ArtMethod** resolved_methods = method->GetDexCacheResolvedMethods(kRuntimePointerSize);
     if (resolved_methods != nullptr) {
       bool in_image_space = false;
@@ -1355,7 +1347,7 @@
           // The image space is not yet added to the heap, avoid read barriers.
           ObjPtr<mirror::Class> klass = types[j].Read();
           if (space->HasAddress(klass.Ptr())) {
-            DCHECK_NE(klass->GetStatus(), mirror::Class::kStatusError);
+            DCHECK(!klass->IsErroneous()) << klass->GetStatus();
             auto it = new_class_set->Find(ClassTable::TableSlot(klass));
             DCHECK(it != new_class_set->end());
             DCHECK_EQ(it->Read(), klass);
@@ -1413,7 +1405,11 @@
         class_loader_(class_loader) {}
 
   bool operator()(ObjPtr<mirror::Class> klass) const REQUIRES_SHARED(Locks::mutator_lock_) {
-    klass->SetClassLoader(class_loader_);
+    // Do not update class loader for boot image classes where the app image
+    // class loader is only the initiating loader but not the defining loader.
+    if (klass->GetClassLoader() != nullptr) {
+      klass->SetClassLoader(class_loader_);
+    }
     return true;
   }
 
@@ -1714,7 +1710,7 @@
       for (int32_t j = 0, num_types = h_dex_cache->NumResolvedTypes(); j < num_types; j++) {
         ObjPtr<mirror::Class> klass = types[j].Read();
         if (klass != nullptr) {
-          DCHECK_NE(klass->GetStatus(), mirror::Class::kStatusError);
+          DCHECK(!klass->IsErroneous()) << klass->GetStatus();
         }
       }
     } else {
@@ -1865,12 +1861,10 @@
                     << reinterpret_cast<const void*>(section_end);
       }
     }
-    if (!oat_file->GetBssGcRoots().empty()) {
-      // Insert oat file to class table for visiting .bss GC roots.
-      class_table->InsertOatFile(oat_file);
-    }
-  } else {
-    DCHECK(oat_file->GetBssGcRoots().empty());
+  }
+  if (!oat_file->GetBssGcRoots().empty()) {
+    // Insert oat file to class table for visiting .bss GC roots.
+    class_table->InsertOatFile(oat_file);
   }
   if (added_class_table) {
     WriterMutexLock mu(self, *Locks::classlinker_classes_lock_);
@@ -1934,14 +1928,27 @@
       // Concurrent moving GC marked new roots through the to-space invariant.
       CHECK_EQ(new_ref, old_ref);
     }
+    for (const OatFile* oat_file : new_bss_roots_boot_oat_files_) {
+      for (GcRoot<mirror::Object>& root : oat_file->GetBssGcRoots()) {
+        ObjPtr<mirror::Object> old_ref = root.Read<kWithoutReadBarrier>();
+        if (old_ref != nullptr) {
+          DCHECK(old_ref->IsClass());
+          root.VisitRoot(visitor, RootInfo(kRootStickyClass));
+          ObjPtr<mirror::Object> new_ref = root.Read<kWithoutReadBarrier>();
+          // Concurrent moving GC marked new roots through the to-space invariant.
+          CHECK_EQ(new_ref, old_ref);
+        }
+      }
+    }
   }
   if ((flags & kVisitRootFlagClearRootLog) != 0) {
     new_class_roots_.clear();
+    new_bss_roots_boot_oat_files_.clear();
   }
   if ((flags & kVisitRootFlagStartLoggingNewRoots) != 0) {
-    log_new_class_table_roots_ = true;
+    log_new_roots_ = true;
   } else if ((flags & kVisitRootFlagStopLoggingNewRoots) != 0) {
-    log_new_class_table_roots_ = false;
+    log_new_roots_ = false;
   }
   // We deliberately ignore the class roots in the image since we
   // handle image roots by using the MS/CMS rescanning of dirty cards.
@@ -2232,7 +2239,7 @@
   // For temporary classes we must wait for them to be retired.
   if (init_done_ && klass->IsTemp()) {
     CHECK(!klass->IsResolved());
-    if (klass->IsErroneous()) {
+    if (klass->IsErroneousUnresolved()) {
       ThrowEarlierClassFailure(klass);
       return nullptr;
     }
@@ -2240,10 +2247,10 @@
     Handle<mirror::Class> h_class(hs.NewHandle(klass));
     ObjectLock<mirror::Class> lock(self, h_class);
     // Loop and wait for the resolving thread to retire this class.
-    while (!h_class->IsRetired() && !h_class->IsErroneous()) {
+    while (!h_class->IsRetired() && !h_class->IsErroneousUnresolved()) {
       lock.WaitIgnoringInterrupts();
     }
-    if (h_class->IsErroneous()) {
+    if (h_class->IsErroneousUnresolved()) {
       ThrowEarlierClassFailure(h_class.Get());
       return nullptr;
     }
@@ -2258,7 +2265,7 @@
   static const size_t kNumYieldIterations = 1000;
   // How long each sleep is in us.
   static const size_t kSleepDurationUS = 1000;  // 1 ms.
-  while (!klass->IsResolved() && !klass->IsErroneous()) {
+  while (!klass->IsResolved() && !klass->IsErroneousUnresolved()) {
     StackHandleScope<1> hs(self);
     HandleWrapperObjPtr<mirror::Class> h_class(hs.NewHandleWrapper(&klass));
     {
@@ -2269,7 +2276,7 @@
         // Check for circular dependencies between classes, the lock is required for SetStatus.
         if (!h_class->IsResolved() && h_class->GetClinitThreadId() == self->GetTid()) {
           ThrowClassCircularityError(h_class.Get());
-          mirror::Class::SetStatus(h_class, mirror::Class::kStatusError, self);
+          mirror::Class::SetStatus(h_class, mirror::Class::kStatusErrorUnresolved, self);
           return nullptr;
         }
       }
@@ -2286,7 +2293,7 @@
     ++index;
   }
 
-  if (klass->IsErroneous()) {
+  if (klass->IsErroneousUnresolved()) {
     ThrowEarlierClassFailure(klass);
     return nullptr;
   }
@@ -2462,10 +2469,8 @@
     return EnsureResolved(self, descriptor, klass);
   }
   // Class is not yet loaded.
-  if (descriptor[0] == '[') {
-    return CreateArrayClass(self, descriptor, hash, class_loader);
-  } else if (class_loader.Get() == nullptr) {
-    // The boot class loader, search the boot class path.
+  if (descriptor[0] != '[' && class_loader.Get() == nullptr) {
+    // Non-array class and the boot class loader, search the boot class path.
     ClassPathEntry pair = FindInClassPath(descriptor, hash, boot_class_path_);
     if (pair.second != nullptr) {
       return DefineClass(self,
@@ -2478,14 +2483,21 @@
       // The boot class loader is searched ahead of the application class loader, failures are
       // expected and will be wrapped in a ClassNotFoundException. Use the pre-allocated error to
       // trigger the chaining with a proper stack trace.
-      ObjPtr<mirror::Throwable> pre_allocated = Runtime::Current()->GetPreAllocatedNoClassDefFoundError();
+      ObjPtr<mirror::Throwable> pre_allocated =
+          Runtime::Current()->GetPreAllocatedNoClassDefFoundError();
       self->SetException(pre_allocated);
       return nullptr;
     }
+  }
+  ObjPtr<mirror::Class> result_ptr;
+  bool descriptor_equals;
+  if (descriptor[0] == '[') {
+    result_ptr = CreateArrayClass(self, descriptor, hash, class_loader);
+    DCHECK_EQ(result_ptr == nullptr, self->IsExceptionPending());
+    DCHECK(result_ptr == nullptr || result_ptr->DescriptorEquals(descriptor));
+    descriptor_equals = true;
   } else {
     ScopedObjectAccessUnchecked soa(self);
-    ObjPtr<mirror::Class> result_ptr;
-    bool descriptor_equals;
     bool known_hierarchy =
         FindClassInBaseDexClassLoader(soa, self, descriptor, hash, class_loader, &result_ptr);
     if (result_ptr != nullptr) {
@@ -2529,16 +2541,7 @@
                                                  WellKnownClasses::java_lang_ClassLoader_loadClass,
                                                  class_name_object.get()));
       }
-      if (self->IsExceptionPending()) {
-        // If the ClassLoader threw, pass that exception up.
-        // However, to comply with the RI behavior, first check if another thread succeeded.
-        result_ptr = LookupClass(self, descriptor, hash, class_loader.Get());
-        if (result_ptr != nullptr && !result_ptr->IsErroneous()) {
-          self->ClearException();
-          return EnsureResolved(self, descriptor, result_ptr);
-        }
-        return nullptr;
-      } else if (result.get() == nullptr) {
+      if (result.get() == nullptr && !self->IsExceptionPending()) {
         // broken loader - throw NPE to be compatible with Dalvik
         ThrowNullPointerException(StringPrintf("ClassLoader.loadClass returned null for %s",
                                                class_name_string.c_str()).c_str());
@@ -2546,50 +2549,60 @@
       }
       result_ptr = soa.Decode<mirror::Class>(result.get());
       // Check the name of the returned class.
-      descriptor_equals = result_ptr->DescriptorEquals(descriptor);
+      descriptor_equals = (result_ptr != nullptr) && result_ptr->DescriptorEquals(descriptor);
     }
-
-    // Try to insert the class to the class table, checking for mismatch.
-    ObjPtr<mirror::Class> old;
-    {
-      WriterMutexLock mu(self, *Locks::classlinker_classes_lock_);
-      ClassTable* const class_table = InsertClassTableForClassLoader(class_loader.Get());
-      old = class_table->Lookup(descriptor, hash);
-      if (old == nullptr) {
-        old = result_ptr;  // For the comparison below, after releasing the lock.
-        if (descriptor_equals) {
-          class_table->InsertWithHash(result_ptr.Ptr(), hash);
-          Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader.Get());
-        }  // else throw below, after releasing the lock.
-      }
-    }
-    if (UNLIKELY(old != result_ptr)) {
-      // Return `old` (even if `!descriptor_equals`) to mimic the RI behavior for parallel
-      // capable class loaders.  (All class loaders are considered parallel capable on Android.)
-      mirror::Class* loader_class = class_loader->GetClass();
-      const char* loader_class_name =
-          loader_class->GetDexFile().StringByTypeIdx(loader_class->GetDexTypeIndex());
-      LOG(WARNING) << "Initiating class loader of type " << DescriptorToDot(loader_class_name)
-          << " is not well-behaved; it returned a different Class for racing loadClass(\""
-          << DescriptorToDot(descriptor) << "\").";
-      return EnsureResolved(self, descriptor, old);
-    }
-    if (UNLIKELY(!descriptor_equals)) {
-      std::string result_storage;
-      const char* result_name = result_ptr->GetDescriptor(&result_storage);
-      std::string loader_storage;
-      const char* loader_class_name = class_loader->GetClass()->GetDescriptor(&loader_storage);
-      ThrowNoClassDefFoundError(
-          "Initiating class loader of type %s returned class %s instead of %s.",
-          DescriptorToDot(loader_class_name).c_str(),
-          DescriptorToDot(result_name).c_str(),
-          DescriptorToDot(descriptor).c_str());
-      return nullptr;
-    }
-    // success, return mirror::Class*
-    return result_ptr.Ptr();
   }
-  UNREACHABLE();
+
+  if (self->IsExceptionPending()) {
+    // If the ClassLoader threw or array class allocation failed, pass that exception up.
+    // However, to comply with the RI behavior, first check if another thread succeeded.
+    result_ptr = LookupClass(self, descriptor, hash, class_loader.Get());
+    if (result_ptr != nullptr && !result_ptr->IsErroneous()) {
+      self->ClearException();
+      return EnsureResolved(self, descriptor, result_ptr);
+    }
+    return nullptr;
+  }
+
+  // Try to insert the class to the class table, checking for mismatch.
+  ObjPtr<mirror::Class> old;
+  {
+    WriterMutexLock mu(self, *Locks::classlinker_classes_lock_);
+    ClassTable* const class_table = InsertClassTableForClassLoader(class_loader.Get());
+    old = class_table->Lookup(descriptor, hash);
+    if (old == nullptr) {
+      old = result_ptr;  // For the comparison below, after releasing the lock.
+      if (descriptor_equals) {
+        class_table->InsertWithHash(result_ptr.Ptr(), hash);
+        Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader.Get());
+      }  // else throw below, after releasing the lock.
+    }
+  }
+  if (UNLIKELY(old != result_ptr)) {
+    // Return `old` (even if `!descriptor_equals`) to mimic the RI behavior for parallel
+    // capable class loaders.  (All class loaders are considered parallel capable on Android.)
+    mirror::Class* loader_class = class_loader->GetClass();
+    const char* loader_class_name =
+        loader_class->GetDexFile().StringByTypeIdx(loader_class->GetDexTypeIndex());
+    LOG(WARNING) << "Initiating class loader of type " << DescriptorToDot(loader_class_name)
+        << " is not well-behaved; it returned a different Class for racing loadClass(\""
+        << DescriptorToDot(descriptor) << "\").";
+    return EnsureResolved(self, descriptor, old);
+  }
+  if (UNLIKELY(!descriptor_equals)) {
+    std::string result_storage;
+    const char* result_name = result_ptr->GetDescriptor(&result_storage);
+    std::string loader_storage;
+    const char* loader_class_name = class_loader->GetClass()->GetDescriptor(&loader_storage);
+    ThrowNoClassDefFoundError(
+        "Initiating class loader of type %s returned class %s instead of %s.",
+        DescriptorToDot(loader_class_name).c_str(),
+        DescriptorToDot(result_name).c_str(),
+        DescriptorToDot(descriptor).c_str());
+    return nullptr;
+  }
+  // success, return mirror::Class*
+  return result_ptr.Ptr();
 }
 
 mirror::Class* ClassLinker::DefineClass(Thread* self,
@@ -2630,13 +2643,30 @@
     self->AssertPendingOOMException();
     return nullptr;
   }
-  ObjPtr<mirror::DexCache> dex_cache = RegisterDexFile(dex_file, class_loader.Get());
+  // Get the real dex file. This will return the input if there aren't any callbacks or they do
+  // nothing.
+  DexFile const* new_dex_file = nullptr;
+  DexFile::ClassDef const* new_class_def = nullptr;
+  // TODO We should ideally figure out some way to move this after we get a lock on the klass so it
+  // will only be called once.
+  Runtime::Current()->GetRuntimeCallbacks()->ClassPreDefine(descriptor,
+                                                            klass,
+                                                            class_loader,
+                                                            dex_file,
+                                                            dex_class_def,
+                                                            &new_dex_file,
+                                                            &new_class_def);
+  // Check to see if an exception happened during runtime callbacks. Return if so.
+  if (self->IsExceptionPending()) {
+    return nullptr;
+  }
+  ObjPtr<mirror::DexCache> dex_cache = RegisterDexFile(*new_dex_file, class_loader.Get());
   if (dex_cache == nullptr) {
     self->AssertPendingOOMException();
     return nullptr;
   }
   klass->SetDexCache(dex_cache);
-  SetupClass(dex_file, dex_class_def, klass, class_loader.Get());
+  SetupClass(*new_dex_file, *new_class_def, klass, class_loader.Get());
 
   // Mark the string class by setting its access flag.
   if (UNLIKELY(!init_done_)) {
@@ -2662,27 +2692,32 @@
   // end up allocating unfree-able linear alloc resources and then lose the race condition. The
   // other reason is that the field roots are only visited from the class table. So we need to be
   // inserted before we allocate / fill in these fields.
-  LoadClass(self, dex_file, dex_class_def, klass);
+  LoadClass(self, *new_dex_file, *new_class_def, klass);
   if (self->IsExceptionPending()) {
     VLOG(class_linker) << self->GetException()->Dump();
     // An exception occured during load, set status to erroneous while holding klass' lock in case
     // notification is necessary.
     if (!klass->IsErroneous()) {
-      mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+      mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorUnresolved, self);
     }
     return nullptr;
   }
 
   // Finish loading (if necessary) by finding parents
   CHECK(!klass->IsLoaded());
-  if (!LoadSuperAndInterfaces(klass, dex_file)) {
+  if (!LoadSuperAndInterfaces(klass, *new_dex_file)) {
     // Loading failed.
     if (!klass->IsErroneous()) {
-      mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+      mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorUnresolved, self);
     }
     return nullptr;
   }
   CHECK(klass->IsLoaded());
+
+  // At this point the class is loaded. Publish a ClassLoad even.
+  // Note: this may be a temporary class. It is a listener's responsibility to handle this.
+  Runtime::Current()->GetRuntimeCallbacks()->ClassLoad(klass);
+
   // Link the class (if necessary)
   CHECK(!klass->IsResolved());
   // TODO: Use fast jobjects?
@@ -2692,17 +2727,13 @@
   if (!LinkClass(self, descriptor, klass, interfaces, &h_new_class)) {
     // Linking failed.
     if (!klass->IsErroneous()) {
-      mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+      mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorUnresolved, self);
     }
     return nullptr;
   }
   self->AssertNoPendingException();
   CHECK(h_new_class.Get() != nullptr) << descriptor;
-  CHECK(h_new_class->IsResolved()) << descriptor;
-
-  // Update the dex cache of where the class is defined. Inlining depends on having
-  // this filled.
-  h_new_class->GetDexCache()->SetResolvedType(h_new_class->GetDexTypeIndex(), h_new_class.Get());
+  CHECK(h_new_class->IsResolved() && !h_new_class->IsErroneousResolved()) << descriptor;
 
   // Instrumentation may have updated entrypoints for all methods of all
   // classes. However it could not update methods of this class while we
@@ -2727,7 +2758,7 @@
    * The class has been prepared and resolved but possibly not yet verified
    * at this point.
    */
-  Dbg::PostClassPrepare(h_new_class.Get());
+  Runtime::Current()->GetRuntimeCallbacks()->ClassPrepare(klass, h_new_class);
 
   // Notify native debugger of the new class and its layout.
   jit::Jit::NewTypeLoadedIfUsingJit(h_new_class.Get());
@@ -3200,7 +3231,6 @@
   dst->SetCodeItemOffset(it.GetMethodCodeItemOffset());
 
   dst->SetDexCacheResolvedMethods(klass->GetDexCache()->GetResolvedMethods(), image_pointer_size_);
-  dst->SetDexCacheResolvedTypes(klass->GetDexCache()->GetResolvedTypes(), image_pointer_size_);
 
   uint32_t access_flags = it.GetMethodAccessFlags();
 
@@ -3296,7 +3326,7 @@
   DexCacheData data;
   data.weak_root = dex_cache_jweak;
   data.dex_file = dex_cache->GetDexFile();
-  data.resolved_types = dex_cache->GetResolvedTypes();
+  data.resolved_methods = dex_cache->GetResolvedMethods();
   dex_caches_.push_back(data);
 }
 
@@ -3307,6 +3337,7 @@
     ReaderMutexLock mu(self, *Locks::dex_lock_);
     ObjPtr<mirror::DexCache> dex_cache = FindDexCacheLocked(self, dex_file, true);
     if (dex_cache != nullptr) {
+      // TODO: Check if the dex file was registered with the same class loader. Bug: 34193123
       return dex_cache.Ptr();
     }
   }
@@ -3497,7 +3528,8 @@
   // class to the hash table --- necessary because of possible races with
   // other threads.)
   if (class_loader.Get() != component_type->GetClassLoader()) {
-    ObjPtr<mirror::Class> new_class = LookupClass(self, descriptor, hash, component_type->GetClassLoader());
+    ObjPtr<mirror::Class> new_class =
+        LookupClass(self, descriptor, hash, component_type->GetClassLoader());
     if (new_class != nullptr) {
       return new_class.Ptr();
     }
@@ -3651,7 +3683,7 @@
       // This is necessary because we need to have the card dirtied for remembered sets.
       Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader);
     }
-    if (log_new_class_table_roots_) {
+    if (log_new_roots_) {
       new_class_roots_.push_back(GcRoot<mirror::Class>(klass));
     }
   }
@@ -3664,6 +3696,14 @@
   return nullptr;
 }
 
+void ClassLinker::WriteBarrierForBootOatFileBssRoots(const OatFile* oat_file) {
+  WriterMutexLock mu(Thread::Current(), *Locks::classlinker_classes_lock_);
+  DCHECK(!oat_file->GetBssGcRoots().empty()) << oat_file->GetLocation();
+  if (log_new_roots_ && !ContainsElement(new_bss_roots_boot_oat_files_, oat_file)) {
+    new_bss_roots_boot_oat_files_.push_back(oat_file);
+  }
+}
+
 // TODO This should really be in mirror::Class.
 void ClassLinker::UpdateClassMethods(ObjPtr<mirror::Class> klass,
                                      LengthPrefixedArray<ArtMethod>* new_methods) {
@@ -3788,7 +3828,7 @@
   }
   // Need to grab the lock to change status.
   ObjectLock<mirror::Class> super_lock(self, klass);
-  mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+  mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorResolved, self);
   return false;
 }
 
@@ -3910,8 +3950,8 @@
   bool preverified = VerifyClassUsingOatFile(dex_file, klass.Get(), oat_file_class_status);
   // If the oat file says the class had an error, re-run the verifier. That way we will get a
   // precise error message. To ensure a rerun, test:
-  //     oat_file_class_status == mirror::Class::kStatusError => !preverified
-  DCHECK(!(oat_file_class_status == mirror::Class::kStatusError) || !preverified);
+  //     mirror::Class::IsErroneous(oat_file_class_status) => !preverified
+  DCHECK(!mirror::Class::IsErroneous(oat_file_class_status) || !preverified);
 
   std::string error_msg;
   verifier::MethodVerifier::FailureKind verifier_failure = verifier::MethodVerifier::kNoFailure;
@@ -3969,7 +4009,7 @@
                   << " because: " << error_msg;
     self->AssertNoPendingException();
     ThrowVerifyError(klass.Get(), "%s", error_msg.c_str());
-    mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+    mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorResolved, self);
   }
   if (preverified || verifier_failure == verifier::MethodVerifier::kNoFailure) {
     // Class is verified so we don't need to do any access check on its methods.
@@ -4060,7 +4100,7 @@
     // at compile time).
     return false;
   }
-  if (oat_file_class_status == mirror::Class::kStatusError) {
+  if (mirror::Class::IsErroneous(oat_file_class_status)) {
     // Compile time verification failed with a hard error. This is caused by invalid instructions
     // in the class. These errors are unrecoverable.
     return false;
@@ -4219,7 +4259,7 @@
     Handle<mirror::ObjectArray<mirror::Class>> h_interfaces(
         hs.NewHandle(soa.Decode<mirror::ObjectArray<mirror::Class>>(interfaces)));
     if (!LinkClass(self, descriptor.c_str(), klass, h_interfaces, &new_class)) {
-      mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+      mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorUnresolved, self);
       return nullptr;
     }
   }
@@ -4349,7 +4389,6 @@
   // The proxy method doesn't have its own dex cache or dex file and so it steals those of its
   // interface prototype. The exception to this are Constructors and the Class of the Proxy itself.
   CHECK(prototype->HasSameDexCacheResolvedMethods(method, image_pointer_size_));
-  CHECK(prototype->HasSameDexCacheResolvedTypes(method, image_pointer_size_));
   auto* np = method->GetInterfaceMethodIfProxy(image_pointer_size_);
   CHECK_EQ(prototype->GetDeclaringClass()->GetDexCache(), np->GetDexCache());
   CHECK_EQ(prototype->GetDexMethodIndex(), method->GetDexMethodIndex());
@@ -4357,8 +4396,7 @@
   CHECK_STREQ(np->GetName(), prototype->GetName());
   CHECK_STREQ(np->GetShorty(), prototype->GetShorty());
   // More complex sanity - via dex cache
-  CHECK_EQ(np->GetReturnType(true /* resolve */, image_pointer_size_),
-           prototype->GetReturnType(true /* resolve */, image_pointer_size_));
+  CHECK_EQ(np->GetReturnType(true /* resolve */), prototype->GetReturnType(true /* resolve */));
 }
 
 bool ClassLinker::CanWeInitializeClass(ObjPtr<mirror::Class> klass, bool can_init_statics,
@@ -4436,7 +4474,8 @@
       return false;
     }
 
-    CHECK(klass->IsResolved()) << klass->PrettyClass() << ": state=" << klass->GetStatus();
+    CHECK(klass->IsResolved() && !klass->IsErroneousResolved())
+        << klass->PrettyClass() << ": state=" << klass->GetStatus();
 
     if (!klass->IsVerified()) {
       VerifyClass(self, klass);
@@ -4471,7 +4510,7 @@
       // A separate thread could have moved us all the way to initialized. A "simple" example
       // involves a subclass of the current class being initialized at the same time (which
       // will implicitly initialize the superclass, if scheduled that way). b/28254258
-      DCHECK_NE(mirror::Class::kStatusError, klass->GetStatus());
+      DCHECK(!klass->IsErroneous()) << klass->GetStatus();
       if (klass->IsInitialized()) {
         return true;
       }
@@ -4498,7 +4537,7 @@
     }
 
     if (!ValidateSuperClassDescriptors(klass)) {
-      mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+      mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorResolved, self);
       return false;
     }
     self->AllowThreadSuspension();
@@ -4534,7 +4573,7 @@
             << (self->GetException() != nullptr ? self->GetException()->Dump() : "");
         ObjectLock<mirror::Class> lock(self, klass);
         // Initialization failed because the super-class is erroneous.
-        mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+        mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorResolved, self);
         return false;
       }
     }
@@ -4565,7 +4604,7 @@
         if (!iface_initialized) {
           ObjectLock<mirror::Class> lock(self, klass);
           // Initialization failed because one of our interfaces with default methods is erroneous.
-          mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+          mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorResolved, self);
           return false;
         }
       }
@@ -4638,7 +4677,7 @@
 
     if (self->IsExceptionPending()) {
       WrapExceptionInInitializer(klass);
-      mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+      mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorResolved, self);
       success = false;
     } else if (Runtime::Current()->IsTransactionAborted()) {
       // The exception thrown when the transaction aborted has been caught and cleared
@@ -4647,7 +4686,7 @@
                      << mirror::Class::PrettyDescriptor(klass.Get())
                      << " without exception while transaction was aborted: re-throw it now.";
       Runtime::Current()->ThrowTransactionAbortError(self);
-      mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+      mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorResolved, self);
       success = false;
     } else {
       RuntimeStats* global_stats = Runtime::Current()->GetStats();
@@ -4731,7 +4770,7 @@
     // we were not using WaitIgnoringInterrupts), bail out.
     if (self->IsExceptionPending()) {
       WrapExceptionInInitializer(klass);
-      mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+      mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorResolved, self);
       return false;
     }
     // Spurious wakeup? Go back to waiting.
@@ -4820,7 +4859,6 @@
 }
 
 static bool HasSameSignatureWithDifferentClassLoaders(Thread* self,
-                                                      PointerSize pointer_size,
                                                       Handle<mirror::Class> klass,
                                                       Handle<mirror::Class> super_klass,
                                                       ArtMethod* method1,
@@ -4828,14 +4866,12 @@
     REQUIRES_SHARED(Locks::mutator_lock_) {
   {
     StackHandleScope<1> hs(self);
-    Handle<mirror::Class> return_type(hs.NewHandle(method1->GetReturnType(true /* resolve */,
-                                                                          pointer_size)));
+    Handle<mirror::Class> return_type(hs.NewHandle(method1->GetReturnType(true /* resolve */)));
     if (UNLIKELY(return_type.Get() == nullptr)) {
       ThrowSignatureCheckResolveReturnTypeException(klass, super_klass, method1, method1);
       return false;
     }
-    ObjPtr<mirror::Class> other_return_type = method2->GetReturnType(true /* resolve */,
-                                                              pointer_size);
+    ObjPtr<mirror::Class> other_return_type = method2->GetReturnType(true /* resolve */);
     if (UNLIKELY(other_return_type == nullptr)) {
       ThrowSignatureCheckResolveReturnTypeException(klass, super_klass, method1, method2);
       return false;
@@ -4880,7 +4916,7 @@
     StackHandleScope<1> hs(self);
     dex::TypeIndex param_type_idx = types1->GetTypeItem(i).type_idx_;
     Handle<mirror::Class> param_type(hs.NewHandle(
-        method1->GetClassFromTypeIndex(param_type_idx, true /* resolve */, pointer_size)));
+        method1->GetClassFromTypeIndex(param_type_idx, true /* resolve */)));
     if (UNLIKELY(param_type.Get() == nullptr)) {
       ThrowSignatureCheckResolveArgException(klass, super_klass, method1,
                                              method1, i, param_type_idx);
@@ -4888,7 +4924,7 @@
     }
     dex::TypeIndex other_param_type_idx = types2->GetTypeItem(i).type_idx_;
     ObjPtr<mirror::Class> other_param_type =
-        method2->GetClassFromTypeIndex(other_param_type_idx, true /* resolve */, pointer_size);
+        method2->GetClassFromTypeIndex(other_param_type_idx, true /* resolve */);
     if (UNLIKELY(other_param_type == nullptr)) {
       ThrowSignatureCheckResolveArgException(klass, super_klass, method1,
                                              method2, i, other_param_type_idx);
@@ -4924,9 +4960,11 @@
       auto* m = klass->GetVTableEntry(i, image_pointer_size_);
       auto* super_m = klass->GetSuperClass()->GetVTableEntry(i, image_pointer_size_);
       if (m != super_m) {
-        if (UNLIKELY(!HasSameSignatureWithDifferentClassLoaders(self, image_pointer_size_,
-                                                                klass, super_klass,
-                                                                m, super_m))) {
+        if (UNLIKELY(!HasSameSignatureWithDifferentClassLoaders(self,
+                                                                klass,
+                                                                super_klass,
+                                                                m,
+                                                                super_m))) {
           self->AssertPendingException();
           return false;
         }
@@ -4942,9 +4980,11 @@
             j, image_pointer_size_);
         auto* super_m = super_klass->GetVirtualMethod(j, image_pointer_size_);
         if (m != super_m) {
-          if (UNLIKELY(!HasSameSignatureWithDifferentClassLoaders(self, image_pointer_size_,
-                                                                  klass, super_klass,
-                                                                  m, super_m))) {
+          if (UNLIKELY(!HasSameSignatureWithDifferentClassLoaders(self,
+                                                                  klass,
+                                                                  super_klass,
+                                                                  m,
+                                                                  super_m))) {
             self->AssertPendingException();
             return false;
           }
@@ -5141,7 +5181,7 @@
     klass->SetIFieldsPtrUnchecked(nullptr);
     if (UNLIKELY(h_new_class.Get() == nullptr)) {
       self->AssertPendingOOMException();
-      mirror::Class::SetStatus(klass, mirror::Class::kStatusError, self);
+      mirror::Class::SetStatus(klass, mirror::Class::kStatusErrorUnresolved, self);
       return false;
     }
 
@@ -5161,7 +5201,7 @@
         Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader);
       }
       CHECK_EQ(existing, klass.Get());
-      if (log_new_class_table_roots_) {
+      if (log_new_roots_) {
         new_class_roots_.push_back(GcRoot<mirror::Class>(h_new_class.Get()));
       }
     }
@@ -7708,7 +7748,7 @@
       type = LookupClass(self, descriptor, hash, class_loader.Ptr());
     }
   }
-  if (type != nullptr || type->IsResolved()) {
+  if (type != nullptr && type->IsResolved()) {
     return type.Ptr();
   }
   return nullptr;
@@ -7753,7 +7793,7 @@
       }
     }
   }
-  DCHECK((resolved == nullptr) || resolved->IsResolved() || resolved->IsErroneous())
+  DCHECK((resolved == nullptr) || resolved->IsResolved())
       << resolved->PrettyDescriptor() << " " << resolved->GetStatus();
   return resolved.Ptr();
 }
@@ -8450,6 +8490,81 @@
   }
 }
 
+class GetResolvedClassesVisitor : public ClassVisitor {
+ public:
+  GetResolvedClassesVisitor(std::set<DexCacheResolvedClasses>* result, bool ignore_boot_classes)
+      : result_(result),
+        ignore_boot_classes_(ignore_boot_classes),
+        last_resolved_classes_(result->end()),
+        last_dex_file_(nullptr),
+        vlog_is_on_(VLOG_IS_ON(class_linker)),
+        extra_stats_(),
+        last_extra_stats_(extra_stats_.end()) { }
+
+  bool operator()(ObjPtr<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+    if (!klass->IsProxyClass() &&
+        !klass->IsArrayClass() &&
+        klass->IsResolved() &&
+        !klass->IsErroneousResolved() &&
+        (!ignore_boot_classes_ || klass->GetClassLoader() != nullptr)) {
+      const DexFile& dex_file = klass->GetDexFile();
+      if (&dex_file != last_dex_file_) {
+        last_dex_file_ = &dex_file;
+        DexCacheResolvedClasses resolved_classes(dex_file.GetLocation(),
+                                                 dex_file.GetBaseLocation(),
+                                                 dex_file.GetLocationChecksum());
+        last_resolved_classes_ = result_->find(resolved_classes);
+        if (last_resolved_classes_ == result_->end()) {
+          last_resolved_classes_ = result_->insert(resolved_classes).first;
+        }
+      }
+      bool added = last_resolved_classes_->AddClass(klass->GetDexTypeIndex());
+      if (UNLIKELY(vlog_is_on_) && added) {
+        const DexCacheResolvedClasses* resolved_classes = std::addressof(*last_resolved_classes_);
+        if (last_extra_stats_ == extra_stats_.end() ||
+            last_extra_stats_->first != resolved_classes) {
+          last_extra_stats_ = extra_stats_.find(resolved_classes);
+          if (last_extra_stats_ == extra_stats_.end()) {
+            last_extra_stats_ =
+                extra_stats_.emplace(resolved_classes, ExtraStats(dex_file.NumClassDefs())).first;
+          }
+        }
+      }
+    }
+    return true;
+  }
+
+  void PrintStatistics() const {
+    if (vlog_is_on_) {
+      for (const DexCacheResolvedClasses& resolved_classes : *result_) {
+        auto it = extra_stats_.find(std::addressof(resolved_classes));
+        DCHECK(it != extra_stats_.end());
+        const ExtraStats& extra_stats = it->second;
+        LOG(INFO) << "Dex location " << resolved_classes.GetDexLocation()
+                  << " has " << resolved_classes.GetClasses().size() << " / "
+                  << extra_stats.number_of_class_defs_ << " resolved classes";
+      }
+    }
+  }
+
+ private:
+  struct ExtraStats {
+    explicit ExtraStats(uint32_t number_of_class_defs)
+        : number_of_class_defs_(number_of_class_defs) {}
+    uint32_t number_of_class_defs_;
+  };
+
+  std::set<DexCacheResolvedClasses>* result_;
+  bool ignore_boot_classes_;
+  std::set<DexCacheResolvedClasses>::iterator last_resolved_classes_;
+  const DexFile* last_dex_file_;
+
+  // Statistics.
+  bool vlog_is_on_;
+  std::map<const DexCacheResolvedClasses*, ExtraStats> extra_stats_;
+  std::map<const DexCacheResolvedClasses*, ExtraStats>::iterator last_extra_stats_;
+};
+
 std::set<DexCacheResolvedClasses> ClassLinker::GetResolvedClasses(bool ignore_boot_classes) {
   ScopedTrace trace(__PRETTY_FUNCTION__);
   ScopedObjectAccess soa(Thread::Current());
@@ -8457,64 +8572,12 @@
   std::set<DexCacheResolvedClasses> ret;
   VLOG(class_linker) << "Collecting resolved classes";
   const uint64_t start_time = NanoTime();
-  ReaderMutexLock mu(soa.Self(), *Locks::dex_lock_);
-  // Loop through all the dex caches and inspect resolved classes.
-  for (const ClassLinker::DexCacheData& data : GetDexCachesData()) {
-    if (soa.Self()->IsJWeakCleared(data.weak_root)) {
-      continue;
-    }
-    ObjPtr<mirror::DexCache> dex_cache = soa.Decode<mirror::DexCache>(data.weak_root);
-    if (dex_cache == nullptr) {
-      continue;
-    }
-    const DexFile* dex_file = dex_cache->GetDexFile();
-    const std::string& location = dex_file->GetLocation();
-    const size_t num_class_defs = dex_file->NumClassDefs();
-    // Use the resolved types, this will miss array classes.
-    const size_t num_types = dex_file->NumTypeIds();
-    VLOG(class_linker) << "Collecting class profile for dex file " << location
-                       << " types=" << num_types << " class_defs=" << num_class_defs;
-    DexCacheResolvedClasses resolved_classes(dex_file->GetLocation(),
-                                             dex_file->GetBaseLocation(),
-                                             dex_file->GetLocationChecksum());
-    size_t num_resolved = 0;
-    std::unordered_set<dex::TypeIndex> class_set;
-    CHECK_EQ(num_types, dex_cache->NumResolvedTypes());
-    for (size_t i = 0; i < num_types; ++i) {
-      ObjPtr<mirror::Class> klass = dex_cache->GetResolvedType(dex::TypeIndex(i));
-      // Filter out null class loader since that is the boot class loader.
-      if (klass == nullptr || (ignore_boot_classes && klass->GetClassLoader() == nullptr)) {
-        continue;
-      }
-      ++num_resolved;
-      DCHECK(!klass->IsProxyClass());
-      if (!klass->IsResolved()) {
-        DCHECK(klass->IsErroneous());
-        continue;
-      }
-      ObjPtr<mirror::DexCache> klass_dex_cache = klass->GetDexCache();
-      if (klass_dex_cache == dex_cache) {
-        DCHECK(klass->IsResolved());
-        CHECK_LT(klass->GetDexClassDefIndex(), num_class_defs);
-        class_set.insert(klass->GetDexTypeIndex());
-      }
-    }
-
-    if (!class_set.empty()) {
-      auto it = ret.find(resolved_classes);
-      if (it != ret.end()) {
-        // Already have the key, union the class type indexes.
-        it->AddClasses(class_set.begin(), class_set.end());
-      } else {
-        resolved_classes.AddClasses(class_set.begin(), class_set.end());
-        ret.insert(resolved_classes);
-      }
-    }
-
-    VLOG(class_linker) << "Dex location " << location << " has " << num_resolved << " / "
-                       << num_class_defs << " resolved classes";
+  GetResolvedClassesVisitor visitor(&ret, ignore_boot_classes);
+  VisitClasses(&visitor);
+  if (VLOG_IS_ON(class_linker)) {
+    visitor.PrintStatistics();
+    LOG(INFO) << "Collecting class profile took " << PrettyDuration(NanoTime() - start_time);
   }
-  VLOG(class_linker) << "Collecting class profile took " << PrettyDuration(NanoTime() - start_time);
   return ret;
 }
 
diff --git a/runtime/class_linker.h b/runtime/class_linker.h
index 77322ed..5042fb7 100644
--- a/runtime/class_linker.h
+++ b/runtime/class_linker.h
@@ -34,6 +34,7 @@
 #include "dex_file.h"
 #include "dex_file_types.h"
 #include "gc_root.h"
+#include "handle.h"
 #include "jni.h"
 #include "mirror/class.h"
 #include "object_callbacks.h"
@@ -64,6 +65,7 @@
 template<typename T> class LengthPrefixedArray;
 template<class T> class MutableHandle;
 class InternTable;
+class OatFile;
 template<class T> class ObjectLock;
 class Runtime;
 class ScopedObjectAccessAlreadyRunnable;
@@ -535,6 +537,12 @@
       REQUIRES(!Locks::classlinker_classes_lock_)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
+  // Add an oat file with .bss GC roots to be visited again at the end of GC
+  // for collector types that need it.
+  void WriteBarrierForBootOatFileBssRoots(const OatFile* oat_file)
+      REQUIRES(!Locks::classlinker_classes_lock_)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+
   mirror::ObjectArray<mirror::Class>* GetClassRoots() REQUIRES_SHARED(Locks::mutator_lock_) {
     mirror::ObjectArray<mirror::Class>* class_roots = class_roots_.Read();
     DCHECK(class_roots != nullptr);
@@ -638,6 +646,14 @@
   mirror::Class* GetHoldingClassOfCopiedMethod(ArtMethod* method)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
+  // Returns null if not found.
+  ClassTable* ClassTableForClassLoader(ObjPtr<mirror::ClassLoader> class_loader)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+
+  void AppendToBootClassPath(Thread* self, const DexFile& dex_file)
+      REQUIRES_SHARED(Locks::mutator_lock_)
+      REQUIRES(!Locks::dex_lock_);
+
   struct DexCacheData {
     // Weak root to the DexCache. Note: Do not decode this unnecessarily or else class unloading may
     // not work properly.
@@ -646,7 +662,7 @@
     // jweak decode that triggers read barriers (and mark them alive unnecessarily and mess with
     // class unloading.)
     const DexFile* dex_file;
-    GcRoot<mirror::Class>* resolved_types;
+    ArtMethod** resolved_methods;
   };
 
  private:
@@ -733,9 +749,6 @@
       REQUIRES_SHARED(Locks::mutator_lock_)
       REQUIRES(!Locks::dex_lock_, !Roles::uninterruptible_);
 
-  void AppendToBootClassPath(Thread* self, const DexFile& dex_file)
-      REQUIRES_SHARED(Locks::mutator_lock_)
-      REQUIRES(!Locks::dex_lock_);
   void AppendToBootClassPath(const DexFile& dex_file, Handle<mirror::DexCache> dex_cache)
       REQUIRES_SHARED(Locks::mutator_lock_)
       REQUIRES(!Locks::dex_lock_);
@@ -1032,10 +1045,6 @@
       REQUIRES_SHARED(Locks::mutator_lock_)
       REQUIRES(Locks::classlinker_classes_lock_);
 
-  // Returns null if not found.
-  ClassTable* ClassTableForClassLoader(ObjPtr<mirror::ClassLoader> class_loader)
-      REQUIRES_SHARED(Locks::mutator_lock_);
-
   // Insert a new class table if not found.
   ClassTable* InsertClassTableForClassLoader(ObjPtr<mirror::ClassLoader> class_loader)
       REQUIRES_SHARED(Locks::mutator_lock_)
@@ -1138,6 +1147,10 @@
   // New class roots, only used by CMS since the GC needs to mark these in the pause.
   std::vector<GcRoot<mirror::Class>> new_class_roots_ GUARDED_BY(Locks::classlinker_classes_lock_);
 
+  // Boot image oat files with new .bss GC roots to be visited in the pause by CMS.
+  std::vector<const OatFile*> new_bss_roots_boot_oat_files_
+      GUARDED_BY(Locks::classlinker_classes_lock_);
+
   // Number of times we've searched dex caches for a class. After a certain number of misses we move
   // the classes into the class_table_ to avoid dex cache based searches.
   Atomic<uint32_t> failed_dex_cache_class_lookups_;
@@ -1155,7 +1168,7 @@
   size_t find_array_class_cache_next_victim_;
 
   bool init_done_;
-  bool log_new_class_table_roots_ GUARDED_BY(Locks::classlinker_classes_lock_);
+  bool log_new_roots_ GUARDED_BY(Locks::classlinker_classes_lock_);
 
   InternTable* intern_table_;
 
@@ -1182,6 +1195,38 @@
   DISALLOW_COPY_AND_ASSIGN(ClassLinker);
 };
 
+class ClassLoadCallback {
+ public:
+  virtual ~ClassLoadCallback() {}
+
+  // If set we will replace initial_class_def & initial_dex_file with the final versions. The
+  // callback author is responsible for ensuring these are allocated in such a way they can be
+  // cleaned up if another transformation occurs. Note that both must be set or null/unchanged on
+  // return.
+  // Note: the class may be temporary, in which case a following ClassPrepare event will be a
+  //       different object. It is the listener's responsibility to handle this.
+  // Note: This callback is rarely useful so a default implementation has been given that does
+  //       nothing.
+  virtual void ClassPreDefine(const char* descriptor ATTRIBUTE_UNUSED,
+                              Handle<mirror::Class> klass ATTRIBUTE_UNUSED,
+                              Handle<mirror::ClassLoader> class_loader ATTRIBUTE_UNUSED,
+                              const DexFile& initial_dex_file ATTRIBUTE_UNUSED,
+                              const DexFile::ClassDef& initial_class_def ATTRIBUTE_UNUSED,
+                              /*out*/DexFile const** final_dex_file ATTRIBUTE_UNUSED,
+                              /*out*/DexFile::ClassDef const** final_class_def ATTRIBUTE_UNUSED)
+      REQUIRES_SHARED(Locks::mutator_lock_) {}
+
+  // A class has been loaded.
+  // Note: the class may be temporary, in which case a following ClassPrepare event will be a
+  //       different object. It is the listener's responsibility to handle this.
+  virtual void ClassLoad(Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+
+  // A class has been prepared, i.e., resolved. As the ClassLoad event might have been for a
+  // temporary class, provide both the former and the current class.
+  virtual void ClassPrepare(Handle<mirror::Class> temp_klass,
+                            Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
 }  // namespace art
 
 #endif  // ART_RUNTIME_CLASS_LINKER_H_
diff --git a/runtime/class_linker_test.cc b/runtime/class_linker_test.cc
index 42108d8..e806e7d 100644
--- a/runtime/class_linker_test.cc
+++ b/runtime/class_linker_test.cc
@@ -87,6 +87,7 @@
     EXPECT_FALSE(primitive->IsErroneous());
     EXPECT_TRUE(primitive->IsLoaded());
     EXPECT_TRUE(primitive->IsResolved());
+    EXPECT_FALSE(primitive->IsErroneousResolved());
     EXPECT_TRUE(primitive->IsVerified());
     EXPECT_TRUE(primitive->IsInitialized());
     EXPECT_FALSE(primitive->IsArrayInstance());
@@ -125,6 +126,7 @@
     EXPECT_FALSE(JavaLangObject->IsErroneous());
     EXPECT_TRUE(JavaLangObject->IsLoaded());
     EXPECT_TRUE(JavaLangObject->IsResolved());
+    EXPECT_FALSE(JavaLangObject->IsErroneousResolved());
     EXPECT_TRUE(JavaLangObject->IsVerified());
     EXPECT_TRUE(JavaLangObject->IsInitialized());
     EXPECT_FALSE(JavaLangObject->IsArrayInstance());
@@ -199,6 +201,7 @@
     EXPECT_FALSE(array->IsErroneous());
     EXPECT_TRUE(array->IsLoaded());
     EXPECT_TRUE(array->IsResolved());
+    EXPECT_FALSE(array->IsErroneousResolved());
     EXPECT_TRUE(array->IsVerified());
     EXPECT_TRUE(array->IsInitialized());
     EXPECT_FALSE(array->IsArrayInstance());
@@ -242,13 +245,9 @@
     EXPECT_TRUE(method->GetSignature() != Signature::NoSignature());
 
     EXPECT_TRUE(method->HasDexCacheResolvedMethods(kRuntimePointerSize));
-    EXPECT_TRUE(method->HasDexCacheResolvedTypes(kRuntimePointerSize));
     EXPECT_TRUE(method->HasSameDexCacheResolvedMethods(
         method->GetDeclaringClass()->GetDexCache()->GetResolvedMethods(),
         kRuntimePointerSize));
-    EXPECT_TRUE(method->HasSameDexCacheResolvedTypes(
-        method->GetDeclaringClass()->GetDexCache()->GetResolvedTypes(),
-        kRuntimePointerSize));
   }
 
   void AssertField(ObjPtr<mirror::Class> klass, ArtField* field)
@@ -274,6 +273,7 @@
     EXPECT_TRUE(klass->GetDexCache() != nullptr);
     EXPECT_TRUE(klass->IsLoaded());
     EXPECT_TRUE(klass->IsResolved());
+    EXPECT_FALSE(klass->IsErroneousResolved());
     EXPECT_FALSE(klass->IsErroneous());
     EXPECT_FALSE(klass->IsArrayClass());
     EXPECT_TRUE(klass->GetComponentType() == nullptr);
@@ -460,7 +460,6 @@
  protected:
   virtual void SetUpRuntimeOptions(RuntimeOptions* options) OVERRIDE {
     CommonRuntimeTest::SetUpRuntimeOptions(options);
-    options->push_back(std::make_pair("-Xexperimental:method-handles", nullptr));
   }
 };
 
@@ -492,7 +491,7 @@
       // says AccessibleObject is 9 bytes but sizeof(AccessibleObject) is 12 bytes due to padding.
       // The RoundUp is to get around this case.
       static constexpr size_t kPackAlignment = 4;
-      size_t expected_size = RoundUp(is_static ? klass->GetClassSize(): klass->GetObjectSize(),
+      size_t expected_size = RoundUp(is_static ? klass->GetClassSize() : klass->GetObjectSize(),
           kPackAlignment);
       if (sizeof(T) != expected_size) {
         LOG(ERROR) << "Class size mismatch:"
@@ -617,7 +616,7 @@
   ClassExtOffsets() : CheckOffsets<mirror::ClassExt>(false, "Ldalvik/system/ClassExt;") {
     addOffset(OFFSETOF_MEMBER(mirror::ClassExt, obsolete_dex_caches_), "obsoleteDexCaches");
     addOffset(OFFSETOF_MEMBER(mirror::ClassExt, obsolete_methods_), "obsoleteMethods");
-    addOffset(OFFSETOF_MEMBER(mirror::ClassExt, original_dex_cache_), "originalDexCache");
+    addOffset(OFFSETOF_MEMBER(mirror::ClassExt, original_dex_file_bytes_), "originalDexFile");
     addOffset(OFFSETOF_MEMBER(mirror::ClassExt, verify_error_), "verifyError");
   }
 };
@@ -748,6 +747,8 @@
   MethodHandleImplOffsets() : CheckOffsets<mirror::MethodHandleImpl>(
       false, "Ljava/lang/invoke/MethodHandle;") {
     addOffset(OFFSETOF_MEMBER(mirror::MethodHandleImpl, art_field_or_method_), "artFieldOrMethod");
+    addOffset(OFFSETOF_MEMBER(mirror::MethodHandleImpl, cached_spread_invoker_),
+              "cachedSpreadInvoker");
     addOffset(OFFSETOF_MEMBER(mirror::MethodHandleImpl, handle_kind_), "handleKind");
     addOffset(OFFSETOF_MEMBER(mirror::MethodHandleImpl, nominal_type_), "nominalType");
     addOffset(OFFSETOF_MEMBER(mirror::MethodHandleImpl, method_type_), "type");
@@ -757,6 +758,7 @@
 struct EmulatedStackFrameOffsets : public CheckOffsets<mirror::EmulatedStackFrame> {
   EmulatedStackFrameOffsets() : CheckOffsets<mirror::EmulatedStackFrame>(
       false, "Ldalvik/system/EmulatedStackFrame;") {
+    addOffset(OFFSETOF_MEMBER(mirror::EmulatedStackFrame, callsite_type_), "callsiteType");
     addOffset(OFFSETOF_MEMBER(mirror::EmulatedStackFrame, references_), "references");
     addOffset(OFFSETOF_MEMBER(mirror::EmulatedStackFrame, stack_frame_), "stackFrame");
     addOffset(OFFSETOF_MEMBER(mirror::EmulatedStackFrame, type_), "type");
@@ -861,6 +863,7 @@
   EXPECT_FALSE(MyClass->IsErroneous());
   EXPECT_TRUE(MyClass->IsLoaded());
   EXPECT_TRUE(MyClass->IsResolved());
+  EXPECT_FALSE(MyClass->IsErroneousResolved());
   EXPECT_FALSE(MyClass->IsVerified());
   EXPECT_FALSE(MyClass->IsInitialized());
   EXPECT_FALSE(MyClass->IsArrayInstance());
@@ -899,7 +902,6 @@
   dex::TypeIndex type_idx = klass->GetClassDef()->class_idx_;
   ObjPtr<mirror::DexCache> dex_cache = klass->GetDexCache();
   const DexFile& dex_file = klass->GetDexFile();
-  EXPECT_OBJ_PTR_EQ(dex_cache->GetResolvedType(type_idx), klass);
   EXPECT_OBJ_PTR_EQ(
       class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache, class_loader.Get()),
       klass);
@@ -911,6 +913,82 @@
       klass);
 }
 
+TEST_F(ClassLinkerTest, LookupResolvedTypeArray) {
+  ScopedObjectAccess soa(Thread::Current());
+  StackHandleScope<2> hs(soa.Self());
+  Handle<mirror::ClassLoader> class_loader(
+      hs.NewHandle(soa.Decode<mirror::ClassLoader>(LoadDex("AllFields"))));
+  // Get the AllFields class for the dex cache and dex file.
+  ObjPtr<mirror::Class> all_fields_klass
+      = class_linker_->FindClass(soa.Self(), "LAllFields;", class_loader);
+  ASSERT_OBJ_PTR_NE(all_fields_klass, ObjPtr<mirror::Class>(nullptr));
+  Handle<mirror::DexCache> dex_cache = hs.NewHandle(all_fields_klass->GetDexCache());
+  const DexFile& dex_file = *dex_cache->GetDexFile();
+  // Get the index of the array class we want to test.
+  const DexFile::TypeId* array_id = dex_file.FindTypeId("[Ljava/lang/Object;");
+  ASSERT_TRUE(array_id != nullptr);
+  dex::TypeIndex array_idx = dex_file.GetIndexForTypeId(*array_id);
+  // Check that the array class wasn't resolved yet.
+  EXPECT_OBJ_PTR_EQ(
+      class_linker_->LookupResolvedType(dex_file, array_idx, dex_cache.Get(), class_loader.Get()),
+      ObjPtr<mirror::Class>(nullptr));
+  // Resolve the array class we want to test.
+  ObjPtr<mirror::Class> array_klass
+      = class_linker_->FindClass(soa.Self(), "[Ljava/lang/Object;", class_loader);
+  ASSERT_OBJ_PTR_NE(array_klass, ObjPtr<mirror::Class>(nullptr));
+  // Test that LookupResolvedType() finds the array class.
+  EXPECT_OBJ_PTR_EQ(
+      class_linker_->LookupResolvedType(dex_file, array_idx, dex_cache.Get(), class_loader.Get()),
+      array_klass);
+  // Zero out the resolved type and make sure LookupResolvedType() still finds it.
+  dex_cache->SetResolvedType(array_idx, nullptr);
+  EXPECT_TRUE(dex_cache->GetResolvedType(array_idx) == nullptr);
+  EXPECT_OBJ_PTR_EQ(
+      class_linker_->LookupResolvedType(dex_file, array_idx, dex_cache.Get(), class_loader.Get()),
+      array_klass);
+}
+
+TEST_F(ClassLinkerTest, LookupResolvedTypeErroneousInit) {
+  ScopedObjectAccess soa(Thread::Current());
+  StackHandleScope<3> hs(soa.Self());
+  Handle<mirror::ClassLoader> class_loader(
+      hs.NewHandle(soa.Decode<mirror::ClassLoader>(LoadDex("ErroneousInit"))));
+  AssertNonExistentClass("LErroneousInit;");
+  Handle<mirror::Class> klass =
+      hs.NewHandle(class_linker_->FindClass(soa.Self(), "LErroneousInit;", class_loader));
+  ASSERT_OBJ_PTR_NE(klass.Get(), ObjPtr<mirror::Class>(nullptr));
+  dex::TypeIndex type_idx = klass->GetClassDef()->class_idx_;
+  Handle<mirror::DexCache> dex_cache = hs.NewHandle(klass->GetDexCache());
+  const DexFile& dex_file = klass->GetDexFile();
+  EXPECT_OBJ_PTR_EQ(
+      class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
+      klass.Get());
+  // Zero out the resolved type and make sure LookupResolvedType still finds it.
+  dex_cache->SetResolvedType(type_idx, nullptr);
+  EXPECT_TRUE(dex_cache->GetResolvedType(type_idx) == nullptr);
+  EXPECT_OBJ_PTR_EQ(
+      class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
+      klass.Get());
+  // Force initialization to turn the class erroneous.
+  bool initialized = class_linker_->EnsureInitialized(soa.Self(),
+                                                      klass,
+                                                      /* can_init_fields */ true,
+                                                      /* can_init_parents */ true);
+  EXPECT_FALSE(initialized);
+  EXPECT_TRUE(soa.Self()->IsExceptionPending());
+  soa.Self()->ClearException();
+  // Check that the LookupResolvedType() can still find the resolved type.
+  EXPECT_OBJ_PTR_EQ(
+      class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
+      klass.Get());
+  // Zero out the resolved type and make sure LookupResolvedType() still finds it.
+  dex_cache->SetResolvedType(type_idx, nullptr);
+  EXPECT_TRUE(dex_cache->GetResolvedType(type_idx) == nullptr);
+  EXPECT_OBJ_PTR_EQ(
+      class_linker_->LookupResolvedType(dex_file, type_idx, dex_cache.Get(), class_loader.Get()),
+      klass.Get());
+}
+
 TEST_F(ClassLinkerTest, LibCore) {
   ScopedObjectAccess soa(Thread::Current());
   ASSERT_TRUE(java_lang_dex_file_ != nullptr);
diff --git a/runtime/class_table.cc b/runtime/class_table.cc
index 0f985c6..ff846a7 100644
--- a/runtime/class_table.cc
+++ b/runtime/class_table.cc
@@ -129,6 +129,19 @@
   classes_.back().InsertWithHash(TableSlot(klass, hash), hash);
 }
 
+void ClassTable::CopyWithoutLocks(const ClassTable& source_table) {
+  if (kIsDebugBuild) {
+    for (ClassSet& class_set : classes_) {
+      CHECK(class_set.Empty());
+    }
+  }
+  for (const ClassSet& class_set : source_table.classes_) {
+    for (const TableSlot& slot : class_set) {
+      classes_.back().Insert(slot);
+    }
+  }
+}
+
 void ClassTable::InsertWithoutLocks(ObjPtr<mirror::Class> klass) {
   const uint32_t hash = TableSlot::HashDescriptor(klass);
   classes_.back().InsertWithHash(TableSlot(klass, hash), hash);
diff --git a/runtime/class_table.h b/runtime/class_table.h
index f27d809..c8ec28e 100644
--- a/runtime/class_table.h
+++ b/runtime/class_table.h
@@ -240,6 +240,7 @@
   }
 
  private:
+  void CopyWithoutLocks(const ClassTable& source_table) NO_THREAD_SAFETY_ANALYSIS;
   void InsertWithoutLocks(ObjPtr<mirror::Class> klass) NO_THREAD_SAFETY_ANALYSIS;
 
   size_t CountDefiningLoaderClasses(ObjPtr<mirror::ClassLoader> defining_loader,
diff --git a/runtime/common_runtime_test.cc b/runtime/common_runtime_test.cc
index 743fcc8..fc82264 100644
--- a/runtime/common_runtime_test.cc
+++ b/runtime/common_runtime_test.cc
@@ -133,7 +133,9 @@
 
 static bool unstarted_initialized_ = false;
 
-CommonRuntimeTestImpl::CommonRuntimeTestImpl() {}
+CommonRuntimeTestImpl::CommonRuntimeTestImpl()
+    : class_linker_(nullptr), java_lang_dex_file_(nullptr) {
+}
 
 CommonRuntimeTestImpl::~CommonRuntimeTestImpl() {
   // Ensure the dex files are cleaned up before the runtime.
@@ -425,7 +427,9 @@
   TearDownAndroidData(android_data_, true);
   dalvik_cache_.clear();
 
-  Runtime::Current()->GetHeap()->VerifyHeap();  // Check for heap corruption after the test
+  if (runtime_ != nullptr) {
+    runtime_->GetHeap()->VerifyHeap();  // Check for heap corruption after the test
+  }
 }
 
 static std::string GetDexFileName(const std::string& jar_prefix, bool host) {
diff --git a/runtime/common_throws.cc b/runtime/common_throws.cc
index c30272e..a44f79e 100644
--- a/runtime/common_throws.cc
+++ b/runtime/common_throws.cc
@@ -428,6 +428,8 @@
     case Instruction::INVOKE_VIRTUAL_RANGE:
     case Instruction::INVOKE_INTERFACE:
     case Instruction::INVOKE_INTERFACE_RANGE:
+    case Instruction::INVOKE_POLYMORPHIC:
+    case Instruction::INVOKE_POLYMORPHIC_RANGE:
     case Instruction::INVOKE_VIRTUAL_QUICK:
     case Instruction::INVOKE_VIRTUAL_RANGE_QUICK: {
       // Without inlining, we could just check that the offset is the class offset.
@@ -551,6 +553,12 @@
     case Instruction::INVOKE_INTERFACE_RANGE:
       ThrowNullPointerExceptionForMethodAccess(instr->VRegB_3rc(), kInterface);
       break;
+    case Instruction::INVOKE_POLYMORPHIC:
+      ThrowNullPointerExceptionForMethodAccess(instr->VRegB_45cc(), kVirtual);
+      break;
+    case Instruction::INVOKE_POLYMORPHIC_RANGE:
+      ThrowNullPointerExceptionForMethodAccess(instr->VRegB_4rcc(), kVirtual);
+      break;
     case Instruction::INVOKE_VIRTUAL_QUICK:
     case Instruction::INVOKE_VIRTUAL_RANGE_QUICK: {
       // Since we replaced the method index, we ask the verifier to tell us which
diff --git a/runtime/debugger.cc b/runtime/debugger.cc
index df4413d..22a3163 100644
--- a/runtime/debugger.cc
+++ b/runtime/debugger.cc
@@ -320,6 +320,9 @@
 size_t Dbg::exception_catch_event_ref_count_ = 0;
 uint32_t Dbg::instrumentation_events_ = 0;
 
+Dbg::DbgThreadLifecycleCallback Dbg::thread_lifecycle_callback_;
+Dbg::DbgClassLoadCallback Dbg::class_load_callback_;
+
 // Breakpoints.
 static std::vector<Breakpoint> gBreakpoints GUARDED_BY(Locks::breakpoint_lock_);
 
@@ -3985,9 +3988,7 @@
         if (shorty[i + 1] == 'L') {
           // Did we really get an argument of an appropriate reference type?
           mirror::Class* parameter_type =
-              m->GetClassFromTypeIndex(types->GetTypeItem(i).type_idx_,
-                                       true /* resolve */,
-                                       kRuntimePointerSize);
+              m->GetClassFromTypeIndex(types->GetTypeItem(i).type_idx_, true /* resolve */);
           mirror::Object* argument = gRegistry->Get<mirror::Object*>(arg_values[i], &error);
           if (error != JDWP::ERR_NONE) {
             return JDWP::ERR_INVALID_OBJECT;
@@ -5137,4 +5138,20 @@
   }
 }
 
+void Dbg::DbgThreadLifecycleCallback::ThreadStart(Thread* self) {
+  Dbg::PostThreadStart(self);
+}
+
+void Dbg::DbgThreadLifecycleCallback::ThreadDeath(Thread* self) {
+  Dbg::PostThreadDeath(self);
+}
+
+void Dbg::DbgClassLoadCallback::ClassLoad(Handle<mirror::Class> klass ATTRIBUTE_UNUSED) {
+  // Ignore ClassLoad;
+}
+void Dbg::DbgClassLoadCallback::ClassPrepare(Handle<mirror::Class> temp_klass ATTRIBUTE_UNUSED,
+                                             Handle<mirror::Class> klass) {
+  Dbg::PostClassPrepare(klass.Get());
+}
+
 }  // namespace art
diff --git a/runtime/debugger.h b/runtime/debugger.h
index 3b4a5e1..a7fd160 100644
--- a/runtime/debugger.h
+++ b/runtime/debugger.h
@@ -28,6 +28,8 @@
 #include <vector>
 
 #include "gc_root.h"
+#include "class_linker.h"
+#include "handle.h"
 #include "jdwp/jdwp.h"
 #include "jni.h"
 #include "jvalue.h"
@@ -502,12 +504,6 @@
       REQUIRES_SHARED(Locks::mutator_lock_);
   static void PostException(mirror::Throwable* exception)
       REQUIRES_SHARED(Locks::mutator_lock_);
-  static void PostThreadStart(Thread* t)
-      REQUIRES_SHARED(Locks::mutator_lock_);
-  static void PostThreadDeath(Thread* t)
-      REQUIRES_SHARED(Locks::mutator_lock_);
-  static void PostClassPrepare(mirror::Class* c)
-      REQUIRES_SHARED(Locks::mutator_lock_);
 
   static void UpdateDebugger(Thread* thread, mirror::Object* this_object,
                              ArtMethod* method, uint32_t new_dex_pc,
@@ -707,6 +703,13 @@
     return instrumentation_events_;
   }
 
+  static ThreadLifecycleCallback* GetThreadLifecycleCallback() {
+    return &thread_lifecycle_callback_;
+  }
+  static ClassLoadCallback* GetClassLoadCallback() {
+    return &class_load_callback_;
+  }
+
  private:
   static void ExecuteMethodWithoutPendingException(ScopedObjectAccess& soa, DebugInvokeReq* pReq)
       REQUIRES_SHARED(Locks::mutator_lock_);
@@ -725,9 +728,17 @@
       REQUIRES(!Locks::thread_list_lock_) REQUIRES_SHARED(Locks::mutator_lock_);
 
   static void DdmBroadcast(bool connect) REQUIRES_SHARED(Locks::mutator_lock_);
+
+  static void PostThreadStart(Thread* t)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+  static void PostThreadDeath(Thread* t)
+      REQUIRES_SHARED(Locks::mutator_lock_);
   static void PostThreadStartOrStop(Thread*, uint32_t)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
+  static void PostClassPrepare(mirror::Class* c)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+
   static void PostLocationEvent(ArtMethod* method, int pcOffset,
                                 mirror::Object* thisPtr, int eventFlags,
                                 const JValue* return_value)
@@ -789,6 +800,22 @@
   static size_t exception_catch_event_ref_count_ GUARDED_BY(Locks::deoptimization_lock_);
   static uint32_t instrumentation_events_ GUARDED_BY(Locks::mutator_lock_);
 
+  class DbgThreadLifecycleCallback : public ThreadLifecycleCallback {
+   public:
+    void ThreadStart(Thread* self) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+    void ThreadDeath(Thread* self) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+  };
+
+  class DbgClassLoadCallback : public ClassLoadCallback {
+   public:
+    void ClassLoad(Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+    void ClassPrepare(Handle<mirror::Class> temp_klass,
+                      Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_);
+  };
+
+  static DbgThreadLifecycleCallback thread_lifecycle_callback_;
+  static DbgClassLoadCallback class_load_callback_;
+
   DISALLOW_COPY_AND_ASSIGN(Dbg);
 };
 
diff --git a/runtime/dex2oat_environment_test.h b/runtime/dex2oat_environment_test.h
index b0c4597..7ae9f03 100644
--- a/runtime/dex2oat_environment_test.h
+++ b/runtime/dex2oat_environment_test.h
@@ -160,7 +160,7 @@
   // image at GetImageLocation(). This is used for testing mismatched
   // image checksums in the oat_file_assistant_tests.
   std::string GetImageLocation2() const {
-    return GetImageDirectory() + "/core-npic.art";
+    return GetImageDirectory() + "/core-interpreter.art";
   }
 
   std::string GetDexSrc1() const {
diff --git a/runtime/dex_cache_resolved_classes.h b/runtime/dex_cache_resolved_classes.h
index f53ca4a..bebdf0d 100644
--- a/runtime/dex_cache_resolved_classes.h
+++ b/runtime/dex_cache_resolved_classes.h
@@ -44,6 +44,10 @@
     return dex_location_.compare(other.dex_location_);
   }
 
+  bool AddClass(dex::TypeIndex index) const {
+    return classes_.insert(index).second;
+  }
+
   template <class InputIt>
   void AddClasses(InputIt begin, InputIt end) const {
     classes_.insert(begin, end);
diff --git a/runtime/dex_file.cc b/runtime/dex_file.cc
index 7d704ad..f59420d 100644
--- a/runtime/dex_file.cc
+++ b/runtime/dex_file.cc
@@ -1274,6 +1274,16 @@
   return result;
 }
 
+uint32_t Signature::GetNumberOfParameters() const {
+  const DexFile::TypeList* params = dex_file_->GetProtoParameters(*proto_id_);
+  return (params != nullptr) ? params->Size() : 0;
+}
+
+bool Signature::IsVoid() const {
+  const char* return_type = dex_file_->GetReturnTypeDescriptor(*proto_id_);
+  return strcmp(return_type, "V") == 0;
+}
+
 bool Signature::operator==(const StringPiece& rhs) const {
   if (dex_file_ == nullptr) {
     return false;
diff --git a/runtime/dex_file.h b/runtime/dex_file.h
index 250795b..cb7f174 100644
--- a/runtime/dex_file.h
+++ b/runtime/dex_file.h
@@ -1197,6 +1197,9 @@
     return Signature();
   }
 
+  bool IsVoid() const;
+  uint32_t GetNumberOfParameters() const;
+
   bool operator==(const Signature& rhs) const;
   bool operator!=(const Signature& rhs) const {
     return !(*this == rhs);
diff --git a/runtime/dex_file_annotations.cc b/runtime/dex_file_annotations.cc
index 9504e8b..16a447b 100644
--- a/runtime/dex_file_annotations.cc
+++ b/runtime/dex_file_annotations.cc
@@ -608,7 +608,7 @@
     return nullptr;
   }
   Handle<mirror::Class> method_return(hs.NewHandle(
-      annotation_method->GetReturnType(true /* resolve */, pointer_size)));
+      annotation_method->GetReturnType(true /* resolve */)));
 
   DexFile::AnnotationValue annotation_value;
   if (!ProcessAnnotationValue(klass, annotation, &annotation_value, method_return,
@@ -948,9 +948,7 @@
   DexFile::AnnotationValue annotation_value;
   StackHandleScope<2> hs(Thread::Current());
   Handle<mirror::Class> h_klass(hs.NewHandle(klass));
-  PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
-  Handle<mirror::Class> return_type(hs.NewHandle(
-      method->GetReturnType(true /* resolve */, pointer_size)));
+  Handle<mirror::Class> return_type(hs.NewHandle(method->GetReturnType(true /* resolve */)));
   if (!ProcessAnnotationValue(h_klass, &annotation, &annotation_value, return_type,
                               DexFile::kAllObjects)) {
     return nullptr;
diff --git a/runtime/dex_file_verifier.cc b/runtime/dex_file_verifier.cc
index a3ab9fa..318123e 100644
--- a/runtime/dex_file_verifier.cc
+++ b/runtime/dex_file_verifier.cc
@@ -91,6 +91,66 @@
   return dex_file_->StringDataByIdx(idx);
 }
 
+// Try to find the name of the method with the given index. We do not want to rely on DexFile
+// infrastructure at this point, so do it all by hand. begin and header correspond to begin_ and
+// header_ of the DexFileVerifier. str will contain the pointer to the method name on success
+// (flagged by the return value), otherwise error_msg will contain an error string.
+static bool FindMethodName(uint32_t method_index,
+                           const uint8_t* begin,
+                           const DexFile::Header* header,
+                           const char** str,
+                           std::string* error_msg) {
+  if (method_index >= header->method_ids_size_) {
+    *error_msg = "Method index not available for method flags verification";
+    return false;
+  }
+  uint32_t string_idx =
+      (reinterpret_cast<const DexFile::MethodId*>(begin + header->method_ids_off_) +
+          method_index)->name_idx_.index_;
+  if (string_idx >= header->string_ids_size_) {
+    *error_msg = "String index not available for method flags verification";
+    return false;
+  }
+  uint32_t string_off =
+      (reinterpret_cast<const DexFile::StringId*>(begin + header->string_ids_off_) + string_idx)->
+          string_data_off_;
+  if (string_off >= header->file_size_) {
+    *error_msg = "String offset out of bounds for method flags verification";
+    return false;
+  }
+  const uint8_t* str_data_ptr = begin + string_off;
+  uint32_t dummy;
+  if (!DecodeUnsignedLeb128Checked(&str_data_ptr, begin + header->file_size_, &dummy)) {
+    *error_msg = "String size out of bounds for method flags verification";
+    return false;
+  }
+  *str = reinterpret_cast<const char*>(str_data_ptr);
+  return true;
+}
+
+// Gets constructor flags based on the |method_name|. Returns true if
+// method_name is either <clinit> or <init> and sets
+// |constructor_flags_by_name| appropriately. Otherwise set
+// |constructor_flags_by_name| to zero and returns whether
+// |method_name| is valid.
+bool GetConstructorFlagsForMethodName(const char* method_name,
+                                      uint32_t* constructor_flags_by_name) {
+  if (method_name[0] != '<') {
+    *constructor_flags_by_name = 0;
+    return true;
+  }
+  if (strcmp(method_name + 1, "clinit>") == 0) {
+    *constructor_flags_by_name = kAccStatic | kAccConstructor;
+    return true;
+  }
+  if (strcmp(method_name + 1, "init>") == 0) {
+    *constructor_flags_by_name = kAccConstructor;
+    return true;
+  }
+  *constructor_flags_by_name = 0;
+  return false;
+}
+
 const char* DexFileVerifier::CheckLoadStringByTypeIdx(dex::TypeIndex type_idx,
                                                       const char* error_string) {
   if (UNLIKELY(!CheckIndex(type_idx.index_, dex_file_->NumTypeIds(), error_string))) {
@@ -113,6 +173,13 @@
   return &dex_file_->GetMethodId(idx);
 }
 
+const DexFile::ProtoId* DexFileVerifier::CheckLoadProtoId(uint32_t idx, const char* err_string) {
+  if (UNLIKELY(!CheckIndex(idx, dex_file_->NumProtoIds(), err_string))) {
+    return nullptr;
+  }
+  return &dex_file_->GetProtoId(idx);
+}
+
 // Helper macro to load string and return false on error.
 #define LOAD_STRING(var, idx, error)                    \
   const char* (var) = CheckLoadStringByIdx(idx, error); \
@@ -606,12 +673,24 @@
     return false;
   }
 
-  // Check method access flags.
-  bool has_code = (code_offset != 0);
   std::string error_msg;
+  const char* method_name;
+  if (!FindMethodName(idx, begin_, header_, &method_name, &error_msg)) {
+    ErrorStringPrintf("%s", error_msg.c_str());
+    return false;
+  }
+
+  uint32_t constructor_flags_by_name = 0;
+  if (!GetConstructorFlagsForMethodName(method_name, &constructor_flags_by_name)) {
+    ErrorStringPrintf("Bad method name: %s", method_name);
+    return false;
+  }
+
+  bool has_code = (code_offset != 0);
   if (!CheckMethodAccessFlags(idx,
                               access_flags,
                               class_access_flags,
+                              constructor_flags_by_name,
                               has_code,
                               expect_direct,
                               &error_msg)) {
@@ -619,6 +698,13 @@
     return false;
   }
 
+  if (constructor_flags_by_name != 0) {
+    if (!CheckConstructorProperties(idx, constructor_flags_by_name)) {
+      DCHECK(FailureReasonIsSet());
+      return false;
+    }
+  }
+
   return true;
 }
 
@@ -2653,46 +2739,10 @@
   return true;
 }
 
-// Try to find the name of the method with the given index. We do not want to rely on DexFile
-// infrastructure at this point, so do it all by hand. begin and header correspond to begin_ and
-// header_ of the DexFileVerifier. str will contain the pointer to the method name on success
-// (flagged by the return value), otherwise error_msg will contain an error string.
-static bool FindMethodName(uint32_t method_index,
-                           const uint8_t* begin,
-                           const DexFile::Header* header,
-                           const char** str,
-                           std::string* error_msg) {
-  if (method_index >= header->method_ids_size_) {
-    *error_msg = "Method index not available for method flags verification";
-    return false;
-  }
-  uint32_t string_idx =
-      (reinterpret_cast<const DexFile::MethodId*>(begin + header->method_ids_off_) +
-          method_index)->name_idx_.index_;
-  if (string_idx >= header->string_ids_size_) {
-    *error_msg = "String index not available for method flags verification";
-    return false;
-  }
-  uint32_t string_off =
-      (reinterpret_cast<const DexFile::StringId*>(begin + header->string_ids_off_) + string_idx)->
-          string_data_off_;
-  if (string_off >= header->file_size_) {
-    *error_msg = "String offset out of bounds for method flags verification";
-    return false;
-  }
-  const uint8_t* str_data_ptr = begin + string_off;
-  uint32_t dummy;
-  if (!DecodeUnsignedLeb128Checked(&str_data_ptr, begin + header->file_size_, &dummy)) {
-    *error_msg = "String size out of bounds for method flags verification";
-    return false;
-  }
-  *str = reinterpret_cast<const char*>(str_data_ptr);
-  return true;
-}
-
 bool DexFileVerifier::CheckMethodAccessFlags(uint32_t method_index,
                                              uint32_t method_access_flags,
                                              uint32_t class_access_flags,
+                                             uint32_t constructor_flags_by_name,
                                              bool has_code,
                                              bool expect_direct,
                                              std::string* error_msg) {
@@ -2728,36 +2778,23 @@
     return false;
   }
 
-  // Try to find the name, to check for constructor properties.
-  const char* str;
-  if (!FindMethodName(method_index, begin_, header_, &str, error_msg)) {
-    return false;
-  }
-  bool is_init_by_name = false;
-  constexpr const char* kInitName = "<init>";
-  size_t str_offset = (reinterpret_cast<const uint8_t*>(str) - begin_);
-  if (header_->file_size_ - str_offset >= sizeof(kInitName)) {
-    is_init_by_name = strcmp(kInitName, str) == 0;
-  }
-  bool is_clinit_by_name = false;
-  constexpr const char* kClinitName = "<clinit>";
-  if (header_->file_size_ - str_offset >= sizeof(kClinitName)) {
-    is_clinit_by_name = strcmp(kClinitName, str) == 0;
-  }
-  bool is_constructor = is_init_by_name || is_clinit_by_name;
+  constexpr uint32_t kConstructorFlags = kAccStatic | kAccConstructor;
+  const bool is_constructor_by_name = (constructor_flags_by_name & kConstructorFlags) != 0;
+  const bool is_clinit_by_name = constructor_flags_by_name == kConstructorFlags;
 
   // Only methods named "<clinit>" or "<init>" may be marked constructor. Note: we cannot enforce
   // the reverse for backwards compatibility reasons.
-  if (((method_access_flags & kAccConstructor) != 0) && !is_constructor) {
+  if (((method_access_flags & kAccConstructor) != 0) && !is_constructor_by_name) {
     *error_msg =
         StringPrintf("Method %" PRIu32 "(%s) is marked constructor, but doesn't match name",
-                     method_index,
-                     GetMethodDescriptionOrError(begin_, header_, method_index).c_str());
+                      method_index,
+                      GetMethodDescriptionOrError(begin_, header_, method_index).c_str());
     return false;
   }
-  // Check that the static constructor (= static initializer) is named "<clinit>" and that the
-  // instance constructor is called "<init>".
-  if (is_constructor) {
+
+  if (is_constructor_by_name) {
+    // Check that the static constructor (= static initializer) is named "<clinit>" and that the
+    // instance constructor is called "<init>".
     bool is_static = (method_access_flags & kAccStatic) != 0;
     if (is_static ^ is_clinit_by_name) {
       *error_msg = StringPrintf("Constructor %" PRIu32 "(%s) is not flagged correctly wrt/ static.",
@@ -2772,9 +2809,11 @@
       }
     }
   }
+
   // Check that static and private methods, as well as constructors, are in the direct methods list,
   // and other methods in the virtual methods list.
-  bool is_direct = (method_access_flags & (kAccStatic | kAccPrivate)) != 0 || is_constructor;
+  bool is_direct = ((method_access_flags & (kAccStatic | kAccPrivate)) != 0) ||
+                   is_constructor_by_name;
   if (is_direct != expect_direct) {
     *error_msg = StringPrintf("Direct/virtual method %" PRIu32 "(%s) not in expected list %d",
                               method_index,
@@ -2783,7 +2822,6 @@
     return false;
   }
 
-
   // From here on out it is easier to mask out the bits we're supposed to ignore.
   method_access_flags &= kMethodAccessFlags;
 
@@ -2819,7 +2857,7 @@
       return false;
     }
     // Constructors must always have code.
-    if (is_constructor) {
+    if (is_constructor_by_name) {
       *error_msg = StringPrintf("Constructor %u(%s) must not be abstract or native",
                                 method_index,
                                 GetMethodDescriptionOrError(begin_, header_, method_index).c_str());
@@ -2881,7 +2919,7 @@
   }
 
   // Instance constructors must not be synchronized and a few other flags.
-  if (is_init_by_name) {
+  if (constructor_flags_by_name == kAccConstructor) {
     static constexpr uint32_t kInitAllowed =
         kAccPrivate | kAccProtected | kAccPublic | kAccStrict | kAccVarargs | kAccSynthetic;
     if ((method_access_flags & ~kInitAllowed) != 0) {
@@ -2896,4 +2934,44 @@
   return true;
 }
 
+bool DexFileVerifier::CheckConstructorProperties(
+      uint32_t method_index,
+      uint32_t constructor_flags) {
+  DCHECK(constructor_flags == kAccConstructor ||
+         constructor_flags == (kAccConstructor | kAccStatic));
+
+  // Check signature matches expectations.
+  const DexFile::MethodId* const method_id = CheckLoadMethodId(method_index,
+                                                               "Bad <init>/<clinit> method id");
+  if (method_id == nullptr) {
+    return false;
+  }
+
+  // Check the ProtoId for the corresponding method.
+  //
+  // TODO(oth): the error message here is to satisfy the MethodId test
+  // in the DexFileVerifierTest. The test is checking that the error
+  // contains this string if the index is out of range.
+  const DexFile::ProtoId* const proto_id = CheckLoadProtoId(method_id->proto_idx_,
+                                                            "inter_method_id_item proto_idx");
+  if (proto_id == nullptr) {
+    return false;
+  }
+
+  Signature signature = dex_file_->GetMethodSignature(*method_id);
+  if (constructor_flags == (kAccStatic | kAccConstructor)) {
+    if (!signature.IsVoid() || signature.GetNumberOfParameters() != 0) {
+      ErrorStringPrintf("<clinit> must have descriptor ()V");
+      return false;
+    }
+  } else if (!signature.IsVoid()) {
+    ErrorStringPrintf("Constructor %u(%s) must be void",
+                      method_index,
+                      GetMethodDescriptionOrError(begin_, header_, method_index).c_str());
+    return false;
+  }
+
+  return true;
+}
+
 }  // namespace art
diff --git a/runtime/dex_file_verifier.h b/runtime/dex_file_verifier.h
index 0327367..ae20613 100644
--- a/runtime/dex_file_verifier.h
+++ b/runtime/dex_file_verifier.h
@@ -153,13 +153,15 @@
   const char* CheckLoadStringByIdx(dex::StringIndex idx, const char* error_fmt);
   const char* CheckLoadStringByTypeIdx(dex::TypeIndex type_idx, const char* error_fmt);
 
-  // Load a field/method Id by index. Checks whether the index is in bounds, printing the error if
-  // not. If there is an error, null is returned.
+  // Load a field/method/proto Id by index. Checks whether the index is in bounds, printing the
+  // error if not. If there is an error, null is returned.
   const DexFile::FieldId* CheckLoadFieldId(uint32_t idx, const char* error_fmt);
   const DexFile::MethodId* CheckLoadMethodId(uint32_t idx, const char* error_fmt);
+  const DexFile::ProtoId* CheckLoadProtoId(uint32_t idx, const char* error_fmt);
 
   void ErrorStringPrintf(const char* fmt, ...)
       __attribute__((__format__(__printf__, 2, 3))) COLD_ATTR;
+  bool FailureReasonIsSet() const { return failure_reason_.size() != 0; }
 
   // Retrieve class index and class access flag from the given member. index is the member index,
   // which is taken as either a field or a method index (as designated by is_field). The result,
@@ -177,15 +179,20 @@
   bool CheckFieldAccessFlags(uint32_t idx,
                              uint32_t field_access_flags,
                              uint32_t class_access_flags,
-                             std::string* error_msg);
+                             std::string* error_message);
+
   // Check validity of the given method and access flags, in the context of a class with the given
   // second access flags.
   bool CheckMethodAccessFlags(uint32_t method_index,
                               uint32_t method_access_flags,
                               uint32_t class_access_flags,
+                              uint32_t constructor_flags_by_name,
                               bool has_code,
                               bool expect_direct,
-                              std::string* error_msg);
+                              std::string* error_message);
+
+  // Check validity of given method if it's a constructor or class initializer.
+  bool CheckConstructorProperties(uint32_t method_index, uint32_t constructor_flags);
 
   const DexFile* const dex_file_;
   const uint8_t* const begin_;
diff --git a/runtime/dex_file_verifier_test.cc b/runtime/dex_file_verifier_test.cc
index f14b1d5..c56b200 100644
--- a/runtime/dex_file_verifier_test.cc
+++ b/runtime/dex_file_verifier_test.cc
@@ -632,12 +632,8 @@
       "b28552165",
       [](DexFile* dex_file) {
         OrMaskToMethodFlags(dex_file, "foo", kAccPublic | kAccProtected);
-        uint32_t method_idx;
-        FindMethodData(dex_file, "foo", &method_idx);
-        auto* method_id = const_cast<DexFile::MethodId*>(&dex_file->GetMethodId(method_idx));
-        method_id->name_idx_ = dex::StringIndex(dex_file->NumStringIds());
       },
-      "Method may have only one of public/protected/private, LMethodFlags;.(error)");
+      "Method may have only one of public/protected/private, LMethodFlags;.foo");
 }
 
 // Set of dex files for interface method tests. As it's not as easy to mutate method names, it's
@@ -1674,4 +1670,219 @@
   EXPECT_NE(error_msg.find("Bad checksum"), std::string::npos) << error_msg;
 }
 
+TEST_F(DexFileVerifierTest, BadStaticMethodName) {
+  // Generated DEX file version (037) from:
+  //
+  // .class public LBadName;
+  // .super Ljava/lang/Object;
+  //
+  // .method public static <bad_name> (II)V
+  //    .registers 2
+  //    .prologue
+  //    return-void
+  // .end method
+  //
+  // .method public constructor <init>()V
+  //     .registers 1
+  //     .prologue
+  //     .line 1
+  // invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+  //     return-void
+  // .end method
+  //
+  static const char kDexBase64[] =
+      "ZGV4CjAzNwC2NYlwyxEc/h6hv+hMeUVQPtiX6MQBcfgwAgAAcAAAAHhWNBIAAAAAAAAAAJABAAAI"
+      "AAAAcAAAAAQAAACQAAAAAgAAAKAAAAAAAAAAAAAAAAMAAAC4AAAAAQAAANAAAABAAQAA8AAAAPAA"
+      "AAD8AAAABAEAABIBAAAVAQAAIAEAADQBAAA3AQAAAwAAAAQAAAAFAAAABgAAAAYAAAADAAAAAAAA"
+      "AAcAAAADAAAAPAEAAAEAAQAAAAAAAQAAAAEAAAACAAAAAQAAAAEAAAABAAAAAgAAAAAAAAACAAAA"
+      "AAAAAIABAAAAAAAACjxiYWRfbmFtZT4ABjxpbml0PgAMQmFkTmFtZS5qYXZhAAFJAAlMQmFkTmFt"
+      "ZTsAEkxqYXZhL2xhbmcvT2JqZWN0OwABVgADVklJAAIAAAAAAAAAAAAAAAACAAAHAAEABw4AAAIA"
+      "AgAAAAAASAEAAAEAAAAOAAAAAQABAAEAAABOAQAABAAAAHAQAgAAAA4AAAACAAAJ1AIBgYAE6AIA"
+      "AA0AAAAAAAAAAQAAAAAAAAABAAAACAAAAHAAAAACAAAABAAAAJAAAAADAAAAAgAAAKAAAAAFAAAA"
+      "AwAAALgAAAAGAAAAAQAAANAAAAACIAAACAAAAPAAAAABEAAAAQAAADwBAAADEAAAAQAAAEQBAAAD"
+      "IAAAAgAAAEgBAAABIAAAAgAAAFQBAAAAIAAAAQAAAIABAAAAEAAAAQAAAJABAAA=";
+
+  size_t length;
+  std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length));
+  CHECK(dex_bytes != nullptr);
+  // Note: `dex_file` will be destroyed before `dex_bytes`.
+  std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
+  std::string error_msg;
+  EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(),
+                                       dex_file->Begin(),
+                                       dex_file->Size(),
+                                       "bad static method name",
+                                       /*verify_checksum*/ true,
+                                       &error_msg));
+}
+
+TEST_F(DexFileVerifierTest, BadVirtualMethodName) {
+  // Generated DEX file version (037) from:
+  //
+  //  .class public LBadVirtualName;
+  //  .super Ljava/lang/Object;
+  //
+  //  .method public <bad_name> (II)V
+  //     .registers 2
+  //     return-void
+  //  .end method
+  //
+  //  .method public constructor <init>()V
+  //      .registers 1
+  //      invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+  //      return-void
+  //  .end method
+  //
+  static const char kDexBase64[] =
+      "ZGV4CjAzNwDcPC8B2E7kYTZmeHX2u2IqrpWV9EXBHpE8AgAAcAAAAHhWNBIAAAAAAAAAAJwBAAAI"
+      "AAAAcAAAAAQAAACQAAAAAgAAAKAAAAAAAAAAAAAAAAMAAAC4AAAAAQAAANAAAABMAQAA8AAAAPAA"
+      "AAD8AAAABAEAABkBAAAcAQAALgEAAEIBAABFAQAAAwAAAAQAAAAFAAAABgAAAAYAAAADAAAAAAAA"
+      "AAcAAAADAAAATAEAAAEAAQAAAAAAAQAAAAEAAAACAAAAAQAAAAEAAAABAAAAAgAAAAAAAAACAAAA"
+      "AAAAAI4BAAAAAAAACjxiYWRfbmFtZT4ABjxpbml0PgATQmFkVmlydHVhbE5hbWUuamF2YQABSQAQ"
+      "TEJhZFZpcnR1YWxOYW1lOwASTGphdmEvbGFuZy9PYmplY3Q7AAFWAANWSUkAAAACAAAAAAAAAAAA"
+      "AAABAAcOAAACAAAHAAABAAEAAQAAAFgBAAAEAAAAcBACAAAADgADAAMAAAAAAF0BAAABAAAADgAA"
+      "AAEBAYGABOQCAAH8Ag0AAAAAAAAAAQAAAAAAAAABAAAACAAAAHAAAAACAAAABAAAAJAAAAADAAAA"
+      "AgAAAKAAAAAFAAAAAwAAALgAAAAGAAAAAQAAANAAAAACIAAACAAAAPAAAAABEAAAAQAAAEwBAAAD"
+      "EAAAAQAAAFQBAAADIAAAAgAAAFgBAAABIAAAAgAAAGQBAAAAIAAAAQAAAI4BAAAAEAAAAQAAAJwB"
+      "AAA=";
+
+  size_t length;
+  std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length));
+  CHECK(dex_bytes != nullptr);
+  // Note: `dex_file` will be destroyed before `dex_bytes`.
+  std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
+  std::string error_msg;
+  EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(),
+                                       dex_file->Begin(),
+                                       dex_file->Size(),
+                                       "bad virtual method name",
+                                       /*verify_checksum*/ true,
+                                       &error_msg));
+}
+
+TEST_F(DexFileVerifierTest, BadClinitSignature) {
+  // Generated DEX file version (037) from:
+  //
+  //  .class public LOneClinitBadSig;
+  //  .super Ljava/lang/Object;
+  //
+  //  .method public static constructor <clinit>(II)V
+  //     .registers 2
+  //     return-void
+  //  .end method
+  //
+  //  .method public constructor <init>()V
+  //      .registers 1
+  //      invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+  //      return-void
+  //  .end method
+  //
+  static const char kDexBase64[] =
+      "ZGV4CjAzNwBNOwTbfJmWq5eMOlxUY4EICGiEGJMVg8RAAgAAcAAAAHhWNBIAAAAAAAAAAKABAAAI"
+      "AAAAcAAAAAQAAACQAAAAAgAAAKAAAAAAAAAAAAAAAAMAAAC4AAAAAQAAANAAAABQAQAA8AAAAPAA"
+      "AAD6AAAAAgEAAAUBAAAYAQAALAEAAEIBAABFAQAAAgAAAAMAAAAEAAAABgAAAAYAAAADAAAAAAAA"
+      "AAcAAAADAAAATAEAAAEAAQAAAAAAAQAAAAEAAAACAAAAAQAAAAEAAAABAAAAAgAAAAAAAAAFAAAA"
+      "AAAAAJABAAAAAAAACDxjbGluaXQ+AAY8aW5pdD4AAUkAEUxPbmVDbGluaXRCYWRTaWc7ABJMamF2"
+      "YS9sYW5nL09iamVjdDsAFE9uZUNsaW5pdEJhZFNpZy5qYXZhAAFWAANWSUkAAAACAAAAAAAAAAAA"
+      "AAAAAgAABwABAAcOAAACAAIAAAAAAFgBAAABAAAADgAAAAEAAQABAAAAXgEAAAQAAABwEAIAAAAO"
+      "AAAAAgAAiYAE5AIBgYAE+AINAAAAAAAAAAEAAAAAAAAAAQAAAAgAAABwAAAAAgAAAAQAAACQAAAA"
+      "AwAAAAIAAACgAAAABQAAAAMAAAC4AAAABgAAAAEAAADQAAAAAiAAAAgAAADwAAAAARAAAAEAAABM"
+      "AQAAAxAAAAEAAABUAQAAAyAAAAIAAABYAQAAASAAAAIAAABkAQAAACAAAAEAAACQAQAAABAAAAEA"
+      "AACgAQAA";
+
+  size_t length;
+  std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length));
+  CHECK(dex_bytes != nullptr);
+  // Note: `dex_file` will be destroyed before `dex_bytes`.
+  std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
+  std::string error_msg;
+  EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(),
+                                       dex_file->Begin(),
+                                       dex_file->Size(),
+                                       "bad clinit signature",
+                                       /*verify_checksum*/ true,
+                                       &error_msg));
+}
+
+TEST_F(DexFileVerifierTest, BadClinitSignatureAgain) {
+  // Generated DEX file version (037) from:
+  //
+  //  .class public LOneClinitBadSigAgain;
+  //  .super Ljava/lang/Object;
+  //
+  //  .method public static constructor <clinit>()I
+  //     .registers 1
+  //     const/4 v0, 1
+  //     return v0
+  //  .end method
+  //
+  //  .method public constructor <init>()V
+  //      .registers 1
+  //      invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+  //      return-void
+  //  .end method
+  //
+  static const char kDexBase64[] =
+      "ZGV4CjAzNwBfPcPu5NVwKUqZIu/YR8xqVlVD5UzTk0gEAgAAcAAAAHhWNBIAAAAAAAAAAIgBAAAH"
+      "AAAAcAAAAAQAAACMAAAAAgAAAJwAAAAAAAAAAAAAAAMAAAC0AAAAAQAAAMwAAAAYAQAA7AAAAOwA"
+      "AAD2AAAA/gAAAAEBAAAZAQAALQEAAEgBAAACAAAAAwAAAAQAAAAGAAAAAgAAAAAAAAAAAAAABgAA"
+      "AAMAAAAAAAAAAQAAAAAAAAABAAEAAQAAAAIAAQABAAAAAQAAAAEAAAACAAAAAAAAAAUAAAAAAAAA"
+      "eAEAAAAAAAAIPGNsaW5pdD4ABjxpbml0PgABSQAWTE9uZUNsaW5pdEJhZFNpZ0FnYWluOwASTGph"
+      "dmEvbGFuZy9PYmplY3Q7ABlPbmVDbGluaXRCYWRTaWdBZ2Fpbi5qYXZhAAFWAAABAAAAAAAAAAAA"
+      "AAACAAAAEhAPAAEAAQABAAAAAAAAAAQAAABwEAIAAAAOAAAAAgAAiYAEzAIBgYAE4AIKAAAAAAAA"
+      "AAEAAAAAAAAAAQAAAAcAAABwAAAAAgAAAAQAAACMAAAAAwAAAAIAAACcAAAABQAAAAMAAAC0AAAA"
+      "BgAAAAEAAADMAAAAAiAAAAcAAADsAAAAASAAAAIAAABMAQAAACAAAAEAAAB4AQAAABAAAAEAAACI"
+      "AQAA";
+
+  size_t length;
+  std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length));
+  CHECK(dex_bytes != nullptr);
+  // Note: `dex_file` will be destroyed before `dex_bytes`.
+  std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
+  std::string error_msg;
+  EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(),
+                                       dex_file->Begin(),
+                                       dex_file->Size(),
+                                       "bad clinit signature",
+                                       /*verify_checksum*/ true,
+                                       &error_msg));
+}
+
+TEST_F(DexFileVerifierTest, BadInitSignature) {
+  // Generated DEX file version (037) from:
+  //
+  //  .class public LBadInitSig;
+  //  .super Ljava/lang/Object;
+  //
+  //  .method public constructor <init>()I
+  //      .registers 1
+  //      invoke-direct {p0}, Ljava/lang/Object;-><init>()V
+  //      const v0, 1
+  //      return v0
+  //  .end method
+  //
+  static const char kDexBase64[] =
+      "ZGV4CjAzNwCdMdeh1KoHWamF2Prq32LF39YZ78fV7q+wAQAAcAAAAHhWNBIAAAAAAAAAADQBAAAF"
+      "AAAAcAAAAAQAAACEAAAAAgAAAJQAAAAAAAAAAAAAAAIAAACsAAAAAQAAALwAAADUAAAA3AAAANwA"
+      "AADkAAAA5wAAAPUAAAAJAQAAAQAAAAIAAAADAAAABAAAAAEAAAAAAAAAAAAAAAQAAAADAAAAAAAA"
+      "AAEAAAAAAAAAAgABAAAAAAABAAAAAQAAAAIAAAAAAAAA/////wAAAAAqAQAAAAAAAAY8aW5pdD4A"
+      "AUkADExCYWRJbml0U2lnOwASTGphdmEvbGFuZy9PYmplY3Q7AAFWAAEAAQABAAAAAAAAAAcAAABw"
+      "EAEAAAAUAAEAAAAPAAAAAQAAgYAEjAIKAAAAAAAAAAEAAAAAAAAAAQAAAAUAAABwAAAAAgAAAAQA"
+      "AACEAAAAAwAAAAIAAACUAAAABQAAAAIAAACsAAAABgAAAAEAAAC8AAAAAiAAAAUAAADcAAAAASAA"
+      "AAEAAAAMAQAAACAAAAEAAAAqAQAAABAAAAEAAAA0AQAA";
+
+  size_t length;
+  std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length));
+  CHECK(dex_bytes != nullptr);
+  // Note: `dex_file` will be destroyed before `dex_bytes`.
+  std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length));
+  std::string error_msg;
+  EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(),
+                                       dex_file->Begin(),
+                                       dex_file->Size(),
+                                       "bad init signature",
+                                       /*verify_checksum*/ true,
+                                       &error_msg));
+}
+
 }  // namespace art
diff --git a/runtime/dex_instruction.cc b/runtime/dex_instruction.cc
index 7b8974f..37f3ac9 100644
--- a/runtime/dex_instruction.cc
+++ b/runtime/dex_instruction.cc
@@ -358,7 +358,7 @@
       }
       break;
     case k35c: {
-      uint32_t arg[5];
+      uint32_t arg[kMaxVarArgRegs];
       GetVarArgs(arg);
       switch (Opcode()) {
         case FILLED_NEW_ARRAY:
@@ -443,8 +443,50 @@
       }
       break;
     }
+    case k45cc: {
+      uint32_t arg[kMaxVarArgRegs];
+      GetVarArgs(arg);
+      uint32_t method_idx = VRegB_45cc();
+      uint32_t proto_idx = VRegH_45cc();
+      os << opcode << " {";
+      for (int i = 0; i < VRegA_45cc(); ++i) {
+        if (i != 0) {
+          os << ", ";
+        }
+        os << "v" << arg[i];
+      }
+      os << "}";
+      if (file != nullptr) {
+        os << ", " << file->PrettyMethod(method_idx) << ", " << file->GetShorty(proto_idx)
+           << " // ";
+      } else {
+        os << ", ";
+      }
+      os << "method@" << method_idx << ", proto@" << proto_idx;
+      break;
+    }
+    case k4rcc:
+      switch (Opcode()) {
+        case INVOKE_POLYMORPHIC_RANGE: {
+          if (file != nullptr) {
+            uint32_t method_idx = VRegB_4rcc();
+            uint32_t proto_idx = VRegH_4rcc();
+            os << opcode << ", {v" << VRegC_4rcc() << " .. v" << (VRegC_4rcc() + VRegA_4rcc())
+               << "}, " << file->PrettyMethod(method_idx) << ", " << file->GetShorty(proto_idx)
+               << " // method@" << method_idx << ", proto@" << proto_idx;
+            break;
+          }
+        }
+        FALLTHROUGH_INTENDED;
+        default: {
+          uint32_t method_idx = VRegB_4rcc();
+          uint32_t proto_idx = VRegH_4rcc();
+          os << opcode << ", {v" << VRegC_4rcc() << " .. v" << (VRegC_4rcc() + VRegA_4rcc())
+             << "}, method@" << method_idx << ", proto@" << proto_idx;
+        }
+      }
+      break;
     case k51l: os << StringPrintf("%s v%d, #%+" PRId64, opcode, VRegA_51l(), VRegB_51l()); break;
-    default: os << " unknown format (" << DumpHex(5) << ")"; break;
   }
   return os.str();
 }
diff --git a/runtime/dexopt_test.cc b/runtime/dexopt_test.cc
new file mode 100644
index 0000000..69c6151
--- /dev/null
+++ b/runtime/dexopt_test.cc
@@ -0,0 +1,236 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <string>
+#include <vector>
+
+#include <backtrace/BacktraceMap.h>
+#include <gtest/gtest.h>
+
+#include "common_runtime_test.h"
+#include "compiler_callbacks.h"
+#include "dex2oat_environment_test.h"
+#include "dexopt_test.h"
+#include "gc/space/image_space.h"
+#include "mem_map.h"
+
+namespace art {
+void DexoptTest::SetUp() {
+  ReserveImageSpace();
+  Dex2oatEnvironmentTest::SetUp();
+}
+
+void DexoptTest::PreRuntimeCreate() {
+  std::string error_msg;
+  ASSERT_TRUE(PreRelocateImage(GetImageLocation(), &error_msg)) << error_msg;
+  ASSERT_TRUE(PreRelocateImage(GetImageLocation2(), &error_msg)) << error_msg;
+  UnreserveImageSpace();
+}
+
+void DexoptTest::PostRuntimeCreate() {
+  ReserveImageSpace();
+}
+
+void DexoptTest::GenerateOatForTest(const std::string& dex_location,
+                        const std::string& oat_location,
+                        CompilerFilter::Filter filter,
+                        bool relocate,
+                        bool pic,
+                        bool with_alternate_image) {
+  std::string dalvik_cache = GetDalvikCache(GetInstructionSetString(kRuntimeISA));
+  std::string dalvik_cache_tmp = dalvik_cache + ".redirected";
+
+  if (!relocate) {
+    // Temporarily redirect the dalvik cache so dex2oat doesn't find the
+    // relocated image file.
+    ASSERT_EQ(0, rename(dalvik_cache.c_str(), dalvik_cache_tmp.c_str())) << strerror(errno);
+  }
+
+  std::vector<std::string> args;
+  args.push_back("--dex-file=" + dex_location);
+  args.push_back("--oat-file=" + oat_location);
+  args.push_back("--compiler-filter=" + CompilerFilter::NameOfFilter(filter));
+  args.push_back("--runtime-arg");
+
+  // Use -Xnorelocate regardless of the relocate argument.
+  // We control relocation by redirecting the dalvik cache when needed
+  // rather than use this flag.
+  args.push_back("-Xnorelocate");
+
+  if (pic) {
+    args.push_back("--compile-pic");
+  }
+
+  std::string image_location = GetImageLocation();
+  if (with_alternate_image) {
+    args.push_back("--boot-image=" + GetImageLocation2());
+  }
+
+  std::string error_msg;
+  ASSERT_TRUE(OatFileAssistant::Dex2Oat(args, &error_msg)) << error_msg;
+
+  if (!relocate) {
+    // Restore the dalvik cache if needed.
+    ASSERT_EQ(0, rename(dalvik_cache_tmp.c_str(), dalvik_cache.c_str())) << strerror(errno);
+  }
+
+  // Verify the odex file was generated as expected.
+  std::unique_ptr<OatFile> odex_file(OatFile::Open(oat_location.c_str(),
+                                                   oat_location.c_str(),
+                                                   nullptr,
+                                                   nullptr,
+                                                   false,
+                                                   /*low_4gb*/false,
+                                                   dex_location.c_str(),
+                                                   &error_msg));
+  ASSERT_TRUE(odex_file.get() != nullptr) << error_msg;
+  EXPECT_EQ(pic, odex_file->IsPic());
+  EXPECT_EQ(filter, odex_file->GetCompilerFilter());
+
+  std::unique_ptr<ImageHeader> image_header(
+          gc::space::ImageSpace::ReadImageHeader(image_location.c_str(),
+                                                 kRuntimeISA,
+                                                 &error_msg));
+  ASSERT_TRUE(image_header != nullptr) << error_msg;
+  const OatHeader& oat_header = odex_file->GetOatHeader();
+  uint32_t combined_checksum = OatFileAssistant::CalculateCombinedImageChecksum();
+
+  if (CompilerFilter::DependsOnImageChecksum(filter)) {
+    if (with_alternate_image) {
+      EXPECT_NE(combined_checksum, oat_header.GetImageFileLocationOatChecksum());
+    } else {
+      EXPECT_EQ(combined_checksum, oat_header.GetImageFileLocationOatChecksum());
+    }
+  }
+
+  if (!with_alternate_image) {
+    if (CompilerFilter::IsBytecodeCompilationEnabled(filter)) {
+      if (relocate) {
+        EXPECT_EQ(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
+            oat_header.GetImageFileLocationOatDataBegin());
+        EXPECT_EQ(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
+      } else {
+        EXPECT_NE(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
+            oat_header.GetImageFileLocationOatDataBegin());
+        EXPECT_NE(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
+      }
+    }
+  }
+}
+
+void DexoptTest::GenerateOdexForTest(const std::string& dex_location,
+                         const std::string& odex_location,
+                         CompilerFilter::Filter filter) {
+  GenerateOatForTest(dex_location,
+                     odex_location,
+                     filter,
+                     /*relocate*/false,
+                     /*pic*/false,
+                     /*with_alternate_image*/false);
+}
+
+void DexoptTest::GeneratePicOdexForTest(const std::string& dex_location,
+                            const std::string& odex_location,
+                            CompilerFilter::Filter filter) {
+  GenerateOatForTest(dex_location,
+                     odex_location,
+                     filter,
+                     /*relocate*/false,
+                     /*pic*/true,
+                     /*with_alternate_image*/false);
+}
+
+void DexoptTest::GenerateOatForTest(const char* dex_location,
+                        CompilerFilter::Filter filter,
+                        bool relocate,
+                        bool pic,
+                        bool with_alternate_image) {
+  std::string oat_location;
+  std::string error_msg;
+  ASSERT_TRUE(OatFileAssistant::DexLocationToOatFilename(
+        dex_location, kRuntimeISA, &oat_location, &error_msg)) << error_msg;
+  GenerateOatForTest(dex_location,
+                     oat_location,
+                     filter,
+                     relocate,
+                     pic,
+                     with_alternate_image);
+}
+
+void DexoptTest::GenerateOatForTest(const char* dex_location, CompilerFilter::Filter filter) {
+  GenerateOatForTest(dex_location,
+                     filter,
+                     /*relocate*/true,
+                     /*pic*/false,
+                     /*with_alternate_image*/false);
+}
+
+bool DexoptTest::PreRelocateImage(const std::string& image_location, std::string* error_msg) {
+  std::string image;
+  if (!GetCachedImageFile(image_location, &image, error_msg)) {
+    return false;
+  }
+
+  std::string patchoat = GetAndroidRoot();
+  patchoat += kIsDebugBuild ? "/bin/patchoatd" : "/bin/patchoat";
+
+  std::vector<std::string> argv;
+  argv.push_back(patchoat);
+  argv.push_back("--input-image-location=" + image_location);
+  argv.push_back("--output-image-file=" + image);
+  argv.push_back("--instruction-set=" + std::string(GetInstructionSetString(kRuntimeISA)));
+  argv.push_back("--base-offset-delta=0x00008000");
+  return Exec(argv, error_msg);
+}
+
+void DexoptTest::ReserveImageSpace() {
+  MemMap::Init();
+
+  // Ensure a chunk of memory is reserved for the image space.
+  // The reservation_end includes room for the main space that has to come
+  // right after the image in case of the GSS collector.
+  uintptr_t reservation_start = ART_BASE_ADDRESS;
+  uintptr_t reservation_end = ART_BASE_ADDRESS + 384 * MB;
+
+  std::unique_ptr<BacktraceMap> map(BacktraceMap::Create(getpid(), true));
+  ASSERT_TRUE(map.get() != nullptr) << "Failed to build process map";
+  for (BacktraceMap::const_iterator it = map->begin();
+      reservation_start < reservation_end && it != map->end(); ++it) {
+    ReserveImageSpaceChunk(reservation_start, std::min(it->start, reservation_end));
+    reservation_start = std::max(reservation_start, it->end);
+  }
+  ReserveImageSpaceChunk(reservation_start, reservation_end);
+}
+
+void DexoptTest::ReserveImageSpaceChunk(uintptr_t start, uintptr_t end) {
+  if (start < end) {
+    std::string error_msg;
+    image_reservation_.push_back(std::unique_ptr<MemMap>(
+        MemMap::MapAnonymous("image reservation",
+            reinterpret_cast<uint8_t*>(start), end - start,
+            PROT_NONE, false, false, &error_msg)));
+    ASSERT_TRUE(image_reservation_.back().get() != nullptr) << error_msg;
+    LOG(INFO) << "Reserved space for image " <<
+      reinterpret_cast<void*>(image_reservation_.back()->Begin()) << "-" <<
+      reinterpret_cast<void*>(image_reservation_.back()->End());
+  }
+}
+
+void DexoptTest::UnreserveImageSpace() {
+  image_reservation_.clear();
+}
+
+}  // namespace art
diff --git a/runtime/dexopt_test.h b/runtime/dexopt_test.h
new file mode 100644
index 0000000..5f0eafd
--- /dev/null
+++ b/runtime/dexopt_test.h
@@ -0,0 +1,97 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_RUNTIME_DEXOPT_TEST_H_
+#define ART_RUNTIME_DEXOPT_TEST_H_
+
+#include <string>
+#include <vector>
+
+#include "dex2oat_environment_test.h"
+
+namespace art {
+
+class DexoptTest : public Dex2oatEnvironmentTest {
+ public:
+  virtual void SetUp() OVERRIDE;
+
+  virtual void PreRuntimeCreate();
+
+  virtual void PostRuntimeCreate() OVERRIDE;
+
+  // Generate an oat file for the purposes of test.
+  // The oat file will be generated for dex_location in the given oat_location
+  // with the following configuration:
+  //   filter - controls the compilation filter
+  //   pic - whether or not the code will be PIC
+  //   relocate - if true, the oat file will be relocated with respect to the
+  //      boot image. Otherwise the oat file will not be relocated.
+  //   with_alternate_image - if true, the oat file will be generated with an
+  //      image checksum different than the current image checksum.
+  void GenerateOatForTest(const std::string& dex_location,
+                          const std::string& oat_location,
+                          CompilerFilter::Filter filter,
+                          bool relocate,
+                          bool pic,
+                          bool with_alternate_image);
+
+  // Generate a non-PIC odex file for the purposes of test.
+  // The generated odex file will be un-relocated.
+  void GenerateOdexForTest(const std::string& dex_location,
+                           const std::string& odex_location,
+                           CompilerFilter::Filter filter);
+
+  void GeneratePicOdexForTest(const std::string& dex_location,
+                              const std::string& odex_location,
+                              CompilerFilter::Filter filter);
+
+  // Generate an oat file for the given dex location in its oat location (under
+  // the dalvik cache).
+  void GenerateOatForTest(const char* dex_location,
+                          CompilerFilter::Filter filter,
+                          bool relocate,
+                          bool pic,
+                          bool with_alternate_image);
+
+  // Generate a standard oat file in the oat location.
+  void GenerateOatForTest(const char* dex_location, CompilerFilter::Filter filter);
+
+ private:
+  // Pre-Relocate the image to a known non-zero offset so we don't have to
+  // deal with the runtime randomly relocating the image by 0 and messing up
+  // the expected results of the tests.
+  bool PreRelocateImage(const std::string& image_location, std::string* error_msg);
+
+  // Reserve memory around where the image will be loaded so other memory
+  // won't conflict when it comes time to load the image.
+  // This can be called with an already loaded image to reserve the space
+  // around it.
+  void ReserveImageSpace();
+
+  // Reserve a chunk of memory for the image space in the given range.
+  // Only has effect for chunks with a positive number of bytes.
+  void ReserveImageSpaceChunk(uintptr_t start, uintptr_t end);
+
+  // Unreserve any memory reserved by ReserveImageSpace. This should be called
+  // before the image is loaded.
+  void UnreserveImageSpace();
+
+  std::vector<std::unique_ptr<MemMap>> image_reservation_;
+};
+
+}  // namespace art
+
+#endif  // ART_RUNTIME_DEXOPT_TEST_H_
diff --git a/runtime/entrypoints/entrypoint_utils-inl.h b/runtime/entrypoints/entrypoint_utils-inl.h
index 469c45c..ac0ce36 100644
--- a/runtime/entrypoints/entrypoint_utils-inl.h
+++ b/runtime/entrypoints/entrypoint_utils-inl.h
@@ -52,21 +52,19 @@
   // suspended while executing it.
   ScopedAssertNoThreadSuspension sants(__FUNCTION__);
 
+  if (inline_info.EncodesArtMethodAtDepth(encoding, inlining_depth)) {
+    return inline_info.GetArtMethodAtDepth(encoding, inlining_depth);
+  }
+
   uint32_t method_index = inline_info.GetMethodIndexAtDepth(encoding, inlining_depth);
-  InvokeType invoke_type = static_cast<InvokeType>(
-        inline_info.GetInvokeTypeAtDepth(encoding, inlining_depth));
-  ArtMethod* inlined_method = outer_method->GetDexCacheResolvedMethod(method_index,
-                                                                      kRuntimePointerSize);
-  if (!inlined_method->IsRuntimeMethod()) {
+  if (inline_info.GetDexPcAtDepth(encoding, inlining_depth) == static_cast<uint32_t>(-1)) {
+    // "charAt" special case. It is the only non-leaf method we inline across dex files.
+    ArtMethod* inlined_method = jni::DecodeArtMethod(WellKnownClasses::java_lang_String_charAt);
+    DCHECK_EQ(inlined_method->GetDexMethodIndex(), method_index);
     return inlined_method;
   }
 
-  // The method in the dex cache is the runtime method responsible for invoking
-  // the stub that will then update the dex cache. Therefore, we need to do the
-  // resolution ourselves.
-
-  // We first find the dex cache of our caller. If it is the outer method, we can directly
-  // use its dex cache. Otherwise, we also need to resolve our caller.
+  // Find which method did the call in the inlining hierarchy.
   ArtMethod* caller = outer_method;
   if (inlining_depth != 0) {
     caller = GetResolvedMethod(outer_method,
@@ -74,59 +72,41 @@
                                encoding,
                                inlining_depth - 1);
   }
-  DCHECK_EQ(caller->GetDexCache(), outer_method->GetDexCache())
-      << "Compiler only supports inlining calls within the same dex cache";
-  const DexFile* dex_file = outer_method->GetDexFile();
-  const DexFile::MethodId& method_id = dex_file->GetMethodId(method_index);
 
-  if (inline_info.GetDexPcAtDepth(encoding, inlining_depth) == static_cast<uint32_t>(-1)) {
-    // "charAt" special case. It is the only non-leaf method we inline across dex files.
-    if (kIsDebugBuild) {
-      const char* name = dex_file->StringDataByIdx(method_id.name_idx_);
-      DCHECK_EQ(std::string(name), "charAt");
-      DCHECK_EQ(std::string(dex_file->GetMethodShorty(method_id)), "CI")
-          << std::string(dex_file->GetMethodShorty(method_id));
-      DCHECK_EQ(std::string(dex_file->StringByTypeIdx(method_id.class_idx_)), "Ljava/lang/String;")
-          << std::string(dex_file->StringByTypeIdx(method_id.class_idx_));
-    }
-    mirror::Class* cls =
-        Runtime::Current()->GetClassLinker()->GetClassRoot(ClassLinker::kJavaLangString);
-    // Update the dex cache for future lookups.
-    caller->GetDexCache()->SetResolvedType(method_id.class_idx_, cls);
-    inlined_method = cls->FindVirtualMethod("charAt", "(I)C", kRuntimePointerSize);
-  } else {
-    mirror::Class* klass = caller->GetDexCache()->GetResolvedType(method_id.class_idx_);
-    DCHECK_EQ(klass->GetDexCache(), caller->GetDexCache())
-        << "Compiler only supports inlining calls within the same dex cache";
-    switch (invoke_type) {
-      case kDirect:
-      case kStatic:
-        inlined_method =
-            klass->FindDirectMethod(klass->GetDexCache(), method_index, kRuntimePointerSize);
-        break;
-      case kSuper:
-      case kVirtual:
-        inlined_method =
-            klass->FindVirtualMethod(klass->GetDexCache(), method_index, kRuntimePointerSize);
-        break;
-      default:
-        LOG(FATAL) << "Unimplemented inlined invocation type: " << invoke_type;
-        UNREACHABLE();
+  // Lookup the declaring class of the inlined method.
+  const DexFile* dex_file = caller->GetDexFile();
+  const DexFile::MethodId& method_id = dex_file->GetMethodId(method_index);
+  const char* descriptor = dex_file->StringByTypeIdx(method_id.class_idx_);
+  ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
+  Thread* self = Thread::Current();
+  mirror::ClassLoader* class_loader = caller->GetDeclaringClass()->GetClassLoader();
+  mirror::Class* klass = class_linker->LookupClass(self, descriptor, class_loader);
+  if (klass == nullptr) {
+      LOG(FATAL) << "Could not find an inlined method from an .oat file: "
+                 << "the class " << descriptor << " was not found in the class loader of "
+                 << caller->PrettyMethod() << ". "
+                 << "This must be due to playing wrongly with class loaders";
+  }
+
+  // Lookup the method.
+  const char* method_name = dex_file->GetMethodName(method_id);
+  const Signature signature = dex_file->GetMethodSignature(method_id);
+
+  ArtMethod* inlined_method =
+      klass->FindDeclaredDirectMethod(method_name, signature, kRuntimePointerSize);
+  if (inlined_method == nullptr) {
+    inlined_method = klass->FindDeclaredVirtualMethod(method_name, signature, kRuntimePointerSize);
+    if (inlined_method == nullptr) {
+      LOG(FATAL) << "Could not find an inlined method from an .oat file: "
+                 << "the class " << descriptor << " does not have "
+                 << method_name << signature << " declared. "
+                 << "This must be due to duplicate classes or playing wrongly with class loaders";
     }
   }
 
-  // Update the dex cache for future lookups. Note that for static methods, this is safe
-  // when the class is being initialized, as the entrypoint for the ArtMethod is at
-  // this point still the resolution trampoline.
-  outer_method->SetDexCacheResolvedMethod(method_index, inlined_method, kRuntimePointerSize);
   return inlined_method;
 }
 
-inline ArtMethod* GetCalleeSaveMethodCaller(Thread* self, Runtime::CalleeSaveType type) {
-  return GetCalleeSaveMethodCaller(
-      self->GetManagedStack()->GetTopQuickFrame(), type, true /* do_caller_check */);
-}
-
 ALWAYS_INLINE inline mirror::Class* CheckObjectAlloc(mirror::Class* klass,
                                                      Thread* self,
                                                      bool* slow_path)
@@ -261,10 +241,9 @@
     *slow_path = true;
     return nullptr;  // Failure
   }
-  ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
-  PointerSize pointer_size = class_linker->GetImagePointerSize();
-  mirror::Class* klass = method->GetDexCacheResolvedType<false>(type_idx, pointer_size);
+  mirror::Class* klass = method->GetDexCache()->GetResolvedType(type_idx);
   if (UNLIKELY(klass == nullptr)) {  // Not in dex cache so try to resolve
+    ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
     klass = class_linker->ResolveType(type_idx, method);
     *slow_path = true;
     if (klass == nullptr) {  // Error
@@ -314,11 +293,10 @@
                                              klass->GetComponentSizeShift(), allocator_type);
 }
 
-template <bool kAccessCheck, bool kInstrumented>
+template <bool kInstrumented>
 ALWAYS_INLINE
 inline mirror::Array* AllocArrayFromCodeResolved(mirror::Class* klass,
                                                  int32_t component_count,
-                                                 ArtMethod* method,
                                                  Thread* self,
                                                  gc::AllocatorType allocator_type) {
   DCHECK(klass != nullptr);
@@ -326,13 +304,6 @@
     ThrowNegativeArraySizeException(component_count);
     return nullptr;  // Failure
   }
-  if (kAccessCheck) {
-    mirror::Class* referrer = method->GetDeclaringClass();
-    if (UNLIKELY(!referrer->CanAccess(klass))) {
-      ThrowIllegalAccessErrorClass(referrer, klass);
-      return nullptr;  // Failure
-    }
-  }
   // No need to retry a slow-path allocation as the above code won't cause a GC or thread
   // suspension.
   return mirror::Array::Alloc<kInstrumented>(self, klass, component_count,
diff --git a/runtime/entrypoints/entrypoint_utils.cc b/runtime/entrypoints/entrypoint_utils.cc
index 5390165..25fd727 100644
--- a/runtime/entrypoints/entrypoint_utils.cc
+++ b/runtime/entrypoints/entrypoint_utils.cc
@@ -38,98 +38,13 @@
 
 namespace art {
 
-static inline mirror::Class* CheckFilledNewArrayAlloc(dex::TypeIndex type_idx,
-                                                      int32_t component_count,
-                                                      ArtMethod* referrer,
-                                                      Thread* self,
-                                                      bool access_check)
-    REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!Roles::uninterruptible_) {
-  if (UNLIKELY(component_count < 0)) {
-    ThrowNegativeArraySizeException(component_count);
-    return nullptr;  // Failure
-  }
-  ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
-  PointerSize pointer_size = class_linker->GetImagePointerSize();
-  mirror::Class* klass = referrer->GetDexCacheResolvedType<false>(type_idx, pointer_size);
-  if (UNLIKELY(klass == nullptr)) {  // Not in dex cache so try to resolve
-    klass = class_linker->ResolveType(type_idx, referrer);
-    if (klass == nullptr) {  // Error
-      DCHECK(self->IsExceptionPending());
-      return nullptr;  // Failure
-    }
-  }
-  if (UNLIKELY(klass->IsPrimitive() && !klass->IsPrimitiveInt())) {
-    if (klass->IsPrimitiveLong() || klass->IsPrimitiveDouble()) {
-      ThrowRuntimeException("Bad filled array request for type %s",
-                            klass->PrettyDescriptor().c_str());
-    } else {
-      self->ThrowNewExceptionF(
-          "Ljava/lang/InternalError;",
-          "Found type %s; filled-new-array not implemented for anything but 'int'",
-          klass->PrettyDescriptor().c_str());
-    }
-    return nullptr;  // Failure
-  }
-  if (access_check) {
-    mirror::Class* referrer_klass = referrer->GetDeclaringClass();
-    if (UNLIKELY(!referrer_klass->CanAccess(klass))) {
-      ThrowIllegalAccessErrorClass(referrer_klass, klass);
-      return nullptr;  // Failure
-    }
-  }
-  DCHECK(klass->IsArrayClass()) << klass->PrettyClass();
-  return klass;
-}
-
-// Helper function to allocate array for FILLED_NEW_ARRAY.
-mirror::Array* CheckAndAllocArrayFromCode(dex::TypeIndex type_idx,
-                                          int32_t component_count,
-                                          ArtMethod* referrer,
-                                          Thread* self,
-                                          bool access_check,
-                                          gc::AllocatorType allocator_type ATTRIBUTE_UNUSED) {
-  mirror::Class* klass = CheckFilledNewArrayAlloc(type_idx, component_count, referrer, self,
-                                                  access_check);
-  if (UNLIKELY(klass == nullptr)) {
-    return nullptr;
-  }
-  // Always go slow path for now, filled new array is not common.
-  gc::Heap* heap = Runtime::Current()->GetHeap();
-  // Use the current allocator type in case CheckFilledNewArrayAlloc caused us to suspend and then
-  // the heap switched the allocator type while we were suspended.
-  return mirror::Array::Alloc<false>(self, klass, component_count,
-                                     klass->GetComponentSizeShift(),
-                                     heap->GetCurrentAllocator());
-}
-
-// Helper function to allocate array for FILLED_NEW_ARRAY.
-mirror::Array* CheckAndAllocArrayFromCodeInstrumented(
-    dex::TypeIndex type_idx,
-    int32_t component_count,
-    ArtMethod* referrer,
-    Thread* self,
-    bool access_check,
-    gc::AllocatorType allocator_type ATTRIBUTE_UNUSED) {
-  mirror::Class* klass = CheckFilledNewArrayAlloc(type_idx, component_count, referrer, self,
-                                                  access_check);
-  if (UNLIKELY(klass == nullptr)) {
-    return nullptr;
-  }
-  gc::Heap* heap = Runtime::Current()->GetHeap();
-  // Use the current allocator type in case CheckFilledNewArrayAlloc caused us to suspend and then
-  // the heap switched the allocator type while we were suspended.
-  return mirror::Array::Alloc<true>(self, klass, component_count,
-                                    klass->GetComponentSizeShift(),
-                                    heap->GetCurrentAllocator());
-}
-
 void CheckReferenceResult(Handle<mirror::Object> o, Thread* self) {
   if (o.Get() == nullptr) {
     return;
   }
   // Make sure that the result is an instance of the type this method was expected to return.
   ArtMethod* method = self->GetCurrentMethod(nullptr);
-  mirror::Class* return_type = method->GetReturnType(true /* resolve */, kRuntimePointerSize);
+  mirror::Class* return_type = method->GetReturnType(true /* resolve */);
 
   if (!o->InstanceOf(return_type)) {
     Runtime::Current()->GetJavaVM()->JniAbortF(nullptr,
@@ -192,8 +107,7 @@
       ArtMethod* interface_method =
           soa.Decode<mirror::Method>(interface_method_jobj)->GetArtMethod();
       // This can cause thread suspension.
-      PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
-      mirror::Class* result_type = interface_method->GetReturnType(true /* resolve */, pointer_size);
+      mirror::Class* result_type = interface_method->GetReturnType(true /* resolve */);
       ObjPtr<mirror::Object> result_ref = soa.Decode<mirror::Object>(result);
       JValue result_unboxed;
       if (!UnboxPrimitiveForResult(result_ref.Ptr(), result_type, &result_unboxed)) {
@@ -261,11 +175,8 @@
   return true;
 }
 
-ArtMethod* GetCalleeSaveMethodCaller(ArtMethod** sp,
-                                     Runtime::CalleeSaveType type,
-                                     bool do_caller_check)
-    REQUIRES_SHARED(Locks::mutator_lock_) {
-  ScopedAssertNoThreadSuspension ants(__FUNCTION__);
+static inline std::pair<ArtMethod*, uintptr_t> DoGetCalleeSaveMethodOuterCallerAndPc(
+    ArtMethod** sp, Runtime::CalleeSaveType type) REQUIRES_SHARED(Locks::mutator_lock_) {
   DCHECK_EQ(*sp, Runtime::Current()->GetCalleeSaveMethod(type));
 
   const size_t callee_frame_size = GetCalleeSaveFrameSize(kRuntimeISA, type);
@@ -275,6 +186,13 @@
   uintptr_t caller_pc = *reinterpret_cast<uintptr_t*>(
       (reinterpret_cast<uint8_t*>(sp) + callee_return_pc_offset));
   ArtMethod* outer_method = *caller_sp;
+  return std::make_pair(outer_method, caller_pc);
+}
+
+static inline ArtMethod* DoGetCalleeSaveMethodCaller(ArtMethod* outer_method,
+                                                     uintptr_t caller_pc,
+                                                     bool do_caller_check)
+    REQUIRES_SHARED(Locks::mutator_lock_) {
   ArtMethod* caller = outer_method;
   if (LIKELY(caller_pc != reinterpret_cast<uintptr_t>(GetQuickInstrumentationExitPc()))) {
     if (outer_method != nullptr) {
@@ -308,8 +226,33 @@
     visitor.WalkStack();
     caller = visitor.caller;
   }
-
   return caller;
 }
 
+ArtMethod* GetCalleeSaveMethodCaller(ArtMethod** sp,
+                                     Runtime::CalleeSaveType type,
+                                     bool do_caller_check)
+    REQUIRES_SHARED(Locks::mutator_lock_) {
+  ScopedAssertNoThreadSuspension ants(__FUNCTION__);
+  auto outer_caller_and_pc = DoGetCalleeSaveMethodOuterCallerAndPc(sp, type);
+  ArtMethod* outer_method = outer_caller_and_pc.first;
+  uintptr_t caller_pc = outer_caller_and_pc.second;
+  ArtMethod* caller = DoGetCalleeSaveMethodCaller(outer_method, caller_pc, do_caller_check);
+  return caller;
+}
+
+CallerAndOuterMethod GetCalleeSaveMethodCallerAndOuterMethod(Thread* self,
+                                                             Runtime::CalleeSaveType type) {
+  CallerAndOuterMethod result;
+  ScopedAssertNoThreadSuspension ants(__FUNCTION__);
+  ArtMethod** sp = self->GetManagedStack()->GetTopQuickFrame();
+  auto outer_caller_and_pc = DoGetCalleeSaveMethodOuterCallerAndPc(sp, type);
+  result.outer_method = outer_caller_and_pc.first;
+  uintptr_t caller_pc = outer_caller_and_pc.second;
+  result.caller =
+      DoGetCalleeSaveMethodCaller(result.outer_method, caller_pc, /* do_caller_check */ true);
+  return result;
+}
+
+
 }  // namespace art
diff --git a/runtime/entrypoints/entrypoint_utils.h b/runtime/entrypoints/entrypoint_utils.h
index 4794610..6a04f20 100644
--- a/runtime/entrypoints/entrypoint_utils.h
+++ b/runtime/entrypoints/entrypoint_utils.h
@@ -93,33 +93,14 @@
     REQUIRES_SHARED(Locks::mutator_lock_)
     REQUIRES(!Roles::uninterruptible_);
 
-template <bool kAccessCheck, bool kInstrumented>
+template <bool kInstrumented>
 ALWAYS_INLINE inline mirror::Array* AllocArrayFromCodeResolved(mirror::Class* klass,
                                                                int32_t component_count,
-                                                               ArtMethod* method,
                                                                Thread* self,
                                                                gc::AllocatorType allocator_type)
     REQUIRES_SHARED(Locks::mutator_lock_)
     REQUIRES(!Roles::uninterruptible_);
 
-mirror::Array* CheckAndAllocArrayFromCode(dex::TypeIndex type_idx,
-                                          int32_t component_count,
-                                          ArtMethod* method,
-                                          Thread* self,
-                                          bool access_check,
-                                          gc::AllocatorType allocator_type)
-    REQUIRES_SHARED(Locks::mutator_lock_)
-    REQUIRES(!Roles::uninterruptible_);
-
-mirror::Array* CheckAndAllocArrayFromCodeInstrumented(dex::TypeIndex type_idx,
-                                                      int32_t component_count,
-                                                      ArtMethod* method,
-                                                      Thread* self,
-                                                      bool access_check,
-                                                      gc::AllocatorType allocator_type)
-    REQUIRES_SHARED(Locks::mutator_lock_)
-    REQUIRES(!Roles::uninterruptible_);
-
 // Type of find field operation for fast and slow case.
 enum FindFieldType {
   InstanceObjectRead,
@@ -201,7 +182,13 @@
                                      bool do_caller_check = false)
     REQUIRES_SHARED(Locks::mutator_lock_);
 
-ArtMethod* GetCalleeSaveMethodCaller(Thread* self, Runtime::CalleeSaveType type)
+struct CallerAndOuterMethod {
+  ArtMethod* caller;
+  ArtMethod* outer_method;
+};
+
+CallerAndOuterMethod GetCalleeSaveMethodCallerAndOuterMethod(Thread* self,
+                                                             Runtime::CalleeSaveType type)
     REQUIRES_SHARED(Locks::mutator_lock_);
 
 }  // namespace art
diff --git a/runtime/entrypoints/quick/quick_alloc_entrypoints.cc b/runtime/entrypoints/quick/quick_alloc_entrypoints.cc
index 2d06508..e9f09b2 100644
--- a/runtime/entrypoints/quick/quick_alloc_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_alloc_entrypoints.cc
@@ -82,72 +82,12 @@
     REQUIRES_SHARED(Locks::mutator_lock_) { \
   return artAllocObjectFromCode<true, false, instrumented_bool, allocator_type>(klass, self); \
 } \
-extern "C" mirror::Array* artAllocArrayFromCode##suffix##suffix2( \
-    uint32_t type_idx, int32_t component_count, ArtMethod* method, Thread* self) \
-    REQUIRES_SHARED(Locks::mutator_lock_) { \
-  ScopedQuickEntrypointChecks sqec(self); \
-  return AllocArrayFromCode<false, instrumented_bool>(dex::TypeIndex(type_idx), \
-                                                      component_count, \
-                                                      method, \
-                                                      self, \
-                                                      allocator_type); \
-} \
 extern "C" mirror::Array* artAllocArrayFromCodeResolved##suffix##suffix2( \
-    mirror::Class* klass, int32_t component_count, ArtMethod* method, Thread* self) \
+    mirror::Class* klass, int32_t component_count, Thread* self) \
     REQUIRES_SHARED(Locks::mutator_lock_) { \
   ScopedQuickEntrypointChecks sqec(self); \
-  return AllocArrayFromCodeResolved<false, instrumented_bool>(klass, component_count, method, self, \
-                                                              allocator_type); \
-} \
-extern "C" mirror::Array* artAllocArrayFromCodeWithAccessCheck##suffix##suffix2( \
-    uint32_t type_idx, int32_t component_count, ArtMethod* method, Thread* self) \
-    REQUIRES_SHARED(Locks::mutator_lock_) { \
-  ScopedQuickEntrypointChecks sqec(self); \
-  return AllocArrayFromCode<true, instrumented_bool>(dex::TypeIndex(type_idx), \
-                                                     component_count, \
-                                                     method, \
-                                                     self, \
-                                                     allocator_type); \
-} \
-extern "C" mirror::Array* artCheckAndAllocArrayFromCode##suffix##suffix2( \
-    uint32_t type_idx, int32_t component_count, ArtMethod* method, Thread* self) \
-    REQUIRES_SHARED(Locks::mutator_lock_) { \
-  ScopedQuickEntrypointChecks sqec(self); \
-  if (!(instrumented_bool)) { \
-    return CheckAndAllocArrayFromCode(dex::TypeIndex(type_idx), \
-                                      component_count, \
-                                      method, \
-                                      self, \
-                                      false, \
-                                      allocator_type); \
-  } else { \
-    return CheckAndAllocArrayFromCodeInstrumented(dex::TypeIndex(type_idx), \
-                                                  component_count, \
-                                                  method, \
-                                                  self, \
-                                                  false, \
-                                                  allocator_type); \
-  } \
-} \
-extern "C" mirror::Array* artCheckAndAllocArrayFromCodeWithAccessCheck##suffix##suffix2( \
-    uint32_t type_idx, int32_t component_count, ArtMethod* method, Thread* self) \
-    REQUIRES_SHARED(Locks::mutator_lock_) { \
-  ScopedQuickEntrypointChecks sqec(self); \
-  if (!(instrumented_bool)) { \
-    return CheckAndAllocArrayFromCode(dex::TypeIndex(type_idx), \
-                                      component_count, \
-                                      method, \
-                                      self, \
-                                      true, \
-                                      allocator_type); \
-  } else { \
-    return CheckAndAllocArrayFromCodeInstrumented(dex::TypeIndex(type_idx), \
-                                                  component_count, \
-                                                  method, \
-                                                  self, \
-                                                  true, \
-                                                  allocator_type); \
-  } \
+  return AllocArrayFromCodeResolved<instrumented_bool>(klass, component_count, self, \
+                                                       allocator_type); \
 } \
 extern "C" mirror::String* artAllocStringFromBytesFromCode##suffix##suffix2( \
     mirror::ByteArray* byte_array, int32_t high, int32_t offset, int32_t byte_count, \
@@ -188,9 +128,7 @@
 GENERATE_ENTRYPOINTS_FOR_ALLOCATOR(RegionTLAB, gc::kAllocatorTypeRegionTLAB)
 
 #define GENERATE_ENTRYPOINTS(suffix) \
-extern "C" void* art_quick_alloc_array##suffix(uint32_t, int32_t, ArtMethod* ref); \
-extern "C" void* art_quick_alloc_array_resolved##suffix(mirror::Class* klass, int32_t, ArtMethod* ref); \
-extern "C" void* art_quick_alloc_array_with_access_check##suffix(uint32_t, int32_t, ArtMethod* ref); \
+extern "C" void* art_quick_alloc_array_resolved##suffix(mirror::Class* klass, int32_t); \
 extern "C" void* art_quick_alloc_object_resolved##suffix(mirror::Class* klass); \
 extern "C" void* art_quick_alloc_object_initialized##suffix(mirror::Class* klass); \
 extern "C" void* art_quick_alloc_object_with_checks##suffix(mirror::Class* klass); \
@@ -200,7 +138,7 @@
 extern "C" void* art_quick_alloc_string_from_chars##suffix(int32_t, int32_t, void*); \
 extern "C" void* art_quick_alloc_string_from_string##suffix(void*); \
 extern "C" void* art_quick_alloc_array##suffix##_instrumented(uint32_t, int32_t, ArtMethod* ref); \
-extern "C" void* art_quick_alloc_array_resolved##suffix##_instrumented(mirror::Class* klass, int32_t, ArtMethod* ref); \
+extern "C" void* art_quick_alloc_array_resolved##suffix##_instrumented(mirror::Class* klass, int32_t); \
 extern "C" void* art_quick_alloc_array_with_access_check##suffix##_instrumented(uint32_t, int32_t, ArtMethod* ref); \
 extern "C" void* art_quick_alloc_object##suffix##_instrumented(uint32_t type_idx, ArtMethod* ref); \
 extern "C" void* art_quick_alloc_object_resolved##suffix##_instrumented(mirror::Class* klass); \
@@ -213,26 +151,18 @@
 extern "C" void* art_quick_alloc_string_from_string##suffix##_instrumented(void*); \
 void SetQuickAllocEntryPoints##suffix(QuickEntryPoints* qpoints, bool instrumented) { \
   if (instrumented) { \
-    qpoints->pAllocArray = art_quick_alloc_array##suffix##_instrumented; \
     qpoints->pAllocArrayResolved = art_quick_alloc_array_resolved##suffix##_instrumented; \
-    qpoints->pAllocArrayWithAccessCheck = art_quick_alloc_array_with_access_check##suffix##_instrumented; \
     qpoints->pAllocObjectResolved = art_quick_alloc_object_resolved##suffix##_instrumented; \
     qpoints->pAllocObjectInitialized = art_quick_alloc_object_initialized##suffix##_instrumented; \
     qpoints->pAllocObjectWithChecks = art_quick_alloc_object_with_checks##suffix##_instrumented; \
-    qpoints->pCheckAndAllocArray = art_quick_check_and_alloc_array##suffix##_instrumented; \
-    qpoints->pCheckAndAllocArrayWithAccessCheck = art_quick_check_and_alloc_array_with_access_check##suffix##_instrumented; \
     qpoints->pAllocStringFromBytes = art_quick_alloc_string_from_bytes##suffix##_instrumented; \
     qpoints->pAllocStringFromChars = art_quick_alloc_string_from_chars##suffix##_instrumented; \
     qpoints->pAllocStringFromString = art_quick_alloc_string_from_string##suffix##_instrumented; \
   } else { \
-    qpoints->pAllocArray = art_quick_alloc_array##suffix; \
     qpoints->pAllocArrayResolved = art_quick_alloc_array_resolved##suffix; \
-    qpoints->pAllocArrayWithAccessCheck = art_quick_alloc_array_with_access_check##suffix; \
     qpoints->pAllocObjectResolved = art_quick_alloc_object_resolved##suffix; \
     qpoints->pAllocObjectInitialized = art_quick_alloc_object_initialized##suffix; \
     qpoints->pAllocObjectWithChecks = art_quick_alloc_object_with_checks##suffix; \
-    qpoints->pCheckAndAllocArray = art_quick_check_and_alloc_array##suffix; \
-    qpoints->pCheckAndAllocArrayWithAccessCheck = art_quick_check_and_alloc_array_with_access_check##suffix; \
     qpoints->pAllocStringFromBytes = art_quick_alloc_string_from_bytes##suffix; \
     qpoints->pAllocStringFromChars = art_quick_alloc_string_from_chars##suffix; \
     qpoints->pAllocStringFromString = art_quick_alloc_string_from_string##suffix; \
diff --git a/runtime/entrypoints/quick/quick_default_externs.h b/runtime/entrypoints/quick/quick_default_externs.h
index 64030f3..2d0932a 100644
--- a/runtime/entrypoints/quick/quick_default_externs.h
+++ b/runtime/entrypoints/quick/quick_default_externs.h
@@ -109,8 +109,13 @@
 extern "C" void art_quick_invoke_interface_trampoline_with_access_check(uint32_t, void*);
 extern "C" void art_quick_invoke_static_trampoline_with_access_check(uint32_t, void*);
 extern "C" void art_quick_invoke_super_trampoline_with_access_check(uint32_t, void*);
+
 extern "C" void art_quick_invoke_virtual_trampoline_with_access_check(uint32_t, void*);
 
+// Invoke polymorphic entrypoint. Return type is dynamic and may be void, a primitive value, or
+// reference return type.
+extern "C" void art_quick_invoke_polymorphic(uint32_t, void*);
+
 // Thread entrypoints.
 extern "C" void art_quick_test_suspend();
 
diff --git a/runtime/entrypoints/quick/quick_default_init_entrypoints.h b/runtime/entrypoints/quick/quick_default_init_entrypoints.h
index 78dad94..6481b97 100644
--- a/runtime/entrypoints/quick/quick_default_init_entrypoints.h
+++ b/runtime/entrypoints/quick/quick_default_init_entrypoints.h
@@ -66,10 +66,7 @@
   qpoints->pGetObjStatic = art_quick_get_obj_static;
 
   // Array
-  qpoints->pAputObjectWithNullAndBoundCheck = art_quick_aput_obj_with_null_and_bound_check;
-  qpoints->pAputObjectWithBoundCheck = art_quick_aput_obj_with_bound_check;
   qpoints->pAputObject = art_quick_aput_obj;
-  qpoints->pHandleFillArrayData = art_quick_handle_fill_data;
 
   // JNI
   qpoints->pJniMethodStart = JniMethodStart;
@@ -106,6 +103,7 @@
       art_quick_invoke_super_trampoline_with_access_check;
   qpoints->pInvokeVirtualTrampolineWithAccessCheck =
       art_quick_invoke_virtual_trampoline_with_access_check;
+  qpoints->pInvokePolymorphic = art_quick_invoke_polymorphic;
 
   // Thread
   qpoints->pTestSuspend = art_quick_test_suspend;
diff --git a/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc b/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc
index 5dad43e..5b1b287 100644
--- a/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_dexcache_entrypoints.cc
@@ -31,22 +31,56 @@
 
 namespace art {
 
+static inline void BssWriteBarrier(ArtMethod* outer_method) REQUIRES_SHARED(Locks::mutator_lock_) {
+  // For AOT code, we need a write barrier for the class loader that holds
+  // the GC roots in the .bss.
+  const DexFile* dex_file = outer_method->GetDexFile();
+  if (dex_file != nullptr &&
+      dex_file->GetOatDexFile() != nullptr &&
+      !dex_file->GetOatDexFile()->GetOatFile()->GetBssGcRoots().empty()) {
+    mirror::ClassLoader* class_loader = outer_method->GetClassLoader();
+    if (class_loader != nullptr) {
+      DCHECK(!class_loader->GetClassTable()->InsertOatFile(dex_file->GetOatDexFile()->GetOatFile()))
+          << "Oat file with .bss GC roots was not registered in class table: "
+          << dex_file->GetOatDexFile()->GetOatFile()->GetLocation();
+      // Note that we emit the barrier before the compiled code stores the String or Class
+      // as a GC root. This is OK as there is no suspend point point in between.
+      Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader);
+    } else {
+      Runtime::Current()->GetClassLinker()->WriteBarrierForBootOatFileBssRoots(
+          dex_file->GetOatDexFile()->GetOatFile());
+    }
+  }
+}
+
 extern "C" mirror::Class* artInitializeStaticStorageFromCode(uint32_t type_idx, Thread* self)
     REQUIRES_SHARED(Locks::mutator_lock_) {
   // Called to ensure static storage base is initialized for direct static field reads and writes.
   // A class may be accessing another class' fields when it doesn't have access, as access has been
   // given by inheritance.
   ScopedQuickEntrypointChecks sqec(self);
-  auto* caller = GetCalleeSaveMethodCaller(self, Runtime::kSaveRefsOnly);
-  return ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, true, false);
+  auto caller_and_outer = GetCalleeSaveMethodCallerAndOuterMethod(self, Runtime::kSaveRefsOnly);
+  ArtMethod* caller = caller_and_outer.caller;
+  mirror::Class* result =
+      ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, true, false);
+  if (LIKELY(result != nullptr)) {
+    BssWriteBarrier(caller_and_outer.outer_method);
+  }
+  return result;
 }
 
 extern "C" mirror::Class* artInitializeTypeFromCode(uint32_t type_idx, Thread* self)
     REQUIRES_SHARED(Locks::mutator_lock_) {
   // Called when method->dex_cache_resolved_types_[] misses.
   ScopedQuickEntrypointChecks sqec(self);
-  auto* caller = GetCalleeSaveMethodCaller(self, Runtime::kSaveRefsOnly);
-  return ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, false, false);
+  auto caller_and_outer = GetCalleeSaveMethodCallerAndOuterMethod(self, Runtime::kSaveRefsOnly);
+  ArtMethod* caller = caller_and_outer.caller;
+  mirror::Class* result =
+      ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, false, false);
+  if (LIKELY(result != nullptr)) {
+    BssWriteBarrier(caller_and_outer.outer_method);
+  }
+  return result;
 }
 
 extern "C" mirror::Class* artInitializeTypeAndVerifyAccessFromCode(uint32_t type_idx, Thread* self)
@@ -54,36 +88,28 @@
   // Called when caller isn't guaranteed to have access to a type and the dex cache may be
   // unpopulated.
   ScopedQuickEntrypointChecks sqec(self);
-  auto* caller = GetCalleeSaveMethodCaller(self, Runtime::kSaveRefsOnly);
-  return ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, false, true);
+  auto caller_and_outer = GetCalleeSaveMethodCallerAndOuterMethod(self, Runtime::kSaveRefsOnly);
+  ArtMethod* caller = caller_and_outer.caller;
+  mirror::Class* result =
+      ResolveVerifyAndClinit(dex::TypeIndex(type_idx), caller, self, false, true);
+  if (LIKELY(result != nullptr)) {
+    BssWriteBarrier(caller_and_outer.outer_method);
+  }
+  return result;
 }
 
 extern "C" mirror::String* artResolveStringFromCode(int32_t string_idx, Thread* self)
     REQUIRES_SHARED(Locks::mutator_lock_) {
   ScopedQuickEntrypointChecks sqec(self);
-  auto* caller = GetCalleeSaveMethodCaller(
+  auto caller_and_outer = GetCalleeSaveMethodCallerAndOuterMethod(
       self,
       // TODO: Change art_quick_resolve_string on MIPS and MIPS64 to kSaveEverything.
       (kRuntimeISA == kMips || kRuntimeISA == kMips64) ? Runtime::kSaveRefsOnly
                                                        : Runtime::kSaveEverything);
+  ArtMethod* caller = caller_and_outer.caller;
   mirror::String* result = ResolveStringFromCode(caller, dex::StringIndex(string_idx));
   if (LIKELY(result != nullptr)) {
-    // For AOT code, we need a write barrier for the class loader that holds
-    // the GC roots in the .bss.
-    const DexFile* dex_file = caller->GetDexFile();
-    if (dex_file != nullptr &&
-        dex_file->GetOatDexFile() != nullptr &&
-        !dex_file->GetOatDexFile()->GetOatFile()->GetBssGcRoots().empty()) {
-      mirror::ClassLoader* class_loader = caller->GetDeclaringClass()->GetClassLoader();
-      DCHECK(class_loader != nullptr);  // We do not use .bss GC roots for boot image.
-      DCHECK(
-          !class_loader->GetClassTable()->InsertOatFile(dex_file->GetOatDexFile()->GetOatFile()))
-          << "Oat file with .bss GC roots was not registered in class table: "
-          << dex_file->GetOatDexFile()->GetOatFile()->GetLocation();
-      // Note that we emit the barrier before the compiled code stores the string as GC root.
-      // This is OK as there is no suspend point point in between.
-      Runtime::Current()->GetHeap()->WriteBarrierEveryFieldOf(class_loader);
-    }
+    BssWriteBarrier(caller_and_outer.outer_method);
   }
   return result;
 }
diff --git a/runtime/entrypoints/quick/quick_entrypoints_list.h b/runtime/entrypoints/quick/quick_entrypoints_list.h
index 0911aeb..22b0f92 100644
--- a/runtime/entrypoints/quick/quick_entrypoints_list.h
+++ b/runtime/entrypoints/quick/quick_entrypoints_list.h
@@ -20,14 +20,10 @@
 // All quick entrypoints. Format is name, return type, argument types.
 
 #define QUICK_ENTRYPOINT_LIST(V) \
-  V(AllocArray, void*, uint32_t, int32_t, ArtMethod*) \
-  V(AllocArrayResolved, void*, mirror::Class*, int32_t, ArtMethod*) \
-  V(AllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*) \
+  V(AllocArrayResolved, void*, mirror::Class*, int32_t) \
   V(AllocObjectResolved, void*, mirror::Class*) \
   V(AllocObjectInitialized, void*, mirror::Class*) \
   V(AllocObjectWithChecks, void*, mirror::Class*) \
-  V(CheckAndAllocArray, void*, uint32_t, int32_t, ArtMethod*) \
-  V(CheckAndAllocArrayWithAccessCheck, void*, uint32_t, int32_t, ArtMethod*) \
   V(AllocStringFromBytes, void*, void*, int32_t, int32_t, int32_t) \
   V(AllocStringFromChars, void*, int32_t, int32_t, void*) \
   V(AllocStringFromString, void*, void*) \
@@ -65,10 +61,7 @@
   V(GetObjInstance, void*, uint32_t, void*) \
   V(GetObjStatic, void*, uint32_t) \
 \
-  V(AputObjectWithNullAndBoundCheck, void, mirror::Array*, int32_t, mirror::Object*) \
-  V(AputObjectWithBoundCheck, void, mirror::Array*, int32_t, mirror::Object*) \
   V(AputObject, void, mirror::Array*, int32_t, mirror::Object*) \
-  V(HandleFillArrayData, void, void*, void*) \
 \
   V(JniMethodStart, uint32_t, Thread*) \
   V(JniMethodFastStart, uint32_t, Thread*) \
@@ -133,6 +126,7 @@
   V(InvokeStaticTrampolineWithAccessCheck, void, uint32_t, void*) \
   V(InvokeSuperTrampolineWithAccessCheck, void, uint32_t, void*) \
   V(InvokeVirtualTrampolineWithAccessCheck, void, uint32_t, void*) \
+  V(InvokePolymorphic, void, uint32_t, void*) \
 \
   V(TestSuspend, void, void) \
 \
diff --git a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
index a3e5b55..eb76fb6 100644
--- a/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
+++ b/runtime/entrypoints/quick/quick_trampoline_entrypoints.cc
@@ -27,10 +27,12 @@
 #include "imtable-inl.h"
 #include "interpreter/interpreter.h"
 #include "linear_alloc.h"
+#include "method_handles.h"
 #include "method_reference.h"
 #include "mirror/class-inl.h"
 #include "mirror/dex_cache-inl.h"
 #include "mirror/method.h"
+#include "mirror/method_handle_impl.h"
 #include "mirror/object-inl.h"
 #include "mirror/object_array-inl.h"
 #include "oat_quick_method_header.h"
@@ -39,6 +41,7 @@
 #include "scoped_thread_state_change-inl.h"
 #include "stack.h"
 #include "debugger.h"
+#include "well_known_classes.h"
 
 namespace art {
 
@@ -2391,4 +2394,121 @@
                                 reinterpret_cast<uintptr_t>(method));
 }
 
+// Returns shorty type so the caller can determine how to put |result|
+// into expected registers. The shorty type is static so the compiler
+// could call different flavors of this code path depending on the
+// shorty type though this would require different entry points for
+// each type.
+extern "C" uintptr_t artInvokePolymorphic(
+    JValue* result,
+    mirror::Object* raw_method_handle,
+    Thread* self,
+    ArtMethod** sp)
+    REQUIRES_SHARED(Locks::mutator_lock_) {
+  ScopedQuickEntrypointChecks sqec(self);
+  DCHECK_EQ(*sp, Runtime::Current()->GetCalleeSaveMethod(Runtime::kSaveRefsAndArgs));
+
+  // Start new JNI local reference state
+  JNIEnvExt* env = self->GetJniEnv();
+  ScopedObjectAccessUnchecked soa(env);
+  ScopedJniEnvLocalRefState env_state(env);
+  const char* old_cause = self->StartAssertNoThreadSuspension("Making stack arguments safe.");
+
+  // From the instruction, get the |callsite_shorty| and expose arguments on the stack to the GC.
+  ArtMethod* caller_method = QuickArgumentVisitor::GetCallingMethod(sp);
+  uint32_t dex_pc = QuickArgumentVisitor::GetCallingDexPc(sp);
+  const DexFile::CodeItem* code = caller_method->GetCodeItem();
+  const Instruction* inst = Instruction::At(&code->insns_[dex_pc]);
+  DCHECK(inst->Opcode() == Instruction::INVOKE_POLYMORPHIC ||
+         inst->Opcode() == Instruction::INVOKE_POLYMORPHIC_RANGE);
+  const DexFile* dex_file = caller_method->GetDexFile();
+  const uint32_t proto_idx = inst->VRegH();
+  const char* shorty = dex_file->GetShorty(proto_idx);
+  const size_t shorty_length = strlen(shorty);
+  static const bool kMethodIsStatic = false;  // invoke() and invokeExact() are not static.
+  RememberForGcArgumentVisitor gc_visitor(sp, kMethodIsStatic, shorty, shorty_length, &soa);
+  gc_visitor.VisitArguments();
+
+  // Wrap raw_method_handle in a Handle for safety.
+  StackHandleScope<5> hs(self);
+  Handle<mirror::MethodHandleImpl> method_handle(
+      hs.NewHandle(ObjPtr<mirror::MethodHandleImpl>::DownCast(MakeObjPtr(raw_method_handle))));
+  raw_method_handle = nullptr;
+  self->EndAssertNoThreadSuspension(old_cause);
+
+  // Resolve method - it's either MethodHandle.invoke() or MethodHandle.invokeExact().
+  ClassLinker* linker = Runtime::Current()->GetClassLinker();
+  ArtMethod* resolved_method = linker->ResolveMethod<ClassLinker::kForceICCECheck>(self,
+                                                                                   inst->VRegB(),
+                                                                                   caller_method,
+                                                                                   kVirtual);
+  DCHECK((resolved_method ==
+          jni::DecodeArtMethod(WellKnownClasses::java_lang_invoke_MethodHandle_invokeExact)) ||
+         (resolved_method ==
+          jni::DecodeArtMethod(WellKnownClasses::java_lang_invoke_MethodHandle_invoke)));
+  if (UNLIKELY(method_handle.IsNull())) {
+    ThrowNullPointerExceptionForMethodAccess(resolved_method, InvokeType::kVirtual);
+    return static_cast<uintptr_t>('V');
+  }
+
+  Handle<mirror::Class> caller_class(hs.NewHandle(caller_method->GetDeclaringClass()));
+  Handle<mirror::MethodType> method_type(hs.NewHandle(linker->ResolveMethodType(
+      *dex_file, proto_idx,
+      hs.NewHandle<mirror::DexCache>(caller_class->GetDexCache()),
+      hs.NewHandle<mirror::ClassLoader>(caller_class->GetClassLoader()))));
+  // This implies we couldn't resolve one or more types in this method handle.
+  if (UNLIKELY(method_type.IsNull())) {
+    CHECK(self->IsExceptionPending());
+    return static_cast<uintptr_t>('V');
+  }
+
+  DCHECK_EQ(ArtMethod::NumArgRegisters(shorty) + 1u, (uint32_t)inst->VRegA());
+  DCHECK_EQ(resolved_method->IsStatic(), kMethodIsStatic);
+
+  // Fix references before constructing the shadow frame.
+  gc_visitor.FixupReferences();
+
+  // Construct shadow frame placing arguments consecutively from |first_arg|.
+  const bool is_range = (inst->Opcode() == Instruction::INVOKE_POLYMORPHIC_RANGE);
+  const size_t num_vregs = is_range ? inst->VRegA_4rcc() : inst->VRegA_45cc();
+  const size_t first_arg = 0;
+  ShadowFrameAllocaUniquePtr shadow_frame_unique_ptr =
+      CREATE_SHADOW_FRAME(num_vregs, /* link */ nullptr, resolved_method, dex_pc);
+  ShadowFrame* shadow_frame = shadow_frame_unique_ptr.get();
+  ScopedStackedShadowFramePusher
+      frame_pusher(self, shadow_frame, StackedShadowFrameType::kShadowFrameUnderConstruction);
+  BuildQuickShadowFrameVisitor shadow_frame_builder(sp,
+                                                    kMethodIsStatic,
+                                                    shorty,
+                                                    strlen(shorty),
+                                                    shadow_frame,
+                                                    first_arg);
+  shadow_frame_builder.VisitArguments();
+
+  // Push a transition back into managed code onto the linked list in thread.
+  ManagedStack fragment;
+  self->PushManagedStackFragment(&fragment);
+
+  // Call DoInvokePolymorphic with |is_range| = true, as shadow frame has argument registers in
+  // consecutive order.
+  uint32_t unused_args[Instruction::kMaxVarArgRegs] = {};
+  uint32_t first_callee_arg = first_arg + 1;
+  const bool do_assignability_check = false;
+  if (!DoInvokePolymorphic<true /* is_range */, do_assignability_check>(self,
+                                                                        resolved_method,
+                                                                        *shadow_frame,
+                                                                        method_handle,
+                                                                        method_type,
+                                                                        unused_args,
+                                                                        first_callee_arg,
+                                                                        result)) {
+    DCHECK(self->IsExceptionPending());
+  }
+
+  // Pop transition record.
+  self->PopManagedStackFragment(fragment);
+
+  return static_cast<uintptr_t>(shorty[0]);
+}
+
 }  // namespace art
diff --git a/runtime/entrypoints_order_test.cc b/runtime/entrypoints_order_test.cc
index 6866abb..8e84d76 100644
--- a/runtime/entrypoints_order_test.cc
+++ b/runtime/entrypoints_order_test.cc
@@ -117,15 +117,14 @@
                         sizeof(void*));
     EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, checkpoint_function, active_suspend_barriers,
                         sizeof(void*));
-    EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, active_suspend_barriers, jni_entrypoints,
+    EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, active_suspend_barriers, thread_local_start,
                         sizeof(Thread::tls_ptr_sized_values::active_suspend_barriers));
-
-    // Skip across the entrypoints structures.
-
     EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, thread_local_start, thread_local_pos, sizeof(void*));
     EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, thread_local_pos, thread_local_end, sizeof(void*));
     EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, thread_local_end, thread_local_objects, sizeof(void*));
-    EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, thread_local_objects, mterp_current_ibase, sizeof(size_t));
+    EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, thread_local_objects, jni_entrypoints, sizeof(size_t));
+
+    // Skip across the entrypoints structures.
     EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, mterp_current_ibase, mterp_default_ibase, sizeof(void*));
     EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, mterp_default_ibase, mterp_alt_ibase, sizeof(void*));
     EXPECT_OFFSET_DIFFP(Thread, tlsPtr_, mterp_alt_ibase, rosalloc_runs, sizeof(void*));
@@ -151,23 +150,16 @@
   }
 
   void CheckQuickEntryPoints() {
-    CHECKED(OFFSETOF_MEMBER(QuickEntryPoints, pAllocArray) == 0,
-                QuickEntryPoints_start_with_allocarray);
-    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocArray, pAllocArrayResolved, sizeof(void*));
-    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocArrayResolved, pAllocArrayWithAccessCheck,
-                         sizeof(void*));
-    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocArrayWithAccessCheck, pAllocObjectResolved,
+    CHECKED(OFFSETOF_MEMBER(QuickEntryPoints, pAllocArrayResolved) == 0,
+            QuickEntryPoints_start_with_allocarray_resoved);
+    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocArrayResolved, pAllocObjectResolved,
                          sizeof(void*));
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocObjectResolved, pAllocObjectInitialized,
                          sizeof(void*));
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocObjectInitialized, pAllocObjectWithChecks,
                          sizeof(void*));
-    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocObjectWithChecks, pCheckAndAllocArray,
+    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocObjectWithChecks, pAllocStringFromBytes,
                          sizeof(void*));
-    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pCheckAndAllocArray, pCheckAndAllocArrayWithAccessCheck,
-                         sizeof(void*));
-    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pCheckAndAllocArrayWithAccessCheck,
-                         pAllocStringFromBytes, sizeof(void*));
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocStringFromBytes, pAllocStringFromChars,
                          sizeof(void*));
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAllocStringFromChars, pAllocStringFromString,
@@ -206,13 +198,8 @@
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pGet64Instance, pGet64Static, sizeof(void*));
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pGet64Static, pGetObjInstance, sizeof(void*));
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pGetObjInstance, pGetObjStatic, sizeof(void*));
-    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pGetObjStatic, pAputObjectWithNullAndBoundCheck,
-                         sizeof(void*));
-    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAputObjectWithNullAndBoundCheck,
-                         pAputObjectWithBoundCheck, sizeof(void*));
-    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAputObjectWithBoundCheck, pAputObject, sizeof(void*));
-    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAputObject, pHandleFillArrayData, sizeof(void*));
-    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pHandleFillArrayData, pJniMethodStart, sizeof(void*));
+    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pGetObjStatic, pAputObject, sizeof(void*));
+    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pAputObject, pJniMethodStart, sizeof(void*));
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pJniMethodStart, pJniMethodFastStart,
                          sizeof(void*));
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pJniMethodFastStart, pJniMethodStartSynchronized,
@@ -286,6 +273,8 @@
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pInvokeSuperTrampolineWithAccessCheck,
                          pInvokeVirtualTrampolineWithAccessCheck, sizeof(void*));
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pInvokeVirtualTrampolineWithAccessCheck,
+                         pInvokePolymorphic, sizeof(void*));
+    EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pInvokePolymorphic,
                          pTestSuspend, sizeof(void*));
     EXPECT_OFFSET_DIFFNP(QuickEntryPoints, pTestSuspend, pDeliverException, sizeof(void*));
 
diff --git a/runtime/experimental_flags.h b/runtime/experimental_flags.h
index 5ddb9fa..0471c96 100644
--- a/runtime/experimental_flags.h
+++ b/runtime/experimental_flags.h
@@ -26,8 +26,6 @@
   // The actual flag values.
   enum {
     kNone           = 0x0000,
-    kAgents         = 0x0001,  // 0b00000001
-    kRuntimePlugins = 0x0002,  // 0b00000010
     kMethodHandles  = 0x0004,  // 0b00000100
   };
 
@@ -67,14 +65,6 @@
 
 inline std::ostream& operator<<(std::ostream& stream, const ExperimentalFlags& e) {
   bool started = false;
-  if (e & ExperimentalFlags::kAgents) {
-    stream << (started ? "|" : "") << "kAgents";
-    started = true;
-  }
-  if (e & ExperimentalFlags::kRuntimePlugins) {
-    stream << (started ? "|" : "") << "kRuntimePlugins";
-    started = true;
-  }
   if (e & ExperimentalFlags::kMethodHandles) {
     stream << (started ? "|" : "") << "kMethodHandles";
     started = true;
diff --git a/runtime/gc/collector/concurrent_copying.cc b/runtime/gc/collector/concurrent_copying.cc
index 7b86339..6044053 100644
--- a/runtime/gc/collector/concurrent_copying.cc
+++ b/runtime/gc/collector/concurrent_copying.cc
@@ -846,7 +846,7 @@
         // Some threads in 'runnable_thread_ids' are probably stuck. Try to dump their stacks.
         // Avoid using ThreadList::Dump() initially because it is likely to get stuck as well.
         {
-          ReaderMutexLock mu0(self, *Locks::mutator_lock_);
+          ScopedObjectAccess soa(self);
           MutexLock mu1(self, *Locks::thread_list_lock_);
           for (Thread* thread : thread_list->GetList()) {
             uint32_t tid = thread->GetThreadId();
diff --git a/runtime/gc/heap.cc b/runtime/gc/heap.cc
index 34d8284..7044979 100644
--- a/runtime/gc/heap.cc
+++ b/runtime/gc/heap.cc
@@ -360,7 +360,7 @@
     // If we are the zygote, the non moving space becomes the zygote space when we run
     // PreZygoteFork the first time. In this case, call the map "zygote space" since we can't
     // rename the mem map later.
-    const char* space_name = is_zygote ? kZygoteSpaceName: kNonMovingSpaceName;
+    const char* space_name = is_zygote ? kZygoteSpaceName : kNonMovingSpaceName;
     // Reserve the non moving mem map before the other two since it needs to be at a specific
     // address.
     non_moving_space_mem_map.reset(
@@ -3543,8 +3543,11 @@
   collector::GcType gc_type = collector_ran->GetGcType();
   const double multiplier = HeapGrowthMultiplier();  // Use the multiplier to grow more for
   // foreground.
-  const uint64_t adjusted_min_free = static_cast<uint64_t>(min_free_ * multiplier);
-  const uint64_t adjusted_max_free = static_cast<uint64_t>(max_free_ * multiplier);
+  // Ensure at least 2.5 MB to temporarily fix excessive GC caused by TLAB ergonomics.
+  const uint64_t adjusted_min_free = std::max(static_cast<uint64_t>(min_free_ * multiplier),
+                                              static_cast<uint64_t>(5 * MB / 2));
+  const uint64_t adjusted_max_free = std::max(static_cast<uint64_t>(max_free_ * multiplier),
+                                              static_cast<uint64_t>(5 * MB / 2));
   if (gc_type != collector::kGcTypeSticky) {
     // Grow the heap for non sticky GC.
     ssize_t delta = bytes_allocated / GetTargetHeapUtilization() - bytes_allocated;
diff --git a/runtime/gc/reference_processor.h b/runtime/gc/reference_processor.h
index b15544d..38b68cb 100644
--- a/runtime/gc/reference_processor.h
+++ b/runtime/gc/reference_processor.h
@@ -42,7 +42,7 @@
 
 class Heap;
 
-// Used to process java.lang.References concurrently or paused.
+// Used to process java.lang.ref.Reference instances concurrently or paused.
 class ReferenceProcessor {
  public:
   explicit ReferenceProcessor();
diff --git a/runtime/gc/scoped_gc_critical_section.h b/runtime/gc/scoped_gc_critical_section.h
index ec93bca..1271ff7 100644
--- a/runtime/gc/scoped_gc_critical_section.h
+++ b/runtime/gc/scoped_gc_critical_section.h
@@ -27,8 +27,8 @@
 
 namespace gc {
 
-// Wait until the GC is finished and then prevent GC from starting until the destructor. Used
-// to prevent deadlocks in places where we call ClassLinker::VisitClass with all th threads
+// Wait until the GC is finished and then prevent the GC from starting until the destructor. Used
+// to prevent deadlocks in places where we call ClassLinker::VisitClass with all the threads
 // suspended.
 class ScopedGCCriticalSection {
  public:
diff --git a/runtime/gc/space/large_object_space.cc b/runtime/gc/space/large_object_space.cc
index e71a397..4c6b5bf 100644
--- a/runtime/gc/space/large_object_space.cc
+++ b/runtime/gc/space/large_object_space.cc
@@ -141,16 +141,6 @@
     return nullptr;
   }
   mirror::Object* const obj = reinterpret_cast<mirror::Object*>(mem_map->Begin());
-  if (kIsDebugBuild) {
-    ReaderMutexLock mu2(Thread::Current(), *Locks::heap_bitmap_lock_);
-    auto* heap = Runtime::Current()->GetHeap();
-    auto* live_bitmap = heap->GetLiveBitmap();
-    auto* space_bitmap = live_bitmap->GetContinuousSpaceBitmap(obj);
-    CHECK(space_bitmap == nullptr) << obj << " overlaps with bitmap " << *space_bitmap;
-    auto* obj_end = reinterpret_cast<mirror::Object*>(mem_map->End());
-    space_bitmap = live_bitmap->GetContinuousSpaceBitmap(obj_end - 1);
-    CHECK(space_bitmap == nullptr) << obj_end << " overlaps with bitmap " << *space_bitmap;
-  }
   MutexLock mu(self, lock_);
   large_objects_.Put(obj, LargeObject {mem_map, false /* not zygote */});
   const size_t allocation_size = mem_map->BaseSize();
diff --git a/runtime/generated/asm_support_gen.h b/runtime/generated/asm_support_gen.h
index bebcd71..af57397 100644
--- a/runtime/generated/asm_support_gen.h
+++ b/runtime/generated/asm_support_gen.h
@@ -60,17 +60,13 @@
 DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_DEX_CACHE_METHODS_OFFSET_32), (static_cast<int32_t>(art::ArtMethod:: DexCacheResolvedMethodsOffset(art::PointerSize::k32).Int32Value())))
 #define ART_METHOD_DEX_CACHE_METHODS_OFFSET_64 24
 DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_DEX_CACHE_METHODS_OFFSET_64), (static_cast<int32_t>(art::ArtMethod:: DexCacheResolvedMethodsOffset(art::PointerSize::k64).Int32Value())))
-#define ART_METHOD_DEX_CACHE_TYPES_OFFSET_32 24
-DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_DEX_CACHE_TYPES_OFFSET_32), (static_cast<int32_t>(art::ArtMethod:: DexCacheResolvedTypesOffset(art::PointerSize::k32).Int32Value())))
-#define ART_METHOD_DEX_CACHE_TYPES_OFFSET_64 32
-DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_DEX_CACHE_TYPES_OFFSET_64), (static_cast<int32_t>(art::ArtMethod:: DexCacheResolvedTypesOffset(art::PointerSize::k64).Int32Value())))
-#define ART_METHOD_JNI_OFFSET_32 28
+#define ART_METHOD_JNI_OFFSET_32 24
 DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_JNI_OFFSET_32), (static_cast<int32_t>(art::ArtMethod:: EntryPointFromJniOffset(art::PointerSize::k32).Int32Value())))
-#define ART_METHOD_JNI_OFFSET_64 40
+#define ART_METHOD_JNI_OFFSET_64 32
 DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_JNI_OFFSET_64), (static_cast<int32_t>(art::ArtMethod:: EntryPointFromJniOffset(art::PointerSize::k64).Int32Value())))
-#define ART_METHOD_QUICK_CODE_OFFSET_32 32
+#define ART_METHOD_QUICK_CODE_OFFSET_32 28
 DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_QUICK_CODE_OFFSET_32), (static_cast<int32_t>(art::ArtMethod:: EntryPointFromQuickCompiledCodeOffset(art::PointerSize::k32).Int32Value())))
-#define ART_METHOD_QUICK_CODE_OFFSET_64 48
+#define ART_METHOD_QUICK_CODE_OFFSET_64 40
 DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_QUICK_CODE_OFFSET_64), (static_cast<int32_t>(art::ArtMethod:: EntryPointFromQuickCompiledCodeOffset(art::PointerSize::k64).Int32Value())))
 #define ART_METHOD_DECLARING_CLASS_OFFSET 0
 DEFINE_CHECK_EQ(static_cast<int32_t>(ART_METHOD_DECLARING_CLASS_OFFSET), (static_cast<int32_t>(art::ArtMethod:: DeclaringClassOffset().Int32Value())))
diff --git a/runtime/hprof/hprof.cc b/runtime/hprof/hprof.cc
index fe6a6e9..3d3ad59 100644
--- a/runtime/hprof/hprof.cc
+++ b/runtime/hprof/hprof.cc
@@ -1169,7 +1169,7 @@
 }
 
 void Hprof::DumpHeapClass(mirror::Class* klass) {
-  if (!klass->IsResolved() && !klass->IsErroneous()) {
+  if (!klass->IsResolved()) {
     // Class is allocated but not yet resolved: we cannot access its fields or super class.
     return;
   }
diff --git a/runtime/image.cc b/runtime/image.cc
index 2ef60c3..54b099e 100644
--- a/runtime/image.cc
+++ b/runtime/image.cc
@@ -25,7 +25,7 @@
 namespace art {
 
 const uint8_t ImageHeader::kImageMagic[] = { 'a', 'r', 't', '\n' };
-const uint8_t ImageHeader::kImageVersion[] = { '0', '3', '4', '\0' };  // mirror::Class update
+const uint8_t ImageHeader::kImageVersion[] = { '0', '3', '6', '\0' };  // Erroneous resolved class.
 
 ImageHeader::ImageHeader(uint32_t image_begin,
                          uint32_t image_size,
diff --git a/runtime/instrumentation.cc b/runtime/instrumentation.cc
index 4ea1130..bbd6d35 100644
--- a/runtime/instrumentation.cc
+++ b/runtime/instrumentation.cc
@@ -88,11 +88,11 @@
 }
 
 void Instrumentation::InstallStubsForClass(mirror::Class* klass) {
-  if (klass->IsErroneous()) {
-    // We can't execute code in a erroneous class: do nothing.
-  } else if (!klass->IsResolved()) {
+  if (!klass->IsResolved()) {
     // We need the class to be resolved to install/uninstall stubs. Otherwise its methods
     // could not be initialized or linked with regards to class inheritance.
+  } else if (klass->IsErroneousResolved()) {
+    // We can't execute code in a erroneous class: do nothing.
   } else {
     for (ArtMethod& method : klass->GetMethods(kRuntimePointerSize)) {
       InstallStubsForMethod(&method);
diff --git a/runtime/interpreter/interpreter_common.cc b/runtime/interpreter/interpreter_common.cc
index ca26207..28bcb97 100644
--- a/runtime/interpreter/interpreter_common.cc
+++ b/runtime/interpreter/interpreter_common.cc
@@ -596,7 +596,7 @@
     // Get the register arguments for the invoke.
     inst->GetVarArgs(args, inst_data);
     // Drop the first register which is the method handle performing the invoke.
-    memcpy(args, args + 1, sizeof(args[0]) * (Instruction::kMaxVarArgRegs - 1));
+    memmove(args, args + 1, sizeof(args[0]) * (Instruction::kMaxVarArgRegs - 1));
     args[Instruction::kMaxVarArgRegs - 1] = 0;
     return DoInvokePolymorphic<is_range, do_access_check>(self,
                                                           invoke_method,
@@ -751,16 +751,14 @@
         case 'L': {
           ObjPtr<mirror::Object> o = shadow_frame.GetVRegReference(src_reg);
           if (do_assignability_check && o != nullptr) {
-            PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
             const dex::TypeIndex type_idx = params->GetTypeItem(shorty_pos).type_idx_;
-            ObjPtr<mirror::Class> arg_type = method->GetDexCacheResolvedType(type_idx,
-                                                                             pointer_size);
+            ObjPtr<mirror::Class> arg_type = method->GetDexCache()->GetResolvedType(type_idx);
             if (arg_type == nullptr) {
               StackHandleScope<1> hs(self);
               // Preserve o since it is used below and GetClassFromTypeIndex may cause thread
               // suspension.
               HandleWrapperObjPtr<mirror::Object> h = hs.NewHandleWrapper(&o);
-              arg_type = method->GetClassFromTypeIndex(type_idx, true /* resolve */, pointer_size);
+              arg_type = method->GetClassFromTypeIndex(type_idx, true /* resolve */);
               if (arg_type == nullptr) {
                 CHECK(self->IsExceptionPending());
                 return false;
diff --git a/runtime/interpreter/interpreter_switch_impl.cc b/runtime/interpreter/interpreter_switch_impl.cc
index d7dfcd4..a77a3fc 100644
--- a/runtime/interpreter/interpreter_switch_impl.cc
+++ b/runtime/interpreter/interpreter_switch_impl.cc
@@ -285,9 +285,7 @@
         const size_t ref_idx = inst->VRegA_11x(inst_data);
         ObjPtr<mirror::Object> obj_result = shadow_frame.GetVRegReference(ref_idx);
         if (do_assignability_check && obj_result != nullptr) {
-          PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
-          ObjPtr<mirror::Class> return_type = method->GetReturnType(true /* resolve */,
-                                                                    pointer_size);
+          ObjPtr<mirror::Class> return_type = method->GetReturnType(true /* resolve */);
           // Re-load since it might have moved.
           obj_result = shadow_frame.GetVRegReference(ref_idx);
           if (return_type == nullptr) {
diff --git a/runtime/interpreter/mterp/arm64/op_iput_wide_quick.S b/runtime/interpreter/mterp/arm64/op_iput_wide_quick.S
index 6cec363..28e831a 100644
--- a/runtime/interpreter/mterp/arm64/op_iput_wide_quick.S
+++ b/runtime/interpreter/mterp/arm64/op_iput_wide_quick.S
@@ -4,7 +4,7 @@
     GET_VREG w2, w2                     // w2<- fp[B], the object pointer
     ubfx    w0, wINST, #8, #4           // w0<- A
     cbz     w2, common_errNullObject    // object was null
-    GET_VREG_WIDE x0, w0                // x0-< fp[A]
+    GET_VREG_WIDE x0, w0                // x0<- fp[A]
     FETCH_ADVANCE_INST 2                // advance rPC, load wINST
     str     x0, [x2, x3]                // obj.field<- x0
     GET_INST_OPCODE ip                  // extract opcode from wINST
diff --git a/runtime/interpreter/mterp/out/mterp_arm64.S b/runtime/interpreter/mterp/out/mterp_arm64.S
index 681790d..7d442c0 100644
--- a/runtime/interpreter/mterp/out/mterp_arm64.S
+++ b/runtime/interpreter/mterp/out/mterp_arm64.S
@@ -6593,7 +6593,7 @@
     GET_VREG w2, w2                     // w2<- fp[B], the object pointer
     ubfx    w0, wINST, #8, #4           // w0<- A
     cbz     w2, common_errNullObject    // object was null
-    GET_VREG_WIDE x0, w0                // x0-< fp[A]
+    GET_VREG_WIDE x0, w0                // x0<- fp[A]
     FETCH_ADVANCE_INST 2                // advance rPC, load wINST
     str     x0, [x2, x3]                // obj.field<- x0
     GET_INST_OPCODE ip                  // extract opcode from wINST
diff --git a/runtime/interpreter/unstarted_runtime.cc b/runtime/interpreter/unstarted_runtime.cc
index 7dd3d3d..feb6e08 100644
--- a/runtime/interpreter/unstarted_runtime.cc
+++ b/runtime/interpreter/unstarted_runtime.cc
@@ -1443,7 +1443,7 @@
 
   ObjPtr<mirror::Object> java_method_obj = shadow_frame->GetVRegReference(arg_offset);
   ScopedLocalRef<jobject> java_method(env,
-      java_method_obj == nullptr ? nullptr :env->AddLocalReference<jobject>(java_method_obj));
+      java_method_obj == nullptr ? nullptr : env->AddLocalReference<jobject>(java_method_obj));
 
   ObjPtr<mirror::Object> java_receiver_obj = shadow_frame->GetVRegReference(arg_offset + 1);
   ScopedLocalRef<jobject> java_receiver(env,
diff --git a/runtime/jit/jit.cc b/runtime/jit/jit.cc
index b7125a8..6deb03d 100644
--- a/runtime/jit/jit.cc
+++ b/runtime/jit/jit.cc
@@ -26,7 +26,7 @@
 #include "jit_code_cache.h"
 #include "oat_file_manager.h"
 #include "oat_quick_method_header.h"
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
 #include "profile_saver.h"
 #include "runtime.h"
 #include "runtime_options.h"
@@ -514,7 +514,7 @@
       }
     }
 
-    native_pc = stack_map.GetNativePcOffset(encoding.stack_map_encoding) +
+    native_pc = stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA) +
         osr_method->GetEntryPoint();
     VLOG(jit) << "Jumping to "
               << method_name
diff --git a/runtime/jit/jit.h b/runtime/jit/jit.h
index 05c3905..4112142 100644
--- a/runtime/jit/jit.h
+++ b/runtime/jit/jit.h
@@ -25,7 +25,7 @@
 #include "jit/profile_saver_options.h"
 #include "obj_ptr.h"
 #include "object_callbacks.h"
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
 #include "thread_pool.h"
 
 namespace art {
diff --git a/runtime/jit/offline_profiling_info.cc b/runtime/jit/profile_compilation_info.cc
similarity index 99%
rename from runtime/jit/offline_profiling_info.cc
rename to runtime/jit/profile_compilation_info.cc
index 6f2a8c6..1405c40 100644
--- a/runtime/jit/offline_profiling_info.cc
+++ b/runtime/jit/profile_compilation_info.cc
@@ -14,7 +14,7 @@
  * limitations under the License.
  */
 
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
 
 #include "errno.h"
 #include <limits.h>
diff --git a/runtime/jit/offline_profiling_info.h b/runtime/jit/profile_compilation_info.h
similarity index 97%
rename from runtime/jit/offline_profiling_info.h
rename to runtime/jit/profile_compilation_info.h
index 53d0eea..f8061bc 100644
--- a/runtime/jit/offline_profiling_info.h
+++ b/runtime/jit/profile_compilation_info.h
@@ -14,8 +14,8 @@
  * limitations under the License.
  */
 
-#ifndef ART_RUNTIME_JIT_OFFLINE_PROFILING_INFO_H_
-#define ART_RUNTIME_JIT_OFFLINE_PROFILING_INFO_H_
+#ifndef ART_RUNTIME_JIT_PROFILE_COMPILATION_INFO_H_
+#define ART_RUNTIME_JIT_PROFILE_COMPILATION_INFO_H_
 
 #include <set>
 #include <vector>
@@ -29,7 +29,6 @@
 
 namespace art {
 
-// TODO: rename file.
 /**
  * Profile information in a format suitable to be queried by the compiler and
  * performing profile guided compilation.
@@ -187,4 +186,4 @@
 
 }  // namespace art
 
-#endif  // ART_RUNTIME_JIT_OFFLINE_PROFILING_INFO_H_
+#endif  // ART_RUNTIME_JIT_PROFILE_COMPILATION_INFO_H_
diff --git a/runtime/jit/profile_compilation_info_test.cc b/runtime/jit/profile_compilation_info_test.cc
index 1dd1e36..835a5f3 100644
--- a/runtime/jit/profile_compilation_info_test.cc
+++ b/runtime/jit/profile_compilation_info_test.cc
@@ -25,7 +25,7 @@
 #include "mirror/class-inl.h"
 #include "mirror/class_loader.h"
 #include "handle_scope-inl.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "scoped_thread_state_change-inl.h"
 
 namespace art {
diff --git a/runtime/jit/profile_saver.h b/runtime/jit/profile_saver.h
index 59e2c94..9c5e41f 100644
--- a/runtime/jit/profile_saver.h
+++ b/runtime/jit/profile_saver.h
@@ -19,7 +19,7 @@
 
 #include "base/mutex.h"
 #include "jit_code_cache.h"
-#include "offline_profiling_info.h"
+#include "profile_compilation_info.h"
 #include "profile_saver_options.h"
 #include "safe_map.h"
 
diff --git a/runtime/jni_env_ext.cc b/runtime/jni_env_ext.cc
index 5a3fafa..0148a1c 100644
--- a/runtime/jni_env_ext.cc
+++ b/runtime/jni_env_ext.cc
@@ -29,6 +29,7 @@
 #include "mirror/object-inl.h"
 #include "nth_caller_visitor.h"
 #include "thread-inl.h"
+#include "thread_list.h"
 
 namespace art {
 
@@ -37,6 +38,8 @@
 static constexpr size_t kMonitorsInitial = 32;  // Arbitrary.
 static constexpr size_t kMonitorsMax = 4096;  // Arbitrary sanity check.
 
+const JNINativeInterface* JNIEnvExt::table_override_ = nullptr;
+
 // Checking "locals" requires the mutator lock, but at creation time we're really only interested
 // in validity, which isn't changing. To avoid grabbing the mutator lock, factored out and tagged
 // with NO_THREAD_SAFETY_ANALYSIS.
@@ -78,10 +81,10 @@
       runtime_deleted(false),
       critical(0),
       monitors("monitors", kMonitorsInitial, kMonitorsMax) {
-  functions = unchecked_functions = GetJniNativeInterface();
-  if (vm->IsCheckJniEnabled()) {
-    SetCheckJniEnabled(true);
-  }
+  MutexLock mu(Thread::Current(), *Locks::jni_function_table_lock_);
+  check_jni = vm->IsCheckJniEnabled();
+  functions = GetFunctionTable(check_jni);
+  unchecked_functions = GetJniNativeInterface();
 }
 
 void JNIEnvExt::SetFunctionsToRuntimeShutdownFunctions() {
@@ -107,7 +110,12 @@
 
 void JNIEnvExt::SetCheckJniEnabled(bool enabled) {
   check_jni = enabled;
-  functions = enabled ? GetCheckJniNativeInterface() : GetJniNativeInterface();
+  MutexLock mu(Thread::Current(), *Locks::jni_function_table_lock_);
+  functions = GetFunctionTable(enabled);
+  // Check whether this is a no-op because of override.
+  if (enabled && JNIEnvExt::table_override_ != nullptr) {
+    LOG(WARNING) << "Enabling CheckJNI after a JNIEnv function table override is not functional.";
+  }
 }
 
 void JNIEnvExt::DumpReferenceTables(std::ostream& os) {
@@ -269,4 +277,33 @@
   }
 }
 
+static void ThreadResetFunctionTable(Thread* thread, void* arg ATTRIBUTE_UNUSED)
+    REQUIRES(Locks::jni_function_table_lock_) {
+  JNIEnvExt* env = thread->GetJniEnv();
+  bool check_jni = env->check_jni;
+  env->functions = JNIEnvExt::GetFunctionTable(check_jni);
+}
+
+void JNIEnvExt::SetTableOverride(const JNINativeInterface* table_override) {
+  MutexLock mu(Thread::Current(), *Locks::thread_list_lock_);
+  MutexLock mu2(Thread::Current(), *Locks::jni_function_table_lock_);
+
+  JNIEnvExt::table_override_ = table_override;
+
+  // See if we have a runtime. Note: we cannot run other code (like JavaVMExt's CheckJNI install
+  // code), as we'd have to recursively lock the mutex.
+  Runtime* runtime = Runtime::Current();
+  if (runtime != nullptr) {
+    runtime->GetThreadList()->ForEach(ThreadResetFunctionTable, nullptr);
+  }
+}
+
+const JNINativeInterface* JNIEnvExt::GetFunctionTable(bool check_jni) {
+  const JNINativeInterface* override = JNIEnvExt::table_override_;
+  if (override != nullptr) {
+    return override;
+  }
+  return check_jni ? GetCheckJniNativeInterface() : GetJniNativeInterface();
+}
+
 }  // namespace art
diff --git a/runtime/jni_env_ext.h b/runtime/jni_env_ext.h
index 5cca0ae..4004c45 100644
--- a/runtime/jni_env_ext.h
+++ b/runtime/jni_env_ext.h
@@ -43,7 +43,7 @@
   void DumpReferenceTables(std::ostream& os)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
-  void SetCheckJniEnabled(bool enabled);
+  void SetCheckJniEnabled(bool enabled) REQUIRES(!Locks::jni_function_table_lock_);
 
   void PushFrame(int capacity) REQUIRES_SHARED(Locks::mutator_lock_);
   void PopFrame() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -104,10 +104,27 @@
   // Set the functions to the runtime shutdown functions.
   void SetFunctionsToRuntimeShutdownFunctions();
 
+  // Set the function table override. This will install the override (or original table, if null)
+  // to all threads.
+  // Note: JNI function table overrides are sensitive to the order of operations wrt/ CheckJNI.
+  //       After overriding the JNI function table, CheckJNI toggling is ignored.
+  static void SetTableOverride(const JNINativeInterface* table_override)
+      REQUIRES(!Locks::thread_list_lock_, !Locks::jni_function_table_lock_);
+
+  // Return either the regular, or the CheckJNI function table. Will return table_override_ instead
+  // if it is not null.
+  static const JNINativeInterface* GetFunctionTable(bool check_jni)
+      REQUIRES(Locks::jni_function_table_lock_);
+
  private:
+  // Override of function tables. This applies to both default as well as instrumented (CheckJNI)
+  // function tables.
+  static const JNINativeInterface* table_override_ GUARDED_BY(Locks::jni_function_table_lock_);
+
   // The constructor should not be called directly. It may leave the object in an erroneous state,
   // and the result needs to be checked.
-  JNIEnvExt(Thread* self, JavaVMExt* vm, std::string* error_msg);
+  JNIEnvExt(Thread* self, JavaVMExt* vm, std::string* error_msg)
+      REQUIRES(!Locks::jni_function_table_lock_);
 
   // All locked objects, with the (Java caller) stack frame that locked them. Used in CheckJNI
   // to ensure that only monitors locked in this native frame are being unlocked, and that at
diff --git a/runtime/jni_internal_test.cc b/runtime/jni_internal_test.cc
index 4da5e23..08d1eeb 100644
--- a/runtime/jni_internal_test.cc
+++ b/runtime/jni_internal_test.cc
@@ -2346,4 +2346,39 @@
   EXPECT_EQ(segment_state_now, segment_state_computed);
 }
 
+static size_t gGlobalRefCount = 0;
+static const JNINativeInterface* gOriginalEnv = nullptr;
+
+static jobject CountNewGlobalRef(JNIEnv* env, jobject o) {
+  ++gGlobalRefCount;
+  return gOriginalEnv->NewGlobalRef(env, o);
+}
+
+// Test the table override.
+TEST_F(JniInternalTest, JNIEnvExtTableOverride) {
+  JNINativeInterface env_override;
+  memcpy(&env_override, env_->functions, sizeof(JNINativeInterface));
+
+  gOriginalEnv = env_->functions;
+  env_override.NewGlobalRef = CountNewGlobalRef;
+  gGlobalRefCount = 0;
+
+  jclass local = env_->FindClass("java/lang/Object");
+  ASSERT_TRUE(local != nullptr);
+
+  // Set the table, add a global ref, see whether the counter increases.
+  JNIEnvExt::SetTableOverride(&env_override);
+
+  jobject global = env_->NewGlobalRef(local);
+  EXPECT_EQ(1u, gGlobalRefCount);
+  env_->DeleteGlobalRef(global);
+
+  // Reset
+  JNIEnvExt::SetTableOverride(nullptr);
+
+  jobject global2 = env_->NewGlobalRef(local);
+  EXPECT_EQ(1u, gGlobalRefCount);
+  env_->DeleteGlobalRef(global2);
+}
+
 }  // namespace art
diff --git a/runtime/memory_region.cc b/runtime/memory_region.cc
index a5c70c3..5bf0f40 100644
--- a/runtime/memory_region.cc
+++ b/runtime/memory_region.cc
@@ -33,4 +33,36 @@
           from.pointer(), from.size());
 }
 
+void MemoryRegion::StoreBits(uintptr_t bit_offset, uint32_t value, size_t length) {
+  DCHECK_LE(value, MaxInt<uint32_t>(length));
+  DCHECK_LE(length, BitSizeOf<uint32_t>());
+  DCHECK_LE(bit_offset + length, size_in_bits());
+  if (length == 0) {
+    return;
+  }
+  // Bits are stored in this order {7 6 5 4 3 2 1 0}.
+  // How many remaining bits in current byte is (bit_offset % kBitsPerByte) + 1.
+  uint8_t* out = ComputeInternalPointer<uint8_t>(bit_offset >> kBitsPerByteLog2);
+  auto orig_len = length;
+  auto orig_value = value;
+  uintptr_t bit_remainder = bit_offset % kBitsPerByte;
+  while (true) {
+    const uintptr_t remaining_bits = kBitsPerByte - bit_remainder;
+    if (length <= remaining_bits) {
+      // Length is smaller than all of remainder bits.
+      size_t mask = ((1 << length) - 1) << bit_remainder;
+      *out = (*out & ~mask) | (value << bit_remainder);
+      break;
+    }
+    // Copy remaining bits in current byte.
+    size_t value_mask = (1 << remaining_bits) - 1;
+    *out = (*out & ~(value_mask << bit_remainder)) | ((value & value_mask) << bit_remainder);
+    value >>= remaining_bits;
+    bit_remainder = 0;
+    length -= remaining_bits;
+    ++out;
+  }
+  DCHECK_EQ(LoadBits(bit_offset, orig_len), orig_value) << bit_offset << " " << orig_len;
+}
+
 }  // namespace art
diff --git a/runtime/memory_region.h b/runtime/memory_region.h
index f018c1f..f55dff7 100644
--- a/runtime/memory_region.h
+++ b/runtime/memory_region.h
@@ -124,11 +124,35 @@
   // The bit at the smallest offset is the least significant bit in the
   // loaded value.  `length` must not be larger than the number of bits
   // contained in the return value (32).
-  uint32_t LoadBits(uintptr_t bit_offset, size_t length) const {
-    CHECK_LE(length, sizeof(uint32_t) * kBitsPerByte);
-    uint32_t value = 0u;
+  ALWAYS_INLINE uint32_t LoadBits(uintptr_t bit_offset, size_t length) const {
+    DCHECK_LE(length, BitSizeOf<uint32_t>());
+    DCHECK_LE(bit_offset + length, size_in_bits());
+    if (UNLIKELY(length == 0)) {
+      // Do not touch any memory if the range is empty.
+      return 0;
+    }
+    const uint8_t* address = start() + bit_offset / kBitsPerByte;
+    const uint32_t shift = bit_offset & (kBitsPerByte - 1);
+    // Load the value (reading only the strictly needed bytes).
+    const uint32_t load_bit_count = shift + length;
+    uint32_t value = address[0] >> shift;
+    if (load_bit_count > 8) {
+      value |= static_cast<uint32_t>(address[1]) << (8 - shift);
+      if (load_bit_count > 16) {
+        value |= static_cast<uint32_t>(address[2]) << (16 - shift);
+        if (load_bit_count > 24) {
+          value |= static_cast<uint32_t>(address[3]) << (24 - shift);
+          if (load_bit_count > 32) {
+            value |= static_cast<uint32_t>(address[4]) << (32 - shift);
+          }
+        }
+      }
+    }
+    // Clear unwanted most significant bits.
+    uint32_t clear_bit_count = BitSizeOf(value) - length;
+    value = (value << clear_bit_count) >> clear_bit_count;
     for (size_t i = 0; i < length; ++i) {
-      value |= LoadBit(bit_offset + i) << i;
+      DCHECK_EQ((value >> i) & 1, LoadBit(bit_offset + i));
     }
     return value;
   }
@@ -137,25 +161,19 @@
   // `bit_offset`.  The bit at the smallest offset is the least significant
   // bit of the stored `value`.  `value` must not be larger than `length`
   // bits.
-  void StoreBits(uintptr_t bit_offset, uint32_t value, size_t length) {
-    CHECK_LE(value, MaxInt<uint32_t>(length));
-    for (size_t i = 0; i < length; ++i) {
-      bool ith_bit = value & (1 << i);
-      StoreBit(bit_offset + i, ith_bit);
-    }
-  }
+  void StoreBits(uintptr_t bit_offset, uint32_t value, size_t length);
 
   void CopyFrom(size_t offset, const MemoryRegion& from) const;
 
   // Compute a sub memory region based on an existing one.
-  MemoryRegion Subregion(uintptr_t offset, uintptr_t size_in) const {
+  ALWAYS_INLINE MemoryRegion Subregion(uintptr_t offset, uintptr_t size_in) const {
     CHECK_GE(this->size(), size_in);
     CHECK_LE(offset,  this->size() - size_in);
     return MemoryRegion(reinterpret_cast<void*>(start() + offset), size_in);
   }
 
   // Compute an extended memory region based on an existing one.
-  void Extend(const MemoryRegion& region, uintptr_t extra) {
+  ALWAYS_INLINE void Extend(const MemoryRegion& region, uintptr_t extra) {
     pointer_ = region.pointer();
     size_ = (region.size() + extra);
   }
diff --git a/runtime/mirror/array-inl.h b/runtime/mirror/array-inl.h
index a5db0c0..f56226b 100644
--- a/runtime/mirror/array-inl.h
+++ b/runtime/mirror/array-inl.h
@@ -207,6 +207,19 @@
 }
 
 template<typename T>
+inline PrimitiveArray<T>* PrimitiveArray<T>::AllocateAndFill(Thread* self,
+                                                             const T* data,
+                                                             size_t length) {
+  StackHandleScope<1> hs(self);
+  Handle<PrimitiveArray<T>> arr(hs.NewHandle(PrimitiveArray<T>::Alloc(self, length)));
+  if (!arr.IsNull()) {
+    // Copy it in. Just skip if it's null
+    memcpy(arr->GetData(), data, sizeof(T) * length);
+  }
+  return arr.Get();
+}
+
+template<typename T>
 inline PrimitiveArray<T>* PrimitiveArray<T>::Alloc(Thread* self, size_t length) {
   Array* raw_array = Array::Alloc<true>(self,
                                         GetArrayClass(),
diff --git a/runtime/mirror/array.h b/runtime/mirror/array.h
index 19d300e..16cf30f 100644
--- a/runtime/mirror/array.h
+++ b/runtime/mirror/array.h
@@ -119,6 +119,10 @@
   static PrimitiveArray<T>* Alloc(Thread* self, size_t length)
       REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!Roles::uninterruptible_);
 
+  static PrimitiveArray<T>* AllocateAndFill(Thread* self, const T* data, size_t length)
+      REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!Roles::uninterruptible_);
+
+
   const T* GetData() const ALWAYS_INLINE  REQUIRES_SHARED(Locks::mutator_lock_) {
     return reinterpret_cast<const T*>(GetRawData(sizeof(T), 0));
   }
diff --git a/runtime/mirror/class.cc b/runtime/mirror/class.cc
index 9964b73..f08d4da 100644
--- a/runtime/mirror/class.cc
+++ b/runtime/mirror/class.cc
@@ -115,7 +115,9 @@
   ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
   bool class_linker_initialized = class_linker != nullptr && class_linker->IsInitialized();
   if (LIKELY(class_linker_initialized)) {
-    if (UNLIKELY(new_status <= old_status && new_status != kStatusError &&
+    if (UNLIKELY(new_status <= old_status &&
+                 new_status != kStatusErrorUnresolved &&
+                 new_status != kStatusErrorResolved &&
                  new_status != kStatusRetired)) {
       LOG(FATAL) << "Unexpected change back of class status for " << h_this->PrettyClass()
                  << " " << old_status << " -> " << new_status;
@@ -127,10 +129,12 @@
             << h_this->PrettyClass() << " " << old_status << " -> " << new_status;
     }
   }
-  if (UNLIKELY(new_status == kStatusError)) {
-    CHECK_NE(h_this->GetStatus(), kStatusError)
+  if (UNLIKELY(IsErroneous(new_status))) {
+    CHECK(!h_this->IsErroneous())
         << "Attempt to set as erroneous an already erroneous class "
-        << h_this->PrettyClass();
+        << h_this->PrettyClass()
+        << " old_status: " << old_status << " new_status: " << new_status;
+    CHECK_EQ(new_status == kStatusErrorResolved, old_status >= kStatusResolved);
     if (VLOG_IS_ON(class_linker)) {
       LOG(ERROR) << "Setting " << h_this->PrettyDescriptor() << " to erroneous.";
       if (self->IsExceptionPending()) {
@@ -177,7 +181,7 @@
       // Class is a temporary one, ensure that waiters for resolution get notified of retirement
       // so that they can grab the new version of the class from the class linker's table.
       CHECK_LT(new_status, kStatusResolved) << h_this->PrettyDescriptor();
-      if (new_status == kStatusRetired || new_status == kStatusError) {
+      if (new_status == kStatusRetired || new_status == kStatusErrorUnresolved) {
         h_this->NotifyAll(self);
       }
     } else {
@@ -305,7 +309,7 @@
     }
     if (h_this->NumStaticFields() > 0) {
       os << "  static fields (" << h_this->NumStaticFields() << " entries):\n";
-      if (h_this->IsResolved() || h_this->IsErroneous()) {
+      if (h_this->IsResolved()) {
         for (size_t i = 0; i < h_this->NumStaticFields(); ++i) {
           os << StringPrintf("    %2zd: %s\n", i,
                              ArtField::PrettyField(h_this->GetStaticField(i)).c_str());
@@ -316,7 +320,7 @@
     }
     if (h_this->NumInstanceFields() > 0) {
       os << "  instance fields (" << h_this->NumInstanceFields() << " entries):\n";
-      if (h_this->IsResolved() || h_this->IsErroneous()) {
+      if (h_this->IsResolved()) {
         for (size_t i = 0; i < h_this->NumInstanceFields(); ++i) {
           os << StringPrintf("    %2zd: %s\n", i,
                              ArtField::PrettyField(h_this->GetInstanceField(i)).c_str());
diff --git a/runtime/mirror/class.h b/runtime/mirror/class.h
index fb2792a..7f6aa12 100644
--- a/runtime/mirror/class.h
+++ b/runtime/mirror/class.h
@@ -84,6 +84,13 @@
   // will be gc'ed once all refs to the class point to the newly
   // cloned version.
   //
+  // kStatusErrorUnresolved, kStatusErrorResolved: Class is erroneous. We need
+  // to distinguish between classes that have been resolved and classes that
+  // have not. This is important because the const-class instruction needs to
+  // return a previously resolved class even if its subsequent initialization
+  // failed. We also need this to decide whether to wrap a previous
+  // initialization failure in ClassDefNotFound error or not.
+  //
   // kStatusNotReady: If a Class cannot be found in the class table by
   // FindClass, it allocates an new one with AllocClass in the
   // kStatusNotReady and calls LoadClass. Note if it does find a
@@ -119,8 +126,9 @@
   //
   // TODO: Explain the other states
   enum Status {
-    kStatusRetired = -2,  // Retired, should not be used. Use the newly cloned one instead.
-    kStatusError = -1,
+    kStatusRetired = -3,  // Retired, should not be used. Use the newly cloned one instead.
+    kStatusErrorResolved = -2,
+    kStatusErrorUnresolved = -1,
     kStatusNotReady = 0,
     kStatusIdx = 1,  // Loaded, DEX idx in super_class_type_idx_ and interfaces_type_idx_.
     kStatusLoaded = 2,  // DEX idx values resolved.
@@ -158,8 +166,25 @@
 
   // Returns true if the class has failed to link.
   template<VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags>
+  bool IsErroneousUnresolved() REQUIRES_SHARED(Locks::mutator_lock_) {
+    return GetStatus<kVerifyFlags>() == kStatusErrorUnresolved;
+  }
+
+  // Returns true if the class has failed to initialize.
+  template<VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags>
+  bool IsErroneousResolved() REQUIRES_SHARED(Locks::mutator_lock_) {
+    return GetStatus<kVerifyFlags>() == kStatusErrorResolved;
+  }
+
+  // Returns true if the class status indicets that the class has failed to link or initialize.
+  static bool IsErroneous(Status status) {
+    return status == kStatusErrorUnresolved || status == kStatusErrorResolved;
+  }
+
+  // Returns true if the class has failed to link or initialize.
+  template<VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags>
   bool IsErroneous() REQUIRES_SHARED(Locks::mutator_lock_) {
-    return GetStatus<kVerifyFlags>() == kStatusError;
+    return IsErroneous(GetStatus<kVerifyFlags>());
   }
 
   // Returns true if the class has been loaded.
@@ -177,7 +202,8 @@
   // Returns true if the class has been linked.
   template<VerifyObjectFlags kVerifyFlags = kDefaultVerifyFlags>
   bool IsResolved() REQUIRES_SHARED(Locks::mutator_lock_) {
-    return GetStatus<kVerifyFlags>() >= kStatusResolved;
+    Status status = GetStatus<kVerifyFlags>();
+    return status >= kStatusResolved || status == kStatusErrorResolved;
   }
 
   // Returns true if the class was compile-time verified.
@@ -345,7 +371,7 @@
   // be replaced with a class with the right size for embedded imt/vtable.
   bool IsTemp() REQUIRES_SHARED(Locks::mutator_lock_) {
     Status s = GetStatus();
-    return s < Status::kStatusResolving && ShouldHaveEmbeddedVTable();
+    return s < Status::kStatusResolving && s != kStatusErrorResolved && ShouldHaveEmbeddedVTable();
   }
 
   String* GetName() REQUIRES_SHARED(Locks::mutator_lock_);  // Returns the cached name.
@@ -1017,7 +1043,7 @@
   // Returns the number of instance fields containing reference types. Does not count fields in any
   // super classes.
   uint32_t NumReferenceInstanceFields() REQUIRES_SHARED(Locks::mutator_lock_) {
-    DCHECK(IsResolved() || IsErroneous());
+    DCHECK(IsResolved());
     return GetField32(OFFSET_OF_OBJECT_MEMBER(Class, num_reference_instance_fields_));
   }
 
@@ -1045,7 +1071,7 @@
 
   // Returns the number of static fields containing reference types.
   uint32_t NumReferenceStaticFields() REQUIRES_SHARED(Locks::mutator_lock_) {
-    DCHECK(IsResolved() || IsErroneous());
+    DCHECK(IsResolved());
     return GetField32(OFFSET_OF_OBJECT_MEMBER(Class, num_reference_static_fields_));
   }
 
diff --git a/runtime/mirror/class_ext.cc b/runtime/mirror/class_ext.cc
index 7c6a710..efd949e 100644
--- a/runtime/mirror/class_ext.cc
+++ b/runtime/mirror/class_ext.cc
@@ -113,6 +113,11 @@
   }
 }
 
+void ClassExt::SetOriginalDexFileBytes(ObjPtr<ByteArray> bytes) {
+  DCHECK(!Runtime::Current()->IsActiveTransaction());
+  SetFieldObject<false>(OFFSET_OF_OBJECT_MEMBER(ClassExt, original_dex_file_bytes_), bytes);
+}
+
 void ClassExt::SetClass(ObjPtr<Class> dalvik_system_ClassExt) {
   CHECK(dalvik_system_ClassExt != nullptr);
   dalvik_system_ClassExt_ = GcRoot<Class>(dalvik_system_ClassExt);
diff --git a/runtime/mirror/class_ext.h b/runtime/mirror/class_ext.h
index 9104631..ad8a61b 100644
--- a/runtime/mirror/class_ext.h
+++ b/runtime/mirror/class_ext.h
@@ -61,6 +61,12 @@
     return GetFieldObject<PointerArray>(OFFSET_OF_OBJECT_MEMBER(ClassExt, obsolete_methods_));
   }
 
+  ByteArray* GetOriginalDexFileBytes() REQUIRES_SHARED(Locks::mutator_lock_) {
+    return GetFieldObject<ByteArray>(OFFSET_OF_OBJECT_MEMBER(ClassExt, original_dex_file_bytes_));
+  }
+
+  void SetOriginalDexFileBytes(ObjPtr<ByteArray> bytes) REQUIRES_SHARED(Locks::mutator_lock_);
+
   void SetObsoleteArrays(ObjPtr<PointerArray> methods, ObjPtr<ObjectArray<DexCache>> dex_caches)
       REQUIRES_SHARED(Locks::mutator_lock_);
 
@@ -80,7 +86,7 @@
 
   HeapReference<PointerArray> obsolete_methods_;
 
-  HeapReference<DexCache> original_dex_cache_;
+  HeapReference<ByteArray> original_dex_file_bytes_;
 
   // The saved verification error of this class.
   HeapReference<Object> verify_error_;
diff --git a/runtime/mirror/dex_cache_test.cc b/runtime/mirror/dex_cache_test.cc
index 916f1cf..8f978e1 100644
--- a/runtime/mirror/dex_cache_test.cc
+++ b/runtime/mirror/dex_cache_test.cc
@@ -35,7 +35,6 @@
  protected:
   virtual void SetUpRuntimeOptions(RuntimeOptions* options) OVERRIDE {
     CommonRuntimeTest::SetUpRuntimeOptions(options);
-    options->push_back(std::make_pair("-Xexperimental:method-handles", nullptr));
   }
 };
 
diff --git a/runtime/mirror/emulated_stack_frame.cc b/runtime/mirror/emulated_stack_frame.cc
index d607040..978cc32 100644
--- a/runtime/mirror/emulated_stack_frame.cc
+++ b/runtime/mirror/emulated_stack_frame.cc
@@ -195,6 +195,7 @@
   // Step 5: Construct the EmulatedStackFrame object.
   Handle<EmulatedStackFrame> sf(hs.NewHandle(
       ObjPtr<EmulatedStackFrame>::DownCast(StaticClass()->AllocObject(self))));
+  sf->SetFieldObject<false>(CallsiteTypeOffset(), caller_type.Get());
   sf->SetFieldObject<false>(TypeOffset(), callee_type.Get());
   sf->SetFieldObject<false>(ReferencesOffset(), references.Get());
   sf->SetFieldObject<false>(StackFrameOffset(), stack_frame.Get());
diff --git a/runtime/mirror/emulated_stack_frame.h b/runtime/mirror/emulated_stack_frame.h
index d83a536..ddd84a1 100644
--- a/runtime/mirror/emulated_stack_frame.h
+++ b/runtime/mirror/emulated_stack_frame.h
@@ -81,6 +81,10 @@
         OFFSET_OF_OBJECT_MEMBER(EmulatedStackFrame, stack_frame_));
   }
 
+  static MemberOffset CallsiteTypeOffset() {
+    return MemberOffset(OFFSETOF_MEMBER(EmulatedStackFrame, callsite_type_));
+  }
+
   static MemberOffset TypeOffset() {
     return MemberOffset(OFFSETOF_MEMBER(EmulatedStackFrame, type_));
   }
@@ -93,6 +97,7 @@
     return MemberOffset(OFFSETOF_MEMBER(EmulatedStackFrame, stack_frame_));
   }
 
+  HeapReference<mirror::MethodType> callsite_type_;
   HeapReference<mirror::ObjectArray<mirror::Object>> references_;
   HeapReference<mirror::ByteArray> stack_frame_;
   HeapReference<mirror::MethodType> type_;
diff --git a/runtime/mirror/method_handle_impl.h b/runtime/mirror/method_handle_impl.h
index abe999a..2f26a22 100644
--- a/runtime/mirror/method_handle_impl.h
+++ b/runtime/mirror/method_handle_impl.h
@@ -84,10 +84,12 @@
   static mirror::Class* StaticClass() REQUIRES_SHARED(Locks::mutator_lock_);
 
  private:
+  // NOTE: cached_spread_invoker_ isn't used by the runtime.
+  HeapReference<mirror::MethodHandle> cached_spread_invoker_;
   HeapReference<mirror::MethodType> nominal_type_;
   HeapReference<mirror::MethodType> method_type_;
-  uint64_t art_field_or_method_;
   uint32_t handle_kind_;
+  uint64_t art_field_or_method_;
 
  private:
   static MemberOffset NominalTypeOffset() {
diff --git a/runtime/mirror/object_test.cc b/runtime/mirror/object_test.cc
index a6f56ae..6a4ec9d 100644
--- a/runtime/mirror/object_test.cc
+++ b/runtime/mirror/object_test.cc
@@ -306,23 +306,6 @@
 }
 
 
-TEST_F(ObjectTest, CheckAndAllocArrayFromCode) {
-  // pretend we are trying to call 'new char[3]' from String.toCharArray
-  ScopedObjectAccess soa(Thread::Current());
-  Class* java_util_Arrays = class_linker_->FindSystemClass(soa.Self(), "Ljava/util/Arrays;");
-  ArtMethod* sort = java_util_Arrays->FindDirectMethod("sort", "([I)V", kRuntimePointerSize);
-  const DexFile::TypeId* type_id = java_lang_dex_file_->FindTypeId("[I");
-  ASSERT_TRUE(type_id != nullptr);
-  dex::TypeIndex type_idx = java_lang_dex_file_->GetIndexForTypeId(*type_id);
-  Object* array = CheckAndAllocArrayFromCodeInstrumented(
-      type_idx, 3, sort, Thread::Current(), false,
-      Runtime::Current()->GetHeap()->GetCurrentAllocator());
-  EXPECT_TRUE(array->IsArrayInstance());
-  EXPECT_EQ(3, array->AsArray()->GetLength());
-  EXPECT_TRUE(array->GetClass()->IsArrayClass());
-  EXPECT_TRUE(array->GetClass()->GetComponentType()->IsPrimitive());
-}
-
 TEST_F(ObjectTest, CreateMultiArray) {
   ScopedObjectAccess soa(Thread::Current());
 
diff --git a/runtime/monitor.cc b/runtime/monitor.cc
index 9c09275..071b0e2 100644
--- a/runtime/monitor.cc
+++ b/runtime/monitor.cc
@@ -1394,6 +1394,12 @@
   }
 }
 
+size_t MonitorList::Size() {
+  Thread* self = Thread::Current();
+  MutexLock mu(self, monitor_list_lock_);
+  return list_.size();
+}
+
 class MonitorDeflateVisitor : public IsMarkedVisitor {
  public:
   MonitorDeflateVisitor() : self_(Thread::Current()), deflate_count_(0) {}
diff --git a/runtime/monitor.h b/runtime/monitor.h
index c3da563..1fa4682 100644
--- a/runtime/monitor.h
+++ b/runtime/monitor.h
@@ -331,6 +331,7 @@
   void BroadcastForNewMonitors() REQUIRES(!monitor_list_lock_);
   // Returns how many monitors were deflated.
   size_t DeflateMonitors() REQUIRES(!monitor_list_lock_) REQUIRES(Locks::mutator_lock_);
+  size_t Size() REQUIRES(!monitor_list_lock_);
 
   typedef std::list<Monitor*, TrackingAllocator<Monitor*, kAllocatorTagMonitorList>> Monitors;
 
diff --git a/runtime/native/dalvik_system_VMDebug.cc b/runtime/native/dalvik_system_VMDebug.cc
index 67b2e1c..0d24587 100644
--- a/runtime/native/dalvik_system_VMDebug.cc
+++ b/runtime/native/dalvik_system_VMDebug.cc
@@ -90,7 +90,8 @@
 
 static void VMDebug_startMethodTracingFd(JNIEnv* env, jclass, jstring javaTraceFilename,
                                          jobject javaFd, jint bufferSize, jint flags,
-                                         jboolean samplingEnabled, jint intervalUs) {
+                                         jboolean samplingEnabled, jint intervalUs,
+                                         jboolean streamingOutput) {
   int originalFd = jniGetFDFromFileDescriptor(env, javaFd);
   if (originalFd < 0) {
     return;
@@ -108,7 +109,10 @@
   if (traceFilename.c_str() == nullptr) {
     return;
   }
-  Trace::Start(traceFilename.c_str(), fd, bufferSize, flags, Trace::TraceOutputMode::kFile,
+  Trace::TraceOutputMode outputMode = streamingOutput
+                                          ? Trace::TraceOutputMode::kStreaming
+                                          : Trace::TraceOutputMode::kFile;
+  Trace::Start(traceFilename.c_str(), fd, bufferSize, flags, outputMode,
                samplingEnabled ? Trace::TraceMode::kSampling : Trace::TraceMode::kMethodTracing,
                intervalUs);
 }
@@ -547,7 +551,7 @@
   NATIVE_METHOD(VMDebug, startEmulatorTracing, "()V"),
   NATIVE_METHOD(VMDebug, startInstructionCounting, "()V"),
   NATIVE_METHOD(VMDebug, startMethodTracingDdmsImpl, "(IIZI)V"),
-  NATIVE_METHOD(VMDebug, startMethodTracingFd, "(Ljava/lang/String;Ljava/io/FileDescriptor;IIZI)V"),
+  NATIVE_METHOD(VMDebug, startMethodTracingFd, "(Ljava/lang/String;Ljava/io/FileDescriptor;IIZIZ)V"),
   NATIVE_METHOD(VMDebug, startMethodTracingFilename, "(Ljava/lang/String;IIZI)V"),
   NATIVE_METHOD(VMDebug, stopAllocCounting, "()V"),
   NATIVE_METHOD(VMDebug, stopEmulatorTracing, "()V"),
diff --git a/runtime/native/java_lang_Class.cc b/runtime/native/java_lang_Class.cc
index 3341f53..5438a6d 100644
--- a/runtime/native/java_lang_Class.cc
+++ b/runtime/native/java_lang_Class.cc
@@ -428,6 +428,10 @@
   }
   auto ret = hs.NewHandle(mirror::ObjectArray<mirror::Method>::Alloc(
       soa.Self(), mirror::Method::ArrayClass(), num_methods));
+  if (ret.Get() == nullptr) {
+    soa.Self()->AssertPendingOOMException();
+    return nullptr;
+  }
   num_methods = 0;
   for (auto& m : klass->GetDeclaredMethods(kRuntimePointerSize)) {
     auto modifiers = m.GetAccessFlags();
diff --git a/runtime/native/java_lang_VMClassLoader.cc b/runtime/native/java_lang_VMClassLoader.cc
index 284d2d1..a8fa7db 100644
--- a/runtime/native/java_lang_VMClassLoader.cc
+++ b/runtime/native/java_lang_VMClassLoader.cc
@@ -81,14 +81,12 @@
   if (c != nullptr && c->IsErroneous()) {
     cl->ThrowEarlierClassFailure(c.Ptr());
     Thread* self = soa.Self();
-    ObjPtr<mirror::Class> eiie_class =
-        self->DecodeJObject(WellKnownClasses::java_lang_ExceptionInInitializerError)->AsClass();
     ObjPtr<mirror::Class> iae_class =
         self->DecodeJObject(WellKnownClasses::java_lang_IllegalAccessError)->AsClass();
     ObjPtr<mirror::Class> ncdfe_class =
         self->DecodeJObject(WellKnownClasses::java_lang_NoClassDefFoundError)->AsClass();
     ObjPtr<mirror::Class> exception = self->GetException()->GetClass();
-    if (exception == eiie_class || exception == iae_class || exception == ncdfe_class) {
+    if (exception == iae_class || exception == ncdfe_class) {
       self->ThrowNewWrappedException("Ljava/lang/ClassNotFoundException;",
                                      c->PrettyDescriptor().c_str());
     }
diff --git a/runtime/oat.cc b/runtime/oat.cc
index 1a07cdc..d14b399 100644
--- a/runtime/oat.cc
+++ b/runtime/oat.cc
@@ -473,6 +473,10 @@
   return IsKeyEnabled(OatHeader::kDebuggableKey);
 }
 
+bool OatHeader::IsConcurrentCopying() const {
+  return IsKeyEnabled(OatHeader::kConcurrentCopying);
+}
+
 bool OatHeader::IsNativeDebuggable() const {
   return IsKeyEnabled(OatHeader::kNativeDebuggableKey);
 }
diff --git a/runtime/oat.h b/runtime/oat.h
index dc103e2..29821a2 100644
--- a/runtime/oat.h
+++ b/runtime/oat.h
@@ -32,7 +32,7 @@
 class PACKED(4) OatHeader {
  public:
   static constexpr uint8_t kOatMagic[] = { 'o', 'a', 't', '\n' };
-  static constexpr uint8_t kOatVersion[] = { '0', '9', '5', '\0' };  // alloc entrypoints change
+  static constexpr uint8_t kOatVersion[] = { '1', '0', '3', '\0' };  // Native pc change
 
   static constexpr const char* kImageLocationKey = "image-location";
   static constexpr const char* kDex2OatCmdLineKey = "dex2oat-cmdline";
@@ -43,6 +43,7 @@
   static constexpr const char* kCompilerFilter = "compiler-filter";
   static constexpr const char* kClassPathKey = "classpath";
   static constexpr const char* kBootClassPathKey = "bootclasspath";
+  static constexpr const char* kConcurrentCopying = "concurrent-copying";
 
   static constexpr const char kTrueValue[] = "true";
   static constexpr const char kFalseValue[] = "false";
@@ -112,6 +113,7 @@
   bool IsDebuggable() const;
   bool IsNativeDebuggable() const;
   CompilerFilter::Filter GetCompilerFilter() const;
+  bool IsConcurrentCopying() const;
 
  private:
   bool KeyHasValue(const char* key, const char* value, size_t value_size) const;
diff --git a/runtime/oat_file.cc b/runtime/oat_file.cc
index 38df427..d47f1b5 100644
--- a/runtime/oat_file.cc
+++ b/runtime/oat_file.cc
@@ -323,8 +323,10 @@
   }
 
   PointerSize pointer_size = GetInstructionSetPointerSize(GetOatHeader().GetInstructionSet());
-  uint8_t* dex_cache_arrays = bss_begin_;
-  uint8_t* dex_cache_arrays_end = (bss_roots_ != nullptr) ? bss_roots_ : bss_end_;
+  uint8_t* dex_cache_arrays = (bss_begin_ == bss_roots_) ? nullptr : bss_begin_;
+  uint8_t* dex_cache_arrays_end =
+      (bss_begin_ == bss_roots_) ? nullptr : (bss_roots_ != nullptr) ? bss_roots_ : bss_end_;
+  DCHECK_EQ(dex_cache_arrays != nullptr, dex_cache_arrays_end != nullptr);
   uint32_t dex_file_count = GetOatHeader().GetDexFileCount();
   oat_dex_files_storage_.reserve(dex_file_count);
   for (size_t i = 0; i < dex_file_count; i++) {
diff --git a/runtime/oat_file.h b/runtime/oat_file.h
index 62d99fb..111755e 100644
--- a/runtime/oat_file.h
+++ b/runtime/oat_file.h
@@ -201,8 +201,12 @@
     // A representation of an invalid OatClass, used when an OatClass can't be found.
     // See FindOatClass().
     static OatClass Invalid() {
-      return OatClass(nullptr, mirror::Class::kStatusError, kOatClassNoneCompiled, 0, nullptr,
-                      nullptr);
+      return OatClass(/* oat_file */ nullptr,
+                      mirror::Class::kStatusErrorUnresolved,
+                      kOatClassNoneCompiled,
+                      /* bitmap_size */ 0,
+                      /* bitmap_pointer */ nullptr,
+                      /* methods_pointer */ nullptr);
     }
 
    private:
diff --git a/runtime/oat_file_assistant.cc b/runtime/oat_file_assistant.cc
index f12a5e7..8554fa2 100644
--- a/runtime/oat_file_assistant.cc
+++ b/runtime/oat_file_assistant.cc
@@ -304,6 +304,13 @@
 }
 
 OatFileAssistant::OatStatus OatFileAssistant::GivenOatFileStatus(const OatFile& file) {
+  // Verify the ART_USE_READ_BARRIER state.
+  const bool is_cc = file.GetOatHeader().IsConcurrentCopying();
+  constexpr bool kRuntimeIsCC = kUseReadBarrier;
+  if (is_cc != kRuntimeIsCC) {
+    return kOatCannotOpen;
+  }
+
   // Verify the dex checksum.
   // Note: GetOatDexFile will return null if the dex checksum doesn't match
   // what we provide, which verifies the primary dex checksum for us.
@@ -903,4 +910,3 @@
   return std::unique_ptr<OatFile>();
 }
 }  // namespace art
-
diff --git a/runtime/oat_file_assistant_test.cc b/runtime/oat_file_assistant_test.cc
index afa804c..5772008 100644
--- a/runtime/oat_file_assistant_test.cc
+++ b/runtime/oat_file_assistant_test.cc
@@ -14,23 +14,16 @@
  * limitations under the License.
  */
 
-#include <algorithm>
-#include <fstream>
 #include <string>
 #include <vector>
 #include <sys/param.h>
 
 #include "android-base/strings.h"
-#include <backtrace/BacktraceMap.h>
 #include <gtest/gtest.h>
 
 #include "art_field-inl.h"
 #include "class_linker-inl.h"
-#include "common_runtime_test.h"
-#include "compiler_callbacks.h"
-#include "dex2oat_environment_test.h"
-#include "gc/space/image_space.h"
-#include "mem_map.h"
+#include "dexopt_test.h"
 #include "oat_file_assistant.h"
 #include "oat_file_manager.h"
 #include "os.h"
@@ -40,240 +33,17 @@
 
 namespace art {
 
-class OatFileAssistantTest : public Dex2oatEnvironmentTest {
- public:
-  virtual void SetUp() OVERRIDE {
-    ReserveImageSpace();
-    Dex2oatEnvironmentTest::SetUp();
-  }
+class OatFileAssistantTest : public DexoptTest {};
 
-  // Pre-Relocate the image to a known non-zero offset so we don't have to
-  // deal with the runtime randomly relocating the image by 0 and messing up
-  // the expected results of the tests.
-  bool PreRelocateImage(const std::string& image_location, std::string* error_msg) {
-    std::string image;
-    if (!GetCachedImageFile(image_location, &image, error_msg)) {
-      return false;
-    }
-
-    std::string patchoat = GetAndroidRoot();
-    patchoat += kIsDebugBuild ? "/bin/patchoatd" : "/bin/patchoat";
-
-    std::vector<std::string> argv;
-    argv.push_back(patchoat);
-    argv.push_back("--input-image-location=" + image_location);
-    argv.push_back("--output-image-file=" + image);
-    argv.push_back("--instruction-set=" + std::string(GetInstructionSetString(kRuntimeISA)));
-    argv.push_back("--base-offset-delta=0x00008000");
-    return Exec(argv, error_msg);
-  }
-
-  virtual void PreRuntimeCreate() {
-    std::string error_msg;
-    ASSERT_TRUE(PreRelocateImage(GetImageLocation(), &error_msg)) << error_msg;
-    ASSERT_TRUE(PreRelocateImage(GetImageLocation2(), &error_msg)) << error_msg;
-    UnreserveImageSpace();
-  }
-
-  virtual void PostRuntimeCreate() OVERRIDE {
-    ReserveImageSpace();
-  }
-
-  // Generate an oat file for the purposes of test.
-  void GenerateOatForTest(const std::string& dex_location,
-                          const std::string& oat_location,
-                          CompilerFilter::Filter filter,
-                          bool relocate,
-                          bool pic,
-                          bool with_alternate_image) {
-    std::string dalvik_cache = GetDalvikCache(GetInstructionSetString(kRuntimeISA));
-    std::string dalvik_cache_tmp = dalvik_cache + ".redirected";
-
-    if (!relocate) {
-      // Temporarily redirect the dalvik cache so dex2oat doesn't find the
-      // relocated image file.
-      ASSERT_EQ(0, rename(dalvik_cache.c_str(), dalvik_cache_tmp.c_str())) << strerror(errno);
-    }
-
-    std::vector<std::string> args;
-    args.push_back("--dex-file=" + dex_location);
-    args.push_back("--oat-file=" + oat_location);
-    args.push_back("--compiler-filter=" + CompilerFilter::NameOfFilter(filter));
-    args.push_back("--runtime-arg");
-
-    // Use -Xnorelocate regardless of the relocate argument.
-    // We control relocation by redirecting the dalvik cache when needed
-    // rather than use this flag.
-    args.push_back("-Xnorelocate");
-
-    if (pic) {
-      args.push_back("--compile-pic");
-    }
-
-    std::string image_location = GetImageLocation();
-    if (with_alternate_image) {
-      args.push_back("--boot-image=" + GetImageLocation2());
-    }
-
-    std::string error_msg;
-    ASSERT_TRUE(OatFileAssistant::Dex2Oat(args, &error_msg)) << error_msg;
-
-    if (!relocate) {
-      // Restore the dalvik cache if needed.
-      ASSERT_EQ(0, rename(dalvik_cache_tmp.c_str(), dalvik_cache.c_str())) << strerror(errno);
-    }
-
-    // Verify the odex file was generated as expected.
-    std::unique_ptr<OatFile> odex_file(OatFile::Open(oat_location.c_str(),
-                                                     oat_location.c_str(),
-                                                     nullptr,
-                                                     nullptr,
-                                                     false,
-                                                     /*low_4gb*/false,
-                                                     dex_location.c_str(),
-                                                     &error_msg));
-    ASSERT_TRUE(odex_file.get() != nullptr) << error_msg;
-    EXPECT_EQ(pic, odex_file->IsPic());
-    EXPECT_EQ(filter, odex_file->GetCompilerFilter());
-
-    std::unique_ptr<ImageHeader> image_header(
-            gc::space::ImageSpace::ReadImageHeader(image_location.c_str(),
-                                                   kRuntimeISA,
-                                                   &error_msg));
-    ASSERT_TRUE(image_header != nullptr) << error_msg;
-    const OatHeader& oat_header = odex_file->GetOatHeader();
-    uint32_t combined_checksum = OatFileAssistant::CalculateCombinedImageChecksum();
-
-    if (CompilerFilter::DependsOnImageChecksum(filter)) {
-      if (with_alternate_image) {
-        EXPECT_NE(combined_checksum, oat_header.GetImageFileLocationOatChecksum());
-      } else {
-        EXPECT_EQ(combined_checksum, oat_header.GetImageFileLocationOatChecksum());
-      }
-    }
-
-    if (CompilerFilter::IsBytecodeCompilationEnabled(filter)) {
-      if (relocate) {
-        EXPECT_EQ(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
-            oat_header.GetImageFileLocationOatDataBegin());
-        EXPECT_EQ(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
-      } else {
-        EXPECT_NE(reinterpret_cast<uintptr_t>(image_header->GetOatDataBegin()),
-            oat_header.GetImageFileLocationOatDataBegin());
-        EXPECT_NE(image_header->GetPatchDelta(), oat_header.GetImagePatchDelta());
-      }
-    }
-  }
-
-  // Generate a non-PIC odex file for the purposes of test.
-  // The generated odex file will be un-relocated.
-  void GenerateOdexForTest(const std::string& dex_location,
-                           const std::string& odex_location,
-                           CompilerFilter::Filter filter) {
-    GenerateOatForTest(dex_location,
-                       odex_location,
-                       filter,
-                       /*relocate*/false,
-                       /*pic*/false,
-                       /*with_alternate_image*/false);
-  }
-
-  void GeneratePicOdexForTest(const std::string& dex_location,
-                              const std::string& odex_location,
-                              CompilerFilter::Filter filter) {
-    GenerateOatForTest(dex_location,
-                       odex_location,
-                       filter,
-                       /*relocate*/false,
-                       /*pic*/true,
-                       /*with_alternate_image*/false);
-  }
-
-  // Generate an oat file in the oat location.
-  void GenerateOatForTest(const char* dex_location,
-                          CompilerFilter::Filter filter,
-                          bool relocate,
-                          bool pic,
-                          bool with_alternate_image) {
-    std::string oat_location;
-    std::string error_msg;
-    ASSERT_TRUE(OatFileAssistant::DexLocationToOatFilename(
-          dex_location, kRuntimeISA, &oat_location, &error_msg)) << error_msg;
-    GenerateOatForTest(dex_location,
-                       oat_location,
-                       filter,
-                       relocate,
-                       pic,
-                       with_alternate_image);
-  }
-
-  // Generate a standard oat file in the oat location.
-  void GenerateOatForTest(const char* dex_location, CompilerFilter::Filter filter) {
-    GenerateOatForTest(dex_location,
-                       filter,
-                       /*relocate*/true,
-                       /*pic*/false,
-                       /*with_alternate_image*/false);
-  }
-
- private:
-  // Reserve memory around where the image will be loaded so other memory
-  // won't conflict when it comes time to load the image.
-  // This can be called with an already loaded image to reserve the space
-  // around it.
-  void ReserveImageSpace() {
-    MemMap::Init();
-
-    // Ensure a chunk of memory is reserved for the image space.
-    // The reservation_end includes room for the main space that has to come
-    // right after the image in case of the GSS collector.
-    uintptr_t reservation_start = ART_BASE_ADDRESS;
-    uintptr_t reservation_end = ART_BASE_ADDRESS + 384 * MB;
-
-    std::unique_ptr<BacktraceMap> map(BacktraceMap::Create(getpid(), true));
-    ASSERT_TRUE(map.get() != nullptr) << "Failed to build process map";
-    for (BacktraceMap::const_iterator it = map->begin();
-        reservation_start < reservation_end && it != map->end(); ++it) {
-      ReserveImageSpaceChunk(reservation_start, std::min(it->start, reservation_end));
-      reservation_start = std::max(reservation_start, it->end);
-    }
-    ReserveImageSpaceChunk(reservation_start, reservation_end);
-  }
-
-  // Reserve a chunk of memory for the image space in the given range.
-  // Only has effect for chunks with a positive number of bytes.
-  void ReserveImageSpaceChunk(uintptr_t start, uintptr_t end) {
-    if (start < end) {
-      std::string error_msg;
-      image_reservation_.push_back(std::unique_ptr<MemMap>(
-          MemMap::MapAnonymous("image reservation",
-              reinterpret_cast<uint8_t*>(start), end - start,
-              PROT_NONE, false, false, &error_msg)));
-      ASSERT_TRUE(image_reservation_.back().get() != nullptr) << error_msg;
-      LOG(INFO) << "Reserved space for image " <<
-        reinterpret_cast<void*>(image_reservation_.back()->Begin()) << "-" <<
-        reinterpret_cast<void*>(image_reservation_.back()->End());
-    }
-  }
-
-
-  // Unreserve any memory reserved by ReserveImageSpace. This should be called
-  // before the image is loaded.
-  void UnreserveImageSpace() {
-    image_reservation_.clear();
-  }
-
-  std::vector<std::unique_ptr<MemMap>> image_reservation_;
-};
-
-class OatFileAssistantNoDex2OatTest : public OatFileAssistantTest {
+class OatFileAssistantNoDex2OatTest : public DexoptTest {
  public:
   virtual void SetUpRuntimeOptions(RuntimeOptions* options) {
-    OatFileAssistantTest::SetUpRuntimeOptions(options);
+    DexoptTest::SetUpRuntimeOptions(options);
     options->push_back(std::make_pair("-Xnodex2oat", nullptr));
   }
 };
 
+
 // Case: We have a DEX file, but no OAT file for it.
 // Expect: The status is kDex2OatNeeded.
 TEST_F(OatFileAssistantTest, DexNoOat) {
diff --git a/runtime/oat_quick_method_header.cc b/runtime/oat_quick_method_header.cc
index 9c2378d..fd84426 100644
--- a/runtime/oat_quick_method_header.cc
+++ b/runtime/oat_quick_method_header.cc
@@ -80,7 +80,7 @@
                                    : code_info.GetStackMapForDexPc(dex_pc, encoding);
   if (stack_map.IsValid()) {
     return reinterpret_cast<uintptr_t>(entry_point) +
-           stack_map.GetNativePcOffset(encoding.stack_map_encoding);
+           stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA);
   }
   if (abort_on_failure) {
     ScopedObjectAccess soa(Thread::Current());
diff --git a/runtime/openjdkjvmti/Android.bp b/runtime/openjdkjvmti/Android.bp
index 26db515..976a1e7 100644
--- a/runtime/openjdkjvmti/Android.bp
+++ b/runtime/openjdkjvmti/Android.bp
@@ -21,16 +21,22 @@
            "object_tagging.cc",
            "OpenjdkJvmTi.cc",
            "ti_class.cc",
+           "ti_class_definition.cc",
+           "ti_dump.cc",
            "ti_field.cc",
            "ti_heap.cc",
+           "ti_jni.cc",
            "ti_method.cc",
            "ti_monitor.cc",
            "ti_object.cc",
+           "ti_phase.cc",
            "ti_properties.cc",
+           "ti_search.cc",
            "ti_stack.cc",
            "ti_redefine.cc",
            "ti_thread.cc",
            "ti_threadgroup.cc",
+           "ti_timers.cc",
            "transform.cc"],
     include_dirs: ["art/runtime"],
     shared_libs: [
diff --git a/runtime/openjdkjvmti/OpenjdkJvmTi.cc b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
index 7b24ec4..c0c301f 100644
--- a/runtime/openjdkjvmti/OpenjdkJvmTi.cc
+++ b/runtime/openjdkjvmti/OpenjdkJvmTi.cc
@@ -30,6 +30,7 @@
  */
 
 #include <string>
+#include <type_traits>
 #include <vector>
 
 #include <jni.h>
@@ -37,6 +38,7 @@
 #include "openjdkjvmti/jvmti.h"
 
 #include "art_jvmti.h"
+#include "base/logging.h"
 #include "base/mutex.h"
 #include "events-inl.h"
 #include "jni_env_ext-inl.h"
@@ -47,16 +49,21 @@
 #include "thread-inl.h"
 #include "thread_list.h"
 #include "ti_class.h"
+#include "ti_dump.h"
 #include "ti_field.h"
 #include "ti_heap.h"
+#include "ti_jni.h"
 #include "ti_method.h"
 #include "ti_monitor.h"
 #include "ti_object.h"
+#include "ti_phase.h"
 #include "ti_properties.h"
 #include "ti_redefine.h"
+#include "ti_search.h"
 #include "ti_stack.h"
 #include "ti_thread.h"
 #include "ti_threadgroup.h"
+#include "ti_timers.h"
 #include "transform.h"
 
 // TODO Remove this at some point by annotating all the methods. It was put in to make the skeleton
@@ -127,10 +134,11 @@
   }
 
   static jvmtiError GetAllThreads(jvmtiEnv* env, jint* threads_count_ptr, jthread** threads_ptr) {
-    return ERR(NOT_IMPLEMENTED);
+    return ThreadUtil::GetAllThreads(env, threads_count_ptr, threads_ptr);
   }
 
   static jvmtiError SuspendThread(jvmtiEnv* env, jthread thread) {
+    ENSURE_HAS_CAP(env, can_suspend);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -138,10 +146,12 @@
                                       jint request_count,
                                       const jthread* request_list,
                                       jvmtiError* results) {
+    ENSURE_HAS_CAP(env, can_suspend);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError ResumeThread(jvmtiEnv* env, jthread thread) {
+    ENSURE_HAS_CAP(env, can_suspend);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -149,14 +159,17 @@
                                      jint request_count,
                                      const jthread* request_list,
                                      jvmtiError* results) {
+    ENSURE_HAS_CAP(env, can_suspend);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError StopThread(jvmtiEnv* env, jthread thread, jobject exception) {
+    ENSURE_HAS_CAP(env, can_signal_thread);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError InterruptThread(jvmtiEnv* env, jthread thread) {
+    ENSURE_HAS_CAP(env, can_signal_thread);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -168,6 +181,7 @@
                                         jthread thread,
                                         jint* owned_monitor_count_ptr,
                                         jobject** owned_monitors_ptr) {
+    ENSURE_HAS_CAP(env, can_get_owned_monitor_info);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -175,12 +189,14 @@
                                                   jthread thread,
                                                   jint* monitor_info_count_ptr,
                                                   jvmtiMonitorStackDepthInfo** monitor_info_ptr) {
+    ENSURE_HAS_CAP(env, can_get_owned_monitor_stack_depth_info);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError GetCurrentContendedMonitor(jvmtiEnv* env,
                                                jthread thread,
                                                jobject* monitor_ptr) {
+    ENSURE_HAS_CAP(env, can_get_current_contended_monitor);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -189,15 +205,15 @@
                                    jvmtiStartFunction proc,
                                    const void* arg,
                                    jint priority) {
-    return ERR(NOT_IMPLEMENTED);
+    return ThreadUtil::RunAgentThread(env, thread, proc, arg, priority);
   }
 
   static jvmtiError SetThreadLocalStorage(jvmtiEnv* env, jthread thread, const void* data) {
-    return ERR(NOT_IMPLEMENTED);
+    return ThreadUtil::SetThreadLocalStorage(env, thread, data);
   }
 
   static jvmtiError GetThreadLocalStorage(jvmtiEnv* env, jthread thread, void** data_ptr) {
-    return ERR(NOT_IMPLEMENTED);
+    return ThreadUtil::GetThreadLocalStorage(env, thread, data_ptr);
   }
 
   static jvmtiError GetTopThreadGroups(jvmtiEnv* env,
@@ -264,6 +280,7 @@
   }
 
   static jvmtiError PopFrame(jvmtiEnv* env, jthread thread) {
+    ENSURE_HAS_CAP(env, can_pop_frame);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -276,30 +293,37 @@
   }
 
   static jvmtiError NotifyFramePop(jvmtiEnv* env, jthread thread, jint depth) {
+    ENSURE_HAS_CAP(env, can_generate_frame_pop_events);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError ForceEarlyReturnObject(jvmtiEnv* env, jthread thread, jobject value) {
+    ENSURE_HAS_CAP(env, can_force_early_return);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError ForceEarlyReturnInt(jvmtiEnv* env, jthread thread, jint value) {
+    ENSURE_HAS_CAP(env, can_force_early_return);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError ForceEarlyReturnLong(jvmtiEnv* env, jthread thread, jlong value) {
+    ENSURE_HAS_CAP(env, can_force_early_return);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError ForceEarlyReturnFloat(jvmtiEnv* env, jthread thread, jfloat value) {
+    ENSURE_HAS_CAP(env, can_force_early_return);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError ForceEarlyReturnDouble(jvmtiEnv* env, jthread thread, jdouble value) {
+    ENSURE_HAS_CAP(env, can_force_early_return);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError ForceEarlyReturnVoid(jvmtiEnv* env, jthread thread) {
+    ENSURE_HAS_CAP(env, can_force_early_return);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -309,6 +333,7 @@
                                      jobject initial_object,
                                      const jvmtiHeapCallbacks* callbacks,
                                      const void* user_data) {
+    ENSURE_HAS_CAP(env, can_tag_objects);
     HeapUtil heap_util(&gObjectTagTable);
     return heap_util.FollowReferences(env,
                                       heap_filter,
@@ -395,6 +420,7 @@
       jobject object,
       jvmtiObjectReferenceCallback object_reference_callback,
       const void* user_data) {
+    ENSURE_HAS_CAP(env, can_tag_objects);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -403,6 +429,7 @@
                                                 jvmtiStackReferenceCallback stack_ref_callback,
                                                 jvmtiObjectReferenceCallback object_ref_callback,
                                                 const void* user_data) {
+    ENSURE_HAS_CAP(env, can_tag_objects);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -410,6 +437,7 @@
                                     jvmtiHeapObjectFilter object_filter,
                                     jvmtiHeapObjectCallback heap_object_callback,
                                     const void* user_data) {
+    ENSURE_HAS_CAP(env, can_tag_objects);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -418,6 +446,7 @@
                                                 jvmtiHeapObjectFilter object_filter,
                                                 jvmtiHeapObjectCallback heap_object_callback,
                                                 const void* user_data) {
+    ENSURE_HAS_CAP(env, can_tag_objects);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -426,6 +455,7 @@
                                    jint depth,
                                    jint slot,
                                    jobject* value_ptr) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -433,6 +463,7 @@
                                      jthread thread,
                                      jint depth,
                                      jobject* value_ptr) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -441,6 +472,7 @@
                                 jint depth,
                                 jint slot,
                                 jint* value_ptr) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -449,6 +481,7 @@
                                  jint depth,
                                  jint slot,
                                  jlong* value_ptr) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -457,6 +490,7 @@
                                   jint depth,
                                   jint slot,
                                   jfloat* value_ptr) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -465,6 +499,7 @@
                                    jint depth,
                                    jint slot,
                                    jdouble* value_ptr) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -473,6 +508,7 @@
                                    jint depth,
                                    jint slot,
                                    jobject value) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -481,6 +517,7 @@
                                 jint depth,
                                 jint slot,
                                 jint value) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -489,6 +526,7 @@
                                  jint depth,
                                  jint slot,
                                  jlong value) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -497,6 +535,7 @@
                                   jint depth,
                                   jint slot,
                                   jfloat value) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -505,30 +544,37 @@
                                    jint depth,
                                    jint slot,
                                    jdouble value) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError SetBreakpoint(jvmtiEnv* env, jmethodID method, jlocation location) {
+    ENSURE_HAS_CAP(env, can_generate_breakpoint_events);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError ClearBreakpoint(jvmtiEnv* env, jmethodID method, jlocation location) {
+    ENSURE_HAS_CAP(env, can_generate_breakpoint_events);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError SetFieldAccessWatch(jvmtiEnv* env, jclass klass, jfieldID field) {
+    ENSURE_HAS_CAP(env, can_generate_field_access_events);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError ClearFieldAccessWatch(jvmtiEnv* env, jclass klass, jfieldID field) {
+    ENSURE_HAS_CAP(env, can_generate_field_access_events);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError SetFieldModificationWatch(jvmtiEnv* env, jclass klass, jfieldID field) {
+    ENSURE_HAS_CAP(env, can_generate_field_modification_events);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError ClearFieldModificationWatch(jvmtiEnv* env, jclass klass, jfieldID field) {
+    ENSURE_HAS_CAP(env, can_generate_field_modification_events);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -541,7 +587,7 @@
                                           jobject initiating_loader,
                                           jint* class_count_ptr,
                                           jclass** classes_ptr) {
-    return ERR(NOT_IMPLEMENTED);
+    return ClassUtil::GetClassLoaderClasses(env, initiating_loader, class_count_ptr, classes_ptr);
   }
 
   static jvmtiError GetClassSignature(jvmtiEnv* env,
@@ -556,6 +602,7 @@
   }
 
   static jvmtiError GetSourceFileName(jvmtiEnv* env, jclass klass, char** source_name_ptr) {
+    ENSURE_HAS_CAP(env, can_get_source_file_name);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -588,7 +635,7 @@
                                            jclass klass,
                                            jint* minor_version_ptr,
                                            jint* major_version_ptr) {
-    return ERR(NOT_IMPLEMENTED);
+    return ClassUtil::GetClassVersionNumbers(env, klass, minor_version_ptr, major_version_ptr);
   }
 
   static jvmtiError GetConstantPool(jvmtiEnv* env,
@@ -596,6 +643,7 @@
                                     jint* constant_pool_count_ptr,
                                     jint* constant_pool_byte_count_ptr,
                                     unsigned char** constant_pool_bytes_ptr) {
+    ENSURE_HAS_CAP(env, can_get_constant_pool);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -622,16 +670,29 @@
   static jvmtiError GetSourceDebugExtension(jvmtiEnv* env,
                                             jclass klass,
                                             char** source_debug_extension_ptr) {
+    ENSURE_HAS_CAP(env, can_get_source_debug_extension);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError RetransformClasses(jvmtiEnv* env, jint class_count, const jclass* classes) {
-    return ERR(NOT_IMPLEMENTED);
+    ENSURE_HAS_CAP(env, can_retransform_classes);
+    std::string error_msg;
+    jvmtiError res = Transformer::RetransformClasses(ArtJvmTiEnv::AsArtJvmTiEnv(env),
+                                                     art::Runtime::Current(),
+                                                     art::Thread::Current(),
+                                                     class_count,
+                                                     classes,
+                                                     &error_msg);
+    if (res != OK) {
+      LOG(WARNING) << "FAILURE TO RETRANFORM " << error_msg;
+    }
+    return res;
   }
 
   static jvmtiError RedefineClasses(jvmtiEnv* env,
                                     jint class_count,
                                     const jvmtiClassDefinition* class_definitions) {
+    ENSURE_HAS_CAP(env, can_redefine_classes);
     std::string error_msg;
     jvmtiError res = Redefiner::RedefineClasses(ArtJvmTiEnv::AsArtJvmTiEnv(env),
                                                 art::Runtime::Current(),
@@ -656,6 +717,7 @@
   static jvmtiError GetObjectMonitorUsage(jvmtiEnv* env,
                                           jobject object,
                                           jvmtiMonitorUsage* info_ptr) {
+    ENSURE_HAS_CAP(env, can_get_monitor_info);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -686,6 +748,7 @@
                                      jclass klass,
                                      jfieldID field,
                                      jboolean* is_synthetic_ptr) {
+    ENSURE_HAS_CAP(env, can_get_synthetic_attribute);
     return FieldUtil::IsFieldSynthetic(env, klass, field, is_synthetic_ptr);
   }
 
@@ -725,6 +788,7 @@
                                        jmethodID method,
                                        jint* entry_count_ptr,
                                        jvmtiLineNumberEntry** table_ptr) {
+    ENSURE_HAS_CAP(env, can_get_line_numbers);
     return MethodUtil::GetLineNumberTable(env, method, entry_count_ptr, table_ptr);
   }
 
@@ -739,6 +803,7 @@
                                           jmethodID method,
                                           jint* entry_count_ptr,
                                           jvmtiLocalVariableEntry** table_ptr) {
+    ENSURE_HAS_CAP(env, can_access_local_variables);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -746,6 +811,7 @@
                                  jmethodID method,
                                  jint* bytecode_count_ptr,
                                  unsigned char** bytecodes_ptr) {
+    ENSURE_HAS_CAP(env, can_get_bytecodes);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -754,6 +820,7 @@
   }
 
   static jvmtiError IsMethodSynthetic(jvmtiEnv* env, jmethodID method, jboolean* is_synthetic_ptr) {
+    ENSURE_HAS_CAP(env, can_get_synthetic_attribute);
     return MethodUtil::IsMethodSynthetic(env, method, is_synthetic_ptr);
   }
 
@@ -762,10 +829,12 @@
   }
 
   static jvmtiError SetNativeMethodPrefix(jvmtiEnv* env, const char* prefix) {
+    ENSURE_HAS_CAP(env, can_set_native_method_prefix);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError SetNativeMethodPrefixes(jvmtiEnv* env, jint prefix_count, char** prefixes) {
+    ENSURE_HAS_CAP(env, can_set_native_method_prefix);
     return ERR(NOT_IMPLEMENTED);
   }
 
@@ -798,11 +867,11 @@
   }
 
   static jvmtiError SetJNIFunctionTable(jvmtiEnv* env, const jniNativeInterface* function_table) {
-    return ERR(NOT_IMPLEMENTED);
+    return JNIUtil::SetJNIFunctionTable(env, function_table);
   }
 
   static jvmtiError GetJNIFunctionTable(jvmtiEnv* env, jniNativeInterface** function_table) {
-    return ERR(NOT_IMPLEMENTED);
+    return JNIUtil::GetJNIFunctionTable(env, function_table);
   }
 
   // TODO: This will require locking, so that an agent can't remove callbacks when we're dispatching
@@ -838,7 +907,6 @@
                                              jthread event_thread,
                                              ...) {
     ENSURE_VALID_ENV(env);
-    // TODO: Check for capabilities.
     art::Thread* art_thread = nullptr;
     if (event_thread != nullptr) {
       // TODO: Need non-aborting call here, to return JVMTI_ERROR_INVALID_THREAD.
@@ -853,7 +921,8 @@
       }
     }
 
-    return gEventHandler.SetEvent(ArtJvmTiEnv::AsArtJvmTiEnv(env), art_thread, event_type, mode);
+    ArtJvmTiEnv* art_env = ArtJvmTiEnv::AsArtJvmTiEnv(env);
+    return gEventHandler.SetEvent(art_env, art_thread, GetArtJvmtiEvent(art_env, event_type), mode);
   }
 
   static jvmtiError GenerateEvents(jvmtiEnv* env, jvmtiEvent event_type) {
@@ -899,11 +968,15 @@
     ENSURE_NON_NULL(capabilities_ptr);
     ArtJvmTiEnv* art_env = static_cast<ArtJvmTiEnv*>(env);
     jvmtiError ret = OK;
+    jvmtiCapabilities changed;
 #define ADD_CAPABILITY(e) \
     do { \
       if (capabilities_ptr->e == 1) { \
         if (kPotentialCapabilities.e == 1) { \
-          art_env->capabilities.e = 1;\
+          if (art_env->capabilities.e != 1) { \
+            art_env->capabilities.e = 1; \
+            changed.e = 1; \
+          }\
         } else { \
           ret = ERR(NOT_AVAILABLE); \
         } \
@@ -952,6 +1025,9 @@
     ADD_CAPABILITY(can_generate_resource_exhaustion_heap_events);
     ADD_CAPABILITY(can_generate_resource_exhaustion_threads_events);
 #undef ADD_CAPABILITY
+    gEventHandler.HandleChangedCapabilities(ArtJvmTiEnv::AsArtJvmTiEnv(env),
+                                            changed,
+                                            /*added*/true);
     return ret;
   }
 
@@ -960,10 +1036,14 @@
     ENSURE_VALID_ENV(env);
     ENSURE_NON_NULL(capabilities_ptr);
     ArtJvmTiEnv* art_env = reinterpret_cast<ArtJvmTiEnv*>(env);
+    jvmtiCapabilities changed;
 #define DEL_CAPABILITY(e) \
     do { \
       if (capabilities_ptr->e == 1) { \
-        art_env->capabilities.e = 0;\
+        if (art_env->capabilities.e == 1) { \
+          art_env->capabilities.e = 0;\
+          changed.e = 1; \
+        } \
       } \
     } while (false)
 
@@ -1009,6 +1089,9 @@
     DEL_CAPABILITY(can_generate_resource_exhaustion_heap_events);
     DEL_CAPABILITY(can_generate_resource_exhaustion_threads_events);
 #undef DEL_CAPABILITY
+    gEventHandler.HandleChangedCapabilities(ArtJvmTiEnv::AsArtJvmTiEnv(env),
+                                            changed,
+                                            /*added*/false);
     return OK;
   }
 
@@ -1021,39 +1104,43 @@
   }
 
   static jvmtiError GetCurrentThreadCpuTimerInfo(jvmtiEnv* env, jvmtiTimerInfo* info_ptr) {
+    ENSURE_HAS_CAP(env, can_get_current_thread_cpu_time);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError GetCurrentThreadCpuTime(jvmtiEnv* env, jlong* nanos_ptr) {
+    ENSURE_HAS_CAP(env, can_get_current_thread_cpu_time);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError GetThreadCpuTimerInfo(jvmtiEnv* env, jvmtiTimerInfo* info_ptr) {
+    ENSURE_HAS_CAP(env, can_get_thread_cpu_time);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError GetThreadCpuTime(jvmtiEnv* env, jthread thread, jlong* nanos_ptr) {
+    ENSURE_HAS_CAP(env, can_get_thread_cpu_time);
     return ERR(NOT_IMPLEMENTED);
   }
 
   static jvmtiError GetTimerInfo(jvmtiEnv* env, jvmtiTimerInfo* info_ptr) {
-    return ERR(NOT_IMPLEMENTED);
+    return TimerUtil::GetTimerInfo(env, info_ptr);
   }
 
   static jvmtiError GetTime(jvmtiEnv* env, jlong* nanos_ptr) {
-    return ERR(NOT_IMPLEMENTED);
+    return TimerUtil::GetTime(env, nanos_ptr);
   }
 
   static jvmtiError GetAvailableProcessors(jvmtiEnv* env, jint* processor_count_ptr) {
-    return ERR(NOT_IMPLEMENTED);
+    return TimerUtil::GetAvailableProcessors(env, processor_count_ptr);
   }
 
   static jvmtiError AddToBootstrapClassLoaderSearch(jvmtiEnv* env, const char* segment) {
-    return ERR(NOT_IMPLEMENTED);
+    return SearchUtil::AddToBootstrapClassLoaderSearch(env, segment);
   }
 
   static jvmtiError AddToSystemClassLoaderSearch(jvmtiEnv* env, const char* segment) {
-    return ERR(NOT_IMPLEMENTED);
+    return SearchUtil::AddToSystemClassLoaderSearch(env, segment);
   }
 
   static jvmtiError GetSystemProperties(jvmtiEnv* env, jint* count_ptr, char*** property_ptr) {
@@ -1069,11 +1156,12 @@
   }
 
   static jvmtiError GetPhase(jvmtiEnv* env, jvmtiPhase* phase_ptr) {
-    return ERR(NOT_IMPLEMENTED);
+    return PhaseUtil::GetPhase(env, phase_ptr);
   }
 
   static jvmtiError DisposeEnvironment(jvmtiEnv* env) {
     ENSURE_VALID_ENV(env);
+    gEventHandler.RemoveArtJvmTiEnv(ArtJvmTiEnv::AsArtJvmTiEnv(env));
     delete env;
     return OK;
   }
@@ -1174,83 +1262,66 @@
   }
 
   static jvmtiError SetVerboseFlag(jvmtiEnv* env, jvmtiVerboseFlag flag, jboolean value) {
-    return ERR(NOT_IMPLEMENTED);
+    if (flag == jvmtiVerboseFlag::JVMTI_VERBOSE_OTHER) {
+      // OTHER is special, as it's 0, so can't do a bit check.
+      bool val = (value == JNI_TRUE) ? true : false;
+
+      art::gLogVerbosity.collector = val;
+      art::gLogVerbosity.compiler = val;
+      art::gLogVerbosity.deopt = val;
+      art::gLogVerbosity.heap = val;
+      art::gLogVerbosity.jdwp = val;
+      art::gLogVerbosity.jit = val;
+      art::gLogVerbosity.monitor = val;
+      art::gLogVerbosity.oat = val;
+      art::gLogVerbosity.profiler = val;
+      art::gLogVerbosity.signals = val;
+      art::gLogVerbosity.simulator = val;
+      art::gLogVerbosity.startup = val;
+      art::gLogVerbosity.third_party_jni = val;
+      art::gLogVerbosity.threads = val;
+      art::gLogVerbosity.verifier = val;
+      art::gLogVerbosity.image = val;
+
+      // Note: can't switch systrace_lock_logging. That requires changing entrypoints.
+
+      art::gLogVerbosity.agents = val;
+    } else {
+      // Spec isn't clear whether "flag" is a mask or supposed to be single. We implement the mask
+      // semantics.
+      constexpr std::underlying_type<jvmtiVerboseFlag>::type kMask =
+          jvmtiVerboseFlag::JVMTI_VERBOSE_GC |
+          jvmtiVerboseFlag::JVMTI_VERBOSE_CLASS |
+          jvmtiVerboseFlag::JVMTI_VERBOSE_JNI;
+      if ((flag & ~kMask) != 0) {
+        return ERR(ILLEGAL_ARGUMENT);
+      }
+
+      bool val = (value == JNI_TRUE) ? true : false;
+
+      if ((flag & jvmtiVerboseFlag::JVMTI_VERBOSE_GC) != 0) {
+        art::gLogVerbosity.gc = val;
+      }
+
+      if ((flag & jvmtiVerboseFlag::JVMTI_VERBOSE_CLASS) != 0) {
+        art::gLogVerbosity.class_linker = val;
+      }
+
+      if ((flag & jvmtiVerboseFlag::JVMTI_VERBOSE_JNI) != 0) {
+        art::gLogVerbosity.jni = val;
+      }
+    }
+
+    return ERR(NONE);
   }
 
   static jvmtiError GetJLocationFormat(jvmtiEnv* env, jvmtiJlocationFormat* format_ptr) {
-    return ERR(NOT_IMPLEMENTED);
-  }
-
-  // TODO Remove this once events are working.
-  static jvmtiError RetransformClassWithHook(jvmtiEnv* env,
-                                             jclass klass,
-                                             jvmtiEventClassFileLoadHook hook) {
-    std::vector<jclass> classes;
-    classes.push_back(klass);
-    return RetransformClassesWithHook(reinterpret_cast<ArtJvmTiEnv*>(env), classes, hook);
-  }
-
-  // TODO This will be called by the event handler for the art::ti Event Load Event
-  static jvmtiError RetransformClassesWithHook(ArtJvmTiEnv* env,
-                                               const std::vector<jclass>& classes,
-                                               jvmtiEventClassFileLoadHook hook) {
-    if (!IsValidEnv(env)) {
-      return ERR(INVALID_ENVIRONMENT);
+    // Report BCI as jlocation format. We report dex bytecode indices.
+    if (format_ptr == nullptr) {
+      return ERR(NULL_POINTER);
     }
-    jvmtiError res = OK;
-    std::string error;
-    for (jclass klass : classes) {
-      JNIEnv* jni_env = nullptr;
-      jobject loader = nullptr;
-      std::string name;
-      jobject protection_domain = nullptr;
-      jint data_len = 0;
-      unsigned char* dex_data = nullptr;
-      jvmtiError ret = OK;
-      std::string location;
-      if ((ret = GetTransformationData(env,
-                                       klass,
-                                       /*out*/&location,
-                                       /*out*/&jni_env,
-                                       /*out*/&loader,
-                                       /*out*/&name,
-                                       /*out*/&protection_domain,
-                                       /*out*/&data_len,
-                                       /*out*/&dex_data)) != OK) {
-        // TODO Do something more here? Maybe give log statements?
-        return ret;
-      }
-      jint new_data_len = 0;
-      unsigned char* new_dex_data = nullptr;
-      hook(env,
-           jni_env,
-           klass,
-           loader,
-           name.c_str(),
-           protection_domain,
-           data_len,
-           dex_data,
-           /*out*/&new_data_len,
-           /*out*/&new_dex_data);
-      // Check if anything actually changed.
-      if ((new_data_len != 0 || new_dex_data != nullptr) && new_dex_data != dex_data) {
-        jvmtiClassDefinition def = { klass, new_data_len, new_dex_data };
-        res = Redefiner::RedefineClasses(env,
-                                         art::Runtime::Current(),
-                                         art::Thread::Current(),
-                                         1,
-                                         &def,
-                                         &error);
-        env->Deallocate(new_dex_data);
-      }
-      // Deallocate the old dex data.
-      env->Deallocate(dex_data);
-      if (res != OK) {
-        LOG(ERROR) << "FAILURE TO REDEFINE " << error;
-        return res;
-      }
-    }
-    return OK;
+    *format_ptr = jvmtiJlocationFormat::JVMTI_JLOCATION_JVMBCI;
+    return ERR(NONE);
   }
 };
 
@@ -1287,17 +1358,35 @@
 // The plugin initialization function. This adds the jvmti environment.
 extern "C" bool ArtPlugin_Initialize() {
   art::Runtime* runtime = art::Runtime::Current();
+
+  if (runtime->IsStarted()) {
+    PhaseUtil::SetToLive();
+  } else {
+    PhaseUtil::SetToOnLoad();
+  }
+  PhaseUtil::Register(&gEventHandler);
+  ThreadUtil::Register(&gEventHandler);
+  ClassUtil::Register(&gEventHandler);
+  DumpUtil::Register(&gEventHandler);
+
   runtime->GetJavaVM()->AddEnvironmentHook(GetEnvHandler);
   runtime->AddSystemWeakHolder(&gObjectTagTable);
+
+  return true;
+}
+
+extern "C" bool ArtPlugin_Deinitialize() {
+  PhaseUtil::Unregister();
+  ThreadUtil::Unregister();
+  ClassUtil::Unregister();
+  DumpUtil::Unregister();
+
   return true;
 }
 
 // The actual struct holding all of the entrypoints into the jvmti interface.
 const jvmtiInterface_1 gJvmtiInterface = {
-  // SPECIAL FUNCTION: RetransformClassWithHook Is normally reserved1
-  // TODO Remove once we have events working.
-  reinterpret_cast<void*>(JvmtiFunctions::RetransformClassWithHook),
-  // nullptr,  // reserved1
+  nullptr,  // reserved1
   JvmtiFunctions::SetEventNotificationMode,
   nullptr,  // reserved3
   JvmtiFunctions::GetAllThreads,
diff --git a/runtime/openjdkjvmti/art_jvmti.h b/runtime/openjdkjvmti/art_jvmti.h
index 5eadc5a..106165c 100644
--- a/runtime/openjdkjvmti/art_jvmti.h
+++ b/runtime/openjdkjvmti/art_jvmti.h
@@ -36,6 +36,7 @@
 
 #include <jni.h>
 
+#include "base/array_slice.h"
 #include "base/casts.h"
 #include "base/logging.h"
 #include "base/macros.h"
@@ -47,6 +48,7 @@
 namespace openjdkjvmti {
 
 extern const jvmtiInterface_1 gJvmtiInterface;
+extern EventHandler gEventHandler;
 
 // A structure that is a jvmtiEnv with additional information for the runtime.
 struct ArtJvmTiEnv : public jvmtiEnv {
@@ -112,6 +114,21 @@
 }
 
 ALWAYS_INLINE
+static inline jvmtiError CopyDataIntoJvmtiBuffer(ArtJvmTiEnv* env,
+                                                 const unsigned char* source,
+                                                 jint len,
+                                                 /*out*/unsigned char** dest) {
+  jvmtiError res = env->Allocate(len, dest);
+  if (res != OK) {
+    return res;
+  }
+  memcpy(reinterpret_cast<void*>(*dest),
+         reinterpret_cast<const void*>(source),
+         len);
+  return OK;
+}
+
+ALWAYS_INLINE
 static inline jvmtiError CopyString(jvmtiEnv* env, const char* src, unsigned char** copy) {
   size_t len = strlen(src) + 1;
   unsigned char* buf;
@@ -129,15 +146,15 @@
     .can_generate_field_modification_events          = 0,
     .can_generate_field_access_events                = 0,
     .can_get_bytecodes                               = 0,
-    .can_get_synthetic_attribute                     = 0,
+    .can_get_synthetic_attribute                     = 1,
     .can_get_owned_monitor_info                      = 0,
     .can_get_current_contended_monitor               = 0,
     .can_get_monitor_info                            = 0,
     .can_pop_frame                                   = 0,
-    .can_redefine_classes                            = 0,
+    .can_redefine_classes                            = 1,
     .can_signal_thread                               = 0,
     .can_get_source_file_name                        = 0,
-    .can_get_line_numbers                            = 0,
+    .can_get_line_numbers                            = 1,
     .can_get_source_debug_extension                  = 0,
     .can_access_local_variables                      = 0,
     .can_maintain_original_method_order              = 0,
@@ -154,15 +171,15 @@
     .can_generate_all_class_hook_events              = 0,
     .can_generate_compiled_method_load_events        = 0,
     .can_generate_monitor_events                     = 0,
-    .can_generate_vm_object_alloc_events             = 0,
+    .can_generate_vm_object_alloc_events             = 1,
     .can_generate_native_method_bind_events          = 0,
-    .can_generate_garbage_collection_events          = 0,
-    .can_generate_object_free_events                 = 0,
+    .can_generate_garbage_collection_events          = 1,
+    .can_generate_object_free_events                 = 1,
     .can_force_early_return                          = 0,
     .can_get_owned_monitor_stack_depth_info          = 0,
     .can_get_constant_pool                           = 0,
     .can_set_native_method_prefix                    = 0,
-    .can_retransform_classes                         = 0,
+    .can_retransform_classes                         = 1,
     .can_retransform_any_class                       = 0,
     .can_generate_resource_exhaustion_heap_events    = 0,
     .can_generate_resource_exhaustion_threads_events = 0,
diff --git a/runtime/openjdkjvmti/events-inl.h b/runtime/openjdkjvmti/events-inl.h
index d027201..4f5eb0c 100644
--- a/runtime/openjdkjvmti/events-inl.h
+++ b/runtime/openjdkjvmti/events-inl.h
@@ -17,101 +17,163 @@
 #ifndef ART_RUNTIME_OPENJDKJVMTI_EVENTS_INL_H_
 #define ART_RUNTIME_OPENJDKJVMTI_EVENTS_INL_H_
 
+#include <array>
+
 #include "events.h"
 
 #include "art_jvmti.h"
 
 namespace openjdkjvmti {
 
-template <typename FnType>
-ALWAYS_INLINE static inline FnType* GetCallback(ArtJvmTiEnv* env, jvmtiEvent event) {
-  if (env->event_callbacks == nullptr) {
-    return nullptr;
+static inline ArtJvmtiEvent GetArtJvmtiEvent(ArtJvmTiEnv* env, jvmtiEvent e) {
+  if (UNLIKELY(e == JVMTI_EVENT_CLASS_FILE_LOAD_HOOK)) {
+    if (env->capabilities.can_retransform_classes) {
+      return ArtJvmtiEvent::kClassFileLoadHookRetransformable;
+    } else {
+      return ArtJvmtiEvent::kClassFileLoadHookNonRetransformable;
+    }
+  } else {
+    return static_cast<ArtJvmtiEvent>(e);
   }
-
-  // TODO: Add a type check. Can be done, for example, by an explicitly instantiated template
-  //       function.
-
-  switch (event) {
-    case JVMTI_EVENT_VM_INIT:
-      return reinterpret_cast<FnType*>(env->event_callbacks->VMInit);
-    case JVMTI_EVENT_VM_DEATH:
-      return reinterpret_cast<FnType*>(env->event_callbacks->VMDeath);
-    case JVMTI_EVENT_THREAD_START:
-      return reinterpret_cast<FnType*>(env->event_callbacks->ThreadStart);
-    case JVMTI_EVENT_THREAD_END:
-      return reinterpret_cast<FnType*>(env->event_callbacks->ThreadEnd);
-    case JVMTI_EVENT_CLASS_FILE_LOAD_HOOK:
-      return reinterpret_cast<FnType*>(env->event_callbacks->ClassFileLoadHook);
-    case JVMTI_EVENT_CLASS_LOAD:
-      return reinterpret_cast<FnType*>(env->event_callbacks->ClassLoad);
-    case JVMTI_EVENT_CLASS_PREPARE:
-      return reinterpret_cast<FnType*>(env->event_callbacks->ClassPrepare);
-    case JVMTI_EVENT_VM_START:
-      return reinterpret_cast<FnType*>(env->event_callbacks->VMStart);
-    case JVMTI_EVENT_EXCEPTION:
-      return reinterpret_cast<FnType*>(env->event_callbacks->Exception);
-    case JVMTI_EVENT_EXCEPTION_CATCH:
-      return reinterpret_cast<FnType*>(env->event_callbacks->ExceptionCatch);
-    case JVMTI_EVENT_SINGLE_STEP:
-      return reinterpret_cast<FnType*>(env->event_callbacks->SingleStep);
-    case JVMTI_EVENT_FRAME_POP:
-      return reinterpret_cast<FnType*>(env->event_callbacks->FramePop);
-    case JVMTI_EVENT_BREAKPOINT:
-      return reinterpret_cast<FnType*>(env->event_callbacks->Breakpoint);
-    case JVMTI_EVENT_FIELD_ACCESS:
-      return reinterpret_cast<FnType*>(env->event_callbacks->FieldAccess);
-    case JVMTI_EVENT_FIELD_MODIFICATION:
-      return reinterpret_cast<FnType*>(env->event_callbacks->FieldModification);
-    case JVMTI_EVENT_METHOD_ENTRY:
-      return reinterpret_cast<FnType*>(env->event_callbacks->MethodEntry);
-    case JVMTI_EVENT_METHOD_EXIT:
-      return reinterpret_cast<FnType*>(env->event_callbacks->MethodExit);
-    case JVMTI_EVENT_NATIVE_METHOD_BIND:
-      return reinterpret_cast<FnType*>(env->event_callbacks->NativeMethodBind);
-    case JVMTI_EVENT_COMPILED_METHOD_LOAD:
-      return reinterpret_cast<FnType*>(env->event_callbacks->CompiledMethodLoad);
-    case JVMTI_EVENT_COMPILED_METHOD_UNLOAD:
-      return reinterpret_cast<FnType*>(env->event_callbacks->CompiledMethodUnload);
-    case JVMTI_EVENT_DYNAMIC_CODE_GENERATED:
-      return reinterpret_cast<FnType*>(env->event_callbacks->DynamicCodeGenerated);
-    case JVMTI_EVENT_DATA_DUMP_REQUEST:
-      return reinterpret_cast<FnType*>(env->event_callbacks->DataDumpRequest);
-    case JVMTI_EVENT_MONITOR_WAIT:
-      return reinterpret_cast<FnType*>(env->event_callbacks->MonitorWait);
-    case JVMTI_EVENT_MONITOR_WAITED:
-      return reinterpret_cast<FnType*>(env->event_callbacks->MonitorWaited);
-    case JVMTI_EVENT_MONITOR_CONTENDED_ENTER:
-      return reinterpret_cast<FnType*>(env->event_callbacks->MonitorContendedEnter);
-    case JVMTI_EVENT_MONITOR_CONTENDED_ENTERED:
-      return reinterpret_cast<FnType*>(env->event_callbacks->MonitorContendedEntered);
-    case JVMTI_EVENT_RESOURCE_EXHAUSTED:
-      return reinterpret_cast<FnType*>(env->event_callbacks->ResourceExhausted);
-    case JVMTI_EVENT_GARBAGE_COLLECTION_START:
-      return reinterpret_cast<FnType*>(env->event_callbacks->GarbageCollectionStart);
-    case JVMTI_EVENT_GARBAGE_COLLECTION_FINISH:
-      return reinterpret_cast<FnType*>(env->event_callbacks->GarbageCollectionFinish);
-    case JVMTI_EVENT_OBJECT_FREE:
-      return reinterpret_cast<FnType*>(env->event_callbacks->ObjectFree);
-    case JVMTI_EVENT_VM_OBJECT_ALLOC:
-      return reinterpret_cast<FnType*>(env->event_callbacks->VMObjectAlloc);
-  }
-  return nullptr;
 }
 
-template <typename ...Args>
-inline void EventHandler::DispatchEvent(art::Thread* thread, jvmtiEvent event, Args... args) {
+namespace impl {
+
+// Infrastructure to achieve type safety for event dispatch.
+
+#define FORALL_EVENT_TYPES(fn)                                                       \
+  fn(VMInit,                  ArtJvmtiEvent::kVmInit)                                \
+  fn(VMDeath,                 ArtJvmtiEvent::kVmDeath)                               \
+  fn(ThreadStart,             ArtJvmtiEvent::kThreadStart)                           \
+  fn(ThreadEnd,               ArtJvmtiEvent::kThreadEnd)                             \
+  fn(ClassFileLoadHook,       ArtJvmtiEvent::kClassFileLoadHookRetransformable)      \
+  fn(ClassFileLoadHook,       ArtJvmtiEvent::kClassFileLoadHookNonRetransformable)   \
+  fn(ClassLoad,               ArtJvmtiEvent::kClassLoad)                             \
+  fn(ClassPrepare,            ArtJvmtiEvent::kClassPrepare)                          \
+  fn(VMStart,                 ArtJvmtiEvent::kVmStart)                               \
+  fn(Exception,               ArtJvmtiEvent::kException)                             \
+  fn(ExceptionCatch,          ArtJvmtiEvent::kExceptionCatch)                        \
+  fn(SingleStep,              ArtJvmtiEvent::kSingleStep)                            \
+  fn(FramePop,                ArtJvmtiEvent::kFramePop)                              \
+  fn(Breakpoint,              ArtJvmtiEvent::kBreakpoint)                            \
+  fn(FieldAccess,             ArtJvmtiEvent::kFieldAccess)                           \
+  fn(FieldModification,       ArtJvmtiEvent::kFieldModification)                     \
+  fn(MethodEntry,             ArtJvmtiEvent::kMethodEntry)                           \
+  fn(MethodExit,              ArtJvmtiEvent::kMethodExit)                            \
+  fn(NativeMethodBind,        ArtJvmtiEvent::kNativeMethodBind)                      \
+  fn(CompiledMethodLoad,      ArtJvmtiEvent::kCompiledMethodLoad)                    \
+  fn(CompiledMethodUnload,    ArtJvmtiEvent::kCompiledMethodUnload)                  \
+  fn(DynamicCodeGenerated,    ArtJvmtiEvent::kDynamicCodeGenerated)                  \
+  fn(DataDumpRequest,         ArtJvmtiEvent::kDataDumpRequest)                       \
+  fn(MonitorWait,             ArtJvmtiEvent::kMonitorWait)                           \
+  fn(MonitorWaited,           ArtJvmtiEvent::kMonitorWaited)                         \
+  fn(MonitorContendedEnter,   ArtJvmtiEvent::kMonitorContendedEnter)                 \
+  fn(MonitorContendedEntered, ArtJvmtiEvent::kMonitorContendedEntered)               \
+  fn(ResourceExhausted,       ArtJvmtiEvent::kResourceExhausted)                     \
+  fn(GarbageCollectionStart,  ArtJvmtiEvent::kGarbageCollectionStart)                \
+  fn(GarbageCollectionFinish, ArtJvmtiEvent::kGarbageCollectionFinish)               \
+  fn(ObjectFree,              ArtJvmtiEvent::kObjectFree)                            \
+  fn(VMObjectAlloc,           ArtJvmtiEvent::kVmObjectAlloc)
+
+template <ArtJvmtiEvent kEvent>
+struct EventFnType {
+};
+
+#define EVENT_FN_TYPE(name, enum_name)               \
+template <>                                          \
+struct EventFnType<enum_name> {                      \
+  using type = decltype(jvmtiEventCallbacks().name); \
+};
+
+FORALL_EVENT_TYPES(EVENT_FN_TYPE)
+
+#undef EVENT_FN_TYPE
+
+template <ArtJvmtiEvent kEvent>
+ALWAYS_INLINE inline typename EventFnType<kEvent>::type GetCallback(ArtJvmTiEnv* env);
+
+#define GET_CALLBACK(name, enum_name)                                     \
+template <>                                                               \
+ALWAYS_INLINE inline EventFnType<enum_name>::type GetCallback<enum_name>( \
+    ArtJvmTiEnv* env) {                                                   \
+  if (env->event_callbacks == nullptr) {                                  \
+    return nullptr;                                                       \
+  }                                                                       \
+  return env->event_callbacks->name;                                      \
+}
+
+FORALL_EVENT_TYPES(GET_CALLBACK)
+
+#undef GET_CALLBACK
+
+#undef FORALL_EVENT_TYPES
+
+}  // namespace impl
+
+// C++ does not allow partial template function specialization. The dispatch for our separated
+// ClassFileLoadHook event types is the same, so use this helper for code deduplication.
+// TODO Locking of some type!
+template <ArtJvmtiEvent kEvent>
+inline void EventHandler::DispatchClassFileLoadHookEvent(art::Thread* thread,
+                                                         JNIEnv* jnienv,
+                                                         jclass class_being_redefined,
+                                                         jobject loader,
+                                                         const char* name,
+                                                         jobject protection_domain,
+                                                         jint class_data_len,
+                                                         const unsigned char* class_data,
+                                                         jint* new_class_data_len,
+                                                         unsigned char** new_class_data) const {
+  static_assert(kEvent == ArtJvmtiEvent::kClassFileLoadHookRetransformable ||
+                kEvent == ArtJvmtiEvent::kClassFileLoadHookNonRetransformable, "Unsupported event");
+  jint current_len = class_data_len;
+  unsigned char* current_class_data = const_cast<unsigned char*>(class_data);
+  ArtJvmTiEnv* last_env = nullptr;
+  for (ArtJvmTiEnv* env : envs) {
+    if (ShouldDispatch<kEvent>(env, thread)) {
+      jint new_len = 0;
+      unsigned char* new_data = nullptr;
+      auto callback = impl::GetCallback<kEvent>(env);
+      callback(env,
+               jnienv,
+               class_being_redefined,
+               loader,
+               name,
+               protection_domain,
+               current_len,
+               current_class_data,
+               &new_len,
+               &new_data);
+      if (new_data != nullptr && new_data != current_class_data) {
+        // Destroy the data the last transformer made. We skip this if the previous state was the
+        // initial one since we don't know here which jvmtiEnv allocated it.
+        // NB Currently this doesn't matter since all allocations just go to malloc but in the
+        // future we might have jvmtiEnv's keep track of their allocations for leak-checking.
+        if (last_env != nullptr) {
+          last_env->Deallocate(current_class_data);
+        }
+        last_env = env;
+        current_class_data = new_data;
+        current_len = new_len;
+      }
+    }
+  }
+  if (last_env != nullptr) {
+    *new_class_data_len = current_len;
+    *new_class_data = current_class_data;
+  }
+}
+
+// Our goal for DispatchEvent: Do not allow implicit type conversion. Types of ...args must match
+// exactly the argument types of the corresponding Jvmti kEvent function pointer.
+
+template <ArtJvmtiEvent kEvent, typename ...Args>
+inline void EventHandler::DispatchEvent(art::Thread* thread,
+                                        Args... args) const {
   using FnType = void(jvmtiEnv*, Args...);
   for (ArtJvmTiEnv* env : envs) {
-    bool dispatch = env->event_masks.global_event_mask.Test(event);
-
-    if (!dispatch && thread != nullptr && env->event_masks.unioned_thread_event_mask.Test(event)) {
-      EventMask* mask = env->event_masks.GetEventMaskOrNull(thread);
-      dispatch = mask != nullptr && mask->Test(event);
-    }
-
-    if (dispatch) {
-      FnType* callback = GetCallback<FnType>(env, event);
+    if (ShouldDispatch<kEvent>(env, thread)) {
+      FnType* callback = impl::GetCallback<kEvent>(env);
       if (callback != nullptr) {
         (*callback)(env, args...);
       }
@@ -119,6 +181,104 @@
   }
 }
 
+// C++ does not allow partial template function specialization. The dispatch for our separated
+// ClassFileLoadHook event types is the same, and in the DispatchClassFileLoadHookEvent helper.
+// The following two DispatchEvent specializations dispatch to it.
+template <>
+inline void EventHandler::DispatchEvent<ArtJvmtiEvent::kClassFileLoadHookRetransformable>(
+    art::Thread* thread,
+    JNIEnv* jnienv,
+    jclass class_being_redefined,
+    jobject loader,
+    const char* name,
+    jobject protection_domain,
+    jint class_data_len,
+    const unsigned char* class_data,
+    jint* new_class_data_len,
+    unsigned char** new_class_data) const {
+  return DispatchClassFileLoadHookEvent<ArtJvmtiEvent::kClassFileLoadHookRetransformable>(
+      thread,
+      jnienv,
+      class_being_redefined,
+      loader,
+      name,
+      protection_domain,
+      class_data_len,
+      class_data,
+      new_class_data_len,
+      new_class_data);
+}
+template <>
+inline void EventHandler::DispatchEvent<ArtJvmtiEvent::kClassFileLoadHookNonRetransformable>(
+    art::Thread* thread,
+    JNIEnv* jnienv,
+    jclass class_being_redefined,
+    jobject loader,
+    const char* name,
+    jobject protection_domain,
+    jint class_data_len,
+    const unsigned char* class_data,
+    jint* new_class_data_len,
+    unsigned char** new_class_data) const {
+  return DispatchClassFileLoadHookEvent<ArtJvmtiEvent::kClassFileLoadHookNonRetransformable>(
+      thread,
+      jnienv,
+      class_being_redefined,
+      loader,
+      name,
+      protection_domain,
+      class_data_len,
+      class_data,
+      new_class_data_len,
+      new_class_data);
+}
+
+template <ArtJvmtiEvent kEvent>
+inline bool EventHandler::ShouldDispatch(ArtJvmTiEnv* env,
+                                         art::Thread* thread) {
+  bool dispatch = env->event_masks.global_event_mask.Test(kEvent);
+
+  if (!dispatch && thread != nullptr && env->event_masks.unioned_thread_event_mask.Test(kEvent)) {
+    EventMask* mask = env->event_masks.GetEventMaskOrNull(thread);
+    dispatch = mask != nullptr && mask->Test(kEvent);
+  }
+  return dispatch;
+}
+
+inline void EventHandler::RecalculateGlobalEventMask(ArtJvmtiEvent event) {
+  bool union_value = false;
+  for (const ArtJvmTiEnv* stored_env : envs) {
+    union_value |= stored_env->event_masks.global_event_mask.Test(event);
+    union_value |= stored_env->event_masks.unioned_thread_event_mask.Test(event);
+    if (union_value) {
+      break;
+    }
+  }
+  global_mask.Set(event, union_value);
+}
+
+inline bool EventHandler::NeedsEventUpdate(ArtJvmTiEnv* env,
+                                           const jvmtiCapabilities& caps,
+                                           bool added) {
+  ArtJvmtiEvent event = added ? ArtJvmtiEvent::kClassFileLoadHookNonRetransformable
+                              : ArtJvmtiEvent::kClassFileLoadHookRetransformable;
+  return caps.can_retransform_classes == 1 &&
+      IsEventEnabledAnywhere(event) &&
+      env->event_masks.IsEnabledAnywhere(event);
+}
+
+inline void EventHandler::HandleChangedCapabilities(ArtJvmTiEnv* env,
+                                                    const jvmtiCapabilities& caps,
+                                                    bool added) {
+  if (UNLIKELY(NeedsEventUpdate(env, caps, added))) {
+    env->event_masks.HandleChangedCapabilities(caps, added);
+    if (caps.can_retransform_classes == 1) {
+      RecalculateGlobalEventMask(ArtJvmtiEvent::kClassFileLoadHookRetransformable);
+      RecalculateGlobalEventMask(ArtJvmtiEvent::kClassFileLoadHookNonRetransformable);
+    }
+  }
+}
+
 }  // namespace openjdkjvmti
 
 #endif  // ART_RUNTIME_OPENJDKJVMTI_EVENTS_INL_H_
diff --git a/runtime/openjdkjvmti/events.cc b/runtime/openjdkjvmti/events.cc
index 12692a1..34492a9 100644
--- a/runtime/openjdkjvmti/events.cc
+++ b/runtime/openjdkjvmti/events.cc
@@ -47,6 +47,10 @@
 
 namespace openjdkjvmti {
 
+bool EventMasks::IsEnabledAnywhere(ArtJvmtiEvent event) {
+  return global_event_mask.Test(event) || unioned_thread_event_mask.Test(event);
+}
+
 EventMask& EventMasks::GetEventMask(art::Thread* thread) {
   if (thread == nullptr) {
     return global_event_mask;
@@ -83,7 +87,7 @@
 }
 
 
-void EventMasks::EnableEvent(art::Thread* thread, jvmtiEvent event) {
+void EventMasks::EnableEvent(art::Thread* thread, ArtJvmtiEvent event) {
   DCHECK(EventMask::EventIsInRange(event));
   GetEventMask(thread).Set(event);
   if (thread != nullptr) {
@@ -91,7 +95,7 @@
   }
 }
 
-void EventMasks::DisableEvent(art::Thread* thread, jvmtiEvent event) {
+void EventMasks::DisableEvent(art::Thread* thread, ArtJvmtiEvent event) {
   DCHECK(EventMask::EventIsInRange(event));
   GetEventMask(thread).Set(event, false);
   if (thread != nullptr) {
@@ -107,20 +111,61 @@
   }
 }
 
+void EventMasks::HandleChangedCapabilities(const jvmtiCapabilities& caps, bool caps_added) {
+  if (UNLIKELY(caps.can_retransform_classes == 1)) {
+    // If we are giving this env the retransform classes cap we need to switch all events of
+    // NonTransformable to Transformable and vice versa.
+    ArtJvmtiEvent to_remove = caps_added ? ArtJvmtiEvent::kClassFileLoadHookNonRetransformable
+                                         : ArtJvmtiEvent::kClassFileLoadHookRetransformable;
+    ArtJvmtiEvent to_add = caps_added ? ArtJvmtiEvent::kClassFileLoadHookRetransformable
+                                      : ArtJvmtiEvent::kClassFileLoadHookNonRetransformable;
+    if (global_event_mask.Test(to_remove)) {
+      CHECK(!global_event_mask.Test(to_add));
+      global_event_mask.Set(to_remove, false);
+      global_event_mask.Set(to_add, true);
+    }
+
+    if (unioned_thread_event_mask.Test(to_remove)) {
+      CHECK(!unioned_thread_event_mask.Test(to_add));
+      unioned_thread_event_mask.Set(to_remove, false);
+      unioned_thread_event_mask.Set(to_add, true);
+    }
+    for (auto thread_mask : thread_event_masks) {
+      if (thread_mask.second.Test(to_remove)) {
+        CHECK(!thread_mask.second.Test(to_add));
+        thread_mask.second.Set(to_remove, false);
+        thread_mask.second.Set(to_add, true);
+      }
+    }
+  }
+}
+
 void EventHandler::RegisterArtJvmTiEnv(ArtJvmTiEnv* env) {
   envs.push_back(env);
 }
 
-static bool IsThreadControllable(jvmtiEvent event) {
+void EventHandler::RemoveArtJvmTiEnv(ArtJvmTiEnv* env) {
+  auto it = std::find(envs.begin(), envs.end(), env);
+  if (it != envs.end()) {
+    envs.erase(it);
+    for (size_t i = static_cast<size_t>(ArtJvmtiEvent::kMinEventTypeVal);
+         i <= static_cast<size_t>(ArtJvmtiEvent::kMaxEventTypeVal);
+         ++i) {
+      RecalculateGlobalEventMask(static_cast<ArtJvmtiEvent>(i));
+    }
+  }
+}
+
+static bool IsThreadControllable(ArtJvmtiEvent event) {
   switch (event) {
-    case JVMTI_EVENT_VM_INIT:
-    case JVMTI_EVENT_VM_START:
-    case JVMTI_EVENT_VM_DEATH:
-    case JVMTI_EVENT_THREAD_START:
-    case JVMTI_EVENT_COMPILED_METHOD_LOAD:
-    case JVMTI_EVENT_COMPILED_METHOD_UNLOAD:
-    case JVMTI_EVENT_DYNAMIC_CODE_GENERATED:
-    case JVMTI_EVENT_DATA_DUMP_REQUEST:
+    case ArtJvmtiEvent::kVmInit:
+    case ArtJvmtiEvent::kVmStart:
+    case ArtJvmtiEvent::kVmDeath:
+    case ArtJvmtiEvent::kThreadStart:
+    case ArtJvmtiEvent::kCompiledMethodLoad:
+    case ArtJvmtiEvent::kCompiledMethodUnload:
+    case ArtJvmtiEvent::kDynamicCodeGenerated:
+    case ArtJvmtiEvent::kDataDumpRequest:
       return false;
 
     default:
@@ -136,7 +181,7 @@
       OVERRIDE REQUIRES_SHARED(art::Locks::mutator_lock_) {
     DCHECK_EQ(self, art::Thread::Current());
 
-    if (handler_->IsEventEnabledAnywhere(JVMTI_EVENT_VM_OBJECT_ALLOC)) {
+    if (handler_->IsEventEnabledAnywhere(ArtJvmtiEvent::kVmObjectAlloc)) {
       art::StackHandleScope<1> hs(self);
       auto h = hs.NewHandleWrapper(obj);
       // jvmtiEventVMObjectAlloc parameters:
@@ -161,13 +206,12 @@
       ScopedLocalRef<jclass> klass(
           jni_env, jni_env->AddLocalReference<jclass>(obj->Ptr()->GetClass()));
 
-      handler_->DispatchEvent(self,
-                              JVMTI_EVENT_VM_OBJECT_ALLOC,
-                              jni_env,
-                              thread.get(),
-                              object.get(),
-                              klass.get(),
-                              byte_count);
+      handler_->DispatchEvent<ArtJvmtiEvent::kVmObjectAlloc>(self,
+                                                             reinterpret_cast<JNIEnv*>(jni_env),
+                                                             thread.get(),
+                                                             object.get(),
+                                                             klass.get(),
+                                                             static_cast<jlong>(byte_count));
     }
   }
 
@@ -196,11 +240,11 @@
         finish_enabled_(false) {}
 
   void StartPause() OVERRIDE {
-    handler_->DispatchEvent(nullptr, JVMTI_EVENT_GARBAGE_COLLECTION_START);
+    handler_->DispatchEvent<ArtJvmtiEvent::kGarbageCollectionStart>(nullptr);
   }
 
   void EndPause() OVERRIDE {
-    handler_->DispatchEvent(nullptr, JVMTI_EVENT_GARBAGE_COLLECTION_FINISH);
+    handler_->DispatchEvent<ArtJvmtiEvent::kGarbageCollectionFinish>(nullptr);
   }
 
   bool IsEnabled() {
@@ -221,10 +265,10 @@
   bool finish_enabled_;
 };
 
-static void SetupGcPauseTracking(JvmtiGcPauseListener* listener, jvmtiEvent event, bool enable) {
+static void SetupGcPauseTracking(JvmtiGcPauseListener* listener, ArtJvmtiEvent event, bool enable) {
   bool old_state = listener->IsEnabled();
 
-  if (event == JVMTI_EVENT_GARBAGE_COLLECTION_START) {
+  if (event == ArtJvmtiEvent::kGarbageCollectionStart) {
     listener->SetStartEnabled(enable);
   } else {
     listener->SetFinishEnabled(enable);
@@ -242,14 +286,14 @@
 }
 
 // Handle special work for the given event type, if necessary.
-void EventHandler::HandleEventType(jvmtiEvent event, bool enable) {
+void EventHandler::HandleEventType(ArtJvmtiEvent event, bool enable) {
   switch (event) {
-    case JVMTI_EVENT_VM_OBJECT_ALLOC:
+    case ArtJvmtiEvent::kVmObjectAlloc:
       SetupObjectAllocationTracking(alloc_listener_.get(), enable);
       return;
 
-    case JVMTI_EVENT_GARBAGE_COLLECTION_START:
-    case JVMTI_EVENT_GARBAGE_COLLECTION_FINISH:
+    case ArtJvmtiEvent::kGarbageCollectionStart:
+    case ArtJvmtiEvent::kGarbageCollectionFinish:
       SetupGcPauseTracking(gc_pause_listener_.get(), event, enable);
       return;
 
@@ -258,9 +302,67 @@
   }
 }
 
+// Checks to see if the env has the capabilities associated with the given event.
+static bool HasAssociatedCapability(ArtJvmTiEnv* env,
+                                    ArtJvmtiEvent event) {
+  jvmtiCapabilities caps = env->capabilities;
+  switch (event) {
+    case ArtJvmtiEvent::kBreakpoint:
+      return caps.can_generate_breakpoint_events == 1;
+
+    case ArtJvmtiEvent::kCompiledMethodLoad:
+    case ArtJvmtiEvent::kCompiledMethodUnload:
+      return caps.can_generate_compiled_method_load_events == 1;
+
+    case ArtJvmtiEvent::kException:
+    case ArtJvmtiEvent::kExceptionCatch:
+      return caps.can_generate_exception_events == 1;
+
+    case ArtJvmtiEvent::kFieldAccess:
+      return caps.can_generate_field_access_events == 1;
+
+    case ArtJvmtiEvent::kFieldModification:
+      return caps.can_generate_field_modification_events == 1;
+
+    case ArtJvmtiEvent::kFramePop:
+      return caps.can_generate_frame_pop_events == 1;
+
+    case ArtJvmtiEvent::kGarbageCollectionStart:
+    case ArtJvmtiEvent::kGarbageCollectionFinish:
+      return caps.can_generate_garbage_collection_events == 1;
+
+    case ArtJvmtiEvent::kMethodEntry:
+      return caps.can_generate_method_entry_events == 1;
+
+    case ArtJvmtiEvent::kMethodExit:
+      return caps.can_generate_method_exit_events == 1;
+
+    case ArtJvmtiEvent::kMonitorContendedEnter:
+    case ArtJvmtiEvent::kMonitorContendedEntered:
+    case ArtJvmtiEvent::kMonitorWait:
+    case ArtJvmtiEvent::kMonitorWaited:
+      return caps.can_generate_monitor_events == 1;
+
+    case ArtJvmtiEvent::kNativeMethodBind:
+      return caps.can_generate_native_method_bind_events == 1;
+
+    case ArtJvmtiEvent::kObjectFree:
+      return caps.can_generate_object_free_events == 1;
+
+    case ArtJvmtiEvent::kSingleStep:
+      return caps.can_generate_single_step_events == 1;
+
+    case ArtJvmtiEvent::kVmObjectAlloc:
+      return caps.can_generate_vm_object_alloc_events == 1;
+
+    default:
+      return true;
+  }
+}
+
 jvmtiError EventHandler::SetEvent(ArtJvmTiEnv* env,
                                   art::Thread* thread,
-                                  jvmtiEvent event,
+                                  ArtJvmtiEvent event,
                                   jvmtiEventMode mode) {
   if (thread != nullptr) {
     art::ThreadState state = thread->GetState();
@@ -274,8 +376,6 @@
     }
   }
 
-  // TODO: Capability check.
-
   if (mode != JVMTI_ENABLE && mode != JVMTI_DISABLE) {
     return ERR(ILLEGAL_ARGUMENT);
   }
@@ -284,6 +384,10 @@
     return ERR(INVALID_EVENT_TYPE);
   }
 
+  if (!HasAssociatedCapability(env, event)) {
+    return ERR(MUST_POSSESS_CAPABILITY);
+  }
+
   bool old_state = global_mask.Test(event);
 
   if (mode == JVMTI_ENABLE) {
@@ -293,17 +397,7 @@
     DCHECK_EQ(mode, JVMTI_DISABLE);
 
     env->event_masks.DisableEvent(thread, event);
-
-    // Gotta recompute the global mask.
-    bool union_value = false;
-    for (const ArtJvmTiEnv* stored_env : envs) {
-      union_value |= stored_env->event_masks.global_event_mask.Test(event);
-      union_value |= stored_env->event_masks.unioned_thread_event_mask.Test(event);
-      if (union_value) {
-        break;
-      }
-    }
-    global_mask.Set(event, union_value);
+    RecalculateGlobalEventMask(event);
   }
 
   bool new_state = global_mask.Test(event);
diff --git a/runtime/openjdkjvmti/events.h b/runtime/openjdkjvmti/events.h
index 07d6bfd..4e20d17 100644
--- a/runtime/openjdkjvmti/events.h
+++ b/runtime/openjdkjvmti/events.h
@@ -30,22 +30,76 @@
 class JvmtiAllocationListener;
 class JvmtiGcPauseListener;
 
+// an enum for ArtEvents. This differs from the JVMTI events only in that we distinguish between
+// retransformation capable and incapable loading
+enum class ArtJvmtiEvent {
+    kMinEventTypeVal = JVMTI_MIN_EVENT_TYPE_VAL,
+    kVmInit = JVMTI_EVENT_VM_INIT,
+    kVmDeath = JVMTI_EVENT_VM_DEATH,
+    kThreadStart = JVMTI_EVENT_THREAD_START,
+    kThreadEnd = JVMTI_EVENT_THREAD_END,
+    kClassFileLoadHookNonRetransformable = JVMTI_EVENT_CLASS_FILE_LOAD_HOOK,
+    kClassLoad = JVMTI_EVENT_CLASS_LOAD,
+    kClassPrepare = JVMTI_EVENT_CLASS_PREPARE,
+    kVmStart = JVMTI_EVENT_VM_START,
+    kException = JVMTI_EVENT_EXCEPTION,
+    kExceptionCatch = JVMTI_EVENT_EXCEPTION_CATCH,
+    kSingleStep = JVMTI_EVENT_SINGLE_STEP,
+    kFramePop = JVMTI_EVENT_FRAME_POP,
+    kBreakpoint = JVMTI_EVENT_BREAKPOINT,
+    kFieldAccess = JVMTI_EVENT_FIELD_ACCESS,
+    kFieldModification = JVMTI_EVENT_FIELD_MODIFICATION,
+    kMethodEntry = JVMTI_EVENT_METHOD_ENTRY,
+    kMethodExit = JVMTI_EVENT_METHOD_EXIT,
+    kNativeMethodBind = JVMTI_EVENT_NATIVE_METHOD_BIND,
+    kCompiledMethodLoad = JVMTI_EVENT_COMPILED_METHOD_LOAD,
+    kCompiledMethodUnload = JVMTI_EVENT_COMPILED_METHOD_UNLOAD,
+    kDynamicCodeGenerated = JVMTI_EVENT_DYNAMIC_CODE_GENERATED,
+    kDataDumpRequest = JVMTI_EVENT_DATA_DUMP_REQUEST,
+    kMonitorWait = JVMTI_EVENT_MONITOR_WAIT,
+    kMonitorWaited = JVMTI_EVENT_MONITOR_WAITED,
+    kMonitorContendedEnter = JVMTI_EVENT_MONITOR_CONTENDED_ENTER,
+    kMonitorContendedEntered = JVMTI_EVENT_MONITOR_CONTENDED_ENTERED,
+    kResourceExhausted = JVMTI_EVENT_RESOURCE_EXHAUSTED,
+    kGarbageCollectionStart = JVMTI_EVENT_GARBAGE_COLLECTION_START,
+    kGarbageCollectionFinish = JVMTI_EVENT_GARBAGE_COLLECTION_FINISH,
+    kObjectFree = JVMTI_EVENT_OBJECT_FREE,
+    kVmObjectAlloc = JVMTI_EVENT_VM_OBJECT_ALLOC,
+    kClassFileLoadHookRetransformable = JVMTI_MAX_EVENT_TYPE_VAL + 1,
+    kMaxEventTypeVal = kClassFileLoadHookRetransformable,
+};
+
+// Convert a jvmtiEvent into a ArtJvmtiEvent
+ALWAYS_INLINE static inline ArtJvmtiEvent GetArtJvmtiEvent(ArtJvmTiEnv* env, jvmtiEvent e);
+
+static inline jvmtiEvent GetJvmtiEvent(ArtJvmtiEvent e) {
+  if (UNLIKELY(e == ArtJvmtiEvent::kClassFileLoadHookRetransformable)) {
+    return JVMTI_EVENT_CLASS_FILE_LOAD_HOOK;
+  } else {
+    return static_cast<jvmtiEvent>(e);
+  }
+}
+
 struct EventMask {
-  static constexpr size_t kEventsSize = JVMTI_MAX_EVENT_TYPE_VAL - JVMTI_MIN_EVENT_TYPE_VAL + 1;
+  static constexpr size_t kEventsSize =
+      static_cast<size_t>(ArtJvmtiEvent::kMaxEventTypeVal) -
+      static_cast<size_t>(ArtJvmtiEvent::kMinEventTypeVal) + 1;
   std::bitset<kEventsSize> bit_set;
 
-  static bool EventIsInRange(jvmtiEvent event) {
-    return event >= JVMTI_MIN_EVENT_TYPE_VAL && event <= JVMTI_MAX_EVENT_TYPE_VAL;
+  static bool EventIsInRange(ArtJvmtiEvent event) {
+    return event >= ArtJvmtiEvent::kMinEventTypeVal && event <= ArtJvmtiEvent::kMaxEventTypeVal;
   }
 
-  void Set(jvmtiEvent event, bool value = true) {
+  void Set(ArtJvmtiEvent event, bool value = true) {
     DCHECK(EventIsInRange(event));
-    bit_set.set(event - JVMTI_MIN_EVENT_TYPE_VAL, value);
+    bit_set.set(static_cast<size_t>(event) - static_cast<size_t>(ArtJvmtiEvent::kMinEventTypeVal),
+                value);
   }
 
-  bool Test(jvmtiEvent event) const {
+  bool Test(ArtJvmtiEvent event) const {
     DCHECK(EventIsInRange(event));
-    return bit_set.test(event - JVMTI_MIN_EVENT_TYPE_VAL);
+    return bit_set.test(
+        static_cast<size_t>(event) - static_cast<size_t>(ArtJvmtiEvent::kMinEventTypeVal));
   }
 };
 
@@ -68,8 +122,13 @@
 
   EventMask& GetEventMask(art::Thread* thread);
   EventMask* GetEventMaskOrNull(art::Thread* thread);
-  void EnableEvent(art::Thread* thread, jvmtiEvent event);
-  void DisableEvent(art::Thread* thread, jvmtiEvent event);
+  void EnableEvent(art::Thread* thread, ArtJvmtiEvent event);
+  void DisableEvent(art::Thread* thread, ArtJvmtiEvent event);
+  bool IsEnabledAnywhere(ArtJvmtiEvent event);
+  // Make any changes to event masks needed for the given capability changes. If caps_added is true
+  // then caps is all the newly set capabilities of the jvmtiEnv. If it is false then caps is the
+  // set of all capabilities that were removed from the jvmtiEnv.
+  void HandleChangedCapabilities(const jvmtiCapabilities& caps, bool caps_added);
 };
 
 // Helper class for event handling.
@@ -82,20 +141,60 @@
   // enabled, yet.
   void RegisterArtJvmTiEnv(ArtJvmTiEnv* env);
 
-  bool IsEventEnabledAnywhere(jvmtiEvent event) {
+  // Remove an env.
+  void RemoveArtJvmTiEnv(ArtJvmTiEnv* env);
+
+  bool IsEventEnabledAnywhere(ArtJvmtiEvent event) const {
     if (!EventMask::EventIsInRange(event)) {
       return false;
     }
     return global_mask.Test(event);
   }
 
-  jvmtiError SetEvent(ArtJvmTiEnv* env, art::Thread* thread, jvmtiEvent event, jvmtiEventMode mode);
+  jvmtiError SetEvent(ArtJvmTiEnv* env,
+                      art::Thread* thread,
+                      ArtJvmtiEvent event,
+                      jvmtiEventMode mode);
 
-  template <typename ...Args>
-  ALWAYS_INLINE inline void DispatchEvent(art::Thread* thread, jvmtiEvent event, Args... args);
+  template <ArtJvmtiEvent kEvent, typename ...Args>
+  ALWAYS_INLINE
+  inline void DispatchEvent(art::Thread* thread, Args... args) const;
+
+  // Tell the event handler capabilities were added/lost so it can adjust the sent events.If
+  // caps_added is true then caps is all the newly set capabilities of the jvmtiEnv. If it is false
+  // then caps is the set of all capabilities that were removed from the jvmtiEnv.
+  ALWAYS_INLINE
+  inline void HandleChangedCapabilities(ArtJvmTiEnv* env,
+                                        const jvmtiCapabilities& caps,
+                                        bool added);
 
  private:
-  void HandleEventType(jvmtiEvent event, bool enable);
+  template <ArtJvmtiEvent kEvent>
+  ALWAYS_INLINE
+  static inline bool ShouldDispatch(ArtJvmTiEnv* env, art::Thread* thread);
+
+  ALWAYS_INLINE
+  inline bool NeedsEventUpdate(ArtJvmTiEnv* env,
+                               const jvmtiCapabilities& caps,
+                               bool added);
+
+  // Recalculates the event mask for the given event.
+  ALWAYS_INLINE
+  inline void RecalculateGlobalEventMask(ArtJvmtiEvent event);
+
+  template <ArtJvmtiEvent kEvent>
+  ALWAYS_INLINE inline void DispatchClassFileLoadHookEvent(art::Thread* thread,
+                                                           JNIEnv* jnienv,
+                                                           jclass class_being_redefined,
+                                                           jobject loader,
+                                                           const char* name,
+                                                           jobject protection_domain,
+                                                           jint class_data_len,
+                                                           const unsigned char* class_data,
+                                                           jint* new_class_data_len,
+                                                           unsigned char** new_class_data) const;
+
+  void HandleEventType(ArtJvmtiEvent event, bool enable);
 
   // List of all JvmTiEnv objects that have been created, in their creation order.
   std::vector<ArtJvmTiEnv*> envs;
diff --git a/runtime/openjdkjvmti/jvmti.h b/runtime/openjdkjvmti/jvmti.h
index ee708cb..de07c16 100644
--- a/runtime/openjdkjvmti/jvmti.h
+++ b/runtime/openjdkjvmti/jvmti.h
@@ -74,7 +74,7 @@
 typedef jlong jlocation;
 struct _jrawMonitorID;
 typedef struct _jrawMonitorID *jrawMonitorID;
-typedef struct JNINativeInterface_ jniNativeInterface;
+typedef struct JNINativeInterface jniNativeInterface;
 
     /* Constants */
 
diff --git a/runtime/openjdkjvmti/object_tagging.cc b/runtime/openjdkjvmti/object_tagging.cc
index b983e79..b27c2a3 100644
--- a/runtime/openjdkjvmti/object_tagging.cc
+++ b/runtime/openjdkjvmti/object_tagging.cc
@@ -177,7 +177,7 @@
 }
 
 void ObjectTagTable::Sweep(art::IsMarkedVisitor* visitor) {
-  if (event_handler_->IsEventEnabledAnywhere(JVMTI_EVENT_OBJECT_FREE)) {
+  if (event_handler_->IsEventEnabledAnywhere(ArtJvmtiEvent::kObjectFree)) {
     SweepImpl<true>(visitor);
   } else {
     SweepImpl<false>(visitor);
@@ -207,7 +207,7 @@
 }
 
 void ObjectTagTable::HandleNullSweep(jlong tag) {
-  event_handler_->DispatchEvent(nullptr, JVMTI_EVENT_OBJECT_FREE, tag);
+  event_handler_->DispatchEvent<ArtJvmtiEvent::kObjectFree>(nullptr, tag);
 }
 
 template <typename T, ObjectTagTable::TableUpdateNullTarget kTargetNull>
diff --git a/runtime/openjdkjvmti/ti_class.cc b/runtime/openjdkjvmti/ti_class.cc
index 0d1704c..b6de592 100644
--- a/runtime/openjdkjvmti/ti_class.cc
+++ b/runtime/openjdkjvmti/ti_class.cc
@@ -31,13 +31,309 @@
 
 #include "ti_class.h"
 
+#include "android-base/stringprintf.h"
+
+#include <mutex>
+#include <unordered_set>
+
 #include "art_jvmti.h"
+#include "base/macros.h"
+#include "class_table-inl.h"
+#include "class_linker.h"
+#include "common_throws.h"
+#include "events-inl.h"
+#include "handle.h"
+#include "jni_env_ext-inl.h"
 #include "jni_internal.h"
+#include "mirror/array-inl.h"
+#include "mirror/class-inl.h"
+#include "mirror/class_ext.h"
+#include "runtime.h"
+#include "runtime_callbacks.h"
+#include "ScopedLocalRef.h"
 #include "scoped_thread_state_change-inl.h"
 #include "thread-inl.h"
+#include "thread_list.h"
+#include "ti_redefine.h"
+#include "utils.h"
 
 namespace openjdkjvmti {
 
+using android::base::StringPrintf;
+
+static std::unique_ptr<const art::DexFile> MakeSingleDexFile(art::Thread* self,
+                                                             const char* descriptor,
+                                                             const std::string& orig_location,
+                                                             jint final_len,
+                                                             const unsigned char* final_dex_data)
+      REQUIRES_SHARED(art::Locks::mutator_lock_) {
+  // Make the mmap
+  std::string error_msg;
+  std::unique_ptr<art::MemMap> map(Redefiner::MoveDataToMemMap(orig_location,
+                                                               final_len,
+                                                               final_dex_data,
+                                                               &error_msg));
+  if (map.get() == nullptr) {
+    LOG(WARNING) << "Unable to allocate mmap for redefined dex file! Error was: " << error_msg;
+    self->ThrowOutOfMemoryError(StringPrintf(
+        "Unable to allocate dex file for transformation of %s", descriptor).c_str());
+    return nullptr;
+  }
+
+  // Make a dex-file
+  if (map->Size() < sizeof(art::DexFile::Header)) {
+    LOG(WARNING) << "Could not read dex file header because dex_data was too short";
+    art::ThrowClassFormatError(nullptr,
+                               "Unable to read transformed dex file of %s",
+                               descriptor);
+    return nullptr;
+  }
+  uint32_t checksum = reinterpret_cast<const art::DexFile::Header*>(map->Begin())->checksum_;
+  std::unique_ptr<const art::DexFile> dex_file(art::DexFile::Open(map->GetName(),
+                                                                  checksum,
+                                                                  std::move(map),
+                                                                  /*verify*/true,
+                                                                  /*verify_checksum*/true,
+                                                                  &error_msg));
+  if (dex_file.get() == nullptr) {
+    LOG(WARNING) << "Unable to load modified dex file for " << descriptor << ": " << error_msg;
+    art::ThrowClassFormatError(nullptr,
+                               "Unable to read transformed dex file of %s because %s",
+                               descriptor,
+                               error_msg.c_str());
+    return nullptr;
+  }
+  if (dex_file->NumClassDefs() != 1) {
+    LOG(WARNING) << "Dex file contains more than 1 class_def. Ignoring.";
+    // TODO Throw some other sort of error here maybe?
+    art::ThrowClassFormatError(
+        nullptr,
+        "Unable to use transformed dex file of %s because it contained too many classes",
+        descriptor);
+    return nullptr;
+  }
+  return dex_file;
+}
+
+struct ClassCallback : public art::ClassLoadCallback {
+  void ClassPreDefine(const char* descriptor,
+                      art::Handle<art::mirror::Class> klass,
+                      art::Handle<art::mirror::ClassLoader> class_loader,
+                      const art::DexFile& initial_dex_file,
+                      const art::DexFile::ClassDef& initial_class_def ATTRIBUTE_UNUSED,
+                      /*out*/art::DexFile const** final_dex_file,
+                      /*out*/art::DexFile::ClassDef const** final_class_def)
+      OVERRIDE REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    bool is_enabled =
+        event_handler->IsEventEnabledAnywhere(ArtJvmtiEvent::kClassFileLoadHookRetransformable) ||
+        event_handler->IsEventEnabledAnywhere(ArtJvmtiEvent::kClassFileLoadHookNonRetransformable);
+    if (!is_enabled) {
+      return;
+    }
+    if (descriptor[0] != 'L') {
+      // It is a primitive or array. Just return
+      return;
+    }
+    std::string name(art::PrettyDescriptor(descriptor));
+
+    art::Thread* self = art::Thread::Current();
+    art::JNIEnvExt* env = self->GetJniEnv();
+    ScopedLocalRef<jobject> loader(
+        env, class_loader.IsNull() ? nullptr : env->AddLocalReference<jobject>(class_loader.Get()));
+    // Go back to native.
+    art::ScopedThreadSuspension sts(self, art::ThreadState::kNative);
+    // Call all Non-retransformable agents.
+    jint post_no_redefine_len = 0;
+    unsigned char* post_no_redefine_dex_data = nullptr;
+    std::unique_ptr<const unsigned char> post_no_redefine_unique_ptr(nullptr);
+    event_handler->DispatchEvent<ArtJvmtiEvent::kClassFileLoadHookNonRetransformable>(
+        self,
+        static_cast<JNIEnv*>(env),
+        static_cast<jclass>(nullptr),  // The class doesn't really exist yet so send null.
+        loader.get(),
+        name.c_str(),
+        static_cast<jobject>(nullptr),  // Android doesn't seem to have protection domains
+        static_cast<jint>(initial_dex_file.Size()),
+        static_cast<const unsigned char*>(initial_dex_file.Begin()),
+        static_cast<jint*>(&post_no_redefine_len),
+        static_cast<unsigned char**>(&post_no_redefine_dex_data));
+    if (post_no_redefine_dex_data == nullptr) {
+      DCHECK_EQ(post_no_redefine_len, 0);
+      post_no_redefine_dex_data = const_cast<unsigned char*>(initial_dex_file.Begin());
+      post_no_redefine_len = initial_dex_file.Size();
+    } else {
+      post_no_redefine_unique_ptr = std::unique_ptr<const unsigned char>(post_no_redefine_dex_data);
+      DCHECK_GT(post_no_redefine_len, 0);
+    }
+    // Call all retransformable agents.
+    jint final_len = 0;
+    unsigned char* final_dex_data = nullptr;
+    std::unique_ptr<const unsigned char> final_dex_unique_ptr(nullptr);
+    event_handler->DispatchEvent<ArtJvmtiEvent::kClassFileLoadHookRetransformable>(
+        self,
+        static_cast<JNIEnv*>(env),
+        static_cast<jclass>(nullptr),  // The class doesn't really exist yet so send null.
+        loader.get(),
+        name.c_str(),
+        static_cast<jobject>(nullptr),  // Android doesn't seem to have protection domains
+        static_cast<jint>(post_no_redefine_len),
+        static_cast<const unsigned char*>(post_no_redefine_dex_data),
+        static_cast<jint*>(&final_len),
+        static_cast<unsigned char**>(&final_dex_data));
+    if (final_dex_data == nullptr) {
+      DCHECK_EQ(final_len, 0);
+      final_dex_data = post_no_redefine_dex_data;
+      final_len = post_no_redefine_len;
+    } else {
+      final_dex_unique_ptr = std::unique_ptr<const unsigned char>(final_dex_data);
+      DCHECK_GT(final_len, 0);
+    }
+
+    if (final_dex_data != initial_dex_file.Begin()) {
+      LOG(WARNING) << "Changing class " << descriptor;
+      art::ScopedObjectAccess soa(self);
+      art::StackHandleScope<2> hs(self);
+      // Save the results of all the non-retransformable agents.
+      // First allocate the ClassExt
+      art::Handle<art::mirror::ClassExt> ext(hs.NewHandle(klass->EnsureExtDataPresent(self)));
+      // Make sure we have a ClassExt. This is fine even though we are a temporary since it will
+      // get copied.
+      if (ext.IsNull()) {
+        // We will just return failure if we fail to allocate
+        LOG(WARNING) << "Could not allocate ext-data for class '" << descriptor << "'. "
+                     << "Aborting transformation since we will be unable to store it.";
+        self->AssertPendingOOMException();
+        return;
+      }
+
+      // Allocate the byte array to store the dex file bytes in.
+      art::Handle<art::mirror::ByteArray> arr(hs.NewHandle(
+          art::mirror::ByteArray::AllocateAndFill(
+              self,
+              reinterpret_cast<const signed char*>(post_no_redefine_dex_data),
+              post_no_redefine_len)));
+      if (arr.IsNull()) {
+        LOG(WARNING) << "Unable to allocate byte array for initial dex-file bytes. Aborting "
+                     << "transformation";
+        self->AssertPendingOOMException();
+        return;
+      }
+
+      std::unique_ptr<const art::DexFile> dex_file(MakeSingleDexFile(self,
+                                                                     descriptor,
+                                                                     initial_dex_file.GetLocation(),
+                                                                     final_len,
+                                                                     final_dex_data));
+      if (dex_file.get() == nullptr) {
+        return;
+      }
+
+      // TODO Check Redefined dex file for invariants.
+      LOG(WARNING) << "Dex file created by class-definition time transformation of "
+                   << descriptor << " is not checked for all retransformation invariants.";
+      // TODO Put it in classpath
+      LOG(WARNING) << "Dex file created for class-definition time transformation of "
+                   << descriptor << " was not added to any classpaths!";
+      // Actually set the ClassExt's original bytes once we have actually succeeded.
+      ext->SetOriginalDexFileBytes(arr.Get());
+      // Set the return values
+      *final_class_def = &dex_file->GetClassDef(0);
+      *final_dex_file = dex_file.release();
+    }
+  }
+
+  void ClassLoad(art::Handle<art::mirror::Class> klass) REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    if (event_handler->IsEventEnabledAnywhere(ArtJvmtiEvent::kClassLoad)) {
+      art::Thread* thread = art::Thread::Current();
+      ScopedLocalRef<jclass> jklass(thread->GetJniEnv(),
+                                    thread->GetJniEnv()->AddLocalReference<jclass>(klass.Get()));
+      ScopedLocalRef<jthread> thread_jni(
+          thread->GetJniEnv(), thread->GetJniEnv()->AddLocalReference<jthread>(thread->GetPeer()));
+      {
+        art::ScopedThreadSuspension sts(thread, art::ThreadState::kNative);
+        event_handler->DispatchEvent<ArtJvmtiEvent::kClassLoad>(
+            thread,
+            static_cast<JNIEnv*>(thread->GetJniEnv()),
+            thread_jni.get(),
+            jklass.get());
+      }
+      AddTempClass(thread, jklass.get());
+    }
+  }
+
+  void ClassPrepare(art::Handle<art::mirror::Class> temp_klass ATTRIBUTE_UNUSED,
+                    art::Handle<art::mirror::Class> klass)
+      REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    if (event_handler->IsEventEnabledAnywhere(ArtJvmtiEvent::kClassPrepare)) {
+      art::Thread* thread = art::Thread::Current();
+      ScopedLocalRef<jclass> jklass(thread->GetJniEnv(),
+                                    thread->GetJniEnv()->AddLocalReference<jclass>(klass.Get()));
+      ScopedLocalRef<jthread> thread_jni(
+          thread->GetJniEnv(), thread->GetJniEnv()->AddLocalReference<jthread>(thread->GetPeer()));
+      art::ScopedThreadSuspension sts(thread, art::ThreadState::kNative);
+      event_handler->DispatchEvent<ArtJvmtiEvent::kClassPrepare>(
+          thread,
+          static_cast<JNIEnv*>(thread->GetJniEnv()),
+          thread_jni.get(),
+          jklass.get());
+    }
+  }
+
+  void AddTempClass(art::Thread* self, jclass klass) {
+    std::unique_lock<std::mutex> mu(temp_classes_lock);
+    temp_classes.push_back(reinterpret_cast<jclass>(self->GetJniEnv()->NewGlobalRef(klass)));
+  }
+
+  void HandleTempClass(art::Handle<art::mirror::Class> temp_klass,
+                       art::Handle<art::mirror::Class> klass)
+      REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    std::unique_lock<std::mutex> mu(temp_classes_lock);
+    if (temp_classes.empty()) {
+      return;
+    }
+
+    art::Thread* self = art::Thread::Current();
+    for (auto it = temp_classes.begin(); it != temp_classes.end(); ++it) {
+      if (temp_klass.Get() == art::ObjPtr<art::mirror::Class>::DownCast(self->DecodeJObject(*it))) {
+        temp_classes.erase(it);
+        FixupTempClass(temp_klass, klass);
+      }
+    }
+  }
+
+  void FixupTempClass(art::Handle<art::mirror::Class> temp_klass ATTRIBUTE_UNUSED,
+                      art::Handle<art::mirror::Class> klass ATTRIBUTE_UNUSED)
+     REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    // TODO: Implement.
+  }
+
+  // A set of all the temp classes we have handed out. We have to fix up references to these.
+  // For simplicity, we store the temp classes as JNI global references in a vector. Normally a
+  // Prepare event will closely follow, so the vector should be small.
+  std::mutex temp_classes_lock;
+  std::vector<jclass> temp_classes;
+
+  EventHandler* event_handler = nullptr;
+};
+
+ClassCallback gClassCallback;
+
+void ClassUtil::Register(EventHandler* handler) {
+  gClassCallback.event_handler = handler;
+  art::ScopedThreadStateChange stsc(art::Thread::Current(),
+                                    art::ThreadState::kWaitingForDebuggerToAttach);
+  art::ScopedSuspendAll ssa("Add load callback");
+  art::Runtime::Current()->GetRuntimeCallbacks()->AddClassLoadCallback(&gClassCallback);
+}
+
+void ClassUtil::Unregister() {
+  art::ScopedThreadStateChange stsc(art::Thread::Current(),
+                                    art::ThreadState::kWaitingForDebuggerToAttach);
+  art::ScopedSuspendAll ssa("Remove thread callback");
+  art::Runtime* runtime = art::Runtime::Current();
+  runtime->GetRuntimeCallbacks()->RemoveClassLoadCallback(&gClassCallback);
+}
+
 jvmtiError ClassUtil::GetClassFields(jvmtiEnv* env,
                                      jclass jklass,
                                      jint* field_count_ptr,
@@ -197,7 +493,9 @@
   }
 
   // TODO: Support generic signature.
-  *generic_ptr = nullptr;
+  if (generic_ptr != nullptr) {
+    *generic_ptr = nullptr;
+  }
 
   // Everything is fine, release the buffers.
   sig_copy.release();
@@ -328,4 +626,121 @@
   return ERR(NONE);
 }
 
+jvmtiError ClassUtil::GetClassLoaderClasses(jvmtiEnv* env,
+                                            jobject initiating_loader,
+                                            jint* class_count_ptr,
+                                            jclass** classes_ptr) {
+  UNUSED(env, initiating_loader, class_count_ptr, classes_ptr);
+
+  if (class_count_ptr == nullptr || classes_ptr == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+  art::Thread* self = art::Thread::Current();
+  if (!self->GetJniEnv()->IsInstanceOf(initiating_loader,
+                                       art::WellKnownClasses::java_lang_ClassLoader)) {
+    return ERR(ILLEGAL_ARGUMENT);
+  }
+  if (self->GetJniEnv()->IsInstanceOf(initiating_loader,
+                                      art::WellKnownClasses::java_lang_BootClassLoader)) {
+    // Need to use null for the BootClassLoader.
+    initiating_loader = nullptr;
+  }
+
+  art::ScopedObjectAccess soa(self);
+  art::ObjPtr<art::mirror::ClassLoader> class_loader =
+      soa.Decode<art::mirror::ClassLoader>(initiating_loader);
+
+  art::ClassLinker* class_linker = art::Runtime::Current()->GetClassLinker();
+
+  art::ReaderMutexLock mu(self, *art::Locks::classlinker_classes_lock_);
+
+  art::ClassTable* class_table = class_linker->ClassTableForClassLoader(class_loader);
+  if (class_table == nullptr) {
+    // Nothing loaded.
+    *class_count_ptr = 0;
+    *classes_ptr = nullptr;
+    return ERR(NONE);
+  }
+
+  struct ClassTableCount {
+    bool operator()(art::ObjPtr<art::mirror::Class> klass) {
+      DCHECK(klass != nullptr);
+      ++count;
+      return true;
+    }
+
+    size_t count = 0;
+  };
+  ClassTableCount ctc;
+  class_table->Visit(ctc);
+
+  if (ctc.count == 0) {
+    // Nothing loaded.
+    *class_count_ptr = 0;
+    *classes_ptr = nullptr;
+    return ERR(NONE);
+  }
+
+  unsigned char* data;
+  jvmtiError data_result = env->Allocate(ctc.count * sizeof(jclass), &data);
+  if (data_result != ERR(NONE)) {
+    return data_result;
+  }
+  jclass* class_array = reinterpret_cast<jclass*>(data);
+
+  struct ClassTableFill {
+    bool operator()(art::ObjPtr<art::mirror::Class> klass)
+        REQUIRES_SHARED(art::Locks::mutator_lock_) {
+      DCHECK(klass != nullptr);
+      DCHECK_LT(count, ctc_ref.count);
+      local_class_array[count++] = soa_ptr->AddLocalReference<jclass>(klass);
+      return true;
+    }
+
+    jclass* local_class_array;
+    const ClassTableCount& ctc_ref;
+    art::ScopedObjectAccess* soa_ptr;
+    size_t count;
+  };
+  ClassTableFill ctf = { class_array, ctc, &soa, 0 };
+  class_table->Visit(ctf);
+  DCHECK_EQ(ctc.count, ctf.count);
+
+  *class_count_ptr = ctc.count;
+  *classes_ptr = class_array;
+
+  return ERR(NONE);
+}
+
+jvmtiError ClassUtil::GetClassVersionNumbers(jvmtiEnv* env ATTRIBUTE_UNUSED,
+                                             jclass jklass,
+                                             jint* minor_version_ptr,
+                                             jint* major_version_ptr) {
+  art::ScopedObjectAccess soa(art::Thread::Current());
+  if (jklass == nullptr) {
+    return ERR(INVALID_CLASS);
+  }
+  art::ObjPtr<art::mirror::Object> jklass_obj = soa.Decode<art::mirror::Object>(jklass);
+  if (!jklass_obj->IsClass()) {
+    return ERR(INVALID_CLASS);
+  }
+  art::ObjPtr<art::mirror::Class> klass = jklass_obj->AsClass();
+  if (klass->IsPrimitive() || klass->IsArrayClass()) {
+    return ERR(INVALID_CLASS);
+  }
+
+  if (minor_version_ptr == nullptr || major_version_ptr == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  // Note: proxies will show the dex file version of java.lang.reflect.Proxy, as that is
+  //       what their dex cache copies from.
+  uint32_t version = klass->GetDexFile().GetHeader().GetVersion();
+
+  *major_version_ptr = static_cast<jint>(version);
+  *minor_version_ptr = 0;
+
+  return ERR(NONE);
+}
+
 }  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_class.h b/runtime/openjdkjvmti/ti_class.h
index 577fc8e..aa2260f 100644
--- a/runtime/openjdkjvmti/ti_class.h
+++ b/runtime/openjdkjvmti/ti_class.h
@@ -37,8 +37,13 @@
 
 namespace openjdkjvmti {
 
+class EventHandler;
+
 class ClassUtil {
  public:
+  static void Register(EventHandler* event_handler);
+  static void Unregister();
+
   static jvmtiError GetClassFields(jvmtiEnv* env,
                                    jclass klass,
                                    jint* field_count_ptr,
@@ -65,8 +70,18 @@
 
   static jvmtiError GetClassLoader(jvmtiEnv* env, jclass klass, jobject* classloader_ptr);
 
+  static jvmtiError GetClassLoaderClasses(jvmtiEnv* env,
+                                          jobject initiating_loader,
+                                          jint* class_count_ptr,
+                                          jclass** classes_ptr);
+
   static jvmtiError IsInterface(jvmtiEnv* env, jclass klass, jboolean* is_interface_ptr);
   static jvmtiError IsArrayClass(jvmtiEnv* env, jclass klass, jboolean* is_array_class_ptr);
+
+  static jvmtiError GetClassVersionNumbers(jvmtiEnv* env,
+                                           jclass klass,
+                                           jint* minor_version_ptr,
+                                           jint* major_version_ptr);
 };
 
 }  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_class_definition.cc b/runtime/openjdkjvmti/ti_class_definition.cc
new file mode 100644
index 0000000..2c2a79b
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_class_definition.cc
@@ -0,0 +1,55 @@
+/* Copyright (C) 2016 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_class_definition.h"
+
+#include "dex_file.h"
+#include "handle_scope-inl.h"
+#include "handle.h"
+#include "mirror/class-inl.h"
+#include "mirror/object-inl.h"
+#include "thread.h"
+
+namespace openjdkjvmti {
+
+bool ArtClassDefinition::IsModified(art::Thread* self) const {
+  if (modified) {
+    return true;
+  }
+  // Check if the dex file we want to set is the same as the current one.
+  art::StackHandleScope<1> hs(self);
+  art::Handle<art::mirror::Class> h_klass(hs.NewHandle(self->DecodeJObject(klass)->AsClass()));
+  const art::DexFile& cur_dex_file = h_klass->GetDexFile();
+  return static_cast<jint>(cur_dex_file.Size()) != dex_len ||
+      memcmp(cur_dex_file.Begin(), dex_data.get(), dex_len) != 0;
+}
+
+}  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_class_definition.h b/runtime/openjdkjvmti/ti_class_definition.h
new file mode 100644
index 0000000..dbe5da2
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_class_definition.h
@@ -0,0 +1,77 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_CLASS_DEFINITION_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_CLASS_DEFINITION_H_
+
+#include "art_jvmti.h"
+
+namespace openjdkjvmti {
+
+// A struct that stores data needed for redefining/transforming classes. This structure should only
+// even be accessed from a single thread and must not survive past the completion of the
+// redefinition/retransformation function that created it.
+struct ArtClassDefinition {
+ public:
+  jclass klass;
+  jobject loader;
+  std::string name;
+  jobject protection_domain;
+  jint dex_len;
+  JvmtiUniquePtr dex_data;
+  art::ArraySlice<const unsigned char> original_dex_file;
+
+  ArtClassDefinition() = default;
+  ArtClassDefinition(ArtClassDefinition&& o) = default;
+
+  void SetNewDexData(ArtJvmTiEnv* env, jint new_dex_len, unsigned char* new_dex_data) {
+    if (new_dex_data == nullptr) {
+      return;
+    } else if (new_dex_data != dex_data.get() || new_dex_len != dex_len) {
+      SetModified();
+      dex_len = new_dex_len;
+      dex_data = MakeJvmtiUniquePtr(env, new_dex_data);
+    }
+  }
+
+  void SetModified() {
+    modified = true;
+  }
+
+  bool IsModified(art::Thread* self) const REQUIRES_SHARED(art::Locks::mutator_lock_);
+
+ private:
+  bool modified;
+};
+
+}  // namespace openjdkjvmti
+
+#endif  // ART_RUNTIME_OPENJDKJVMTI_TI_CLASS_DEFINITION_H_
diff --git a/runtime/openjdkjvmti/ti_dump.cc b/runtime/openjdkjvmti/ti_dump.cc
new file mode 100644
index 0000000..d9e3ef1
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_dump.cc
@@ -0,0 +1,74 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_dump.h"
+
+#include <limits>
+
+
+#include "art_jvmti.h"
+#include "base/mutex.h"
+#include "events-inl.h"
+#include "runtime_callbacks.h"
+#include "scoped_thread_state_change-inl.h"
+#include "thread-inl.h"
+#include "thread_list.h"
+
+namespace openjdkjvmti {
+
+struct DumpCallback : public art::RuntimeSigQuitCallback {
+  void SigQuit() OVERRIDE REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    art::Thread* thread = art::Thread::Current();
+    art::ScopedThreadSuspension sts(thread, art::ThreadState::kNative);
+    event_handler->DispatchEvent<ArtJvmtiEvent::kDataDumpRequest>(nullptr);
+  }
+
+  EventHandler* event_handler = nullptr;
+};
+
+static DumpCallback gDumpCallback;
+
+void DumpUtil::Register(EventHandler* handler) {
+  gDumpCallback.event_handler = handler;
+  art::ScopedThreadStateChange stsc(art::Thread::Current(),
+                                    art::ThreadState::kWaitingForDebuggerToAttach);
+  art::ScopedSuspendAll ssa("Add sigquit callback");
+  art::Runtime::Current()->GetRuntimeCallbacks()->AddRuntimeSigQuitCallback(&gDumpCallback);
+}
+
+void DumpUtil::Unregister() {
+  art::ScopedThreadStateChange stsc(art::Thread::Current(),
+                                    art::ThreadState::kWaitingForDebuggerToAttach);
+  art::ScopedSuspendAll ssa("Remove sigquit callback");
+  art::Runtime::Current()->GetRuntimeCallbacks()->RemoveRuntimeSigQuitCallback(&gDumpCallback);
+}
+
+}  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_dump.h b/runtime/openjdkjvmti/ti_dump.h
new file mode 100644
index 0000000..67cb239
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_dump.h
@@ -0,0 +1,50 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_DUMP_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_DUMP_H_
+
+#include "jni.h"
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+class EventHandler;
+
+class DumpUtil {
+ public:
+  static void Register(EventHandler* event_handler);
+  static void Unregister();
+};
+
+}  // namespace openjdkjvmti
+
+#endif  // ART_RUNTIME_OPENJDKJVMTI_TI_DUMP_H_
diff --git a/runtime/openjdkjvmti/ti_jni.cc b/runtime/openjdkjvmti/ti_jni.cc
new file mode 100644
index 0000000..88f0395
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_jni.cc
@@ -0,0 +1,91 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_jni.h"
+
+#include "jni.h"
+
+#include "art_jvmti.h"
+#include "base/mutex.h"
+#include "java_vm_ext.h"
+#include "jni_env_ext.h"
+#include "runtime.h"
+#include "thread-inl.h"
+
+namespace openjdkjvmti {
+
+jvmtiError JNIUtil::SetJNIFunctionTable(jvmtiEnv* env ATTRIBUTE_UNUSED,
+                                        const jniNativeInterface* function_table) {
+  // While we supporting setting null (which will reset the table), the spec says no.
+  if (function_table == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  art::JNIEnvExt::SetTableOverride(function_table);
+  return ERR(NONE);
+}
+
+jvmtiError JNIUtil::GetJNIFunctionTable(jvmtiEnv* env, jniNativeInterface** function_table) {
+  if (function_table == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  // We use the generic JNIEnvExt::GetFunctionTable instead of querying a specific JNIEnv, as
+  // this has to work in the start phase.
+
+  // Figure out which table is current. Conservatively assume check-jni is off.
+  bool check_jni = false;
+  art::Runtime* runtime = art::Runtime::Current();
+  if (runtime != nullptr && runtime->GetJavaVM() != nullptr) {
+    check_jni = runtime->GetJavaVM()->IsCheckJniEnabled();
+  }
+
+  // Get that table.
+  const JNINativeInterface* current_table;
+  {
+    art::MutexLock mu(art::Thread::Current(), *art::Locks::jni_function_table_lock_);
+    current_table = art::JNIEnvExt::GetFunctionTable(check_jni);
+  }
+
+  // Allocate memory and copy the table.
+  unsigned char* data;
+  jvmtiError data_result = env->Allocate(sizeof(JNINativeInterface), &data);
+  if (data_result != ERR(NONE)) {
+    return data_result;
+  }
+  memcpy(data, current_table, sizeof(JNINativeInterface));
+
+  *function_table = reinterpret_cast<JNINativeInterface*>(data);
+
+  return ERR(NONE);
+}
+
+}  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_jni.h b/runtime/openjdkjvmti/ti_jni.h
new file mode 100644
index 0000000..906aab0
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_jni.h
@@ -0,0 +1,58 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_JNI_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_JNI_H_
+
+#include "jni.h"
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+// Note: Currently, JNI function table changes are sensitive to the order of operations wrt/
+//       CheckJNI. If an agent sets the function table, and a program than late-enables CheckJNI,
+//       CheckJNI will not be working (as the agent will forward to the non-CheckJNI table).
+//
+//       This behavior results from our usage of the function table to avoid a check of the
+//       CheckJNI flag. A future implementation may install on loading of this plugin an
+//       intermediate function table that explicitly checks the flag, so that switching CheckJNI
+//       is transparently handled.
+
+class JNIUtil {
+ public:
+  static jvmtiError SetJNIFunctionTable(jvmtiEnv* env, const jniNativeInterface* function_table);
+
+  static jvmtiError GetJNIFunctionTable(jvmtiEnv* env, jniNativeInterface** function_table);
+};
+
+}  // namespace openjdkjvmti
+
+#endif  // ART_RUNTIME_OPENJDKJVMTI_TI_JNI_H_
diff --git a/runtime/openjdkjvmti/ti_phase.cc b/runtime/openjdkjvmti/ti_phase.cc
new file mode 100644
index 0000000..4970288
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_phase.cc
@@ -0,0 +1,139 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_phase.h"
+
+#include "art_jvmti.h"
+#include "base/macros.h"
+#include "events-inl.h"
+#include "runtime.h"
+#include "runtime_callbacks.h"
+#include "ScopedLocalRef.h"
+#include "scoped_thread_state_change-inl.h"
+#include "thread-inl.h"
+#include "thread_list.h"
+
+namespace openjdkjvmti {
+
+jvmtiPhase PhaseUtil::current_phase_ = static_cast<jvmtiPhase>(0);
+
+struct PhaseUtil::PhaseCallback : public art::RuntimePhaseCallback {
+  inline static JNIEnv* GetJniEnv() {
+    return reinterpret_cast<JNIEnv*>(art::Thread::Current()->GetJniEnv());
+  }
+
+  inline static jthread GetCurrentJThread() {
+    art::ScopedObjectAccess soa(art::Thread::Current());
+    return soa.AddLocalReference<jthread>(soa.Self()->GetPeer());
+  }
+
+  void NextRuntimePhase(RuntimePhase phase) REQUIRES_SHARED(art::Locks::mutator_lock_) OVERRIDE {
+    // TODO: Events.
+    switch (phase) {
+      case RuntimePhase::kInitialAgents:
+        PhaseUtil::current_phase_ = JVMTI_PHASE_PRIMORDIAL;
+        break;
+      case RuntimePhase::kStart:
+        {
+          art::ScopedThreadSuspension sts(art::Thread::Current(), art::ThreadState::kNative);
+          event_handler->DispatchEvent<ArtJvmtiEvent::kVmStart>(nullptr, GetJniEnv());
+          PhaseUtil::current_phase_ = JVMTI_PHASE_START;
+        }
+        break;
+      case RuntimePhase::kInit:
+        {
+          ScopedLocalRef<jthread> thread(GetJniEnv(), GetCurrentJThread());
+          art::ScopedThreadSuspension sts(art::Thread::Current(), art::ThreadState::kNative);
+          event_handler->DispatchEvent<ArtJvmtiEvent::kVmInit>(nullptr, GetJniEnv(), thread.get());
+          PhaseUtil::current_phase_ = JVMTI_PHASE_LIVE;
+        }
+        break;
+      case RuntimePhase::kDeath:
+        {
+          art::ScopedThreadSuspension sts(art::Thread::Current(), art::ThreadState::kNative);
+          event_handler->DispatchEvent<ArtJvmtiEvent::kVmDeath>(nullptr, GetJniEnv());
+          PhaseUtil::current_phase_ = JVMTI_PHASE_DEAD;
+        }
+        // TODO: Block events now.
+        break;
+    }
+  }
+
+  EventHandler* event_handler = nullptr;
+};
+
+PhaseUtil::PhaseCallback gPhaseCallback;
+
+jvmtiError PhaseUtil::GetPhase(jvmtiEnv* env ATTRIBUTE_UNUSED, jvmtiPhase* phase_ptr) {
+  if (phase_ptr == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+  jvmtiPhase now = PhaseUtil::current_phase_;
+  DCHECK(now == JVMTI_PHASE_ONLOAD ||
+         now == JVMTI_PHASE_PRIMORDIAL ||
+         now == JVMTI_PHASE_START ||
+         now == JVMTI_PHASE_LIVE ||
+         now == JVMTI_PHASE_DEAD);
+  *phase_ptr = now;
+  return ERR(NONE);
+}
+
+void PhaseUtil::SetToOnLoad() {
+  DCHECK_EQ(0u, static_cast<size_t>(PhaseUtil::current_phase_));
+  PhaseUtil::current_phase_ = JVMTI_PHASE_ONLOAD;
+}
+
+void PhaseUtil::SetToPrimordial() {
+  DCHECK_EQ(static_cast<size_t>(JVMTI_PHASE_ONLOAD), static_cast<size_t>(PhaseUtil::current_phase_));
+  PhaseUtil::current_phase_ = JVMTI_PHASE_ONLOAD;
+}
+
+void PhaseUtil::SetToLive() {
+  DCHECK_EQ(static_cast<size_t>(0), static_cast<size_t>(PhaseUtil::current_phase_));
+  PhaseUtil::current_phase_ = JVMTI_PHASE_LIVE;
+}
+
+void PhaseUtil::Register(EventHandler* handler) {
+  gPhaseCallback.event_handler = handler;
+  art::ScopedThreadStateChange stsc(art::Thread::Current(),
+                                    art::ThreadState::kWaitingForDebuggerToAttach);
+  art::ScopedSuspendAll ssa("Add phase callback");
+  art::Runtime::Current()->GetRuntimeCallbacks()->AddRuntimePhaseCallback(&gPhaseCallback);
+}
+
+void PhaseUtil::Unregister() {
+  art::ScopedThreadStateChange stsc(art::Thread::Current(),
+                                    art::ThreadState::kWaitingForDebuggerToAttach);
+  art::ScopedSuspendAll ssa("Remove phase callback");
+  art::Runtime::Current()->GetRuntimeCallbacks()->RemoveRuntimePhaseCallback(&gPhaseCallback);
+}
+
+}  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_phase.h b/runtime/openjdkjvmti/ti_phase.h
new file mode 100644
index 0000000..bd15fa6
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_phase.h
@@ -0,0 +1,66 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_PHASE_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_PHASE_H_
+
+#include "jni.h"
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+class EventHandler;
+
+class PhaseUtil {
+ public:
+  static jvmtiError GetPhase(jvmtiEnv* env, jvmtiPhase* phase_ptr);
+
+  static void Register(EventHandler* event_handler);
+  static void Unregister();
+
+  // Move the phase from unitialized to LOAD.
+  static void SetToOnLoad();
+
+  // Move the phase from LOAD to PRIMORDIAL.
+  static void SetToPrimordial();
+
+  // Move the phase from unitialized to LIVE.
+  static void SetToLive();
+
+  struct PhaseCallback;
+
+ private:
+  static jvmtiPhase current_phase_;
+};
+
+}  // namespace openjdkjvmti
+
+#endif  // ART_RUNTIME_OPENJDKJVMTI_TI_PHASE_H_
diff --git a/runtime/openjdkjvmti/ti_redefine.cc b/runtime/openjdkjvmti/ti_redefine.cc
index 14477a1..d2ddc21 100644
--- a/runtime/openjdkjvmti/ti_redefine.cc
+++ b/runtime/openjdkjvmti/ti_redefine.cc
@@ -36,6 +36,7 @@
 #include "android-base/stringprintf.h"
 
 #include "art_jvmti.h"
+#include "base/array_slice.h"
 #include "base/logging.h"
 #include "dex_file.h"
 #include "dex_file_types.h"
@@ -228,11 +229,17 @@
   return map;
 }
 
-Redefiner::ClassRedefinition::ClassRedefinition(Redefiner* driver,
-                                                jclass klass,
-                                                const art::DexFile* redefined_dex_file,
-                                                const char* class_sig) :
-      driver_(driver), klass_(klass), dex_file_(redefined_dex_file), class_sig_(class_sig) {
+Redefiner::ClassRedefinition::ClassRedefinition(
+    Redefiner* driver,
+    jclass klass,
+    const art::DexFile* redefined_dex_file,
+    const char* class_sig,
+    art::ArraySlice<const unsigned char> orig_dex_file) :
+      driver_(driver),
+      klass_(klass),
+      dex_file_(redefined_dex_file),
+      class_sig_(class_sig),
+      original_dex_file_(orig_dex_file) {
   GetMirrorClass()->MonitorEnter(driver_->self_);
 }
 
@@ -242,14 +249,12 @@
   }
 }
 
-// TODO This should handle doing multiple classes at once so we need to do less cleanup when things
-// go wrong.
 jvmtiError Redefiner::RedefineClasses(ArtJvmTiEnv* env,
                                       art::Runtime* runtime,
                                       art::Thread* self,
                                       jint class_count,
                                       const jvmtiClassDefinition* definitions,
-                                      std::string* error_msg) {
+                                      /*out*/std::string* error_msg) {
   if (env == nullptr) {
     *error_msg = "env was null!";
     return ERR(INVALID_ENVIRONMENT);
@@ -263,46 +268,95 @@
     *error_msg = "null definitions!";
     return ERR(NULL_POINTER);
   }
+  std::vector<ArtClassDefinition> def_vector;
+  def_vector.reserve(class_count);
+  for (jint i = 0; i < class_count; i++) {
+    // We make a copy of the class_bytes to pass into the retransformation.
+    // This makes cleanup easier (since we unambiguously own the bytes) and also is useful since we
+    // will need to keep the original bytes around unaltered for subsequent RetransformClasses calls
+    // to get the passed in bytes.
+    // TODO Implement saving the original bytes.
+    unsigned char* class_bytes_copy = nullptr;
+    jvmtiError res = env->Allocate(definitions[i].class_byte_count, &class_bytes_copy);
+    if (res != OK) {
+      return res;
+    }
+    memcpy(class_bytes_copy, definitions[i].class_bytes, definitions[i].class_byte_count);
+
+    ArtClassDefinition def;
+    def.dex_len = definitions[i].class_byte_count;
+    def.dex_data = MakeJvmtiUniquePtr(env, class_bytes_copy);
+    // We are definitely modified.
+    def.SetModified();
+    def.original_dex_file = art::ArraySlice<const unsigned char>(definitions[i].class_bytes,
+                                                                 definitions[i].class_byte_count);
+    res = Transformer::FillInTransformationData(env, definitions[i].klass, &def);
+    if (res != OK) {
+      return res;
+    }
+    def_vector.push_back(std::move(def));
+  }
+  // Call all the transformation events.
+  jvmtiError res = Transformer::RetransformClassesDirect(env,
+                                                         self,
+                                                         &def_vector);
+  if (res != OK) {
+    // Something went wrong with transformation!
+    return res;
+  }
+  return RedefineClassesDirect(env, runtime, self, def_vector, error_msg);
+}
+
+jvmtiError Redefiner::RedefineClassesDirect(ArtJvmTiEnv* env,
+                                            art::Runtime* runtime,
+                                            art::Thread* self,
+                                            const std::vector<ArtClassDefinition>& definitions,
+                                            std::string* error_msg) {
+  DCHECK(env != nullptr);
+  if (definitions.size() == 0) {
+    // We don't actually need to do anything. Just return OK.
+    return OK;
+  }
   // Stop JIT for the duration of this redefine since the JIT might concurrently compile a method we
   // are going to redefine.
   art::jit::ScopedJitSuspend suspend_jit;
   // Get shared mutator lock so we can lock all the classes.
   art::ScopedObjectAccess soa(self);
-  std::vector<Redefiner::ClassRedefinition> redefinitions;
-  redefinitions.reserve(class_count);
   Redefiner r(runtime, self, error_msg);
-  for (jint i = 0; i < class_count; i++) {
-    jvmtiError res = r.AddRedefinition(env, definitions[i]);
-    if (res != OK) {
-      return res;
+  for (const ArtClassDefinition& def : definitions) {
+    // Only try to transform classes that have been modified.
+    if (def.IsModified(self)) {
+      jvmtiError res = r.AddRedefinition(env, def);
+      if (res != OK) {
+        return res;
+      }
     }
   }
   return r.Run();
 }
 
-jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefinition& def) {
+jvmtiError Redefiner::AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def) {
   std::string original_dex_location;
   jvmtiError ret = OK;
   if ((ret = GetClassLocation(env, def.klass, &original_dex_location))) {
     *error_msg_ = "Unable to get original dex file location!";
     return ret;
   }
-  std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location,
-                                                    def.class_byte_count,
-                                                    def.class_bytes,
-                                                    error_msg_));
-  std::ostringstream os;
   char* generic_ptr_unused = nullptr;
   char* signature_ptr = nullptr;
-  if (env->GetClassSignature(def.klass, &signature_ptr, &generic_ptr_unused) != OK) {
-    *error_msg_ = "A jclass passed in does not seem to be valid";
-    return ERR(INVALID_CLASS);
+  if ((ret = env->GetClassSignature(def.klass, &signature_ptr, &generic_ptr_unused)) != OK) {
+    *error_msg_ = "Unable to get class signature!";
+    return ret;
   }
-  // These will make sure we deallocate the signature.
-  JvmtiUniquePtr sig_unique_ptr(MakeJvmtiUniquePtr(env, signature_ptr));
   JvmtiUniquePtr generic_unique_ptr(MakeJvmtiUniquePtr(env, generic_ptr_unused));
+  JvmtiUniquePtr signature_unique_ptr(MakeJvmtiUniquePtr(env, signature_ptr));
+  std::unique_ptr<art::MemMap> map(MoveDataToMemMap(original_dex_location,
+                                                    def.dex_len,
+                                                    def.dex_data.get(),
+                                                    error_msg_));
+  std::ostringstream os;
   if (map.get() == nullptr) {
-    os << "Failed to create anonymous mmap for modified dex file of class " << signature_ptr
+    os << "Failed to create anonymous mmap for modified dex file of class " << def.name
        << "in dex file " << original_dex_location << " because: " << *error_msg_;
     *error_msg_ = os.str();
     return ERR(OUT_OF_MEMORY);
@@ -319,12 +373,16 @@
                                                                   /*verify_checksum*/true,
                                                                   error_msg_));
   if (dex_file.get() == nullptr) {
-    os << "Unable to load modified dex file for " << signature_ptr << ": " << *error_msg_;
+    os << "Unable to load modified dex file for " << def.name << ": " << *error_msg_;
     *error_msg_ = os.str();
     return ERR(INVALID_CLASS_FORMAT);
   }
   redefinitions_.push_back(
-      Redefiner::ClassRedefinition(this, def.klass, dex_file.release(), signature_ptr));
+      Redefiner::ClassRedefinition(this,
+                                   def.klass,
+                                   dex_file.release(),
+                                   signature_ptr,
+                                   def.original_dex_file));
   return OK;
 }
 
@@ -462,44 +520,36 @@
   result_ = result;
 }
 
-bool Redefiner::ClassRedefinition::FinishRemainingAllocations(
-    /*out*/art::MutableHandle<art::mirror::ClassLoader>* source_class_loader,
-    /*out*/art::MutableHandle<art::mirror::Object>* java_dex_file_obj,
-    /*out*/art::MutableHandle<art::mirror::LongArray>* new_dex_file_cookie,
-    /*out*/art::MutableHandle<art::mirror::DexCache>* new_dex_cache) {
-  art::StackHandleScope<4> hs(driver_->self_);
-  // This shouldn't allocate
-  art::Handle<art::mirror::ClassLoader> loader(hs.NewHandle(GetClassLoader()));
-  if (loader.Get() == nullptr) {
-    // TODO Better error msg.
-    RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
-    return false;
+art::mirror::ByteArray* Redefiner::ClassRedefinition::AllocateOrGetOriginalDexFileBytes() {
+  // If we have been specifically given a new set of bytes use that
+  if (original_dex_file_.size() != 0) {
+    return art::mirror::ByteArray::AllocateAndFill(
+        driver_->self_,
+        reinterpret_cast<const signed char*>(&original_dex_file_.At(0)),
+        original_dex_file_.size());
   }
-  art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(FindSourceDexFileObject(loader)));
-  if (dex_file_obj.Get() == nullptr) {
-    // TODO Better error msg.
-    RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
-    return false;
+
+  // See if we already have one set.
+  art::ObjPtr<art::mirror::ClassExt> ext(GetMirrorClass()->GetExtData());
+  if (!ext.IsNull()) {
+    art::ObjPtr<art::mirror::ByteArray> old_original_bytes(ext->GetOriginalDexFileBytes());
+    if (!old_original_bytes.IsNull()) {
+      // We do. Use it.
+      return old_original_bytes.Ptr();
+    }
   }
-  art::Handle<art::mirror::LongArray> new_cookie(hs.NewHandle(AllocateDexFileCookie(dex_file_obj)));
-  if (new_cookie.Get() == nullptr) {
-    driver_->self_->AssertPendingOOMException();
-    driver_->self_->ClearException();
-    RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate dex file array for class loader");
-    return false;
+
+  // Copy the current dex_file
+  const art::DexFile& current_dex_file = GetMirrorClass()->GetDexFile();
+  // TODO Handle this or make it so it cannot happen.
+  if (current_dex_file.NumClassDefs() != 1) {
+    LOG(WARNING) << "Current dex file has more than one class in it. Calling RetransformClasses "
+                 << "on this class might fail if no transformations are applied to it!";
   }
-  art::Handle<art::mirror::DexCache> dex_cache(hs.NewHandle(CreateNewDexCache(loader)));
-  if (dex_cache.Get() == nullptr) {
-    driver_->self_->AssertPendingOOMException();
-    driver_->self_->ClearException();
-    RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate DexCache");
-    return false;
-  }
-  source_class_loader->Assign(loader.Get());
-  java_dex_file_obj->Assign(dex_file_obj.Get());
-  new_dex_file_cookie->Assign(new_cookie.Get());
-  new_dex_cache->Assign(dex_cache.Get());
-  return true;
+  return art::mirror::ByteArray::AllocateAndFill(
+      driver_->self_,
+      reinterpret_cast<const signed char*>(current_dex_file.Begin()),
+      current_dex_file.Size());
 }
 
 struct CallbackCtx {
@@ -694,9 +744,10 @@
     kSlotNewDexFileCookie = 2,
     kSlotNewDexCache = 3,
     kSlotMirrorClass = 4,
+    kSlotOrigDexFile = 5,
 
     // Must be last one.
-    kNumSlots = 5,
+    kNumSlots = 6,
   };
 
   // This needs to have a HandleScope passed in that is capable of creating a new Handle without
@@ -737,6 +788,11 @@
     return art::down_cast<art::mirror::Class*>(GetSlot(klass_index, kSlotMirrorClass));
   }
 
+  art::mirror::ByteArray* GetOriginalDexFileBytes(jint klass_index)
+      REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    return art::down_cast<art::mirror::ByteArray*>(GetSlot(klass_index, kSlotOrigDexFile));
+  }
+
   void SetSourceClassLoader(jint klass_index, art::mirror::ClassLoader* loader)
       REQUIRES_SHARED(art::Locks::mutator_lock_) {
     SetSlot(klass_index, kSlotSourceClassLoader, loader);
@@ -757,6 +813,10 @@
       REQUIRES_SHARED(art::Locks::mutator_lock_) {
     SetSlot(klass_index, kSlotMirrorClass, klass);
   }
+  void SetOriginalDexFileBytes(jint klass_index, art::mirror::ByteArray* bytes)
+      REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    SetSlot(klass_index, kSlotOrigDexFile, bytes);
+  }
 
   int32_t Length() REQUIRES_SHARED(art::Locks::mutator_lock_) {
     return arr_->GetLength() / kNumSlots;
@@ -782,6 +842,51 @@
   DISALLOW_COPY_AND_ASSIGN(RedefinitionDataHolder);
 };
 
+bool Redefiner::ClassRedefinition::FinishRemainingAllocations(
+    int32_t klass_index, /*out*/RedefinitionDataHolder* holder) {
+  art::StackHandleScope<2> hs(driver_->self_);
+  holder->SetMirrorClass(klass_index, GetMirrorClass());
+  // This shouldn't allocate
+  art::Handle<art::mirror::ClassLoader> loader(hs.NewHandle(GetClassLoader()));
+  holder->SetSourceClassLoader(klass_index, loader.Get());
+  if (loader.Get() == nullptr) {
+    // TODO Better error msg.
+    RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
+    return false;
+  }
+  art::Handle<art::mirror::Object> dex_file_obj(hs.NewHandle(FindSourceDexFileObject(loader)));
+  holder->SetJavaDexFile(klass_index, dex_file_obj.Get());
+  if (dex_file_obj.Get() == nullptr) {
+    // TODO Better error msg.
+    RecordFailure(ERR(INTERNAL), "Unable to find class loader!");
+    return false;
+  }
+  holder->SetNewDexFileCookie(klass_index, AllocateDexFileCookie(dex_file_obj));
+  if (holder->GetNewDexFileCookie(klass_index) == nullptr) {
+    driver_->self_->AssertPendingOOMException();
+    driver_->self_->ClearException();
+    RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate dex file array for class loader");
+    return false;
+  }
+  holder->SetNewDexCache(klass_index, CreateNewDexCache(loader));
+  if (holder->GetNewDexCache(klass_index) == nullptr) {
+    driver_->self_->AssertPendingOOMException();
+    driver_->self_->ClearException();
+    RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate DexCache");
+    return false;
+  }
+
+  // We won't always need to set this field.
+  holder->SetOriginalDexFileBytes(klass_index, AllocateOrGetOriginalDexFileBytes());
+  if (holder->GetOriginalDexFileBytes(klass_index) == nullptr) {
+    driver_->self_->AssertPendingOOMException();
+    driver_->self_->ClearException();
+    RecordFailure(ERR(OUT_OF_MEMORY), "Unable to allocate array for original dex file");
+    return false;
+  }
+  return true;
+}
+
 bool Redefiner::CheckAllRedefinitionAreValid() {
   for (Redefiner::ClassRedefinition& redef : redefinitions_) {
     if (!redef.CheckRedefinitionIsValid()) {
@@ -802,33 +907,11 @@
 
 bool Redefiner::FinishAllRemainingAllocations(RedefinitionDataHolder& holder) {
   int32_t cnt = 0;
-  art::StackHandleScope<4> hs(self_);
-  art::MutableHandle<art::mirror::Object> java_dex_file(hs.NewHandle<art::mirror::Object>(nullptr));
-  art::MutableHandle<art::mirror::ClassLoader> source_class_loader(
-      hs.NewHandle<art::mirror::ClassLoader>(nullptr));
-  art::MutableHandle<art::mirror::LongArray> new_dex_file_cookie(
-      hs.NewHandle<art::mirror::LongArray>(nullptr));
-  art::MutableHandle<art::mirror::DexCache> new_dex_cache(
-      hs.NewHandle<art::mirror::DexCache>(nullptr));
   for (Redefiner::ClassRedefinition& redef : redefinitions_) {
-    // Reset the out pointers to null
-    source_class_loader.Assign(nullptr);
-    java_dex_file.Assign(nullptr);
-    new_dex_file_cookie.Assign(nullptr);
-    new_dex_cache.Assign(nullptr);
     // Allocate the data this redefinition requires.
-    if (!redef.FinishRemainingAllocations(&source_class_loader,
-                                          &java_dex_file,
-                                          &new_dex_file_cookie,
-                                          &new_dex_cache)) {
+    if (!redef.FinishRemainingAllocations(cnt, &holder)) {
       return false;
     }
-    // Save the allocated data into the holder.
-    holder.SetSourceClassLoader(cnt, source_class_loader.Get());
-    holder.SetJavaDexFile(cnt, java_dex_file.Get());
-    holder.SetNewDexFileCookie(cnt, new_dex_file_cookie.Get());
-    holder.SetNewDexCache(cnt, new_dex_cache.Get());
-    holder.SetMirrorClass(cnt, redef.GetMirrorClass());
     cnt++;
   }
   return true;
@@ -894,7 +977,7 @@
     redef.UpdateJavaDexFile(holder.GetJavaDexFile(cnt), holder.GetNewDexFileCookie(cnt));
     // TODO Rewrite so we don't do a stack walk for each and every class.
     redef.FindAndAllocateObsoleteMethods(klass);
-    redef.UpdateClass(klass, holder.GetNewDexCache(cnt));
+    redef.UpdateClass(klass, holder.GetNewDexCache(cnt), holder.GetOriginalDexFileBytes(cnt));
     cnt++;
   }
   // Ensure that obsolete methods are deoptimized. This is needed since optimized methods may have
@@ -958,7 +1041,6 @@
     linker->SetEntryPointsToInterpreter(&method);
     method.SetCodeItemOffset(dex_file_->FindCodeItemOffset(class_def, dex_method_idx));
     method.SetDexCacheResolvedMethods(new_dex_cache->GetResolvedMethods(), image_pointer_size);
-    method.SetDexCacheResolvedTypes(new_dex_cache->GetResolvedTypes(), image_pointer_size);
     // Notify the jit that this method is redefined.
     art::jit::Jit* jit = driver_->runtime_->GetJit();
     if (jit != nullptr) {
@@ -988,20 +1070,24 @@
 }
 
 // Performs updates to class that will allow us to verify it.
-void Redefiner::ClassRedefinition::UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
-                                               art::ObjPtr<art::mirror::DexCache> new_dex_cache) {
-  const art::DexFile::ClassDef* class_def = art::OatFile::OatDexFile::FindClassDef(
-      *dex_file_, class_sig_.c_str(), art::ComputeModifiedUtf8Hash(class_sig_.c_str()));
-  DCHECK(class_def != nullptr);
-  UpdateMethods(mclass, new_dex_cache, *class_def);
+void Redefiner::ClassRedefinition::UpdateClass(
+    art::ObjPtr<art::mirror::Class> mclass,
+    art::ObjPtr<art::mirror::DexCache> new_dex_cache,
+    art::ObjPtr<art::mirror::ByteArray> original_dex_file) {
+  DCHECK_EQ(dex_file_->NumClassDefs(), 1u);
+  const art::DexFile::ClassDef& class_def = dex_file_->GetClassDef(0);
+  UpdateMethods(mclass, new_dex_cache, class_def);
   UpdateFields(mclass);
 
   // Update the class fields.
   // Need to update class last since the ArtMethod gets its DexFile from the class (which is needed
   // to call GetReturnTypeDescriptor and GetParameterTypeList above).
   mclass->SetDexCache(new_dex_cache.Ptr());
-  mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(*class_def));
+  mclass->SetDexClassDefIndex(dex_file_->GetIndexForClassDef(class_def));
   mclass->SetDexTypeIndex(dex_file_->GetIndexForTypeId(*dex_file_->FindTypeId(class_sig_.c_str())));
+  art::ObjPtr<art::mirror::ClassExt> ext(mclass->GetExtData());
+  CHECK(!ext.IsNull());
+  ext->SetOriginalDexFileBytes(original_dex_file);
 }
 
 void Redefiner::ClassRedefinition::UpdateJavaDexFile(
diff --git a/runtime/openjdkjvmti/ti_redefine.h b/runtime/openjdkjvmti/ti_redefine.h
index 8626bc5..fdc13ee 100644
--- a/runtime/openjdkjvmti/ti_redefine.h
+++ b/runtime/openjdkjvmti/ti_redefine.h
@@ -38,6 +38,7 @@
 
 #include "art_jvmti.h"
 #include "art_method.h"
+#include "base/array_slice.h"
 #include "class_linker.h"
 #include "dex_file.h"
 #include "gc_root-inl.h"
@@ -56,6 +57,7 @@
 #include "obj_ptr.h"
 #include "scoped_thread_state_change-inl.h"
 #include "stack.h"
+#include "ti_class_definition.h"
 #include "thread_list.h"
 #include "transform.h"
 #include "utf.h"
@@ -72,23 +74,41 @@
  public:
   // Redefine the given classes with the given dex data. Note this function does not take ownership
   // of the dex_data pointers. It is not used after this call however and may be freed if desired.
+  // The caller is responsible for freeing it. The runtime makes its own copy of the data. This
+  // function does not call the transformation events.
+  // TODO Check modified flag of the definitions.
+  static jvmtiError RedefineClassesDirect(ArtJvmTiEnv* env,
+                                          art::Runtime* runtime,
+                                          art::Thread* self,
+                                          const std::vector<ArtClassDefinition>& definitions,
+                                          /*out*/std::string* error_msg);
+
+  // Redefine the given classes with the given dex data. Note this function does not take ownership
+  // of the dex_data pointers. It is not used after this call however and may be freed if desired.
   // The caller is responsible for freeing it. The runtime makes its own copy of the data.
+  // TODO This function should call the transformation events.
   static jvmtiError RedefineClasses(ArtJvmTiEnv* env,
                                     art::Runtime* runtime,
                                     art::Thread* self,
                                     jint class_count,
                                     const jvmtiClassDefinition* definitions,
-                                    std::string* error_msg);
+                                    /*out*/std::string* error_msg);
 
   static jvmtiError IsModifiableClass(jvmtiEnv* env, jclass klass, jboolean* is_redefinable);
 
+  static std::unique_ptr<art::MemMap> MoveDataToMemMap(const std::string& original_location,
+                                                       jint data_len,
+                                                       const unsigned char* dex_data,
+                                                       std::string* error_msg);
+
  private:
   class ClassRedefinition {
    public:
     ClassRedefinition(Redefiner* driver,
                       jclass klass,
                       const art::DexFile* redefined_dex_file,
-                      const char* class_sig)
+                      const char* class_sig,
+                      art::ArraySlice<const unsigned char> orig_dex_file)
       REQUIRES_SHARED(art::Locks::mutator_lock_);
 
     // NO_THREAD_SAFETY_ANALYSIS so we can unlock the class in the destructor.
@@ -99,7 +119,8 @@
         : driver_(other.driver_),
           klass_(other.klass_),
           dex_file_(std::move(other.dex_file_)),
-          class_sig_(std::move(other.class_sig_)) {
+          class_sig_(std::move(other.class_sig_)),
+          original_dex_file_(other.original_dex_file_) {
       other.driver_ = nullptr;
     }
 
@@ -118,15 +139,15 @@
     art::mirror::LongArray* AllocateDexFileCookie(art::Handle<art::mirror::Object> j_dex_file_obj)
         REQUIRES_SHARED(art::Locks::mutator_lock_);
 
+    // This may return nullptr with a OOME pending if allocation fails.
+    art::mirror::ByteArray* AllocateOrGetOriginalDexFileBytes()
+        REQUIRES_SHARED(art::Locks::mutator_lock_);
+
     void RecordFailure(jvmtiError e, const std::string& err) {
       driver_->RecordFailure(e, class_sig_, err);
     }
 
-    bool FinishRemainingAllocations(
-          /*out*/art::MutableHandle<art::mirror::ClassLoader>* source_class_loader,
-          /*out*/art::MutableHandle<art::mirror::Object>* source_dex_file_obj,
-          /*out*/art::MutableHandle<art::mirror::LongArray>* new_dex_file_cookie,
-          /*out*/art::MutableHandle<art::mirror::DexCache>* new_dex_cache)
+    bool FinishRemainingAllocations(int32_t klass_index, /*out*/RedefinitionDataHolder* holder)
         REQUIRES_SHARED(art::Locks::mutator_lock_);
 
     void FindAndAllocateObsoleteMethods(art::mirror::Class* art_klass)
@@ -179,7 +200,8 @@
         REQUIRES(art::Locks::mutator_lock_);
 
     void UpdateClass(art::ObjPtr<art::mirror::Class> mclass,
-                     art::ObjPtr<art::mirror::DexCache> new_dex_cache)
+                     art::ObjPtr<art::mirror::DexCache> new_dex_cache,
+                     art::ObjPtr<art::mirror::ByteArray> original_dex_file)
         REQUIRES(art::Locks::mutator_lock_);
 
     void ReleaseDexFile() REQUIRES_SHARED(art::Locks::mutator_lock_);
@@ -189,6 +211,7 @@
     jclass klass_;
     std::unique_ptr<const art::DexFile> dex_file_;
     std::string class_sig_;
+    art::ArraySlice<const unsigned char> original_dex_file_;
   };
 
   jvmtiError result_;
@@ -209,18 +232,13 @@
         redefinitions_(),
         error_msg_(error_msg) { }
 
-  jvmtiError AddRedefinition(ArtJvmTiEnv* env, const jvmtiClassDefinition& def)
+  jvmtiError AddRedefinition(ArtJvmTiEnv* env, const ArtClassDefinition& def)
       REQUIRES_SHARED(art::Locks::mutator_lock_);
 
   static jvmtiError GetClassRedefinitionError(art::Handle<art::mirror::Class> klass,
                                               /*out*/std::string* error_msg)
       REQUIRES_SHARED(art::Locks::mutator_lock_);
 
-  static std::unique_ptr<art::MemMap> MoveDataToMemMap(const std::string& original_location,
-                                                       jint data_len,
-                                                       const unsigned char* dex_data,
-                                                       std::string* error_msg);
-
   // TODO Put on all the lock qualifiers.
   jvmtiError Run() REQUIRES_SHARED(art::Locks::mutator_lock_);
 
diff --git a/runtime/openjdkjvmti/ti_search.cc b/runtime/openjdkjvmti/ti_search.cc
new file mode 100644
index 0000000..913d2b6
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_search.cc
@@ -0,0 +1,122 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_search.h"
+
+#include "jni.h"
+
+#include "art_jvmti.h"
+#include "base/macros.h"
+#include "class_linker.h"
+#include "dex_file.h"
+#include "runtime.h"
+#include "scoped_thread_state_change-inl.h"
+#include "ScopedLocalRef.h"
+
+namespace openjdkjvmti {
+
+jvmtiError SearchUtil::AddToBootstrapClassLoaderSearch(jvmtiEnv* env ATTRIBUTE_UNUSED,
+                                                       const char* segment) {
+  art::Runtime* current = art::Runtime::Current();
+  if (current == nullptr) {
+    return ERR(WRONG_PHASE);
+  }
+  if (current->GetClassLinker() == nullptr) {
+    // TODO: Support boot classpath change in OnLoad.
+    return ERR(WRONG_PHASE);
+  }
+  if (segment == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  std::string error_msg;
+  std::vector<std::unique_ptr<const art::DexFile>> dex_files;
+  if (!art::DexFile::Open(segment, segment, true, &error_msg, &dex_files)) {
+    LOG(WARNING) << "Could not open " << segment << " for boot classpath extension: " << error_msg;
+    return ERR(ILLEGAL_ARGUMENT);
+  }
+
+  art::ScopedObjectAccess soa(art::Thread::Current());
+  for (std::unique_ptr<const art::DexFile>& dex_file : dex_files) {
+    current->GetClassLinker()->AppendToBootClassPath(art::Thread::Current(), *dex_file.release());
+  }
+
+  return ERR(NONE);
+}
+
+jvmtiError SearchUtil::AddToSystemClassLoaderSearch(jvmtiEnv* jvmti_env ATTRIBUTE_UNUSED,
+                                                    const char* segment) {
+  if (segment == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  art::Runtime* current = art::Runtime::Current();
+  if (current == nullptr) {
+    return ERR(WRONG_PHASE);
+  }
+  jobject sys_class_loader = current->GetSystemClassLoader();
+  if (sys_class_loader == nullptr) {
+    // TODO: Support classpath change in OnLoad.
+    return ERR(WRONG_PHASE);
+  }
+
+  // We'll use BaseDexClassLoader.addDexPath, as it takes care of array resizing etc. As a downside,
+  // exceptions are swallowed.
+
+  art::Thread* self = art::Thread::Current();
+  JNIEnv* env = self->GetJniEnv();
+  if (!env->IsInstanceOf(sys_class_loader,
+                         art::WellKnownClasses::dalvik_system_BaseDexClassLoader)) {
+    return ERR(INTERNAL);
+  }
+
+  jmethodID add_dex_path_id = env->GetMethodID(
+      art::WellKnownClasses::dalvik_system_BaseDexClassLoader,
+      "addDexPath",
+      "(Ljava/lang/String;)V");
+  if (add_dex_path_id == nullptr) {
+    return ERR(INTERNAL);
+  }
+
+  ScopedLocalRef<jstring> dex_path(env, env->NewStringUTF(segment));
+  if (dex_path.get() == nullptr) {
+    return ERR(INTERNAL);
+  }
+  env->CallVoidMethod(sys_class_loader, add_dex_path_id, dex_path.get());
+
+  if (env->ExceptionCheck()) {
+    env->ExceptionClear();
+    return ERR(ILLEGAL_ARGUMENT);
+  }
+  return ERR(NONE);
+}
+
+}  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_search.h b/runtime/openjdkjvmti/ti_search.h
new file mode 100644
index 0000000..6a52e80
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_search.h
@@ -0,0 +1,48 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_SEARCH_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_SEARCH_H_
+
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+class SearchUtil {
+ public:
+  static jvmtiError AddToBootstrapClassLoaderSearch(jvmtiEnv* env, const char* segment);
+
+  static jvmtiError AddToSystemClassLoaderSearch(jvmtiEnv* env, const char* segment);
+};
+
+}  // namespace openjdkjvmti
+
+#endif  // ART_RUNTIME_OPENJDKJVMTI_TI_SEARCH_H_
diff --git a/runtime/openjdkjvmti/ti_thread.cc b/runtime/openjdkjvmti/ti_thread.cc
index e20f560..b18a5cd 100644
--- a/runtime/openjdkjvmti/ti_thread.cc
+++ b/runtime/openjdkjvmti/ti_thread.cc
@@ -31,21 +31,103 @@
 
 #include "ti_thread.h"
 
+#include "android-base/strings.h"
 #include "art_field.h"
 #include "art_jvmti.h"
 #include "base/logging.h"
 #include "base/mutex.h"
+#include "events-inl.h"
+#include "gc/system_weak.h"
+#include "gc_root-inl.h"
 #include "jni_internal.h"
 #include "mirror/class.h"
 #include "mirror/object-inl.h"
 #include "mirror/string.h"
 #include "obj_ptr.h"
+#include "runtime.h"
+#include "runtime_callbacks.h"
+#include "ScopedLocalRef.h"
 #include "scoped_thread_state_change-inl.h"
 #include "thread-inl.h"
+#include "thread_list.h"
 #include "well_known_classes.h"
 
 namespace openjdkjvmti {
 
+struct ThreadCallback : public art::ThreadLifecycleCallback, public art::RuntimePhaseCallback {
+  jthread GetThreadObject(art::Thread* self) REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    if (self->GetPeer() == nullptr) {
+      return nullptr;
+    }
+    return self->GetJniEnv()->AddLocalReference<jthread>(self->GetPeer());
+  }
+  template <ArtJvmtiEvent kEvent>
+  void Post(art::Thread* self) REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    DCHECK_EQ(self, art::Thread::Current());
+    ScopedLocalRef<jthread> thread(self->GetJniEnv(), GetThreadObject(self));
+    art::ScopedThreadSuspension sts(self, art::ThreadState::kNative);
+    event_handler->DispatchEvent<kEvent>(self,
+                                         reinterpret_cast<JNIEnv*>(self->GetJniEnv()),
+                                         thread.get());
+  }
+
+  void ThreadStart(art::Thread* self) OVERRIDE REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    if (!started) {
+      // Runtime isn't started. We only expect at most the signal handler or JIT threads to be
+      // started here.
+      if (art::kIsDebugBuild) {
+        std::string name;
+        self->GetThreadName(name);
+        if (name != "Signal Catcher" && !android::base::StartsWith(name, "Jit thread pool")) {
+          LOG(FATAL) << "Unexpected thread before start: " << name;
+        }
+      }
+      return;
+    }
+    Post<ArtJvmtiEvent::kThreadStart>(self);
+  }
+
+  void ThreadDeath(art::Thread* self) OVERRIDE REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    Post<ArtJvmtiEvent::kThreadEnd>(self);
+  }
+
+  void NextRuntimePhase(RuntimePhase phase) OVERRIDE REQUIRES_SHARED(art::Locks::mutator_lock_) {
+    if (phase == RuntimePhase::kInit) {
+      // We moved to VMInit. Report the main thread as started (it was attached early, and must
+      // not be reported until Init.
+      started = true;
+      Post<ArtJvmtiEvent::kThreadStart>(art::Thread::Current());
+    }
+  }
+
+  EventHandler* event_handler = nullptr;
+  bool started = false;
+};
+
+ThreadCallback gThreadCallback;
+
+void ThreadUtil::Register(EventHandler* handler) {
+  art::Runtime* runtime = art::Runtime::Current();
+
+  gThreadCallback.started = runtime->IsStarted();
+  gThreadCallback.event_handler = handler;
+
+  art::ScopedThreadStateChange stsc(art::Thread::Current(),
+                                    art::ThreadState::kWaitingForDebuggerToAttach);
+  art::ScopedSuspendAll ssa("Add thread callback");
+  runtime->GetRuntimeCallbacks()->AddThreadLifecycleCallback(&gThreadCallback);
+  runtime->GetRuntimeCallbacks()->AddRuntimePhaseCallback(&gThreadCallback);
+}
+
+void ThreadUtil::Unregister() {
+  art::ScopedThreadStateChange stsc(art::Thread::Current(),
+                                    art::ThreadState::kWaitingForDebuggerToAttach);
+  art::ScopedSuspendAll ssa("Remove thread callback");
+  art::Runtime* runtime = art::Runtime::Current();
+  runtime->GetRuntimeCallbacks()->RemoveThreadLifecycleCallback(&gThreadCallback);
+  runtime->GetRuntimeCallbacks()->RemoveRuntimePhaseCallback(&gThreadCallback);
+}
+
 jvmtiError ThreadUtil::GetCurrentThread(jvmtiEnv* env ATTRIBUTE_UNUSED, jthread* thread_ptr) {
   art::Thread* self = art::Thread::Current();
 
@@ -354,4 +436,165 @@
   return ERR(NONE);
 }
 
+jvmtiError ThreadUtil::GetAllThreads(jvmtiEnv* env,
+                                     jint* threads_count_ptr,
+                                     jthread** threads_ptr) {
+  if (threads_count_ptr == nullptr || threads_ptr == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  art::Thread* current = art::Thread::Current();
+
+  art::ScopedObjectAccess soa(current);
+
+  art::MutexLock mu(current, *art::Locks::thread_list_lock_);
+  std::list<art::Thread*> thread_list = art::Runtime::Current()->GetThreadList()->GetList();
+
+  std::vector<art::ObjPtr<art::mirror::Object>> peers;
+
+  for (art::Thread* thread : thread_list) {
+    // Skip threads that are still starting.
+    if (thread->IsStillStarting()) {
+      continue;
+    }
+
+    art::ObjPtr<art::mirror::Object> peer = thread->GetPeer();
+    if (peer != nullptr) {
+      peers.push_back(peer);
+    }
+  }
+
+  if (peers.empty()) {
+    *threads_count_ptr = 0;
+    *threads_ptr = nullptr;
+  } else {
+    unsigned char* data;
+    jvmtiError data_result = env->Allocate(peers.size() * sizeof(jthread), &data);
+    if (data_result != ERR(NONE)) {
+      return data_result;
+    }
+    jthread* threads = reinterpret_cast<jthread*>(data);
+    for (size_t i = 0; i != peers.size(); ++i) {
+      threads[i] = soa.AddLocalReference<jthread>(peers[i]);
+    }
+
+    *threads_count_ptr = static_cast<jint>(peers.size());
+    *threads_ptr = threads;
+  }
+  return ERR(NONE);
+}
+
+jvmtiError ThreadUtil::SetThreadLocalStorage(jvmtiEnv* env ATTRIBUTE_UNUSED,
+                                             jthread thread,
+                                             const void* data) {
+  art::ScopedObjectAccess soa(art::Thread::Current());
+  art::Thread* self = GetNativeThread(thread, soa);
+  if (self == nullptr && thread == nullptr) {
+    return ERR(INVALID_THREAD);
+  }
+  if (self == nullptr) {
+    return ERR(THREAD_NOT_ALIVE);
+  }
+
+  self->SetCustomTLS(data);
+
+  return ERR(NONE);
+}
+
+jvmtiError ThreadUtil::GetThreadLocalStorage(jvmtiEnv* env ATTRIBUTE_UNUSED,
+                                             jthread thread,
+                                             void** data_ptr) {
+  if (data_ptr == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  art::ScopedObjectAccess soa(art::Thread::Current());
+  art::Thread* self = GetNativeThread(thread, soa);
+  if (self == nullptr && thread == nullptr) {
+    return ERR(INVALID_THREAD);
+  }
+  if (self == nullptr) {
+    return ERR(THREAD_NOT_ALIVE);
+  }
+
+  *data_ptr = const_cast<void*>(self->GetCustomTLS());
+  return ERR(NONE);
+}
+
+struct AgentData {
+  const void* arg;
+  jvmtiStartFunction proc;
+  jthread thread;
+  JavaVM* java_vm;
+  jvmtiEnv* jvmti_env;
+  jint priority;
+};
+
+static void* AgentCallback(void* arg) {
+  std::unique_ptr<AgentData> data(reinterpret_cast<AgentData*>(arg));
+  CHECK(data->thread != nullptr);
+
+  // We already have a peer. So call our special Attach function.
+  art::Thread* self = art::Thread::Attach("JVMTI Agent thread", true, data->thread);
+  CHECK(self != nullptr);
+  // The name in Attach() is only for logging. Set the thread name. This is important so
+  // that the thread is no longer seen as starting up.
+  {
+    art::ScopedObjectAccess soa(self);
+    self->SetThreadName("JVMTI Agent thread");
+  }
+
+  // Release the peer.
+  JNIEnv* env = self->GetJniEnv();
+  env->DeleteGlobalRef(data->thread);
+  data->thread = nullptr;
+
+  // Run the agent code.
+  data->proc(data->jvmti_env, env, const_cast<void*>(data->arg));
+
+  // Detach the thread.
+  int detach_result = data->java_vm->DetachCurrentThread();
+  CHECK_EQ(detach_result, 0);
+
+  return nullptr;
+}
+
+jvmtiError ThreadUtil::RunAgentThread(jvmtiEnv* jvmti_env,
+                                      jthread thread,
+                                      jvmtiStartFunction proc,
+                                      const void* arg,
+                                      jint priority) {
+  if (priority < JVMTI_THREAD_MIN_PRIORITY || priority > JVMTI_THREAD_MAX_PRIORITY) {
+    return ERR(INVALID_PRIORITY);
+  }
+  JNIEnv* env = art::Thread::Current()->GetJniEnv();
+  if (thread == nullptr || !env->IsInstanceOf(thread, art::WellKnownClasses::java_lang_Thread)) {
+    return ERR(INVALID_THREAD);
+  }
+  if (proc == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  std::unique_ptr<AgentData> data(new AgentData);
+  data->arg = arg;
+  data->proc = proc;
+  // We need a global ref for Java objects, as local refs will be invalid.
+  data->thread = env->NewGlobalRef(thread);
+  data->java_vm = art::Runtime::Current()->GetJavaVM();
+  data->jvmti_env = jvmti_env;
+  data->priority = priority;
+
+  pthread_t pthread;
+  int pthread_create_result = pthread_create(&pthread,
+                                             nullptr,
+                                             &AgentCallback,
+                                             reinterpret_cast<void*>(data.get()));
+  if (pthread_create_result != 0) {
+    return ERR(INTERNAL);
+  }
+  data.release();
+
+  return ERR(NONE);
+}
+
 }  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_thread.h b/runtime/openjdkjvmti/ti_thread.h
index b6ffbb5..f6f93ee 100644
--- a/runtime/openjdkjvmti/ti_thread.h
+++ b/runtime/openjdkjvmti/ti_thread.h
@@ -37,13 +37,29 @@
 
 namespace openjdkjvmti {
 
+class EventHandler;
+
 class ThreadUtil {
  public:
+  static void Register(EventHandler* event_handler);
+  static void Unregister();
+
+  static jvmtiError GetAllThreads(jvmtiEnv* env, jint* threads_count_ptr, jthread** threads_ptr);
+
   static jvmtiError GetCurrentThread(jvmtiEnv* env, jthread* thread_ptr);
 
   static jvmtiError GetThreadInfo(jvmtiEnv* env, jthread thread, jvmtiThreadInfo* info_ptr);
 
   static jvmtiError GetThreadState(jvmtiEnv* env, jthread thread, jint* thread_state_ptr);
+
+  static jvmtiError SetThreadLocalStorage(jvmtiEnv* env, jthread thread, const void* data);
+  static jvmtiError GetThreadLocalStorage(jvmtiEnv* env, jthread thread, void** data_ptr);
+
+  static jvmtiError RunAgentThread(jvmtiEnv* env,
+                                   jthread thread,
+                                   jvmtiStartFunction proc,
+                                   const void* arg,
+                                   jint priority);
 };
 
 }  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_threadgroup.cc b/runtime/openjdkjvmti/ti_threadgroup.cc
index 31c7582..35b1bfd 100644
--- a/runtime/openjdkjvmti/ti_threadgroup.cc
+++ b/runtime/openjdkjvmti/ti_threadgroup.cc
@@ -42,6 +42,7 @@
 #include "mirror/object-inl.h"
 #include "mirror/string.h"
 #include "obj_ptr.h"
+#include "object_lock.h"
 #include "runtime.h"
 #include "scoped_thread_state_change-inl.h"
 #include "thread-inl.h"
@@ -151,29 +152,25 @@
 }
 
 
-static bool IsInDesiredThreadGroup(art::ObjPtr<art::mirror::Object> desired_thread_group,
+static bool IsInDesiredThreadGroup(art::Handle<art::mirror::Object> desired_thread_group,
                                    art::ObjPtr<art::mirror::Object> peer)
     REQUIRES_SHARED(art::Locks::mutator_lock_) {
-  CHECK(desired_thread_group != nullptr);
+  CHECK(desired_thread_group.Get() != nullptr);
 
   art::ArtField* thread_group_field =
       art::jni::DecodeArtField(art::WellKnownClasses::java_lang_Thread_group);
   DCHECK(thread_group_field != nullptr);
   art::ObjPtr<art::mirror::Object> group = thread_group_field->GetObject(peer);
-  return (group == desired_thread_group);
+  return (group == desired_thread_group.Get());
 }
 
-static void GetThreads(art::ObjPtr<art::mirror::Object> thread_group,
+static void GetThreads(art::Handle<art::mirror::Object> thread_group,
                        std::vector<art::ObjPtr<art::mirror::Object>>* thread_peers)
     REQUIRES_SHARED(art::Locks::mutator_lock_) REQUIRES(!art::Locks::thread_list_lock_) {
-  CHECK(thread_group != nullptr);
+  CHECK(thread_group.Get() != nullptr);
 
-  std::list<art::Thread*> all_threads_list;
-  {
-    art::MutexLock mu(art::Thread::Current(), *art::Locks::thread_list_lock_);
-    all_threads_list = art::Runtime::Current()->GetThreadList()->GetList();
-  }
-  for (art::Thread* t : all_threads_list) {
+  art::MutexLock mu(art::Thread::Current(), *art::Locks::thread_list_lock_);
+  for (art::Thread* t : art::Runtime::Current()->GetThreadList()->GetList()) {
     if (t->IsStillStarting()) {
       continue;
     }
@@ -187,15 +184,15 @@
   }
 }
 
-static void GetChildThreadGroups(art::ObjPtr<art::mirror::Object> thread_group,
+static void GetChildThreadGroups(art::Handle<art::mirror::Object> thread_group,
                                  std::vector<art::ObjPtr<art::mirror::Object>>* thread_groups)
     REQUIRES_SHARED(art::Locks::mutator_lock_) {
-  CHECK(thread_group != nullptr);
+  CHECK(thread_group.Get() != nullptr);
 
   // Get the ThreadGroup[] "groups" out of this thread group...
   art::ArtField* groups_field =
       art::jni::DecodeArtField(art::WellKnownClasses::java_lang_ThreadGroup_groups);
-  art::ObjPtr<art::mirror::Object> groups_array = groups_field->GetObject(thread_group);
+  art::ObjPtr<art::mirror::Object> groups_array = groups_field->GetObject(thread_group.Get());
 
   if (groups_array == nullptr) {
     return;
@@ -230,7 +227,11 @@
     return ERR(INVALID_THREAD_GROUP);
   }
 
-  art::ObjPtr<art::mirror::Object> thread_group = soa.Decode<art::mirror::Object>(group);
+  art::StackHandleScope<1> hs(soa.Self());
+  art::Handle<art::mirror::Object> thread_group = hs.NewHandle(
+      soa.Decode<art::mirror::Object>(group));
+
+  art::ObjectLock<art::mirror::Object> thread_group_lock(soa.Self(), thread_group);
 
   std::vector<art::ObjPtr<art::mirror::Object>> thread_peers;
   GetThreads(thread_group, &thread_peers);
diff --git a/runtime/openjdkjvmti/ti_timers.cc b/runtime/openjdkjvmti/ti_timers.cc
new file mode 100644
index 0000000..24fb041
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_timers.cc
@@ -0,0 +1,93 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#include "ti_timers.h"
+
+#include <limits>
+
+#ifndef __APPLE__
+#include <time.h>
+#else
+#include <sys/time.h>
+#endif
+#include <unistd.h>
+
+#include "art_jvmti.h"
+#include "base/macros.h"
+
+namespace openjdkjvmti {
+
+jvmtiError TimerUtil::GetAvailableProcessors(jvmtiEnv* env ATTRIBUTE_UNUSED,
+                                             jint* processor_count_ptr) {
+  if (processor_count_ptr == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  *processor_count_ptr = static_cast<jint>(sysconf(_SC_NPROCESSORS_CONF));
+
+  return ERR(NONE);
+}
+
+jvmtiError TimerUtil::GetTimerInfo(jvmtiEnv* env ATTRIBUTE_UNUSED, jvmtiTimerInfo* info_ptr) {
+  if (info_ptr == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+  info_ptr->max_value = static_cast<jlong>(std::numeric_limits<uint64_t>::max());
+  info_ptr->may_skip_forward = JNI_TRUE;
+  info_ptr->may_skip_backward = JNI_TRUE;
+  info_ptr->kind = jvmtiTimerKind::JVMTI_TIMER_ELAPSED;
+
+  return ERR(NONE);
+}
+
+jvmtiError TimerUtil::GetTime(jvmtiEnv* env ATTRIBUTE_UNUSED, jlong* nanos_ptr) {
+  if (nanos_ptr == nullptr) {
+    return ERR(NULL_POINTER);
+  }
+
+#ifndef __APPLE__
+  // Use the same implementation as System.nanoTime.
+  struct timespec now;
+  clock_gettime(CLOCK_MONOTONIC, &now);
+  *nanos_ptr = now.tv_sec * 1000000000LL + now.tv_nsec;
+#else
+  // No CLOCK_MONOTONIC support on older Mac OS.
+  struct timeval t;
+  t.tv_sec = t.tv_usec = 0;
+  gettimeofday(&t, NULL);
+  *nanos_ptr = static_cast<jlong>(t.tv_sec)*1000000000LL + static_cast<jlong>(t.tv_usec)*1000LL;
+#endif
+
+  return ERR(NONE);
+}
+
+}  // namespace openjdkjvmti
diff --git a/runtime/openjdkjvmti/ti_timers.h b/runtime/openjdkjvmti/ti_timers.h
new file mode 100644
index 0000000..6300678
--- /dev/null
+++ b/runtime/openjdkjvmti/ti_timers.h
@@ -0,0 +1,51 @@
+/* Copyright (C) 2017 The Android Open Source Project
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This file implements interfaces from the file jvmti.h. This implementation
+ * is licensed under the same terms as the file jvmti.h.  The
+ * copyright and license information for the file jvmti.h follows.
+ *
+ * Copyright (c) 2003, 2011, Oracle and/or its affiliates. All rights reserved.
+ * DO NOT ALTER OR REMOVE COPYRIGHT NOTICES OR THIS FILE HEADER.
+ *
+ * This code is free software; you can redistribute it and/or modify it
+ * under the terms of the GNU General Public License version 2 only, as
+ * published by the Free Software Foundation.  Oracle designates this
+ * particular file as subject to the "Classpath" exception as provided
+ * by Oracle in the LICENSE file that accompanied this code.
+ *
+ * This code is distributed in the hope that it will be useful, but WITHOUT
+ * ANY WARRANTY; without even the implied warranty of MERCHANTABILITY or
+ * FITNESS FOR A PARTICULAR PURPOSE.  See the GNU General Public License
+ * version 2 for more details (a copy is included in the LICENSE file that
+ * accompanied this code).
+ *
+ * You should have received a copy of the GNU General Public License version
+ * 2 along with this work; if not, write to the Free Software Foundation,
+ * Inc., 51 Franklin St, Fifth Floor, Boston, MA 02110-1301 USA.
+ *
+ * Please contact Oracle, 500 Oracle Parkway, Redwood Shores, CA 94065 USA
+ * or visit www.oracle.com if you need additional information or have any
+ * questions.
+ */
+
+#ifndef ART_RUNTIME_OPENJDKJVMTI_TI_TIMERS_H_
+#define ART_RUNTIME_OPENJDKJVMTI_TI_TIMERS_H_
+
+#include "jni.h"
+#include "jvmti.h"
+
+namespace openjdkjvmti {
+
+class TimerUtil {
+ public:
+  static jvmtiError GetAvailableProcessors(jvmtiEnv* env, jint* processor_count_ptr);
+
+  static jvmtiError GetTimerInfo(jvmtiEnv* env, jvmtiTimerInfo* info_ptr);
+
+  static jvmtiError GetTime(jvmtiEnv* env, jlong* nanos_ptr);
+};
+
+}  // namespace openjdkjvmti
+
+#endif  // ART_RUNTIME_OPENJDKJVMTI_TI_TIMERS_H_
diff --git a/runtime/openjdkjvmti/transform.cc b/runtime/openjdkjvmti/transform.cc
index f545125..3c4cfea 100644
--- a/runtime/openjdkjvmti/transform.cc
+++ b/runtime/openjdkjvmti/transform.cc
@@ -38,6 +38,7 @@
 #include "class_linker.h"
 #include "dex_file.h"
 #include "dex_file_types.h"
+#include "events-inl.h"
 #include "gc_root-inl.h"
 #include "globals.h"
 #include "jni_env_ext-inl.h"
@@ -46,18 +47,81 @@
 #include "mem_map.h"
 #include "mirror/array.h"
 #include "mirror/class-inl.h"
+#include "mirror/class_ext.h"
 #include "mirror/class_loader-inl.h"
 #include "mirror/string-inl.h"
 #include "oat_file.h"
 #include "scoped_thread_state_change-inl.h"
 #include "stack.h"
 #include "thread_list.h"
+#include "ti_redefine.h"
 #include "transform.h"
 #include "utf.h"
 #include "utils/dex_cache_arrays_layout-inl.h"
 
 namespace openjdkjvmti {
 
+jvmtiError Transformer::RetransformClassesDirect(
+      ArtJvmTiEnv* env,
+      art::Thread* self,
+      /*in-out*/std::vector<ArtClassDefinition>* definitions) {
+  for (ArtClassDefinition& def : *definitions) {
+    jint new_len = -1;
+    unsigned char* new_data = nullptr;
+    gEventHandler.DispatchEvent<ArtJvmtiEvent::kClassFileLoadHookRetransformable>(
+        self,
+        GetJniEnv(env),
+        def.klass,
+        def.loader,
+        def.name.c_str(),
+        def.protection_domain,
+        def.dex_len,
+        static_cast<const unsigned char*>(def.dex_data.get()),
+        &new_len,
+        &new_data);
+    def.SetNewDexData(env, new_len, new_data);
+  }
+  return OK;
+}
+
+jvmtiError Transformer::RetransformClasses(ArtJvmTiEnv* env,
+                                           art::Runtime* runtime,
+                                           art::Thread* self,
+                                           jint class_count,
+                                           const jclass* classes,
+                                           /*out*/std::string* error_msg) {
+  if (env == nullptr) {
+    *error_msg = "env was null!";
+    return ERR(INVALID_ENVIRONMENT);
+  } else if (class_count < 0) {
+    *error_msg = "class_count was less then 0";
+    return ERR(ILLEGAL_ARGUMENT);
+  } else if (class_count == 0) {
+    // We don't actually need to do anything. Just return OK.
+    return OK;
+  } else if (classes == nullptr) {
+    *error_msg = "null classes!";
+    return ERR(NULL_POINTER);
+  }
+  // A holder that will Deallocate all the class bytes buffers on destruction.
+  std::vector<ArtClassDefinition> definitions;
+  jvmtiError res = OK;
+  for (jint i = 0; i < class_count; i++) {
+    ArtClassDefinition def;
+    res = FillInTransformationData(env, classes[i], &def);
+    if (res != OK) {
+      return res;
+    }
+    definitions.push_back(std::move(def));
+  }
+  res = RetransformClassesDirect(env, self, &definitions);
+  if (res != OK) {
+    return res;
+  }
+  return Redefiner::RedefineClassesDirect(env, runtime, self, definitions, error_msg);
+}
+
+// TODO Move this somewhere else, ti_class?
 jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location) {
   JNIEnv* jni_env = nullptr;
   jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(&jni_env), JNI_VERSION_1_1);
@@ -73,42 +137,60 @@
   return OK;
 }
 
+jvmtiError Transformer::GetDexDataForRetransformation(ArtJvmTiEnv* env,
+                                                      art::Handle<art::mirror::Class> klass,
+                                                      /*out*/jint* dex_data_len,
+                                                      /*out*/unsigned char** dex_data) {
+  art::StackHandleScope<2> hs(art::Thread::Current());
+  art::Handle<art::mirror::ClassExt> ext(hs.NewHandle(klass->GetExtData()));
+  if (!ext.IsNull()) {
+    art::Handle<art::mirror::ByteArray> orig_dex(hs.NewHandle(ext->GetOriginalDexFileBytes()));
+    if (!orig_dex.IsNull()) {
+      *dex_data_len = static_cast<jint>(orig_dex->GetLength());
+      return CopyDataIntoJvmtiBuffer(env,
+                                     reinterpret_cast<const unsigned char*>(orig_dex->GetData()),
+                                     *dex_data_len,
+                                     /*out*/dex_data);
+    }
+  }
+  // TODO De-quicken the dex file before passing it to the agents.
+  LOG(WARNING) << "Dex file is not de-quickened yet! Quickened dex instructions might be present";
+  const art::DexFile& dex = klass->GetDexFile();
+  *dex_data_len = static_cast<jint>(dex.Size());
+  return CopyDataIntoJvmtiBuffer(env, dex.Begin(), *dex_data_len, /*out*/dex_data);
+}
+
 // TODO Move this function somewhere more appropriate.
 // Gets the data surrounding the given class.
-jvmtiError GetTransformationData(ArtJvmTiEnv* env,
-                                 jclass klass,
-                                 /*out*/std::string* location,
-                                 /*out*/JNIEnv** jni_env_ptr,
-                                 /*out*/jobject* loader,
-                                 /*out*/std::string* name,
-                                 /*out*/jobject* protection_domain,
-                                 /*out*/jint* data_len,
-                                 /*out*/unsigned char** dex_data) {
-  jint ret = env->art_vm->GetEnv(reinterpret_cast<void**>(jni_env_ptr), JNI_VERSION_1_1);
-  if (ret != JNI_OK) {
+// TODO Make this less magical.
+jvmtiError Transformer::FillInTransformationData(ArtJvmTiEnv* env,
+                                                 jclass klass,
+                                                 ArtClassDefinition* def) {
+  JNIEnv* jni_env = GetJniEnv(env);
+  if (jni_env == nullptr) {
     // TODO Different error might be better?
     return ERR(INTERNAL);
   }
-  JNIEnv* jni_env = *jni_env_ptr;
   art::ScopedObjectAccess soa(jni_env);
   art::StackHandleScope<3> hs(art::Thread::Current());
   art::Handle<art::mirror::Class> hs_klass(hs.NewHandle(soa.Decode<art::mirror::Class>(klass)));
-  *loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader());
-  *name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8();
-  // TODO is this always null?
-  *protection_domain = nullptr;
-  const art::DexFile& dex = hs_klass->GetDexFile();
-  *location = dex.GetLocation();
-  *data_len = static_cast<jint>(dex.Size());
-  // TODO We should maybe change env->Allocate to allow us to mprotect this memory and stop writes.
-  jvmtiError alloc_error = env->Allocate(*data_len, dex_data);
-  if (alloc_error != OK) {
-    return alloc_error;
+  if (hs_klass.IsNull()) {
+    return ERR(INVALID_CLASS);
   }
-  // Copy the data into a temporary buffer.
-  memcpy(reinterpret_cast<void*>(*dex_data),
-          reinterpret_cast<const void*>(dex.Begin()),
-          *data_len);
+  def->klass = klass;
+  def->loader = soa.AddLocalReference<jobject>(hs_klass->GetClassLoader());
+  def->name = art::mirror::Class::ComputeName(hs_klass)->ToModifiedUtf8();
+  // TODO is this always null?
+  def->protection_domain = nullptr;
+  if (def->dex_data.get() == nullptr) {
+    unsigned char* new_data;
+    jvmtiError res = GetDexDataForRetransformation(env, hs_klass, &def->dex_len, &new_data);
+    if (res == OK) {
+      def->dex_data = MakeJvmtiUniquePtr(env, new_data);
+    } else {
+      return res;
+    }
+  }
   return OK;
 }
 
diff --git a/runtime/openjdkjvmti/transform.h b/runtime/openjdkjvmti/transform.h
index 0ad5099..65f2ae1 100644
--- a/runtime/openjdkjvmti/transform.h
+++ b/runtime/openjdkjvmti/transform.h
@@ -37,22 +37,37 @@
 #include <jni.h>
 
 #include "art_jvmti.h"
+#include "ti_class_definition.h"
 #include "jvmti.h"
 
 namespace openjdkjvmti {
 
 jvmtiError GetClassLocation(ArtJvmTiEnv* env, jclass klass, /*out*/std::string* location);
 
-// Gets the data surrounding the given class.
-jvmtiError GetTransformationData(ArtJvmTiEnv* env,
-                                 jclass klass,
-                                 /*out*/std::string* location,
-                                 /*out*/JNIEnv** jni_env_ptr,
-                                 /*out*/jobject* loader,
-                                 /*out*/std::string* name,
-                                 /*out*/jobject* protection_domain,
-                                 /*out*/jint* data_len,
-                                 /*out*/unsigned char** dex_data);
+class Transformer {
+ public:
+  static jvmtiError RetransformClassesDirect(
+      ArtJvmTiEnv* env, art::Thread* self, /*in-out*/std::vector<ArtClassDefinition>* definitions);
+
+  static jvmtiError RetransformClasses(ArtJvmTiEnv* env,
+                                       art::Runtime* runtime,
+                                       art::Thread* self,
+                                       jint class_count,
+                                       const jclass* classes,
+                                       /*out*/std::string* error_msg);
+
+  // Gets the data surrounding the given class.
+  static jvmtiError FillInTransformationData(ArtJvmTiEnv* env,
+                                             jclass klass,
+                                             ArtClassDefinition* def);
+
+ private:
+  static jvmtiError GetDexDataForRetransformation(ArtJvmTiEnv* env,
+                                                  art::Handle<art::mirror::Class> klass,
+                                                  /*out*/jint* dex_data_length,
+                                                  /*out*/unsigned char** dex_data)
+      REQUIRES_SHARED(art::Locks::mutator_lock_);
+};
 
 }  // namespace openjdkjvmti
 
diff --git a/runtime/parsed_options.cc b/runtime/parsed_options.cc
index e1022b0..ccc5f7a 100644
--- a/runtime/parsed_options.cc
+++ b/runtime/parsed_options.cc
@@ -302,6 +302,9 @@
           .IntoKey(M::Plugins)
       .Define("-Xfully-deoptable")
           .IntoKey(M::FullyDeoptable)
+      .Define("-XX:ThreadSuspendTimeout=_")  // in ms
+          .WithType<MillisecondsToNanoseconds>()  // store as ns
+          .IntoKey(M::ThreadSuspendTimeout)
       .Ignore({
           "-ea", "-da", "-enableassertions", "-disableassertions", "--runtime-arg", "-esa",
           "-dsa", "-enablesystemassertions", "-disablesystemassertions", "-Xrs", "-Xint:_",
@@ -596,42 +599,6 @@
     args.Set(M::HeapGrowthLimit, args.GetOrDefault(M::MemoryMaximumSize));
   }
 
-  if (args.GetOrDefault(M::Experimental) & ExperimentalFlags::kRuntimePlugins) {
-    LOG(WARNING) << "Experimental runtime plugin support has been enabled. No guarantees are made "
-                 << "about stability or usage of this plugin support. Use at your own risk. Do "
-                 << "not attempt to write shipping code that relies on the implementation of "
-                 << "runtime plugins.";
-  } else if (!args.GetOrDefault(M::Plugins).empty()) {
-    LOG(WARNING) << "Experimental runtime plugin support has not been enabled. Ignored options: ";
-    for (const auto& op : args.GetOrDefault(M::Plugins)) {
-      LOG(WARNING) << "    -plugin:" << op.GetLibrary();
-    }
-  }
-
-  if (args.GetOrDefault(M::Experimental) & ExperimentalFlags::kAgents) {
-    LOG(WARNING) << "Experimental runtime agent support has been enabled. No guarantees are made "
-                 << "the completeness, accuracy, reliability, or stability of the agent "
-                 << "implementation. Use at your own risk. Do not attempt to write shipping code "
-                 << "that relies on the implementation of any part of this api.";
-  } else if (!args.GetOrDefault(M::AgentLib).empty() || !args.GetOrDefault(M::AgentPath).empty()) {
-    LOG(WARNING) << "agent support has not been enabled. Enable experimental agent "
-                 << " support with '-XExperimental:agent'. Ignored options are:";
-    for (const auto& op : args.GetOrDefault(M::AgentLib)) {
-      if (op.HasArgs()) {
-        LOG(WARNING) << "    -agentlib:" << op.GetName() << "=" << op.GetArgs();
-      } else {
-        LOG(WARNING) << "    -agentlib:" << op.GetName();
-      }
-    }
-    for (const auto& op : args.GetOrDefault(M::AgentPath)) {
-      if (op.HasArgs()) {
-        LOG(WARNING) << "    -agentpath:" << op.GetName() << "=" << op.GetArgs();
-      } else {
-        LOG(WARNING) << "    -agentpath:" << op.GetName();
-      }
-    }
-  }
-
   *runtime_options = std::move(args);
   return true;
 }
@@ -724,6 +691,7 @@
   UsageMessage(stream, "  -XX:MaxSpinsBeforeThinLockInflation=integervalue\n");
   UsageMessage(stream, "  -XX:LongPauseLogThreshold=integervalue\n");
   UsageMessage(stream, "  -XX:LongGCLogThreshold=integervalue\n");
+  UsageMessage(stream, "  -XX:ThreadSuspendTimeout=integervalue\n");
   UsageMessage(stream, "  -XX:DumpGCPerformanceOnShutdown\n");
   UsageMessage(stream, "  -XX:DumpJITInfoOnShutdown\n");
   UsageMessage(stream, "  -XX:IgnoreMaxFootprint\n");
@@ -763,8 +731,6 @@
                        "(Enable new and experimental agent support)\n");
   UsageMessage(stream, "  -Xexperimental:agents"
                        "(Enable new and experimental agent support)\n");
-  UsageMessage(stream, "  -Xexperimental:method-handles"
-                       "(Enable new and experimental method handles support)\n");
   UsageMessage(stream, "\n");
 
   UsageMessage(stream, "The following previously supported Dalvik options are ignored:\n");
diff --git a/runtime/reflection.cc b/runtime/reflection.cc
index 4d24501..a2b4cb3 100644
--- a/runtime/reflection.cc
+++ b/runtime/reflection.cc
@@ -216,43 +216,54 @@
   }
 
   bool BuildArgArrayFromObjectArray(ObjPtr<mirror::Object> receiver,
-                                    ObjPtr<mirror::ObjectArray<mirror::Object>> args,
-                                    ArtMethod* m)
+                                    ObjPtr<mirror::ObjectArray<mirror::Object>> raw_args,
+                                    ArtMethod* m,
+                                    Thread* self)
       REQUIRES_SHARED(Locks::mutator_lock_) {
     const DexFile::TypeList* classes = m->GetParameterTypeList();
     // Set receiver if non-null (method is not static)
     if (receiver != nullptr) {
       Append(receiver);
     }
+    StackHandleScope<2> hs(self);
+    MutableHandle<mirror::Object> arg(hs.NewHandle<mirror::Object>(nullptr));
+    Handle<mirror::ObjectArray<mirror::Object>> args(
+        hs.NewHandle<mirror::ObjectArray<mirror::Object>>(raw_args));
     for (size_t i = 1, args_offset = 0; i < shorty_len_; ++i, ++args_offset) {
-      ObjPtr<mirror::Object> arg(args->Get(args_offset));
-      if (((shorty_[i] == 'L') && (arg != nullptr)) || ((arg == nullptr && shorty_[i] != 'L'))) {
-        PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
+      arg.Assign(args->Get(args_offset));
+      if (((shorty_[i] == 'L') && (arg.Get() != nullptr)) ||
+          ((arg.Get() == nullptr && shorty_[i] != 'L'))) {
+        // TODO: The method's parameter's type must have been previously resolved, yet
+        // we've seen cases where it's not b/34440020.
         ObjPtr<mirror::Class> dst_class(
             m->GetClassFromTypeIndex(classes->GetTypeItem(args_offset).type_idx_,
-                                     true /* resolve */,
-                                     pointer_size));
-        if (UNLIKELY(arg == nullptr || !arg->InstanceOf(dst_class))) {
+                                     true /* resolve */));
+        if (dst_class.Ptr() == nullptr) {
+          CHECK(self->IsExceptionPending());
+          return false;
+        }
+        if (UNLIKELY(arg.Get() == nullptr || !arg->InstanceOf(dst_class))) {
           ThrowIllegalArgumentException(
               StringPrintf("method %s argument %zd has type %s, got %s",
                   m->PrettyMethod(false).c_str(),
                   args_offset + 1,  // Humans don't count from 0.
                   mirror::Class::PrettyDescriptor(dst_class).c_str(),
-                  mirror::Object::PrettyTypeOf(arg).c_str()).c_str());
+                  mirror::Object::PrettyTypeOf(arg.Get()).c_str()).c_str());
           return false;
         }
       }
 
 #define DO_FIRST_ARG(match_descriptor, get_fn, append) { \
-          if (LIKELY(arg != nullptr && arg->GetClass()->DescriptorEquals(match_descriptor))) { \
+          if (LIKELY(arg.Get() != nullptr && \
+              arg->GetClass()->DescriptorEquals(match_descriptor))) { \
             ArtField* primitive_field = arg->GetClass()->GetInstanceField(0); \
-            append(primitive_field-> get_fn(arg));
+            append(primitive_field-> get_fn(arg.Get()));
 
 #define DO_ARG(match_descriptor, get_fn, append) \
-          } else if (LIKELY(arg != nullptr && \
+          } else if (LIKELY(arg.Get() != nullptr && \
                             arg->GetClass<>()->DescriptorEquals(match_descriptor))) { \
             ArtField* primitive_field = arg->GetClass()->GetInstanceField(0); \
-            append(primitive_field-> get_fn(arg));
+            append(primitive_field-> get_fn(arg.Get()));
 
 #define DO_FAIL(expected) \
           } else { \
@@ -266,14 +277,14 @@
                       ArtMethod::PrettyMethod(m, false).c_str(), \
                       args_offset + 1, \
                       expected, \
-                      mirror::Object::PrettyTypeOf(arg).c_str()).c_str()); \
+                      mirror::Object::PrettyTypeOf(arg.Get()).c_str()).c_str()); \
             } \
             return false; \
           } }
 
       switch (shorty_[i]) {
         case 'L':
-          Append(arg);
+          Append(arg.Get());
           break;
         case 'Z':
           DO_FIRST_ARG("Ljava/lang/Boolean;", GetBoolean, Append)
@@ -363,12 +374,9 @@
   }
   // TODO: If args contain object references, it may cause problems.
   Thread* const self = Thread::Current();
-  PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
   for (uint32_t i = 0; i < num_params; i++) {
     dex::TypeIndex type_idx = params->GetTypeItem(i).type_idx_;
-    ObjPtr<mirror::Class> param_type(m->GetClassFromTypeIndex(type_idx,
-                                                              true /* resolve*/,
-                                                              pointer_size));
+    ObjPtr<mirror::Class> param_type(m->GetClassFromTypeIndex(type_idx, true /* resolve */));
     if (param_type == nullptr) {
       CHECK(self->IsExceptionPending());
       LOG(ERROR) << "Internal error: unresolvable type for argument type in JNI invoke: "
@@ -649,7 +657,7 @@
   uint32_t shorty_len = 0;
   const char* shorty = np_method->GetShorty(&shorty_len);
   ArgArray arg_array(shorty, shorty_len);
-  if (!arg_array.BuildArgArrayFromObjectArray(receiver, objects, np_method)) {
+  if (!arg_array.BuildArgArrayFromObjectArray(receiver, objects, np_method, soa.Self())) {
     CHECK(soa.Self()->IsExceptionPending());
     return nullptr;
   }
diff --git a/runtime/runtime.cc b/runtime/runtime.cc
index 55e1852..5e008a8 100644
--- a/runtime/runtime.cc
+++ b/runtime/runtime.cc
@@ -137,6 +137,7 @@
 #include "jit/profile_saver.h"
 #include "quick/quick_method_frame_info.h"
 #include "reflection.h"
+#include "runtime_callbacks.h"
 #include "runtime_options.h"
 #include "ScopedLocalRef.h"
 #include "scoped_thread_state_change-inl.h"
@@ -253,10 +254,12 @@
       pruned_dalvik_cache_(false),
       // Initially assume we perceive jank in case the process state is never updated.
       process_state_(kProcessStateJankPerceptible),
-      zygote_no_threads_(false) {
+      zygote_no_threads_(false),
+      cha_(nullptr) {
   CheckAsmSupportOffsetsAndSizes();
   std::fill(callee_save_methods_, callee_save_methods_ + arraysize(callee_save_methods_), 0u);
   interpreter::CheckInterpreterAsmConstants();
+  callbacks_.reset(new RuntimeCallbacks());
 }
 
 Runtime::~Runtime() {
@@ -301,6 +304,13 @@
 
   Trace::Shutdown();
 
+  // Report death. Clients me require a working thread, still, so do it before GC completes and
+  // all non-daemon threads are done.
+  {
+    ScopedObjectAccess soa(self);
+    callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kDeath);
+  }
+
   if (attach_shutdown_thread) {
     DetachCurrentThread();
     self = nullptr;
@@ -703,6 +713,13 @@
 
   Thread::FinishStartup();
 
+  // Send the start phase event. We have to wait till here as this is when the main thread peer
+  // has just been generated, important root clinits have been run and JNI is completely functional.
+  {
+    ScopedObjectAccess soa(self);
+    callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kStart);
+  }
+
   system_class_loader_ = CreateSystemClassLoader(this);
 
   if (!is_zygote_) {
@@ -718,6 +735,13 @@
                             GetInstructionSetString(kRuntimeISA));
   }
 
+  // Send the initialized phase event. Send it before starting daemons, as otherwise
+  // sending thread events becomes complicated.
+  {
+    ScopedObjectAccess soa(self);
+    callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kInit);
+  }
+
   StartDaemonThreads();
 
   {
@@ -1022,7 +1046,7 @@
 
   monitor_list_ = new MonitorList;
   monitor_pool_ = MonitorPool::Create();
-  thread_list_ = new ThreadList;
+  thread_list_ = new ThreadList(runtime_options.GetOrDefault(Opt::ThreadSuspendTimeout));
   intern_table_ = new InternTable;
 
   verify_ = runtime_options.GetOrDefault(Opt::Verify);
@@ -1045,16 +1069,13 @@
   experimental_flags_ = runtime_options.GetOrDefault(Opt::Experimental);
   is_low_memory_mode_ = runtime_options.Exists(Opt::LowMemoryMode);
 
-  if (experimental_flags_ & ExperimentalFlags::kRuntimePlugins) {
-    plugins_ = runtime_options.ReleaseOrDefault(Opt::Plugins);
-  }
-  if (experimental_flags_ & ExperimentalFlags::kAgents) {
-    agents_ = runtime_options.ReleaseOrDefault(Opt::AgentPath);
-    // TODO Add back in -agentlib
-    // for (auto lib : runtime_options.ReleaseOrDefault(Opt::AgentLib)) {
-    //   agents_.push_back(lib);
-    // }
-  }
+  plugins_ = runtime_options.ReleaseOrDefault(Opt::Plugins);
+  agents_ = runtime_options.ReleaseOrDefault(Opt::AgentPath);
+  // TODO Add back in -agentlib
+  // for (auto lib : runtime_options.ReleaseOrDefault(Opt::AgentLib)) {
+  //   agents_.push_back(lib);
+  // }
+
   XGcOption xgc_option = runtime_options.GetOrDefault(Opt::GcOption);
   heap_ = new gc::Heap(runtime_options.GetOrDefault(Opt::MemoryInitialSize),
                        runtime_options.GetOrDefault(Opt::HeapGrowthLimit),
@@ -1100,6 +1121,8 @@
   if (runtime_options.Exists(Opt::JdwpOptions)) {
     Dbg::ConfigureJdwp(runtime_options.GetOrDefault(Opt::JdwpOptions));
   }
+  callbacks_->AddThreadLifecycleCallback(Dbg::GetThreadLifecycleCallback());
+  callbacks_->AddClassLoadCallback(Dbg::GetClassLoadCallback());
 
   jit_options_.reset(jit::JitOptions::CreateFromRuntimeArguments(runtime_options));
   if (IsAotCompiler()) {
@@ -1358,6 +1381,10 @@
       LOG(ERROR) << "Unable to load an agent: " << err;
     }
   }
+  {
+    ScopedObjectAccess soa(self);
+    callbacks_->NextRuntimePhase(RuntimePhaseCallback::RuntimePhase::kInitialAgents);
+  }
 
   VLOG(startup) << "Runtime::Init exiting";
 
@@ -1370,7 +1397,7 @@
   constexpr const char* plugin_name = kIsDebugBuild ? "libopenjdkjvmtid.so" : "libopenjdkjvmti.so";
 
   // Is the plugin already loaded?
-  for (Plugin p : *plugins) {
+  for (const Plugin& p : *plugins) {
     if (p.GetLibrary() == plugin_name) {
       return true;
     }
@@ -1547,6 +1574,12 @@
 
   thread_list_->DumpForSigQuit(os);
   BaseMutex::DumpAll(os);
+
+  // Inform anyone else who is interested in SigQuit.
+  {
+    ScopedObjectAccess soa(Thread::Current());
+    callbacks_->SigQuit();
+  }
 }
 
 void Runtime::DumpLockHolders(std::ostream& os) {
@@ -2253,4 +2286,8 @@
   Runtime::Abort(abort_message);
 }
 
+RuntimeCallbacks* Runtime::GetRuntimeCallbacks() {
+  return callbacks_.get();
+}
+
 }  // namespace art
diff --git a/runtime/runtime.h b/runtime/runtime.h
index 8fc211c..f7d6810 100644
--- a/runtime/runtime.h
+++ b/runtime/runtime.h
@@ -28,6 +28,7 @@
 
 #include "arch/instruction_set.h"
 #include "base/macros.h"
+#include "base/mutex.h"
 #include "dex_file_types.h"
 #include "experimental_flags.h"
 #include "gc_root.h"
@@ -40,7 +41,6 @@
 #include "process_state.h"
 #include "quick/quick_method_frame_info.h"
 #include "runtime_stats.h"
-#include "safe_map.h"
 
 namespace art {
 
@@ -90,6 +90,7 @@
 class OatFileManager;
 class Plugin;
 struct RuntimeArgumentMap;
+class RuntimeCallbacks;
 class SignalCatcher;
 class StackOverflowHandler;
 class SuspensionHandler;
@@ -304,7 +305,7 @@
   }
 
   bool IsMethodHandlesEnabled() const {
-    return experimental_flags_ & ExperimentalFlags::kMethodHandles;
+    return true;
   }
 
   void DisallowNewSystemWeaks() REQUIRES_SHARED(Locks::mutator_lock_);
@@ -660,6 +661,8 @@
 
   void AttachAgent(const std::string& agent_arg);
 
+  RuntimeCallbacks* GetRuntimeCallbacks();
+
  private:
   static void InitPlatformSignalHandlers();
 
@@ -917,6 +920,8 @@
 
   ClassHierarchyAnalysis* cha_;
 
+  std::unique_ptr<RuntimeCallbacks> callbacks_;
+
   DISALLOW_COPY_AND_ASSIGN(Runtime);
 };
 std::ostream& operator<<(std::ostream& os, const Runtime::CalleeSaveType& rhs);
diff --git a/runtime/runtime_callbacks.cc b/runtime/runtime_callbacks.cc
new file mode 100644
index 0000000..25324b5
--- /dev/null
+++ b/runtime/runtime_callbacks.cc
@@ -0,0 +1,134 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "runtime_callbacks.h"
+
+#include <algorithm>
+
+#include "base/macros.h"
+#include "class_linker.h"
+#include "thread.h"
+
+namespace art {
+
+void RuntimeCallbacks::AddThreadLifecycleCallback(ThreadLifecycleCallback* cb) {
+  thread_callbacks_.push_back(cb);
+}
+
+template <typename T>
+ALWAYS_INLINE
+static inline void Remove(T* cb, std::vector<T*>* data) {
+  auto it = std::find(data->begin(), data->end(), cb);
+  if (it != data->end()) {
+    data->erase(it);
+  }
+}
+
+void RuntimeCallbacks::RemoveThreadLifecycleCallback(ThreadLifecycleCallback* cb) {
+  Remove(cb, &thread_callbacks_);
+}
+
+void RuntimeCallbacks::ThreadStart(Thread* self) {
+  for (ThreadLifecycleCallback* cb : thread_callbacks_) {
+    cb->ThreadStart(self);
+  }
+}
+
+void RuntimeCallbacks::ThreadDeath(Thread* self) {
+  for (ThreadLifecycleCallback* cb : thread_callbacks_) {
+    cb->ThreadDeath(self);
+  }
+}
+
+void RuntimeCallbacks::AddClassLoadCallback(ClassLoadCallback* cb) {
+  class_callbacks_.push_back(cb);
+}
+
+void RuntimeCallbacks::RemoveClassLoadCallback(ClassLoadCallback* cb) {
+  Remove(cb, &class_callbacks_);
+}
+
+void RuntimeCallbacks::ClassLoad(Handle<mirror::Class> klass) {
+  for (ClassLoadCallback* cb : class_callbacks_) {
+    cb->ClassLoad(klass);
+  }
+}
+
+void RuntimeCallbacks::ClassPreDefine(const char* descriptor,
+                                      Handle<mirror::Class> temp_class,
+                                      Handle<mirror::ClassLoader> loader,
+                                      const DexFile& initial_dex_file,
+                                      const DexFile::ClassDef& initial_class_def,
+                                      /*out*/DexFile const** final_dex_file,
+                                      /*out*/DexFile::ClassDef const** final_class_def) {
+  DexFile const* current_dex_file = &initial_dex_file;
+  DexFile::ClassDef const* current_class_def = &initial_class_def;
+  for (ClassLoadCallback* cb : class_callbacks_) {
+    DexFile const* new_dex_file = nullptr;
+    DexFile::ClassDef const* new_class_def = nullptr;
+    cb->ClassPreDefine(descriptor,
+                       temp_class,
+                       loader,
+                       *current_dex_file,
+                       *current_class_def,
+                       &new_dex_file,
+                       &new_class_def);
+    if ((new_dex_file != nullptr && new_dex_file != current_dex_file) ||
+        (new_class_def != nullptr && new_class_def != current_class_def)) {
+      DCHECK(new_dex_file != nullptr && new_class_def != nullptr);
+      current_dex_file = new_dex_file;
+      current_class_def = new_class_def;
+    }
+  }
+  *final_dex_file = current_dex_file;
+  *final_class_def = current_class_def;
+}
+
+void RuntimeCallbacks::ClassPrepare(Handle<mirror::Class> temp_klass, Handle<mirror::Class> klass) {
+  for (ClassLoadCallback* cb : class_callbacks_) {
+    cb->ClassPrepare(temp_klass, klass);
+  }
+}
+
+void RuntimeCallbacks::AddRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb) {
+  sigquit_callbacks_.push_back(cb);
+}
+
+void RuntimeCallbacks::RemoveRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb) {
+  Remove(cb, &sigquit_callbacks_);
+}
+
+void RuntimeCallbacks::SigQuit() {
+  for (RuntimeSigQuitCallback* cb : sigquit_callbacks_) {
+    cb->SigQuit();
+  }
+}
+
+void RuntimeCallbacks::AddRuntimePhaseCallback(RuntimePhaseCallback* cb) {
+  phase_callbacks_.push_back(cb);
+}
+
+void RuntimeCallbacks::RemoveRuntimePhaseCallback(RuntimePhaseCallback* cb) {
+  Remove(cb, &phase_callbacks_);
+}
+
+void RuntimeCallbacks::NextRuntimePhase(RuntimePhaseCallback::RuntimePhase phase) {
+  for (RuntimePhaseCallback* cb : phase_callbacks_) {
+    cb->NextRuntimePhase(phase);
+  }
+}
+
+}  // namespace art
diff --git a/runtime/runtime_callbacks.h b/runtime/runtime_callbacks.h
new file mode 100644
index 0000000..d321254
--- /dev/null
+++ b/runtime/runtime_callbacks.h
@@ -0,0 +1,126 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#ifndef ART_RUNTIME_RUNTIME_CALLBACKS_H_
+#define ART_RUNTIME_RUNTIME_CALLBACKS_H_
+
+#include <vector>
+
+#include "base/macros.h"
+#include "base/mutex.h"
+#include "dex_file.h"
+#include "handle.h"
+
+namespace art {
+
+namespace mirror {
+class Class;
+class ClassLoader;
+}  // namespace mirror
+
+class ClassLoadCallback;
+class Thread;
+class ThreadLifecycleCallback;
+
+// Note: RuntimeCallbacks uses the mutator lock to synchronize the callback lists. A thread must
+//       hold the exclusive lock to add or remove a listener. A thread must hold the shared lock
+//       to dispatch an event. This setup is chosen as some clients may want to suspend the
+//       dispatching thread or all threads.
+//
+//       To make this safe, the following restrictions apply:
+//       * Only the owner of a listener may ever add or remove said listener.
+//       * A listener must never add or remove itself or any other listener while running.
+//       * It is the responsibility of the owner to not remove the listener while it is running
+//         (and suspended).
+//
+//       The simplest way to satisfy these restrictions is to never remove a listener, and to do
+//       any state checking (is the listener enabled) in the listener itself. For an example, see
+//       Dbg.
+
+class RuntimeSigQuitCallback {
+ public:
+  virtual ~RuntimeSigQuitCallback() {}
+
+  virtual void SigQuit() REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
+class RuntimePhaseCallback {
+ public:
+  enum RuntimePhase {
+    kInitialAgents,   // Initial agent loading is done.
+    kStart,           // The runtime is started.
+    kInit,            // The runtime is initialized (and will run user code soon).
+    kDeath,           // The runtime just died.
+  };
+
+  virtual ~RuntimePhaseCallback() {}
+
+  virtual void NextRuntimePhase(RuntimePhase phase) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
+class RuntimeCallbacks {
+ public:
+  void AddThreadLifecycleCallback(ThreadLifecycleCallback* cb) REQUIRES(Locks::mutator_lock_);
+  void RemoveThreadLifecycleCallback(ThreadLifecycleCallback* cb) REQUIRES(Locks::mutator_lock_);
+
+  void ThreadStart(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_);
+  void ThreadDeath(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_);
+
+  void AddClassLoadCallback(ClassLoadCallback* cb) REQUIRES(Locks::mutator_lock_);
+  void RemoveClassLoadCallback(ClassLoadCallback* cb) REQUIRES(Locks::mutator_lock_);
+
+  void ClassLoad(Handle<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_);
+  void ClassPrepare(Handle<mirror::Class> temp_klass, Handle<mirror::Class> klass)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+
+  void AddRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb)
+      REQUIRES(Locks::mutator_lock_);
+  void RemoveRuntimeSigQuitCallback(RuntimeSigQuitCallback* cb)
+      REQUIRES(Locks::mutator_lock_);
+
+  void SigQuit() REQUIRES_SHARED(Locks::mutator_lock_);
+
+  void AddRuntimePhaseCallback(RuntimePhaseCallback* cb)
+      REQUIRES(Locks::mutator_lock_);
+  void RemoveRuntimePhaseCallback(RuntimePhaseCallback* cb)
+      REQUIRES(Locks::mutator_lock_);
+
+  void NextRuntimePhase(RuntimePhaseCallback::RuntimePhase phase)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+
+  void ClassPreDefine(const char* descriptor,
+                      Handle<mirror::Class> temp_class,
+                      Handle<mirror::ClassLoader> loader,
+                      const DexFile& initial_dex_file,
+                      const DexFile::ClassDef& initial_class_def,
+                      /*out*/DexFile const** final_dex_file,
+                      /*out*/DexFile::ClassDef const** final_class_def)
+      REQUIRES_SHARED(Locks::mutator_lock_);
+
+ private:
+  std::vector<ThreadLifecycleCallback*> thread_callbacks_
+      GUARDED_BY(Locks::mutator_lock_);
+  std::vector<ClassLoadCallback*> class_callbacks_
+      GUARDED_BY(Locks::mutator_lock_);
+  std::vector<RuntimeSigQuitCallback*> sigquit_callbacks_
+      GUARDED_BY(Locks::mutator_lock_);
+  std::vector<RuntimePhaseCallback*> phase_callbacks_
+        GUARDED_BY(Locks::mutator_lock_);
+};
+
+}  // namespace art
+
+#endif  // ART_RUNTIME_RUNTIME_CALLBACKS_H_
diff --git a/runtime/runtime_callbacks_test.cc b/runtime/runtime_callbacks_test.cc
new file mode 100644
index 0000000..f1e78b4
--- /dev/null
+++ b/runtime/runtime_callbacks_test.cc
@@ -0,0 +1,432 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "runtime_callbacks.h"
+
+#include "jni.h"
+#include <signal.h>
+#include <sys/types.h>
+#include <unistd.h>
+
+#include <initializer_list>
+#include <memory>
+#include <string>
+
+#include "art_method-inl.h"
+#include "base/mutex.h"
+#include "class_linker.h"
+#include "common_runtime_test.h"
+#include "handle.h"
+#include "handle_scope-inl.h"
+#include "mem_map.h"
+#include "mirror/class-inl.h"
+#include "mirror/class_loader.h"
+#include "obj_ptr.h"
+#include "runtime.h"
+#include "scoped_thread_state_change-inl.h"
+#include "ScopedLocalRef.h"
+#include "thread-inl.h"
+#include "thread_list.h"
+#include "well_known_classes.h"
+
+namespace art {
+
+class RuntimeCallbacksTest : public CommonRuntimeTest {
+ protected:
+  void SetUp() OVERRIDE {
+    CommonRuntimeTest::SetUp();
+
+    Thread* self = Thread::Current();
+    ScopedObjectAccess soa(self);
+    ScopedThreadSuspension sts(self, kWaitingForDebuggerToAttach);
+    ScopedSuspendAll ssa("RuntimeCallbacksTest SetUp");
+    AddListener();
+  }
+
+  void TearDown() OVERRIDE {
+    {
+      Thread* self = Thread::Current();
+      ScopedObjectAccess soa(self);
+      ScopedThreadSuspension sts(self, kWaitingForDebuggerToAttach);
+      ScopedSuspendAll ssa("RuntimeCallbacksTest TearDown");
+      RemoveListener();
+    }
+
+    CommonRuntimeTest::TearDown();
+  }
+
+  virtual void AddListener() REQUIRES(Locks::mutator_lock_) = 0;
+  virtual void RemoveListener() REQUIRES(Locks::mutator_lock_) = 0;
+
+  void MakeExecutable(ObjPtr<mirror::Class> klass) REQUIRES_SHARED(Locks::mutator_lock_) {
+    CHECK(klass != nullptr);
+    PointerSize pointer_size = class_linker_->GetImagePointerSize();
+    for (auto& m : klass->GetMethods(pointer_size)) {
+      if (!m.IsAbstract()) {
+        class_linker_->SetEntryPointsToInterpreter(&m);
+      }
+    }
+  }
+};
+
+class ThreadLifecycleCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ public:
+  static void* PthreadsCallback(void* arg ATTRIBUTE_UNUSED) {
+    // Attach.
+    Runtime* runtime = Runtime::Current();
+    CHECK(runtime->AttachCurrentThread("ThreadLifecycle test thread", true, nullptr, false));
+
+    // Detach.
+    runtime->DetachCurrentThread();
+
+    // Die...
+    return nullptr;
+  }
+
+ protected:
+  void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->AddThreadLifecycleCallback(&cb_);
+  }
+  void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->RemoveThreadLifecycleCallback(&cb_);
+  }
+
+  enum CallbackState {
+    kBase,
+    kStarted,
+    kDied,
+    kWrongStart,
+    kWrongDeath,
+  };
+
+  struct Callback : public ThreadLifecycleCallback {
+    void ThreadStart(Thread* self) OVERRIDE {
+      if (state == CallbackState::kBase) {
+        state = CallbackState::kStarted;
+        stored_self = self;
+      } else {
+        state = CallbackState::kWrongStart;
+      }
+    }
+
+    void ThreadDeath(Thread* self) OVERRIDE {
+      if (state == CallbackState::kStarted && self == stored_self) {
+        state = CallbackState::kDied;
+      } else {
+        state = CallbackState::kWrongDeath;
+      }
+    }
+
+    Thread* stored_self;
+    CallbackState state = CallbackState::kBase;
+  };
+
+  Callback cb_;
+};
+
+TEST_F(ThreadLifecycleCallbackRuntimeCallbacksTest, ThreadLifecycleCallbackJava) {
+  Thread* self = Thread::Current();
+
+  self->TransitionFromSuspendedToRunnable();
+  bool started = runtime_->Start();
+  ASSERT_TRUE(started);
+
+  cb_.state = CallbackState::kBase;  // Ignore main thread attach.
+
+  {
+    ScopedObjectAccess soa(self);
+    MakeExecutable(soa.Decode<mirror::Class>(WellKnownClasses::java_lang_Thread));
+  }
+
+  JNIEnv* env = self->GetJniEnv();
+
+  ScopedLocalRef<jobject> thread_name(env,
+                                      env->NewStringUTF("ThreadLifecycleCallback test thread"));
+  ASSERT_TRUE(thread_name.get() != nullptr);
+
+  ScopedLocalRef<jobject> thread(env, env->AllocObject(WellKnownClasses::java_lang_Thread));
+  ASSERT_TRUE(thread.get() != nullptr);
+
+  env->CallNonvirtualVoidMethod(thread.get(),
+                                WellKnownClasses::java_lang_Thread,
+                                WellKnownClasses::java_lang_Thread_init,
+                                runtime_->GetMainThreadGroup(),
+                                thread_name.get(),
+                                kMinThreadPriority,
+                                JNI_FALSE);
+  ASSERT_FALSE(env->ExceptionCheck());
+
+  jmethodID start_id = env->GetMethodID(WellKnownClasses::java_lang_Thread, "start", "()V");
+  ASSERT_TRUE(start_id != nullptr);
+
+  env->CallVoidMethod(thread.get(), start_id);
+  ASSERT_FALSE(env->ExceptionCheck());
+
+  jmethodID join_id = env->GetMethodID(WellKnownClasses::java_lang_Thread, "join", "()V");
+  ASSERT_TRUE(join_id != nullptr);
+
+  env->CallVoidMethod(thread.get(), join_id);
+  ASSERT_FALSE(env->ExceptionCheck());
+
+  EXPECT_TRUE(cb_.state == CallbackState::kDied) << static_cast<int>(cb_.state);
+}
+
+TEST_F(ThreadLifecycleCallbackRuntimeCallbacksTest, ThreadLifecycleCallbackAttach) {
+  std::string error_msg;
+  std::unique_ptr<MemMap> stack(MemMap::MapAnonymous("ThreadLifecycleCallback Thread",
+                                                     nullptr,
+                                                     128 * kPageSize,  // Just some small stack.
+                                                     PROT_READ | PROT_WRITE,
+                                                     false,
+                                                     false,
+                                                     &error_msg));
+  ASSERT_FALSE(stack == nullptr) << error_msg;
+
+  const char* reason = "ThreadLifecycleCallback test thread";
+  pthread_attr_t attr;
+  CHECK_PTHREAD_CALL(pthread_attr_init, (&attr), reason);
+  CHECK_PTHREAD_CALL(pthread_attr_setstack, (&attr, stack->Begin(), stack->Size()), reason);
+  pthread_t pthread;
+  CHECK_PTHREAD_CALL(pthread_create,
+                     (&pthread,
+                         &attr,
+                         &ThreadLifecycleCallbackRuntimeCallbacksTest::PthreadsCallback,
+                         this),
+                         reason);
+  CHECK_PTHREAD_CALL(pthread_attr_destroy, (&attr), reason);
+
+  CHECK_PTHREAD_CALL(pthread_join, (pthread, nullptr), "ThreadLifecycleCallback test shutdown");
+
+  // Detach is not a ThreadDeath event, so we expect to be in state Started.
+  EXPECT_TRUE(cb_.state == CallbackState::kStarted) << static_cast<int>(cb_.state);
+}
+
+class ClassLoadCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ protected:
+  void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->AddClassLoadCallback(&cb_);
+  }
+  void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->RemoveClassLoadCallback(&cb_);
+  }
+
+  bool Expect(std::initializer_list<const char*> list) {
+    if (cb_.data.size() != list.size()) {
+      PrintError(list);
+      return false;
+    }
+
+    if (!std::equal(cb_.data.begin(), cb_.data.end(), list.begin())) {
+      PrintError(list);
+      return false;
+    }
+
+    return true;
+  }
+
+  void PrintError(std::initializer_list<const char*> list) {
+    LOG(ERROR) << "Expected:";
+    for (const char* expected : list) {
+      LOG(ERROR) << "  " << expected;
+    }
+    LOG(ERROR) << "Found:";
+    for (const auto& s : cb_.data) {
+      LOG(ERROR) << "  " << s;
+    }
+  }
+
+  struct Callback : public ClassLoadCallback {
+    virtual void ClassPreDefine(const char* descriptor,
+                                Handle<mirror::Class> klass ATTRIBUTE_UNUSED,
+                                Handle<mirror::ClassLoader> class_loader ATTRIBUTE_UNUSED,
+                                const DexFile& initial_dex_file,
+                                const DexFile::ClassDef& initial_class_def ATTRIBUTE_UNUSED,
+                                /*out*/DexFile const** final_dex_file ATTRIBUTE_UNUSED,
+                                /*out*/DexFile::ClassDef const** final_class_def ATTRIBUTE_UNUSED)
+        OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+      std::string location(initial_dex_file.GetLocation());
+      std::string event =
+          std::string("PreDefine:") + descriptor + " <" +
+          location.substr(location.rfind("/") + 1, location.size()) + ">";
+      data.push_back(event);
+    }
+
+    void ClassLoad(Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+      std::string tmp;
+      std::string event = std::string("Load:") + klass->GetDescriptor(&tmp);
+      data.push_back(event);
+    }
+
+    void ClassPrepare(Handle<mirror::Class> temp_klass,
+                      Handle<mirror::Class> klass) OVERRIDE REQUIRES_SHARED(Locks::mutator_lock_) {
+      std::string tmp, tmp2;
+      std::string event = std::string("Prepare:") + klass->GetDescriptor(&tmp)
+          + "[" + temp_klass->GetDescriptor(&tmp2) + "]";
+      data.push_back(event);
+    }
+
+    std::vector<std::string> data;
+  };
+
+  Callback cb_;
+};
+
+TEST_F(ClassLoadCallbackRuntimeCallbacksTest, ClassLoadCallback) {
+  ScopedObjectAccess soa(Thread::Current());
+  jobject jclass_loader = LoadDex("XandY");
+  VariableSizedHandleScope hs(soa.Self());
+  Handle<mirror::ClassLoader> class_loader(hs.NewHandle(
+      soa.Decode<mirror::ClassLoader>(jclass_loader)));
+
+  const char* descriptor_y = "LY;";
+  Handle<mirror::Class> h_Y(
+      hs.NewHandle(class_linker_->FindClass(soa.Self(), descriptor_y, class_loader)));
+  ASSERT_TRUE(h_Y.Get() != nullptr);
+
+  bool expect1 = Expect({ "PreDefine:LY; <art-gtest-XandY.jar>",
+                          "PreDefine:LX; <art-gtest-XandY.jar>",
+                          "Load:LX;",
+                          "Prepare:LX;[LX;]",
+                          "Load:LY;",
+                          "Prepare:LY;[LY;]" });
+  EXPECT_TRUE(expect1);
+
+  cb_.data.clear();
+
+  ASSERT_TRUE(class_linker_->EnsureInitialized(Thread::Current(), h_Y, true, true));
+
+  bool expect2 = Expect({ "PreDefine:LY$Z; <art-gtest-XandY.jar>",
+                          "Load:LY$Z;",
+                          "Prepare:LY$Z;[LY$Z;]" });
+  EXPECT_TRUE(expect2);
+}
+
+class RuntimeSigQuitCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ protected:
+  void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->AddRuntimeSigQuitCallback(&cb_);
+  }
+  void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->RemoveRuntimeSigQuitCallback(&cb_);
+  }
+
+  struct Callback : public RuntimeSigQuitCallback {
+    void SigQuit() OVERRIDE {
+      ++sigquit_count;
+    }
+
+    size_t sigquit_count = 0;
+  };
+
+  Callback cb_;
+};
+
+TEST_F(RuntimeSigQuitCallbackRuntimeCallbacksTest, SigQuit) {
+  // The runtime needs to be started for the signal handler.
+  Thread* self = Thread::Current();
+
+  self->TransitionFromSuspendedToRunnable();
+  bool started = runtime_->Start();
+  ASSERT_TRUE(started);
+
+  EXPECT_EQ(0u, cb_.sigquit_count);
+
+  kill(getpid(), SIGQUIT);
+
+  // Try a few times.
+  for (size_t i = 0; i != 30; ++i) {
+    if (cb_.sigquit_count == 0) {
+      sleep(1);
+    } else {
+      break;
+    }
+  }
+  EXPECT_EQ(1u, cb_.sigquit_count);
+}
+
+class RuntimePhaseCallbackRuntimeCallbacksTest : public RuntimeCallbacksTest {
+ protected:
+  void AddListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->AddRuntimePhaseCallback(&cb_);
+  }
+  void RemoveListener() OVERRIDE REQUIRES(Locks::mutator_lock_) {
+    Runtime::Current()->GetRuntimeCallbacks()->RemoveRuntimePhaseCallback(&cb_);
+  }
+
+  void TearDown() OVERRIDE {
+    // Bypass RuntimeCallbacksTest::TearDown, as the runtime is already gone.
+    CommonRuntimeTest::TearDown();
+  }
+
+  struct Callback : public RuntimePhaseCallback {
+    void NextRuntimePhase(RuntimePhaseCallback::RuntimePhase p) OVERRIDE {
+      if (p == RuntimePhaseCallback::RuntimePhase::kInitialAgents) {
+        if (start_seen > 0 || init_seen > 0 || death_seen > 0) {
+          LOG(FATAL) << "Unexpected order";
+        }
+        ++initial_agents_seen;
+      } else if (p == RuntimePhaseCallback::RuntimePhase::kStart) {
+        if (init_seen > 0 || death_seen > 0) {
+          LOG(FATAL) << "Init seen before start.";
+        }
+        ++start_seen;
+      } else if (p == RuntimePhaseCallback::RuntimePhase::kInit) {
+        ++init_seen;
+      } else if (p == RuntimePhaseCallback::RuntimePhase::kDeath) {
+        ++death_seen;
+      } else {
+        LOG(FATAL) << "Unknown phase " << static_cast<uint32_t>(p);
+      }
+    }
+
+    size_t initial_agents_seen = 0;
+    size_t start_seen = 0;
+    size_t init_seen = 0;
+    size_t death_seen = 0;
+  };
+
+  Callback cb_;
+};
+
+TEST_F(RuntimePhaseCallbackRuntimeCallbacksTest, Phases) {
+  ASSERT_EQ(0u, cb_.initial_agents_seen);
+  ASSERT_EQ(0u, cb_.start_seen);
+  ASSERT_EQ(0u, cb_.init_seen);
+  ASSERT_EQ(0u, cb_.death_seen);
+
+  // Start the runtime.
+  {
+    Thread* self = Thread::Current();
+    self->TransitionFromSuspendedToRunnable();
+    bool started = runtime_->Start();
+    ASSERT_TRUE(started);
+  }
+
+  ASSERT_EQ(0u, cb_.initial_agents_seen);
+  ASSERT_EQ(1u, cb_.start_seen);
+  ASSERT_EQ(1u, cb_.init_seen);
+  ASSERT_EQ(0u, cb_.death_seen);
+
+  // Delete the runtime.
+  runtime_.reset();
+
+  ASSERT_EQ(0u, cb_.initial_agents_seen);
+  ASSERT_EQ(1u, cb_.start_seen);
+  ASSERT_EQ(1u, cb_.init_seen);
+  ASSERT_EQ(1u, cb_.death_seen);
+}
+
+}  // namespace art
diff --git a/runtime/runtime_options.cc b/runtime/runtime_options.cc
index e75481c..aa14719 100644
--- a/runtime/runtime_options.cc
+++ b/runtime/runtime_options.cc
@@ -21,6 +21,7 @@
 #include "gc/heap.h"
 #include "monitor.h"
 #include "runtime.h"
+#include "thread_list.h"
 #include "trace.h"
 #include "utils.h"
 #include "debugger.h"
diff --git a/runtime/runtime_options.def b/runtime/runtime_options.def
index d1970fe..ad748b0 100644
--- a/runtime/runtime_options.def
+++ b/runtime/runtime_options.def
@@ -60,6 +60,8 @@
                                           LongPauseLogThreshold,          gc::Heap::kDefaultLongPauseLogThreshold)
 RUNTIME_OPTIONS_KEY (MillisecondsToNanoseconds, \
                                           LongGCLogThreshold,             gc::Heap::kDefaultLongGCLogThreshold)
+RUNTIME_OPTIONS_KEY (MillisecondsToNanoseconds, \
+                                          ThreadSuspendTimeout,           ThreadList::kDefaultThreadSuspendTimeout)
 RUNTIME_OPTIONS_KEY (Unit,                DumpGCPerformanceOnShutdown)
 RUNTIME_OPTIONS_KEY (Unit,                DumpJITInfoOnShutdown)
 RUNTIME_OPTIONS_KEY (Unit,                IgnoreMaxFootprint)
@@ -117,10 +119,10 @@
 RUNTIME_OPTIONS_KEY (Unit,                NoDexFileFallback)
 RUNTIME_OPTIONS_KEY (std::string,         CpuAbiList)
 RUNTIME_OPTIONS_KEY (std::string,         Fingerprint)
-RUNTIME_OPTIONS_KEY (ExperimentalFlags,   Experimental,     ExperimentalFlags::kNone) // -Xexperimental:{none, agents, method-handles}
-RUNTIME_OPTIONS_KEY (std::vector<ti::Agent>,         AgentLib)  // -agentlib:<libname>=<options>, Requires -Xexperimental:agents
-RUNTIME_OPTIONS_KEY (std::vector<ti::Agent>,         AgentPath)  // -agentpath:<libname>=<options>, Requires -Xexperimental:agents
-RUNTIME_OPTIONS_KEY (std::vector<Plugin>,            Plugins)  // -Xplugin:<library> Requires -Xexperimental:runtime-plugins
+RUNTIME_OPTIONS_KEY (ExperimentalFlags,   Experimental,     ExperimentalFlags::kNone) // -Xexperimental:{...}
+RUNTIME_OPTIONS_KEY (std::vector<ti::Agent>,         AgentLib)  // -agentlib:<libname>=<options>
+RUNTIME_OPTIONS_KEY (std::vector<ti::Agent>,         AgentPath)  // -agentpath:<libname>=<options>
+RUNTIME_OPTIONS_KEY (std::vector<Plugin>,            Plugins)  // -Xplugin:<library>
 RUNTIME_OPTIONS_KEY (Unit,                           FullyDeoptable)  // -Xfully-deoptable
 
 // Not parse-able from command line, but can be provided explicitly.
diff --git a/runtime/stack_map.cc b/runtime/stack_map.cc
index a7e7c21..690b069 100644
--- a/runtime/stack_map.cc
+++ b/runtime/stack_map.cc
@@ -18,8 +18,9 @@
 
 #include <stdint.h>
 
+#include "art_method.h"
 #include "indenter.h"
-#include "invoke_type.h"
+#include "scoped_thread_state_change-inl.h"
 
 namespace art {
 
@@ -106,7 +107,7 @@
       << "InlineInfoEncoding"
       << " (method_index_bit_offset=" << static_cast<uint32_t>(kMethodIndexBitOffset)
       << ", dex_pc_bit_offset=" << static_cast<uint32_t>(dex_pc_bit_offset_)
-      << ", invoke_type_bit_offset=" << static_cast<uint32_t>(invoke_type_bit_offset_)
+      << ", extra_data_bit_offset=" << static_cast<uint32_t>(extra_data_bit_offset_)
       << ", dex_register_map_bit_offset=" << static_cast<uint32_t>(dex_register_map_bit_offset_)
       << ", total_bit_size=" << static_cast<uint32_t>(total_bit_size_)
       << ")\n";
@@ -115,7 +116,8 @@
 void CodeInfo::Dump(VariableIndentationOutputStream* vios,
                     uint32_t code_offset,
                     uint16_t number_of_dex_registers,
-                    bool dump_stack_maps) const {
+                    bool dump_stack_maps,
+                    InstructionSet instruction_set) const {
   CodeInfoEncoding encoding = ExtractEncoding();
   size_t number_of_stack_maps = GetNumberOfStackMaps(encoding);
   vios->Stream()
@@ -138,6 +140,7 @@
                      encoding,
                      code_offset,
                      number_of_dex_registers,
+                     instruction_set,
                      " " + std::to_string(i));
     }
   }
@@ -187,14 +190,17 @@
                     const CodeInfoEncoding& encoding,
                     uint32_t code_offset,
                     uint16_t number_of_dex_registers,
+                    InstructionSet instruction_set,
                     const std::string& header_suffix) const {
   StackMapEncoding stack_map_encoding = encoding.stack_map_encoding;
+  const uint32_t pc_offset = GetNativePcOffset(stack_map_encoding, instruction_set);
   vios->Stream()
       << "StackMap" << header_suffix
       << std::hex
-      << " [native_pc=0x" << code_offset + GetNativePcOffset(stack_map_encoding) << "]"
+      << " [native_pc=0x" << code_offset + pc_offset << "]"
+      << " [entry_size=0x" << encoding.stack_map_size_in_bytes << "]"
       << " (dex_pc=0x" << GetDexPc(stack_map_encoding)
-      << ", native_pc_offset=0x" << GetNativePcOffset(stack_map_encoding)
+      << ", native_pc_offset=0x" << pc_offset
       << ", dex_register_map_offset=0x" << GetDexRegisterMapOffset(stack_map_encoding)
       << ", inline_info_offset=0x" << GetInlineDescriptorOffset(stack_map_encoding)
       << ", register_mask=0x" << GetRegisterMask(stack_map_encoding)
@@ -230,12 +236,16 @@
     vios->Stream()
         << " At depth " << i
         << std::hex
-        << " (dex_pc=0x" << GetDexPcAtDepth(inline_info_encoding, i)
-        << std::dec
-        << ", method_index=" << GetMethodIndexAtDepth(inline_info_encoding, i)
-        << ", invoke_type=" << static_cast<InvokeType>(GetInvokeTypeAtDepth(inline_info_encoding,
-                                                                            i))
-        << ")\n";
+        << " (dex_pc=0x" << GetDexPcAtDepth(inline_info_encoding, i);
+    if (EncodesArtMethodAtDepth(inline_info_encoding, i)) {
+      ScopedObjectAccess soa(Thread::Current());
+      vios->Stream() << ", method=" << GetArtMethodAtDepth(inline_info_encoding, i)->PrettyMethod();
+    } else {
+      vios->Stream()
+          << std::dec
+          << ", method_index=" << GetMethodIndexAtDepth(inline_info_encoding, i);
+    }
+    vios->Stream() << ")\n";
     if (HasDexRegisterMapAtDepth(inline_info_encoding, i) && (number_of_dex_registers != nullptr)) {
       CodeInfoEncoding encoding = code_info.ExtractEncoding();
       DexRegisterMap dex_register_map =
diff --git a/runtime/stack_map.h b/runtime/stack_map.h
index 5e556be..5782521 100644
--- a/runtime/stack_map.h
+++ b/runtime/stack_map.h
@@ -17,6 +17,7 @@
 #ifndef ART_RUNTIME_STACK_MAP_H_
 #define ART_RUNTIME_STACK_MAP_H_
 
+#include "arch/code_offset.h"
 #include "base/bit_vector.h"
 #include "base/bit_utils.h"
 #include "dex_file.h"
@@ -35,6 +36,7 @@
 // Size of Dex virtual registers.
 static constexpr size_t kVRegSize = 4;
 
+class ArtMethod;
 class CodeInfo;
 class StackMapEncoding;
 struct CodeInfoEncoding;
@@ -665,32 +667,7 @@
 
   ALWAYS_INLINE int32_t Load(const MemoryRegion& region) const {
     DCHECK_LE(end_offset_, region.size_in_bits());
-    const size_t bit_count = BitSize();
-    if (bit_count == 0) {
-      // Do not touch any memory if the range is empty.
-      return min_value_;
-    }
-    uint8_t* address = region.start() + start_offset_ / kBitsPerByte;
-    const uint32_t shift = start_offset_ & (kBitsPerByte - 1);
-    // Load the value (reading only the strictly needed bytes).
-    const uint32_t load_bit_count = shift + bit_count;
-    uint32_t value = *address++ >> shift;
-    if (load_bit_count > 8) {
-      value |= static_cast<uint32_t>(*address++) << (8 - shift);
-      if (load_bit_count > 16) {
-        value |= static_cast<uint32_t>(*address++) << (16 - shift);
-        if (load_bit_count > 24) {
-          value |= static_cast<uint32_t>(*address++) << (24 - shift);
-          if (load_bit_count > 32) {
-            value |= static_cast<uint32_t>(*address++) << (32 - shift);
-          }
-        }
-      }
-    }
-    // Clear unwanted most significant bits.
-    uint32_t clear_bit_count = 32 - bit_count;
-    value = (value << clear_bit_count) >> clear_bit_count;
-    return value + min_value_;
+    return static_cast<int32_t>(region.LoadBits(start_offset_, BitSize())) + min_value_;
   }
 
   ALWAYS_INLINE void Store(MemoryRegion region, int32_t value) const {
@@ -804,12 +781,16 @@
     encoding.GetDexPcEncoding().Store(region_, dex_pc);
   }
 
-  ALWAYS_INLINE uint32_t GetNativePcOffset(const StackMapEncoding& encoding) const {
-    return encoding.GetNativePcEncoding().Load(region_);
+  ALWAYS_INLINE uint32_t GetNativePcOffset(const StackMapEncoding& encoding,
+                                           InstructionSet instruction_set) const {
+    CodeOffset offset(
+        CodeOffset::FromCompressedOffset(encoding.GetNativePcEncoding().Load(region_)));
+    return offset.Uint32Value(instruction_set);
   }
 
-  ALWAYS_INLINE void SetNativePcOffset(const StackMapEncoding& encoding, uint32_t native_pc_offset) {
-    encoding.GetNativePcEncoding().Store(region_, native_pc_offset);
+  ALWAYS_INLINE void SetNativePcCodeOffset(const StackMapEncoding& encoding,
+                                           CodeOffset native_pc_offset) {
+    encoding.GetNativePcEncoding().Store(region_, native_pc_offset.CompressedValue());
   }
 
   ALWAYS_INLINE uint32_t GetDexRegisterMapOffset(const StackMapEncoding& encoding) const {
@@ -865,6 +846,7 @@
             const CodeInfoEncoding& encoding,
             uint32_t code_offset,
             uint16_t number_of_dex_registers,
+            InstructionSet instruction_set,
             const std::string& header_suffix = "") const;
 
   // Special (invalid) offset for the DexRegisterMapOffset field meaning
@@ -887,7 +869,7 @@
  public:
   void SetFromSizes(size_t method_index_max,
                     size_t dex_pc_max,
-                    size_t invoke_type_max,
+                    size_t extra_data_max,
                     size_t dex_register_map_size) {
     total_bit_size_ = kMethodIndexBitOffset;
     total_bit_size_ += MinimumBitsToStore(method_index_max);
@@ -899,8 +881,8 @@
       total_bit_size_ += MinimumBitsToStore(1 /* kNoDexPc */ + dex_pc_max);
     }
 
-    invoke_type_bit_offset_ = dchecked_integral_cast<uint8_t>(total_bit_size_);
-    total_bit_size_ += MinimumBitsToStore(invoke_type_max);
+    extra_data_bit_offset_ = dchecked_integral_cast<uint8_t>(total_bit_size_);
+    total_bit_size_ += MinimumBitsToStore(extra_data_max);
 
     // We also need +1 for kNoDexRegisterMap, but since the size is strictly
     // greater than any offset we might try to encode, we already implicitly have it.
@@ -912,10 +894,10 @@
     return FieldEncoding(kMethodIndexBitOffset, dex_pc_bit_offset_);
   }
   ALWAYS_INLINE FieldEncoding GetDexPcEncoding() const {
-    return FieldEncoding(dex_pc_bit_offset_, invoke_type_bit_offset_, -1 /* min_value */);
+    return FieldEncoding(dex_pc_bit_offset_, extra_data_bit_offset_, -1 /* min_value */);
   }
-  ALWAYS_INLINE FieldEncoding GetInvokeTypeEncoding() const {
-    return FieldEncoding(invoke_type_bit_offset_, dex_register_map_bit_offset_);
+  ALWAYS_INLINE FieldEncoding GetExtraDataEncoding() const {
+    return FieldEncoding(extra_data_bit_offset_, dex_register_map_bit_offset_);
   }
   ALWAYS_INLINE FieldEncoding GetDexRegisterMapEncoding() const {
     return FieldEncoding(dex_register_map_bit_offset_, total_bit_size_, -1 /* min_value */);
@@ -930,7 +912,7 @@
   static constexpr uint8_t kIsLastBitOffset = 0;
   static constexpr uint8_t kMethodIndexBitOffset = 1;
   uint8_t dex_pc_bit_offset_;
-  uint8_t invoke_type_bit_offset_;
+  uint8_t extra_data_bit_offset_;
   uint8_t dex_register_map_bit_offset_;
   uint8_t total_bit_size_;
 };
@@ -938,7 +920,11 @@
 /**
  * Inline information for a specific PC. The information is of the form:
  *
- *   [is_last, method_index, dex_pc, invoke_type, dex_register_map_offset]+.
+ *   [is_last,
+ *    method_index (or ArtMethod high bits),
+ *    dex_pc,
+ *    extra_data (ArtMethod low bits or 1),
+ *    dex_register_map_offset]+.
  */
 class InlineInfo {
  public:
@@ -960,6 +946,7 @@
 
   ALWAYS_INLINE uint32_t GetMethodIndexAtDepth(const InlineInfoEncoding& encoding,
                                                uint32_t depth) const {
+    DCHECK(!EncodesArtMethodAtDepth(encoding, depth));
     return encoding.GetMethodIndexEncoding().Load(GetRegionAtDepth(encoding, depth));
   }
 
@@ -980,15 +967,28 @@
     encoding.GetDexPcEncoding().Store(GetRegionAtDepth(encoding, depth), dex_pc);
   }
 
-  ALWAYS_INLINE uint32_t GetInvokeTypeAtDepth(const InlineInfoEncoding& encoding,
-                                              uint32_t depth) const {
-    return encoding.GetInvokeTypeEncoding().Load(GetRegionAtDepth(encoding, depth));
+  ALWAYS_INLINE bool EncodesArtMethodAtDepth(const InlineInfoEncoding& encoding,
+                                             uint32_t depth) const {
+    return (encoding.GetExtraDataEncoding().Load(GetRegionAtDepth(encoding, depth)) & 1) == 0;
   }
 
-  ALWAYS_INLINE void SetInvokeTypeAtDepth(const InlineInfoEncoding& encoding,
-                                          uint32_t depth,
-                                          uint32_t invoke_type) {
-    encoding.GetInvokeTypeEncoding().Store(GetRegionAtDepth(encoding, depth), invoke_type);
+  ALWAYS_INLINE void SetExtraDataAtDepth(const InlineInfoEncoding& encoding,
+                                         uint32_t depth,
+                                         uint32_t extra_data) {
+    encoding.GetExtraDataEncoding().Store(GetRegionAtDepth(encoding, depth), extra_data);
+  }
+
+  ALWAYS_INLINE ArtMethod* GetArtMethodAtDepth(const InlineInfoEncoding& encoding,
+                                               uint32_t depth) const {
+    uint32_t low_bits = encoding.GetExtraDataEncoding().Load(GetRegionAtDepth(encoding, depth));
+    uint32_t high_bits = encoding.GetMethodIndexEncoding().Load(GetRegionAtDepth(encoding, depth));
+    if (high_bits == 0) {
+      return reinterpret_cast<ArtMethod*>(low_bits);
+    } else {
+      uint64_t address = high_bits;
+      address = address << 32;
+      return reinterpret_cast<ArtMethod*>(address | low_bits);
+    }
   }
 
   ALWAYS_INLINE uint32_t GetDexRegisterMapOffsetAtDepth(const InlineInfoEncoding& encoding,
@@ -1108,7 +1108,7 @@
         GetDexRegisterLocationCatalogSize(encoding)));
   }
 
-  StackMap GetStackMapAt(size_t i, const CodeInfoEncoding& encoding) const {
+  ALWAYS_INLINE StackMap GetStackMapAt(size_t i, const CodeInfoEncoding& encoding) const {
     size_t stack_map_size = encoding.stack_map_size_in_bytes;
     return StackMap(GetStackMaps(encoding).Subregion(i * stack_map_size, stack_map_size));
   }
@@ -1157,6 +1157,17 @@
     }
   }
 
+  size_t GetDexRegisterMapsSize(const CodeInfoEncoding& encoding,
+                                uint32_t number_of_dex_registers) const {
+    size_t total = 0;
+    for (size_t i = 0, e = GetNumberOfStackMaps(encoding); i < e; ++i) {
+      StackMap stack_map = GetStackMapAt(i, encoding);
+      DexRegisterMap map(GetDexRegisterMapOf(stack_map, encoding, number_of_dex_registers));
+      total += map.Size();
+    }
+    return total;
+  }
+
   // Return the `DexRegisterMap` pointed by `inline_info` at depth `depth`.
   DexRegisterMap GetDexRegisterMapAtDepth(uint8_t depth,
                                           InlineInfo inline_info,
@@ -1215,15 +1226,16 @@
       if (stack_map.GetDexPc(stack_map_encoding) == dex_pc) {
         StackMap other = GetStackMapAt(i + 1, encoding);
         if (other.GetDexPc(stack_map_encoding) == dex_pc &&
-            other.GetNativePcOffset(stack_map_encoding) ==
-                stack_map.GetNativePcOffset(stack_map_encoding)) {
+            other.GetNativePcOffset(stack_map_encoding, kRuntimeISA) ==
+                stack_map.GetNativePcOffset(stack_map_encoding, kRuntimeISA)) {
           DCHECK_EQ(other.GetDexRegisterMapOffset(stack_map_encoding),
                     stack_map.GetDexRegisterMapOffset(stack_map_encoding));
           DCHECK(!stack_map.HasInlineInfo(stack_map_encoding));
           if (i < e - 2) {
             // Make sure there are not three identical stack maps following each other.
-            DCHECK_NE(stack_map.GetNativePcOffset(stack_map_encoding),
-                      GetStackMapAt(i + 2, encoding).GetNativePcOffset(stack_map_encoding));
+            DCHECK_NE(
+                stack_map.GetNativePcOffset(stack_map_encoding, kRuntimeISA),
+                GetStackMapAt(i + 2, encoding).GetNativePcOffset(stack_map_encoding, kRuntimeISA));
           }
           return stack_map;
         }
@@ -1239,7 +1251,8 @@
     //       we could do binary search.
     for (size_t i = 0, e = GetNumberOfStackMaps(encoding); i < e; ++i) {
       StackMap stack_map = GetStackMapAt(i, encoding);
-      if (stack_map.GetNativePcOffset(encoding.stack_map_encoding) == native_pc_offset) {
+      if (stack_map.GetNativePcOffset(encoding.stack_map_encoding, kRuntimeISA) ==
+          native_pc_offset) {
         return stack_map;
       }
     }
@@ -1254,7 +1267,8 @@
   void Dump(VariableIndentationOutputStream* vios,
             uint32_t code_offset,
             uint16_t number_of_dex_registers,
-            bool dump_stack_maps) const;
+            bool dump_stack_maps,
+            InstructionSet instruction_set) const;
 
   // Check that the code info has valid stack map and abort if it does not.
   void AssertValidStackMap(const CodeInfoEncoding& encoding) const {
@@ -1269,7 +1283,7 @@
   }
 
  private:
-  MemoryRegion GetStackMaps(const CodeInfoEncoding& encoding) const {
+  ALWAYS_INLINE MemoryRegion GetStackMaps(const CodeInfoEncoding& encoding) const {
     return region_.size() == 0
         ? MemoryRegion()
         : region_.Subregion(GetStackMapsOffset(encoding), GetStackMapsSize(encoding));
diff --git a/runtime/thread.cc b/runtime/thread.cc
index bdd4ca6..d93eab1 100644
--- a/runtime/thread.cc
+++ b/runtime/thread.cc
@@ -67,6 +67,7 @@
 #include "quick/quick_method_frame_info.h"
 #include "reflection.h"
 #include "runtime.h"
+#include "runtime_callbacks.h"
 #include "scoped_thread_state_change-inl.h"
 #include "ScopedLocalRef.h"
 #include "ScopedUtfChars.h"
@@ -431,7 +432,8 @@
 
     ArtField* priorityField = jni::DecodeArtField(WellKnownClasses::java_lang_Thread_priority);
     self->SetNativePriority(priorityField->GetInt(self->tlsPtr_.opeer));
-    Dbg::PostThreadStart(self);
+
+    runtime->GetRuntimeCallbacks()->ThreadStart(self);
 
     // Invoke the 'run' method of our java.lang.Thread.
     ObjPtr<mirror::Object> receiver = self->tlsPtr_.opeer;
@@ -723,8 +725,8 @@
   return true;
 }
 
-Thread* Thread::Attach(const char* thread_name, bool as_daemon, jobject thread_group,
-                       bool create_peer) {
+template <typename PeerAction>
+Thread* Thread::Attach(const char* thread_name, bool as_daemon, PeerAction peer_action) {
   Runtime* runtime = Runtime::Current();
   if (runtime == nullptr) {
     LOG(ERROR) << "Thread attaching to non-existent runtime: " << thread_name;
@@ -753,32 +755,11 @@
   CHECK_NE(self->GetState(), kRunnable);
   self->SetState(kNative);
 
-  // If we're the main thread, ClassLinker won't be created until after we're attached,
-  // so that thread needs a two-stage attach. Regular threads don't need this hack.
-  // In the compiler, all threads need this hack, because no-one's going to be getting
-  // a native peer!
-  if (create_peer) {
-    self->CreatePeer(thread_name, as_daemon, thread_group);
-    if (self->IsExceptionPending()) {
-      // We cannot keep the exception around, as we're deleting self. Try to be helpful and log it.
-      {
-        ScopedObjectAccess soa(self);
-        LOG(ERROR) << "Exception creating thread peer:";
-        LOG(ERROR) << self->GetException()->Dump();
-        self->ClearException();
-      }
-      runtime->GetThreadList()->Unregister(self);
-      // Unregister deletes self, no need to do this here.
-      return nullptr;
-    }
-  } else {
-    // These aren't necessary, but they improve diagnostics for unit tests & command-line tools.
-    if (thread_name != nullptr) {
-      self->tlsPtr_.name->assign(thread_name);
-      ::art::SetThreadName(thread_name);
-    } else if (self->GetJniEnv()->check_jni) {
-      LOG(WARNING) << *Thread::Current() << " attached without supplying a name";
-    }
+  // Run the action that is acting on the peer.
+  if (!peer_action(self)) {
+    runtime->GetThreadList()->Unregister(self);
+    // Unregister deletes self, no need to do this here.
+    return nullptr;
   }
 
   if (VLOG_IS_ON(threads)) {
@@ -793,12 +774,63 @@
 
   {
     ScopedObjectAccess soa(self);
-    Dbg::PostThreadStart(self);
+    runtime->GetRuntimeCallbacks()->ThreadStart(self);
   }
 
   return self;
 }
 
+Thread* Thread::Attach(const char* thread_name,
+                       bool as_daemon,
+                       jobject thread_group,
+                       bool create_peer) {
+  auto create_peer_action = [&](Thread* self) {
+    // If we're the main thread, ClassLinker won't be created until after we're attached,
+    // so that thread needs a two-stage attach. Regular threads don't need this hack.
+    // In the compiler, all threads need this hack, because no-one's going to be getting
+    // a native peer!
+    if (create_peer) {
+      self->CreatePeer(thread_name, as_daemon, thread_group);
+      if (self->IsExceptionPending()) {
+        // We cannot keep the exception around, as we're deleting self. Try to be helpful and log it.
+        {
+          ScopedObjectAccess soa(self);
+          LOG(ERROR) << "Exception creating thread peer:";
+          LOG(ERROR) << self->GetException()->Dump();
+          self->ClearException();
+        }
+        return false;
+      }
+    } else {
+      // These aren't necessary, but they improve diagnostics for unit tests & command-line tools.
+      if (thread_name != nullptr) {
+        self->tlsPtr_.name->assign(thread_name);
+        ::art::SetThreadName(thread_name);
+      } else if (self->GetJniEnv()->check_jni) {
+        LOG(WARNING) << *Thread::Current() << " attached without supplying a name";
+      }
+    }
+    return true;
+  };
+  return Attach(thread_name, as_daemon, create_peer_action);
+}
+
+Thread* Thread::Attach(const char* thread_name, bool as_daemon, jobject thread_peer) {
+  auto set_peer_action = [&](Thread* self) {
+    // Install the given peer.
+    {
+      DCHECK(self == Thread::Current());
+      ScopedObjectAccess soa(self);
+      self->tlsPtr_.opeer = soa.Decode<mirror::Object>(thread_peer).Ptr();
+    }
+    self->GetJniEnv()->SetLongField(thread_peer,
+                                    WellKnownClasses::java_lang_Thread_nativePeer,
+                                    reinterpret_cast<jlong>(self));
+    return true;
+  };
+  return Attach(thread_name, as_daemon, set_peer_action);
+}
+
 void Thread::CreatePeer(const char* name, bool as_daemon, jobject thread_group) {
   Runtime* runtime = Runtime::Current();
   CHECK(runtime->IsStarted());
@@ -1929,7 +1961,11 @@
       jni::DecodeArtField(WellKnownClasses::java_lang_Thread_nativePeer)
           ->SetLong<false>(tlsPtr_.opeer, 0);
     }
-    Dbg::PostThreadDeath(self);
+    Runtime* runtime = Runtime::Current();
+    if (runtime != nullptr) {
+      runtime->GetRuntimeCallbacks()->ThreadDeath(self);
+    }
+
 
     // Thread.join() is implemented as an Object.wait() on the Thread.lock object. Signal anyone
     // who is waiting.
@@ -2626,14 +2662,10 @@
       os << #x; \
       return; \
     }
-  QUICK_ENTRY_POINT_INFO(pAllocArray)
   QUICK_ENTRY_POINT_INFO(pAllocArrayResolved)
-  QUICK_ENTRY_POINT_INFO(pAllocArrayWithAccessCheck)
   QUICK_ENTRY_POINT_INFO(pAllocObjectResolved)
   QUICK_ENTRY_POINT_INFO(pAllocObjectInitialized)
   QUICK_ENTRY_POINT_INFO(pAllocObjectWithChecks)
-  QUICK_ENTRY_POINT_INFO(pCheckAndAllocArray)
-  QUICK_ENTRY_POINT_INFO(pCheckAndAllocArrayWithAccessCheck)
   QUICK_ENTRY_POINT_INFO(pAllocStringFromBytes)
   QUICK_ENTRY_POINT_INFO(pAllocStringFromChars)
   QUICK_ENTRY_POINT_INFO(pAllocStringFromString)
@@ -2667,10 +2699,7 @@
   QUICK_ENTRY_POINT_INFO(pGet64Static)
   QUICK_ENTRY_POINT_INFO(pGetObjInstance)
   QUICK_ENTRY_POINT_INFO(pGetObjStatic)
-  QUICK_ENTRY_POINT_INFO(pAputObjectWithNullAndBoundCheck)
-  QUICK_ENTRY_POINT_INFO(pAputObjectWithBoundCheck)
   QUICK_ENTRY_POINT_INFO(pAputObject)
-  QUICK_ENTRY_POINT_INFO(pHandleFillArrayData)
   QUICK_ENTRY_POINT_INFO(pJniMethodStart)
   QUICK_ENTRY_POINT_INFO(pJniMethodStartSynchronized)
   QUICK_ENTRY_POINT_INFO(pJniMethodEnd)
@@ -2727,6 +2756,7 @@
   QUICK_ENTRY_POINT_INFO(pInvokeStaticTrampolineWithAccessCheck)
   QUICK_ENTRY_POINT_INFO(pInvokeSuperTrampolineWithAccessCheck)
   QUICK_ENTRY_POINT_INFO(pInvokeVirtualTrampolineWithAccessCheck)
+  QUICK_ENTRY_POINT_INFO(pInvokePolymorphic)
   QUICK_ENTRY_POINT_INFO(pTestSuspend)
   QUICK_ENTRY_POINT_INFO(pDeliverException)
   QUICK_ENTRY_POINT_INFO(pThrowArrayBounds)
diff --git a/runtime/thread.h b/runtime/thread.h
index a3ef9bc..b609e72 100644
--- a/runtime/thread.h
+++ b/runtime/thread.h
@@ -158,6 +158,8 @@
   // Used to implement JNI AttachCurrentThread and AttachCurrentThreadAsDaemon calls.
   static Thread* Attach(const char* thread_name, bool as_daemon, jobject thread_group,
                         bool create_peer);
+  // Attaches the calling native thread to the runtime, returning the new native peer.
+  static Thread* Attach(const char* thread_name, bool as_daemon, jobject thread_peer);
 
   // Reset internal state of child thread after fork.
   void InitAfterFork();
@@ -1140,6 +1142,14 @@
     return debug_disallow_read_barrier_;
   }
 
+  const void* GetCustomTLS() const {
+    return custom_tls_;
+  }
+
+  void SetCustomTLS(const void* data) {
+    custom_tls_ = data;
+  }
+
   // Returns true if the current thread is the jit sensitive thread.
   bool IsJitSensitiveThread() const {
     return this == jit_sensitive_thread_;
@@ -1158,6 +1168,13 @@
   ~Thread() REQUIRES(!Locks::mutator_lock_, !Locks::thread_suspend_count_lock_);
   void Destroy();
 
+  // Attaches the calling native thread to the runtime, returning the new native peer.
+  // Used to implement JNI AttachCurrentThread and AttachCurrentThreadAsDaemon calls.
+  template <typename PeerAction>
+  static Thread* Attach(const char* thread_name,
+                        bool as_daemon,
+                        PeerAction p);
+
   void CreatePeer(const char* name, bool as_daemon, jobject thread_group);
 
   template<bool kTransactionActive>
@@ -1537,13 +1554,9 @@
     // to avoid additional cost of a mutex and a condition variable, as used in art::Barrier.
     AtomicInteger* active_suspend_barriers[kMaxSuspendBarriers];
 
-    // Entrypoint function pointers.
-    // TODO: move this to more of a global offset table model to avoid per-thread duplication.
-    JniEntryPoints jni_entrypoints;
-    QuickEntryPoints quick_entrypoints;
-
     // Thread-local allocation pointer. Moved here to force alignment for thread_local_pos on ARM.
     uint8_t* thread_local_start;
+
     // thread_local_pos and thread_local_end must be consecutive for ldrd and are 8 byte aligned for
     // potentially better performance.
     uint8_t* thread_local_pos;
@@ -1551,6 +1564,11 @@
 
     size_t thread_local_objects;
 
+    // Entrypoint function pointers.
+    // TODO: move this to more of a global offset table model to avoid per-thread duplication.
+    JniEntryPoints jni_entrypoints;
+    QuickEntryPoints quick_entrypoints;
+
     // Mterp jump table bases.
     void* mterp_current_ibase;
     void* mterp_default_ibase;
@@ -1599,6 +1617,10 @@
   // Pending extra checkpoints if checkpoint_function_ is already used.
   std::list<Closure*> checkpoint_overflow_ GUARDED_BY(Locks::thread_suspend_count_lock_);
 
+  // Custom TLS field that can be used by plugins.
+  // TODO: Generalize once we have more plugins.
+  const void* custom_tls_;
+
   // True if the thread is allowed to call back into java (for e.g. during class resolution).
   // By default this is true.
   bool can_call_into_java_;
@@ -1691,6 +1713,14 @@
   Thread* const self_;
 };
 
+class ThreadLifecycleCallback {
+ public:
+  virtual ~ThreadLifecycleCallback() {}
+
+  virtual void ThreadStart(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+  virtual void ThreadDeath(Thread* self) REQUIRES_SHARED(Locks::mutator_lock_) = 0;
+};
+
 std::ostream& operator<<(std::ostream& os, const Thread& thread);
 std::ostream& operator<<(std::ostream& os, const StackedShadowFrameType& thread);
 
diff --git a/runtime/thread_list.cc b/runtime/thread_list.cc
index c5c7e2c..01c940e 100644
--- a/runtime/thread_list.cc
+++ b/runtime/thread_list.cc
@@ -57,7 +57,6 @@
 using android::base::StringPrintf;
 
 static constexpr uint64_t kLongThreadSuspendThreshold = MsToNs(5);
-static constexpr uint64_t kThreadSuspendTimeoutMs = 30 * 1000;  // 30s.
 // Use 0 since we want to yield to prevent blocking for an unpredictable amount of time.
 static constexpr useconds_t kThreadSuspendInitialSleepUs = 0;
 static constexpr useconds_t kThreadSuspendMaxYieldUs = 3000;
@@ -68,12 +67,13 @@
 // Turned off again. b/29248079
 static constexpr bool kDumpUnattachedThreadNativeStackForSigQuit = false;
 
-ThreadList::ThreadList()
+ThreadList::ThreadList(uint64_t thread_suspend_timeout_ns)
     : suspend_all_count_(0),
       debug_suspend_all_count_(0),
       unregistering_count_(0),
       suspend_all_historam_("suspend all histogram", 16, 64),
       long_suspend_(false),
+      thread_suspend_timeout_ns_(thread_suspend_timeout_ns),
       empty_checkpoint_barrier_(new Barrier(0)) {
   CHECK(Monitor::IsValidLockWord(LockWord::FromThinLockId(kMaxThreadId, 1, 0U)));
 }
@@ -554,12 +554,14 @@
     // Make sure this thread grabs exclusive access to the mutator lock and its protected data.
 #if HAVE_TIMED_RWLOCK
     while (true) {
-      if (Locks::mutator_lock_->ExclusiveLockWithTimeout(self, kThreadSuspendTimeoutMs, 0)) {
+      if (Locks::mutator_lock_->ExclusiveLockWithTimeout(self,
+                                                         NsToMs(thread_suspend_timeout_ns_),
+                                                         0)) {
         break;
       } else if (!long_suspend_) {
         // Reading long_suspend without the mutator lock is slightly racy, in some rare cases, this
         // could result in a thread suspend timeout.
-        // Timeout if we wait more than kThreadSuspendTimeoutMs seconds.
+        // Timeout if we wait more than thread_suspend_timeout_ns_ nanoseconds.
         UnsafeLogFatalForThreadSuspendAllTimeout();
       }
     }
@@ -653,7 +655,7 @@
   // is done with a timeout so that we can detect problems.
 #if ART_USE_FUTEXES
   timespec wait_timeout;
-  InitTimeSpec(false, CLOCK_MONOTONIC, kIsDebugBuild ? 50000 : 10000, 0, &wait_timeout);
+  InitTimeSpec(false, CLOCK_MONOTONIC, NsToMs(thread_suspend_timeout_ns_), 0, &wait_timeout);
 #endif
   const uint64_t start_time = NanoTime();
   while (true) {
@@ -863,7 +865,7 @@
           return thread;
         }
         const uint64_t total_delay = NanoTime() - start_time;
-        if (total_delay >= MsToNs(kThreadSuspendTimeoutMs)) {
+        if (total_delay >= thread_suspend_timeout_ns_) {
           ThreadSuspendByPeerWarning(self,
                                      ::android::base::FATAL,
                                      "Thread suspension timed out",
@@ -969,7 +971,7 @@
           return thread;
         }
         const uint64_t total_delay = NanoTime() - start_time;
-        if (total_delay >= MsToNs(kThreadSuspendTimeoutMs)) {
+        if (total_delay >= thread_suspend_timeout_ns_) {
           ThreadSuspendByThreadIdWarning(::android::base::WARNING,
                                          "Thread suspension timed out",
                                          thread_id);
diff --git a/runtime/thread_list.h b/runtime/thread_list.h
index 658db00..b60fca1 100644
--- a/runtime/thread_list.h
+++ b/runtime/thread_list.h
@@ -20,6 +20,7 @@
 #include "barrier.h"
 #include "base/histogram.h"
 #include "base/mutex.h"
+#include "base/time_utils.h"
 #include "base/value_object.h"
 #include "gc_root.h"
 #include "jni.h"
@@ -41,11 +42,12 @@
 
 class ThreadList {
  public:
-  static const uint32_t kMaxThreadId = 0xFFFF;
-  static const uint32_t kInvalidThreadId = 0;
-  static const uint32_t kMainThreadId = 1;
+  static constexpr uint32_t kMaxThreadId = 0xFFFF;
+  static constexpr uint32_t kInvalidThreadId = 0;
+  static constexpr uint32_t kMainThreadId = 1;
+  static constexpr uint64_t kDefaultThreadSuspendTimeout = MsToNs(kIsDebugBuild ? 50000 : 10000);
 
-  explicit ThreadList();
+  explicit ThreadList(uint64_t thread_suspend_timeout_ns);
   ~ThreadList();
 
   void DumpForSigQuit(std::ostream& os)
@@ -219,6 +221,9 @@
   // Whether or not the current thread suspension is long.
   bool long_suspend_;
 
+  // Thread suspension timeout in nanoseconds.
+  const uint64_t thread_suspend_timeout_ns_;
+
   std::unique_ptr<Barrier> empty_checkpoint_barrier_;
 
   friend class Thread;
diff --git a/runtime/trace.cc b/runtime/trace.cc
index 9d9360e..2add955 100644
--- a/runtime/trace.cc
+++ b/runtime/trace.cc
@@ -54,6 +54,7 @@
     static_cast<size_t>(kTraceMethodActionMask));
 static constexpr uint8_t kOpNewMethod = 1U;
 static constexpr uint8_t kOpNewThread = 2U;
+static constexpr uint8_t kOpTraceSummary = 3U;
 
 class BuildStackTraceVisitor : public StackVisitor {
  public:
@@ -700,20 +701,19 @@
   std::string header(os.str());
 
   if (trace_output_mode_ == TraceOutputMode::kStreaming) {
-    File file(streaming_file_name_ + ".sec", O_CREAT | O_WRONLY, true);
-    if (!file.IsOpened()) {
-      LOG(WARNING) << "Could not open secondary trace file!";
-      return;
-    }
-    if (!file.WriteFully(header.c_str(), header.length())) {
-      file.Erase();
-      std::string detail(StringPrintf("Trace data write failed: %s", strerror(errno)));
-      PLOG(ERROR) << detail;
-      ThrowRuntimeException("%s", detail.c_str());
-    }
-    if (file.FlushCloseOrErase() != 0) {
-      PLOG(ERROR) << "Could not write secondary file";
-    }
+    MutexLock mu(Thread::Current(), *streaming_lock_);  // To serialize writing.
+    // Write a special token to mark the end of trace records and the start of
+    // trace summary.
+    uint8_t buf[7];
+    Append2LE(buf, 0);
+    buf[2] = kOpTraceSummary;
+    Append4LE(buf + 3, static_cast<uint32_t>(header.length()));
+    WriteToBuf(buf, sizeof(buf));
+    // Write the trace summary. The summary is identical to the file header when
+    // the output mode is not streaming (except for methods).
+    WriteToBuf(reinterpret_cast<const uint8_t*>(header.c_str()), header.length());
+    // Flush the buffer, which may include some trace records before the summary.
+    FlushBuf();
   } else {
     if (trace_file_.get() == nullptr) {
       iovec iov[2];
@@ -894,6 +894,14 @@
   memcpy(buf_.get() + old_offset, src, src_size);
 }
 
+void Trace::FlushBuf() {
+  int32_t offset = cur_offset_.LoadRelaxed();
+  if (!trace_file_->WriteFully(buf_.get(), offset)) {
+    PLOG(WARNING) << "Failed flush the remaining data in streaming.";
+  }
+  cur_offset_.StoreRelease(0);
+}
+
 void Trace::LogMethodTraceEvent(Thread* thread, ArtMethod* method,
                                 instrumentation::Instrumentation::InstrumentationEvent event,
                                 uint32_t thread_clock_diff, uint32_t wall_clock_diff) {
diff --git a/runtime/trace.h b/runtime/trace.h
index 824b150..485e9a1 100644
--- a/runtime/trace.h
+++ b/runtime/trace.h
@@ -202,7 +202,8 @@
       // This causes the negative annotations to incorrectly have a false positive. TODO: Figure out
       // how to annotate this.
       NO_THREAD_SAFETY_ANALYSIS;
-  void FinishTracing() REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!*unique_methods_lock_);
+  void FinishTracing()
+      REQUIRES_SHARED(Locks::mutator_lock_) REQUIRES(!*unique_methods_lock_, !*streaming_lock_);
 
   void ReadClocks(Thread* thread, uint32_t* thread_clock_diff, uint32_t* wall_clock_diff);
 
@@ -229,6 +230,9 @@
   // annotation.
   void WriteToBuf(const uint8_t* src, size_t src_size)
       REQUIRES(streaming_lock_);
+  // Flush the main buffer to file. Used for streaming. Exposed here for lock annotation.
+  void FlushBuf()
+      REQUIRES(streaming_lock_);
 
   uint32_t EncodeTraceMethod(ArtMethod* method) REQUIRES(!*unique_methods_lock_);
   uint32_t EncodeTraceMethodAndAction(ArtMethod* method, TraceAction action)
diff --git a/runtime/utils.cc b/runtime/utils.cc
index 8867743..80a427b 100644
--- a/runtime/utils.cc
+++ b/runtime/utils.cc
@@ -415,6 +415,22 @@
   return result;
 }
 
+std::string GetJniShortName(const std::string& class_descriptor, const std::string& method) {
+  // Remove the leading 'L' and trailing ';'...
+  std::string class_name(class_descriptor);
+  CHECK_EQ(class_name[0], 'L') << class_name;
+  CHECK_EQ(class_name[class_name.size() - 1], ';') << class_name;
+  class_name.erase(0, 1);
+  class_name.erase(class_name.size() - 1, 1);
+
+  std::string short_name;
+  short_name += "Java_";
+  short_name += MangleForJni(class_name);
+  short_name += "_";
+  short_name += MangleForJni(method);
+  return short_name;
+}
+
 // See http://java.sun.com/j2se/1.5.0/docs/guide/jni/spec/design.html#wp615 for the full rules.
 std::string MangleForJni(const std::string& s) {
   std::string result;
@@ -788,49 +804,58 @@
   *task_cpu = strtoull(fields[36].c_str(), nullptr, 10);
 }
 
-const char* GetAndroidRoot() {
-  const char* android_root = getenv("ANDROID_ROOT");
-  if (android_root == nullptr) {
-    if (OS::DirectoryExists("/system")) {
-      android_root = "/system";
+static const char* GetAndroidDirSafe(const char* env_var,
+                                     const char* default_dir,
+                                     std::string* error_msg) {
+  const char* android_dir = getenv(env_var);
+  if (android_dir == nullptr) {
+    if (OS::DirectoryExists(default_dir)) {
+      android_dir = default_dir;
     } else {
-      LOG(FATAL) << "ANDROID_ROOT not set and /system does not exist";
-      return "";
+      *error_msg = StringPrintf("%s not set and %s does not exist", env_var, default_dir);
+      return nullptr;
     }
   }
-  if (!OS::DirectoryExists(android_root)) {
-    LOG(FATAL) << "Failed to find ANDROID_ROOT directory " << android_root;
-    return "";
+  if (!OS::DirectoryExists(android_dir)) {
+    *error_msg = StringPrintf("Failed to find %s directory %s", env_var, android_dir);
+    return nullptr;
   }
-  return android_root;
+  return android_dir;
 }
 
-const char* GetAndroidData() {
+const char* GetAndroidDir(const char* env_var, const char* default_dir) {
   std::string error_msg;
-  const char* dir = GetAndroidDataSafe(&error_msg);
+  const char* dir = GetAndroidDirSafe(env_var, default_dir, &error_msg);
   if (dir != nullptr) {
     return dir;
   } else {
     LOG(FATAL) << error_msg;
-    return "";
+    return nullptr;
   }
 }
 
+const char* GetAndroidRoot() {
+  return GetAndroidDir("ANDROID_ROOT", "/system");
+}
+
+const char* GetAndroidRootSafe(std::string* error_msg) {
+  return GetAndroidDirSafe("ANDROID_ROOT", "/system", error_msg);
+}
+
+const char* GetAndroidData() {
+  return GetAndroidDir("ANDROID_DATA", "/data");
+}
+
 const char* GetAndroidDataSafe(std::string* error_msg) {
-  const char* android_data = getenv("ANDROID_DATA");
-  if (android_data == nullptr) {
-    if (OS::DirectoryExists("/data")) {
-      android_data = "/data";
-    } else {
-      *error_msg = "ANDROID_DATA not set and /data does not exist";
-      return nullptr;
-    }
+  return GetAndroidDirSafe("ANDROID_DATA", "/data", error_msg);
+}
+
+std::string GetDefaultBootImageLocation(std::string* error_msg) {
+  const char* android_root = GetAndroidRootSafe(error_msg);
+  if (android_root == nullptr) {
+    return "";
   }
-  if (!OS::DirectoryExists(android_data)) {
-    *error_msg = StringPrintf("Failed to find ANDROID_DATA directory %s", android_data);
-    return nullptr;
-  }
-  return android_data;
+  return StringPrintf("%s/framework/boot.art", android_root);
 }
 
 void GetDalvikCache(const char* subdir, const bool create_if_absent, std::string* dalvik_cache,
diff --git a/runtime/utils.h b/runtime/utils.h
index 16ef706..5f53608 100644
--- a/runtime/utils.h
+++ b/runtime/utils.h
@@ -101,6 +101,8 @@
 // of the JNI spec.
 std::string MangleForJni(const std::string& s);
 
+std::string GetJniShortName(const std::string& class_name, const std::string& method_name);
+
 // Turn "java.lang.String" into "Ljava/lang/String;".
 std::string DotToDescriptor(const char* class_name);
 
@@ -143,12 +145,18 @@
 
 // Find $ANDROID_ROOT, /system, or abort.
 const char* GetAndroidRoot();
+// Find $ANDROID_ROOT, /system, or return null.
+const char* GetAndroidRootSafe(std::string* error_msg);
 
 // Find $ANDROID_DATA, /data, or abort.
 const char* GetAndroidData();
 // Find $ANDROID_DATA, /data, or return null.
 const char* GetAndroidDataSafe(std::string* error_msg);
 
+// Returns the default boot image location (ANDROID_ROOT/framework/boot.art).
+// Returns an empty string if ANDROID_ROOT is not set.
+std::string GetDefaultBootImageLocation(std::string* error_msg);
+
 // Returns the dalvik-cache location, with subdir appended. Returns the empty string if the cache
 // could not be found.
 std::string GetDalvikCache(const char* subdir);
diff --git a/runtime/vdex_file.h b/runtime/vdex_file.h
index 3b114a9..bb9844a 100644
--- a/runtime/vdex_file.h
+++ b/runtime/vdex_file.h
@@ -61,7 +61,7 @@
 
    private:
     static constexpr uint8_t kVdexMagic[] = { 'v', 'd', 'e', 'x' };
-    static constexpr uint8_t kVdexVersion[] = { '0', '0', '1', '\0' };
+    static constexpr uint8_t kVdexVersion[] = { '0', '0', '2', '\0' };  // Handle verify-profile
 
     uint8_t magic_[4];
     uint8_t version_[4];
diff --git a/runtime/verifier/method_verifier.cc b/runtime/verifier/method_verifier.cc
index 715b237..b915457 100644
--- a/runtime/verifier/method_verifier.cc
+++ b/runtime/verifier/method_verifier.cc
@@ -2901,9 +2901,7 @@
       ArtMethod* called_method = VerifyInvocationArgs(inst, type, is_range);
       const RegType* return_type = nullptr;
       if (called_method != nullptr) {
-        PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
-        mirror::Class* return_type_class = called_method->GetReturnType(can_load_classes_,
-                                                                        pointer_size);
+        mirror::Class* return_type_class = called_method->GetReturnType(can_load_classes_);
         if (return_type_class != nullptr) {
           return_type = &FromClass(called_method->GetReturnTypeDescriptor(),
                                    return_type_class,
@@ -2946,9 +2944,7 @@
       } else {
         is_constructor = called_method->IsConstructor();
         return_type_descriptor = called_method->GetReturnTypeDescriptor();
-        PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
-        mirror::Class* return_type_class = called_method->GetReturnType(can_load_classes_,
-                                                                        pointer_size);
+        mirror::Class* return_type_class = called_method->GetReturnType(can_load_classes_);
         if (return_type_class != nullptr) {
           return_type = &FromClass(return_type_descriptor,
                                    return_type_class,
@@ -3106,19 +3102,16 @@
         break;
       }
       const uint32_t proto_idx = (is_range) ? inst->VRegH_4rcc() : inst->VRegH_45cc();
-      const char* descriptor =
+      const char* return_descriptor =
           dex_file_->GetReturnTypeDescriptor(dex_file_->GetProtoId(proto_idx));
       const RegType& return_type =
-          reg_types_.FromDescriptor(GetClassLoader(), descriptor, false);
+          reg_types_.FromDescriptor(GetClassLoader(), return_descriptor, false);
       if (!return_type.IsLowHalf()) {
         work_line_->SetResultRegisterType(this, return_type);
       } else {
         work_line_->SetResultRegisterTypeWide(return_type, return_type.HighHalf(&reg_types_));
       }
-      // TODO(oth): remove when compiler support is available.
-      Fail(VERIFY_ERROR_FORCE_INTERPRETER)
-          << "invoke-polymorphic is not supported by compiler";
-      have_pending_experimental_failure_ = true;
+      just_set_result = true;
       break;
     }
     case Instruction::NEG_INT:
@@ -5136,9 +5129,7 @@
 const RegType& MethodVerifier::GetMethodReturnType() {
   if (return_type_ == nullptr) {
     if (mirror_method_ != nullptr) {
-      PointerSize pointer_size = Runtime::Current()->GetClassLinker()->GetImagePointerSize();
-      mirror::Class* return_type_class = mirror_method_->GetReturnType(can_load_classes_,
-                                                                       pointer_size);
+      mirror::Class* return_type_class = mirror_method_->GetReturnType(can_load_classes_);
       if (return_type_class != nullptr) {
         return_type_ = &FromClass(mirror_method_->GetReturnTypeDescriptor(),
                                   return_type_class,
diff --git a/runtime/verifier/verifier_deps.cc b/runtime/verifier/verifier_deps.cc
index 15cc566..1131607 100644
--- a/runtime/verifier/verifier_deps.cc
+++ b/runtime/verifier/verifier_deps.cc
@@ -963,20 +963,25 @@
   // Check recorded fields are resolved the same way, have the same recorded class,
   // and have the same recorded flags.
   ClassLinker* class_linker = Runtime::Current()->GetClassLinker();
-  StackHandleScope<1> hs(self);
-  Handle<mirror::DexCache> dex_cache(
-      hs.NewHandle(class_linker->FindDexCache(self, dex_file, /* allow_failure */ false)));
   for (const auto& entry : fields) {
-    ArtField* field = class_linker->ResolveFieldJLS(
-        dex_file, entry.GetDexFieldIndex(), dex_cache, class_loader);
-
-    if (field == nullptr) {
-      DCHECK(self->IsExceptionPending());
-      self->ClearException();
+    const DexFile::FieldId& field_id = dex_file.GetFieldId(entry.GetDexFieldIndex());
+    StringPiece name(dex_file.StringDataByIdx(field_id.name_idx_));
+    StringPiece type(dex_file.StringDataByIdx(dex_file.GetTypeId(field_id.type_idx_).descriptor_idx_));
+    // Only use field_id.class_idx_ when the entry is unresolved, which is rare.
+    // Otherwise, we might end up resolving an application class, which is expensive.
+    std::string expected_decl_klass = entry.IsResolved()
+        ? GetStringFromId(dex_file, entry.GetDeclaringClassIndex())
+        : dex_file.StringByTypeIdx(field_id.class_idx_);
+    mirror::Class* cls = FindClassAndClearException(
+        class_linker, self, expected_decl_klass.c_str(), class_loader);
+    if (cls == nullptr) {
+      LOG(INFO) << "VerifierDeps: Could not resolve class " << expected_decl_klass;
+      return false;
     }
+    DCHECK(cls->IsResolved());
 
+    ArtField* field = mirror::Class::FindField(self, cls, name, type);
     if (entry.IsResolved()) {
-      std::string expected_decl_klass = GetStringFromId(dex_file, entry.GetDeclaringClassIndex());
       std::string temp;
       if (field == nullptr) {
         LOG(INFO) << "VerifierDeps: Could not resolve field "
@@ -1025,11 +1030,16 @@
 
     const char* name = dex_file.GetMethodName(method_id);
     const Signature signature = dex_file.GetMethodSignature(method_id);
-    const char* descriptor = dex_file.GetMethodDeclaringClassDescriptor(method_id);
+    // Only use method_id.class_idx_ when the entry is unresolved, which is rare.
+    // Otherwise, we might end up resolving an application class, which is expensive.
+    std::string expected_decl_klass = entry.IsResolved()
+        ? GetStringFromId(dex_file, entry.GetDeclaringClassIndex())
+        : dex_file.StringByTypeIdx(method_id.class_idx_);
 
-    mirror::Class* cls = FindClassAndClearException(class_linker, self, descriptor, class_loader);
+    mirror::Class* cls = FindClassAndClearException(
+        class_linker, self, expected_decl_klass.c_str(), class_loader);
     if (cls == nullptr) {
-      LOG(INFO) << "VerifierDeps: Could not resolve class " << descriptor;
+      LOG(INFO) << "VerifierDeps: Could not resolve class " << expected_decl_klass;
       return false;
     }
     DCHECK(cls->IsResolved());
@@ -1045,7 +1055,6 @@
 
     if (entry.IsResolved()) {
       std::string temp;
-      std::string expected_decl_klass = GetStringFromId(dex_file, entry.GetDeclaringClassIndex());
       if (method == nullptr) {
         LOG(INFO) << "VerifierDeps: Could not resolve "
                   << kind
diff --git a/runtime/well_known_classes.cc b/runtime/well_known_classes.cc
index a5b275c..2610252 100644
--- a/runtime/well_known_classes.cc
+++ b/runtime/well_known_classes.cc
@@ -51,7 +51,6 @@
 jclass WellKnownClasses::java_lang_ClassNotFoundException;
 jclass WellKnownClasses::java_lang_Daemons;
 jclass WellKnownClasses::java_lang_Error;
-jclass WellKnownClasses::java_lang_ExceptionInInitializerError;
 jclass WellKnownClasses::java_lang_invoke_MethodHandle;
 jclass WellKnownClasses::java_lang_IllegalAccessError;
 jclass WellKnownClasses::java_lang_NoClassDefFoundError;
@@ -103,6 +102,7 @@
 jmethodID WellKnownClasses::java_lang_reflect_Proxy_invoke;
 jmethodID WellKnownClasses::java_lang_Runtime_nativeLoad;
 jmethodID WellKnownClasses::java_lang_Short_valueOf;
+jmethodID WellKnownClasses::java_lang_String_charAt;
 jmethodID WellKnownClasses::java_lang_System_runFinalization = nullptr;
 jmethodID WellKnownClasses::java_lang_Thread_dispatchUncaughtException;
 jmethodID WellKnownClasses::java_lang_Thread_init;
@@ -289,7 +289,6 @@
   java_lang_Object = CacheClass(env, "java/lang/Object");
   java_lang_OutOfMemoryError = CacheClass(env, "java/lang/OutOfMemoryError");
   java_lang_Error = CacheClass(env, "java/lang/Error");
-  java_lang_ExceptionInInitializerError = CacheClass(env, "java/lang/ExceptionInInitializerError");
   java_lang_IllegalAccessError = CacheClass(env, "java/lang/IllegalAccessError");
   java_lang_invoke_MethodHandle = CacheClass(env, "java/lang/invoke/MethodHandle");
   java_lang_NoClassDefFoundError = CacheClass(env, "java/lang/NoClassDefFoundError");
@@ -337,6 +336,7 @@
   java_lang_ref_ReferenceQueue_add = CacheMethod(env, java_lang_ref_ReferenceQueue.get(), true, "add", "(Ljava/lang/ref/Reference;)V");
 
   java_lang_reflect_Parameter_init = CacheMethod(env, java_lang_reflect_Parameter, false, "<init>", "(Ljava/lang/String;ILjava/lang/reflect/Executable;I)V");
+  java_lang_String_charAt = CacheMethod(env, java_lang_String, false, "charAt", "(I)C");
   java_lang_Thread_dispatchUncaughtException = CacheMethod(env, java_lang_Thread, false, "dispatchUncaughtException", "(Ljava/lang/Throwable;)V");
   java_lang_Thread_init = CacheMethod(env, java_lang_Thread, false, "<init>", "(Ljava/lang/ThreadGroup;Ljava/lang/String;IZ)V");
   java_lang_Thread_run = CacheMethod(env, java_lang_Thread, false, "run", "()V");
diff --git a/runtime/well_known_classes.h b/runtime/well_known_classes.h
index 371be61..db8a53c 100644
--- a/runtime/well_known_classes.h
+++ b/runtime/well_known_classes.h
@@ -61,7 +61,6 @@
   static jclass java_lang_ClassNotFoundException;
   static jclass java_lang_Daemons;
   static jclass java_lang_Error;
-  static jclass java_lang_ExceptionInInitializerError;
   static jclass java_lang_IllegalAccessError;
   static jclass java_lang_invoke_MethodHandle;
   static jclass java_lang_NoClassDefFoundError;
@@ -113,6 +112,7 @@
   static jmethodID java_lang_reflect_Proxy_invoke;
   static jmethodID java_lang_Runtime_nativeLoad;
   static jmethodID java_lang_Short_valueOf;
+  static jmethodID java_lang_String_charAt;
   static jmethodID java_lang_System_runFinalization;
   static jmethodID java_lang_Thread_dispatchUncaughtException;
   static jmethodID java_lang_Thread_init;
diff --git a/test/008-exceptions/expected.txt b/test/008-exceptions/expected.txt
index 083ecf7..fcf2ef4 100644
--- a/test/008-exceptions/expected.txt
+++ b/test/008-exceptions/expected.txt
@@ -1,11 +1,11 @@
 Got an NPE: second throw
 java.lang.NullPointerException: second throw
-	at Main.catchAndRethrow(Main.java:77)
-	at Main.exceptions_007(Main.java:59)
-	at Main.main(Main.java:67)
+	at Main.catchAndRethrow(Main.java:94)
+	at Main.exceptions_007(Main.java:74)
+	at Main.main(Main.java:82)
 Caused by: java.lang.NullPointerException: first throw
-	at Main.throwNullPointerException(Main.java:84)
-	at Main.catchAndRethrow(Main.java:74)
+	at Main.throwNullPointerException(Main.java:101)
+	at Main.catchAndRethrow(Main.java:91)
 	... 2 more
 Static Init
 BadError: This is bad by convention: BadInit
@@ -15,3 +15,11 @@
 BadErrorNoStringInit: This is bad by convention
 java.lang.NoClassDefFoundError: BadInitNoStringInit
 BadErrorNoStringInit: This is bad by convention
+BadSuperClass Static Init
+BadError: This is bad by convention: BadInit
+MultiDexBadInit Static Init
+java.lang.Error: MultiDexBadInit
+java.lang.NoClassDefFoundError: MultiDexBadInit
+  cause: java.lang.Error: MultiDexBadInit
+java.lang.NoClassDefFoundError: MultiDexBadInit
+  cause: java.lang.Error: MultiDexBadInit
diff --git a/test/008-exceptions/multidex.jpp b/test/008-exceptions/multidex.jpp
new file mode 100644
index 0000000..a3746f5
--- /dev/null
+++ b/test/008-exceptions/multidex.jpp
@@ -0,0 +1,27 @@
+BadError:
+  @@com.android.jack.annotations.ForceInMainDex
+  class BadError
+BadInit:
+  @@com.android.jack.annotations.ForceInMainDex
+  class BadInit
+BadErrorNoStringInit:
+  @@com.android.jack.annotations.ForceInMainDex
+  class BadErrorNoStringInit
+BadInitNoStringInit:
+  @@com.android.jack.annotations.ForceInMainDex
+  class BadInitNoStringInit
+BadSuperClass:
+  @@com.android.jack.annotations.ForceInMainDex
+  class BadSuperClass
+DerivedFromBadSuperClass:
+  @@com.android.jack.annotations.ForceInMainDex
+  class DerivedFromBadSuperClass
+Main:
+  @@com.android.jack.annotations.ForceInMainDex
+  class Main
+MultiDexBadInit:
+  @@com.android.jack.annotations.ForceInMainDex
+  class MultiDexBadInit
+MultiDexBadInitWrapper1:
+  @@com.android.jack.annotations.ForceInMainDex
+  class MultiDexBadInitWrapper1
diff --git a/test/008-exceptions/src-multidex/MultiDexBadInitWrapper2.java b/test/008-exceptions/src-multidex/MultiDexBadInitWrapper2.java
new file mode 100644
index 0000000..f3953bd
--- /dev/null
+++ b/test/008-exceptions/src-multidex/MultiDexBadInitWrapper2.java
@@ -0,0 +1,24 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class MultiDexBadInitWrapper2 {
+    public static void setDummy(int value) {
+        if (doThrow) { throw new Error(); }
+        MultiDexBadInit.dummy = value;
+    }
+
+    public static boolean doThrow = false;
+}
diff --git a/test/008-exceptions/src/Main.java b/test/008-exceptions/src/Main.java
index b8231f1..74af00c 100644
--- a/test/008-exceptions/src/Main.java
+++ b/test/008-exceptions/src/Main.java
@@ -50,6 +50,21 @@
     }
 }
 
+// A class that throws BadError during static initialization, serving as a super class.
+class BadSuperClass {
+ static int dummy;
+ static {
+     System.out.println("BadSuperClass Static Init");
+     if (true) {
+         throw new BadError("BadInit");
+     }
+ }
+}
+
+// A class that derives from BadSuperClass.
+class DerivedFromBadSuperClass extends BadSuperClass {
+}
+
 /**
  * Exceptions across method calls
  */
@@ -63,10 +78,12 @@
             npe.printStackTrace(System.out);
         }
     }
-    public static void main (String args[]) {
+    public static void main(String args[]) {
         exceptions_007();
         exceptionsRethrowClassInitFailure();
         exceptionsRethrowClassInitFailureNoStringInit();
+        exceptionsForSuperClassInitFailure();
+        exceptionsInMultiDex();
     }
 
     private static void catchAndRethrow() {
@@ -129,4 +146,70 @@
             error.printStackTrace(System.out);
         }
     }
+
+    private static void exceptionsForSuperClassInitFailure() {
+        try {
+            // Resolve DerivedFromBadSuperClass.
+            BadSuperClass.dummy = 1;
+            throw new IllegalStateException("Should not reach here.");
+        } catch (BadError e) {
+            System.out.println(e);
+        } catch (Throwable t) {
+            t.printStackTrace();
+        }
+        try {
+            // Before splitting mirror::Class::kStatusError into
+            // kStatusErrorUnresolved and kStatusErrorResolved,
+            // this would trigger a
+            //     CHECK(super_class->IsResolved())
+            // failure in
+            //     ClassLinker::LoadSuperAndInterfaces().
+            // After the change we're getting either VerifyError
+            // (for Optimizing) or NoClassDefFoundError wrapping
+            // BadError (for interpreter or JIT).
+            new DerivedFromBadSuperClass();
+            throw new IllegalStateException("Should not reach here.");
+        } catch (NoClassDefFoundError ncdfe) {
+            if (!(ncdfe.getCause() instanceof BadError)) {
+                ncdfe.getCause().printStackTrace();
+            }
+        } catch (VerifyError e) {
+        } catch (Throwable t) {
+            t.printStackTrace();
+        }
+    }
+
+    private static void exceptionsInMultiDex() {
+        try {
+            MultiDexBadInit.dummy = 1;
+            throw new IllegalStateException("Should not reach here.");
+        } catch (Error e) {
+            System.out.println(e);
+        } catch (Throwable t) {
+            t.printStackTrace();
+        }
+        // Before splitting mirror::Class::kStatusError into
+        // kStatusErrorUnresolved and kStatusErrorResolved,
+        // the exception from wrapper 1 would have been
+        // wrapped in NoClassDefFoundError but the exception
+        // from wrapper 2 would have been unwrapped.
+        try {
+            MultiDexBadInitWrapper1.setDummy(1);
+            throw new IllegalStateException("Should not reach here.");
+        } catch (NoClassDefFoundError ncdfe) {
+            System.out.println(ncdfe);
+            System.out.println("  cause: " + ncdfe.getCause());
+        } catch (Throwable t) {
+            t.printStackTrace();
+        }
+        try {
+            MultiDexBadInitWrapper2.setDummy(1);
+            throw new IllegalStateException("Should not reach here.");
+        } catch (NoClassDefFoundError ncdfe) {
+            System.out.println(ncdfe);
+            System.out.println("  cause: " + ncdfe.getCause());
+        } catch (Throwable t) {
+            t.printStackTrace();
+        }
+    }
 }
diff --git a/test/008-exceptions/src/MultiDexBadInit.java b/test/008-exceptions/src/MultiDexBadInit.java
new file mode 100644
index 0000000..e3ebb9c
--- /dev/null
+++ b/test/008-exceptions/src/MultiDexBadInit.java
@@ -0,0 +1,25 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class MultiDexBadInit {
+    static int dummy;
+    static {
+        System.out.println("MultiDexBadInit Static Init");
+        if (true) {
+            throw new Error("MultiDexBadInit");
+        }
+    }
+}
diff --git a/test/008-exceptions/src/MultiDexBadInitWrapper1.java b/test/008-exceptions/src/MultiDexBadInitWrapper1.java
new file mode 100644
index 0000000..059e6a3
--- /dev/null
+++ b/test/008-exceptions/src/MultiDexBadInitWrapper1.java
@@ -0,0 +1,24 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class MultiDexBadInitWrapper1 {
+    public static void setDummy(int value) {
+        if (doThrow) { throw new Error(); }
+        MultiDexBadInit.dummy = value;
+    }
+
+    public static boolean doThrow = false;
+}
diff --git a/test/080-oom-throw/expected.txt b/test/080-oom-throw/expected.txt
index 904393b..0967278 100644
--- a/test/080-oom-throw/expected.txt
+++ b/test/080-oom-throw/expected.txt
@@ -1,3 +1,4 @@
 Test reflection correctly threw
+Test reflection2 correctly threw
 NEW_ARRAY correctly threw OOME
 NEW_INSTANCE correctly threw OOME
diff --git a/test/080-oom-throw/src/Main.java b/test/080-oom-throw/src/Main.java
index 0ae92a9..a6c18b7 100644
--- a/test/080-oom-throw/src/Main.java
+++ b/test/080-oom-throw/src/Main.java
@@ -53,6 +53,30 @@
         }
     }
 
+    public static Object eatAllMemory() {
+        Object[] result = null;
+        int size = 1000000;
+        while (result == null && size != 0) {
+            try {
+                result = new Object[size];
+            } catch (OutOfMemoryError oome) {
+                size /= 2;
+            }
+        }
+        if (result != null) {
+            int index = 0;
+            while (index != result.length && size != 0) {
+                try {
+                    result[index] = new byte[size];
+                    ++index;
+                } catch (OutOfMemoryError oome) {
+                    size /= 2;
+                }
+            }
+        }
+        return result;
+    }
+
     static boolean triggerArrayOOM() {
         ArrayMemEater.blowup(new char[128 * 1024][]);
         return ArrayMemEater.sawOome;
@@ -74,6 +98,9 @@
         if (triggerReflectionOOM()) {
             System.out.println("Test reflection correctly threw");
         }
+        if (triggerReflectionOOM2()) {
+            System.out.println("Test reflection2 correctly threw");
+        }
 
         if (triggerArrayOOM()) {
             System.out.println("NEW_ARRAY correctly threw OOME");
@@ -125,4 +152,20 @@
         }
         return true;
     }
+
+    static boolean triggerReflectionOOM2() {
+        Object memory = eatAllMemory();
+        boolean result = false;
+        try {
+            Main.class.getDeclaredMethods();
+        } catch (OutOfMemoryError e) {
+            result = true;
+        }
+        if (!result) {
+            boolean memoryWasAllocated = (memory != null);
+            memory = null;
+            System.out.println("memoryWasAllocated = " + memoryWasAllocated);
+        }
+        return result;
+    }
 }
diff --git a/test/129-ThreadGetId/src/Main.java b/test/129-ThreadGetId/src/Main.java
index 6ba01ff..4e48e0e 100644
--- a/test/129-ThreadGetId/src/Main.java
+++ b/test/129-ThreadGetId/src/Main.java
@@ -23,7 +23,6 @@
 
     public static void main(String[] args) throws Exception {
         final Thread[] threads = new Thread[numberOfThreads];
-        test_getStackTraces();
         for (int t = 0; t < threads.length; t++) {
             threads[t] = new Thread(new Main());
             threads[t].start();
@@ -31,6 +30,9 @@
         for (Thread t : threads) {
             t.join();
         }
+        // Do this test after the other part to leave some time for the heap task daemon to start
+        // up.
+        test_getStackTraces();
         System.out.println("Finishing");
     }
 
diff --git a/test/142-classloader2/expected.txt b/test/142-classloader2/expected.txt
index 86f5e22..056d978 100644
--- a/test/142-classloader2/expected.txt
+++ b/test/142-classloader2/expected.txt
@@ -1 +1,5 @@
+Loaded class B.
+Caught VerifyError.
+Loaded class B.
+Caught wrapped VerifyError.
 Everything OK.
diff --git a/test/142-classloader2/src/Main.java b/test/142-classloader2/src/Main.java
index 80b00e7..a0c7764 100644
--- a/test/142-classloader2/src/Main.java
+++ b/test/142-classloader2/src/Main.java
@@ -74,16 +74,25 @@
         // Try to load a dex file with bad dex code. Use new instance to force verification.
         try {
           Class<?> badClass = Main.class.getClassLoader().loadClass("B");
+          System.out.println("Loaded class B.");
           badClass.newInstance();
-          System.out.println("Should not be able to load class from bad dex file.");
+          System.out.println("Should not be able to instantiate B with bad dex bytecode.");
         } catch (VerifyError e) {
+          System.out.println("Caught VerifyError.");
         }
 
         // Make sure the same error is rethrown when reloading the bad class.
         try {
           Class<?> badClass = Main.class.getClassLoader().loadClass("B");
-          System.out.println("Should not be able to load class from bad dex file.");
-        } catch (VerifyError e) {
+          System.out.println("Loaded class B.");
+          badClass.newInstance();
+          System.out.println("Should not be able to instantiate B with bad dex bytecode.");
+        } catch (NoClassDefFoundError e) {
+          if (e.getCause() instanceof VerifyError) {
+            System.out.println("Caught wrapped VerifyError.");
+          } else {
+            e.printStackTrace();
+          }
         }
 
         System.out.println("Everything OK.");
diff --git a/test/154-gc-loop/expected.txt b/test/154-gc-loop/expected.txt
new file mode 100644
index 0000000..6106818
--- /dev/null
+++ b/test/154-gc-loop/expected.txt
@@ -0,0 +1,2 @@
+JNI_OnLoad called
+Finalize count too large: false
diff --git a/test/154-gc-loop/heap_interface.cc b/test/154-gc-loop/heap_interface.cc
new file mode 100644
index 0000000..8d610a8
--- /dev/null
+++ b/test/154-gc-loop/heap_interface.cc
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2015 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "gc/heap.h"
+#include "runtime.h"
+
+namespace art {
+namespace {
+
+extern "C" JNIEXPORT void JNICALL Java_Main_backgroundProcessState(JNIEnv*, jclass) {
+  Runtime::Current()->UpdateProcessState(kProcessStateJankImperceptible);
+}
+
+}  // namespace
+}  // namespace art
diff --git a/test/154-gc-loop/info.txt b/test/154-gc-loop/info.txt
new file mode 100644
index 0000000..f599db1
--- /dev/null
+++ b/test/154-gc-loop/info.txt
@@ -0,0 +1 @@
+Test that GC doesn't happen too often for a few small allocations.
diff --git a/test/154-gc-loop/src/Main.java b/test/154-gc-loop/src/Main.java
new file mode 100644
index 0000000..3a256c1
--- /dev/null
+++ b/test/154-gc-loop/src/Main.java
@@ -0,0 +1,45 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.ref.WeakReference;
+
+public class Main {
+  static final class GcWatcher {
+    protected void finalize() throws Throwable {
+        watcher = new WeakReference<GcWatcher>(new GcWatcher());
+        ++finalizeCounter;
+    }
+  }
+  static WeakReference<GcWatcher> watcher = new WeakReference<GcWatcher>(new GcWatcher());
+  static Object o = new Object();
+  static int finalizeCounter = 0;
+
+  public static void main(String[] args) {
+    System.loadLibrary(args[0]);
+    backgroundProcessState();
+    try {
+        Runtime.getRuntime().gc();
+        for (int i = 0; i < 10; ++i) {
+            o = new Object();
+            Thread.sleep(1000);
+        }
+    } catch (Exception e) {}
+    System.out.println("Finalize count too large: " +
+            ((finalizeCounter >= 10) ? Integer.toString(finalizeCounter) : "false"));
+  }
+
+  private static native void backgroundProcessState();
+}
diff --git a/test/494-checker-instanceof-tests/src/Main.java b/test/494-checker-instanceof-tests/src/Main.java
index 2eac6c9..acd2305 100644
--- a/test/494-checker-instanceof-tests/src/Main.java
+++ b/test/494-checker-instanceof-tests/src/Main.java
@@ -142,11 +142,11 @@
   /// CHECK:                LoadClass
   /// CHECK:                Return [<<Const>>]
   public static boolean knownTestWithUnloadedClass() {
-    return $inline$returnMain() instanceof String;
+    return $inline$returnUnrelated() instanceof String;
   }
 
-  public static Object $inline$returnMain() {
-    return new Main();
+  public static Object $inline$returnUnrelated() {
+    return new Unrelated();
   }
 
   public static void expect(boolean expected, boolean actual) {
diff --git a/test/496-checker-inlining-class-loader/src/Main.java b/test/496-checker-inlining-class-loader/src/Main.java
index 15d4dc0..5deb77f 100644
--- a/test/496-checker-inlining-class-loader/src/Main.java
+++ b/test/496-checker-inlining-class-loader/src/Main.java
@@ -82,10 +82,10 @@
 
 class LoadedByMyClassLoader {
   /// CHECK-START: void LoadedByMyClassLoader.bar() inliner (before)
-  /// CHECK:      LoadClass
+  /// CHECK:      LoadClass class_name:FirstSeenByMyClassLoader
   /// CHECK-NEXT: ClinitCheck
   /// CHECK-NEXT: InvokeStaticOrDirect
-  /// CHECK-NEXT: LoadClass
+  /// CHECK-NEXT: LoadClass class_name:java.lang.System
   /// CHECK-NEXT: ClinitCheck
   /// CHECK-NEXT: StaticFieldGet
   /// CHECK-NEXT: LoadString
@@ -93,10 +93,10 @@
   /// CHECK-NEXT: InvokeVirtual
 
   /// CHECK-START: void LoadedByMyClassLoader.bar() inliner (after)
-  /// CHECK:      LoadClass
+  /// CHECK:      LoadClass class_name:FirstSeenByMyClassLoader
   /// CHECK-NEXT: ClinitCheck
                 /* We inlined FirstSeenByMyClassLoader.$inline$bar */
-  /// CHECK-NEXT: LoadClass
+  /// CHECK-NEXT: LoadClass class_name:java.lang.System
   /// CHECK-NEXT: ClinitCheck
   /// CHECK-NEXT: StaticFieldGet
   /// CHECK-NEXT: LoadString
@@ -105,12 +105,15 @@
 
   /// CHECK-START: void LoadedByMyClassLoader.bar() register (before)
                 /* Load and initialize FirstSeenByMyClassLoader */
-  /// CHECK:      LoadClass gen_clinit_check:true
+  /// CHECK:      LoadClass class_name:FirstSeenByMyClassLoader gen_clinit_check:true
                 /* Load and initialize System */
   // There may be MipsComputeBaseMethodAddress here.
-  /// CHECK:      LoadClass gen_clinit_check:true
-  /// CHECK-NEXT: StaticFieldGet
-  // There may be HArmDexCacheArraysBase or HX86ComputeBaseMethodAddress here.
+  /// CHECK:      LoadClass class_name:java.lang.System
+  // The ClinitCheck may (PIC) or may not (non-PIC) be merged into the LoadClass.
+  // (The merging checks for environment match but HLoadClass/kBootImageAddress
+  // used for non-PIC mode does not have an environment at all.)
+  /// CHECK:      StaticFieldGet
+  // There may be HX86ComputeBaseMethodAddress or MipsComputeBaseMethodAddress here.
   /// CHECK:      LoadString
   /// CHECK-NEXT: NullCheck
   /// CHECK-NEXT: InvokeVirtual
diff --git a/test/552-checker-sharpening/src/Main.java b/test/552-checker-sharpening/src/Main.java
index fe6ff13..db43768 100644
--- a/test/552-checker-sharpening/src/Main.java
+++ b/test/552-checker-sharpening/src/Main.java
@@ -331,32 +331,32 @@
   /// CHECK-START-X86: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
   // Note: load kind depends on PIC/non-PIC
   // TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
-  /// CHECK:                LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+  /// CHECK:                LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
 
   /// CHECK-START-X86_64: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
   // Note: load kind depends on PIC/non-PIC
   // TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
-  /// CHECK:                LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+  /// CHECK:                LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
 
   /// CHECK-START-ARM: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
   // Note: load kind depends on PIC/non-PIC
   // TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
-  /// CHECK:                LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+  /// CHECK:                LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
 
   /// CHECK-START-ARM64: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
   // Note: load kind depends on PIC/non-PIC
   // TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
-  /// CHECK:                LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+  /// CHECK:                LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
 
   /// CHECK-START-MIPS: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
   // Note: load kind depends on PIC/non-PIC
   // TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
-  /// CHECK:                LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+  /// CHECK:                LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
 
   /// CHECK-START-MIPS64: java.lang.Class Main.$noinline$getStringClass() sharpening (after)
   // Note: load kind depends on PIC/non-PIC
   // TODO: Remove DexCacheViaMethod when read barrier config supports BootImageAddress.
-  /// CHECK:                LoadClass load_kind:{{BootImageAddress|DexCachePcRelative|DexCacheViaMethod}} class_name:java.lang.String
+  /// CHECK:                LoadClass load_kind:{{BootImageAddress|BssEntry|DexCacheViaMethod}} class_name:java.lang.String
 
   public static Class<?> $noinline$getStringClass() {
     // Prevent inlining to avoid the string comparison being optimized away.
@@ -369,34 +369,34 @@
   /// CHECK:                LoadClass load_kind:DexCacheViaMethod class_name:Other
 
   /// CHECK-START-X86: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
-  /// CHECK:                LoadClass load_kind:DexCachePcRelative class_name:Other
+  /// CHECK:                LoadClass load_kind:BssEntry class_name:Other
 
   /// CHECK-START-X86: java.lang.Class Main.$noinline$getOtherClass() pc_relative_fixups_x86 (after)
   /// CHECK-DAG:            X86ComputeBaseMethodAddress
-  /// CHECK-DAG:            LoadClass load_kind:DexCachePcRelative class_name:Other
+  /// CHECK-DAG:            LoadClass load_kind:BssEntry class_name:Other
 
   /// CHECK-START-X86_64: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
-  /// CHECK:                LoadClass load_kind:DexCachePcRelative class_name:Other
+  /// CHECK:                LoadClass load_kind:BssEntry class_name:Other
 
   /// CHECK-START-ARM: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
-  /// CHECK:                LoadClass load_kind:DexCachePcRelative class_name:Other
+  /// CHECK:                LoadClass load_kind:BssEntry class_name:Other
 
   /// CHECK-START-ARM: java.lang.Class Main.$noinline$getOtherClass() dex_cache_array_fixups_arm (after)
   /// CHECK-DAG:            ArmDexCacheArraysBase
-  /// CHECK-DAG:            LoadClass load_kind:DexCachePcRelative class_name:Other
+  /// CHECK-DAG:            LoadClass load_kind:BssEntry class_name:Other
 
   /// CHECK-START-ARM64: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
-  /// CHECK:                LoadClass load_kind:DexCachePcRelative class_name:Other
+  /// CHECK:                LoadClass load_kind:BssEntry class_name:Other
 
   /// CHECK-START-MIPS: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
-  /// CHECK:                LoadClass load_kind:DexCachePcRelative class_name:Other
+  /// CHECK:                LoadClass load_kind:BssEntry class_name:Other
 
   /// CHECK-START-MIPS: java.lang.Class Main.$noinline$getOtherClass() dex_cache_array_fixups_mips (after)
   /// CHECK-DAG:            MipsDexCacheArraysBase
-  /// CHECK-DAG:            LoadClass load_kind:DexCachePcRelative class_name:Other
+  /// CHECK-DAG:            LoadClass load_kind:BssEntry class_name:Other
 
   /// CHECK-START-MIPS64: java.lang.Class Main.$noinline$getOtherClass() sharpening (after)
-  /// CHECK:                LoadClass load_kind:DexCachePcRelative class_name:Other
+  /// CHECK:                LoadClass load_kind:BssEntry class_name:Other
 
   public static Class<?> $noinline$getOtherClass() {
     // Prevent inlining to avoid the string comparison being optimized away.
diff --git a/test/559-checker-irreducible-loop/smali/IrreducibleLoop.smali b/test/559-checker-irreducible-loop/smali/IrreducibleLoop.smali
index af43973..a30a11a 100644
--- a/test/559-checker-irreducible-loop/smali/IrreducibleLoop.smali
+++ b/test/559-checker-irreducible-loop/smali/IrreducibleLoop.smali
@@ -196,7 +196,7 @@
   const-class v0, LMain;
   if-ne v0, v2, :exit
   :other_loop_entry
-  const-class v1, Ljava/lang/Class;  # LoadClass that can throw
+  const-class v1, LOther;  # LoadClass that can throw
   goto :loop_entry
   :exit
   return-object v0
@@ -250,7 +250,7 @@
   const/4 v0, 0
   if-ne p0, v0, :other_loop_entry
   :loop_entry
-  const-class v1, Ljava/lang/Class;  # LoadClass that can throw
+  const-class v1, LOther;  # LoadClass that can throw
   if-ne v0, p0, :exit
   :other_loop_entry
   sub-int v1, p0, p0
@@ -286,7 +286,7 @@
 .method public static licm3(III)I
   .registers 4
   :loop_entry
-  const-class v0, Ljava/lang/Class;  # LoadClass that can throw
+  const-class v0, LOther;  # LoadClass that can throw
   if-ne p1, p2, :exit
   goto :loop_body
 
diff --git a/test/559-checker-irreducible-loop/src/Main.java b/test/559-checker-irreducible-loop/src/Main.java
index ab84f81..023e769 100644
--- a/test/559-checker-irreducible-loop/src/Main.java
+++ b/test/559-checker-irreducible-loop/src/Main.java
@@ -67,3 +67,6 @@
 
   int myField;
 }
+
+class Other {
+}
diff --git a/test/559-checker-rtp-ifnotnull/src/Main.java b/test/559-checker-rtp-ifnotnull/src/Main.java
index 2dc5666..1e15654 100644
--- a/test/559-checker-rtp-ifnotnull/src/Main.java
+++ b/test/559-checker-rtp-ifnotnull/src/Main.java
@@ -18,7 +18,6 @@
 public class Main {
 
   /// CHECK-START: void Main.boundTypeForIfNotNull() builder (after)
-  /// CHECK-DAG:     <<Method:(i|j)\d+>>  CurrentMethod
   /// CHECK-DAG:     <<Null:l\d+>>        NullConstant
   /// CHECK-DAG:     <<Cst5:i\d+>>        IntConstant 5
   /// CHECK-DAG:     <<Cst10:i\d+>>       IntConstant 10
@@ -28,10 +27,12 @@
   /// CHECK-DAG:     <<LoopPhi>>          Phi [<<Null>>,<<MergePhi:l\d+>>] klass:int[]
 
   /// CHECK-DAG:     <<BoundType:l\d+>>   BoundType [<<LoopPhi>>] klass:int[] can_be_null:false
-  /// CHECK-DAG:     <<NewArray10:l\d+>>  NewArray [<<Cst10>>,<<Method>>] klass:int[]
+  /// CHECK-DAG:     <<LoadClass1:l\d+>>  LoadClass
+  /// CHECK-DAG:     <<LoadClass2:l\d+>>  LoadClass
+  /// CHECK-DAG:     <<NewArray10:l\d+>>  NewArray [<<LoadClass2>>,<<Cst10>>] klass:int[]
   /// CHECK-DAG:     <<NotNullPhi:l\d+>>  Phi [<<BoundType>>,<<NewArray10>>] klass:int[]
 
-  /// CHECK-DAG:     <<NewArray5:l\d+>>   NewArray [<<Cst5>>,<<Method>>] klass:int[]
+  /// CHECK-DAG:     <<NewArray5:l\d+>>   NewArray [<<LoadClass1>>,<<Cst5>>] klass:int[]
   /// CHECK-DAG:     <<MergePhi>>         Phi [<<NewArray5>>,<<NotNullPhi>>] klass:int[]
 
   public static void boundTypeForIfNotNull() {
diff --git a/test/564-checker-irreducible-loop/smali/IrreducibleLoop.smali b/test/564-checker-irreducible-loop/smali/IrreducibleLoop.smali
index 75344f7..e4bf236 100644
--- a/test/564-checker-irreducible-loop/smali/IrreducibleLoop.smali
+++ b/test/564-checker-irreducible-loop/smali/IrreducibleLoop.smali
@@ -17,10 +17,9 @@
 .super Ljava/lang/Object;
 
 ## CHECK-START-X86: int IrreducibleLoop.simpleLoop(int) dead_code_elimination$initial (before)
-## CHECK-DAG: <<Method:(i|j)\d+>> CurrentMethod
 ## CHECK-DAG: <<Constant:i\d+>>   IntConstant 42
-## CHECK-DAG:                     InvokeStaticOrDirect [<<Constant>>,<<Method>>] loop:{{B\d+}} irreducible:true
-## CHECK-DAG:                     InvokeStaticOrDirect [<<Constant>>,<<Method>>] loop:none
+## CHECK-DAG:                     InvokeStaticOrDirect [<<Constant>>] loop:{{B\d+}} irreducible:true
+## CHECK-DAG:                     InvokeStaticOrDirect [<<Constant>>] loop:none
 .method public static simpleLoop(I)I
    .registers 3
    const/16 v0, 42
diff --git a/test/572-checker-array-get-regression/src/Main.java b/test/572-checker-array-get-regression/src/Main.java
index 89b97ed..03a8448 100644
--- a/test/572-checker-array-get-regression/src/Main.java
+++ b/test/572-checker-array-get-regression/src/Main.java
@@ -21,10 +21,10 @@
   }
 
   /// CHECK-START: java.lang.Integer Main.test() builder (after)
-  /// CHECK-DAG:     <<Method:[ij]\d+>>    CurrentMethod
   /// CHECK-DAG:     <<Const2P19:i\d+>>    IntConstant 524288
   /// CHECK-DAG:     <<ConstM1:i\d+>>      IntConstant -1
-  /// CHECK-DAG:     <<Array:l\d+>>        NewArray [<<Const2P19>>,<<Method>>]
+  /// CHECK-DAG:     <<LoadClass:l\d+>>    LoadClass
+  /// CHECK-DAG:     <<Array:l\d+>>        NewArray [<<LoadClass>>,<<Const2P19>>]
   /// CHECK-DAG:     <<Length1:i\d+>>      ArrayLength [<<Array>>]
   /// CHECK-DAG:     <<Index:i\d+>>        Add [<<Length1>>,<<ConstM1>>]
   /// CHECK-DAG:     <<Length2:i\d+>>      ArrayLength [<<Array>>]
@@ -34,10 +34,10 @@
 
 
   /// CHECK-START: java.lang.Integer Main.test() register (before)
-  /// CHECK-DAG:     <<Method:[ij]\d+>>    CurrentMethod
   /// CHECK-DAG:     <<Const2P19:i\d+>>    IntConstant 524288
   /// CHECK-DAG:     <<Const2P19M1:i\d+>>  IntConstant 524287
-  /// CHECK-DAG:     <<Array:l\d+>>        NewArray [<<Const2P19>>,<<Method>>]
+  /// CHECK-DAG:     <<LoadClass:l\d+>>    LoadClass
+  /// CHECK-DAG:     <<Array:l\d+>>        NewArray [<<LoadClass>>,<<Const2P19>>]
   /// CHECK-DAG:     <<LastElement:l\d+>>  ArrayGet [<<Array>>,<<Const2P19M1>>]
   /// CHECK-DAG:                           Return [<<LastElement>>]
 
diff --git a/test/588-checker-irreducib-lifetime-hole/smali/IrreducibleLoop.smali b/test/588-checker-irreducib-lifetime-hole/smali/IrreducibleLoop.smali
index 186f0ab..9b8aa51 100644
--- a/test/588-checker-irreducib-lifetime-hole/smali/IrreducibleLoop.smali
+++ b/test/588-checker-irreducib-lifetime-hole/smali/IrreducibleLoop.smali
@@ -17,11 +17,10 @@
 .super Ljava/lang/Object;
 
 ## CHECK-START-X86: int IrreducibleLoop.simpleLoop1(int) dead_code_elimination$initial (before)
-## CHECK-DAG: <<Method:(i|j)\d+>> CurrentMethod
 ## CHECK-DAG: <<Constant:i\d+>>   IntConstant 42
 ## CHECK-DAG:                     Goto irreducible:true
-## CHECK-DAG:                     InvokeStaticOrDirect [<<Constant>>,<<Method>>] loop:none
-## CHECK-DAG:                     InvokeStaticOrDirect [{{i\d+}},<<Method>>] loop:none
+## CHECK-DAG:                     InvokeStaticOrDirect [<<Constant>>] loop:none
+## CHECK-DAG:                     InvokeStaticOrDirect [{{i\d+}}] loop:none
 .method public static simpleLoop1(I)I
    .registers 3
    const/16 v0, 42
@@ -58,11 +57,10 @@
 .end method
 
 ## CHECK-START-X86: int IrreducibleLoop.simpleLoop2(int) dead_code_elimination$initial (before)
-## CHECK-DAG: <<Method:(i|j)\d+>> CurrentMethod
 ## CHECK-DAG: <<Constant:i\d+>>   IntConstant 42
 ## CHECK-DAG:                     Goto irreducible:true
-## CHECK-DAG:                     InvokeStaticOrDirect [<<Constant>>,<<Method>>] loop:none
-## CHECK-DAG:                     InvokeStaticOrDirect [{{i\d+}},<<Method>>] loop:none
+## CHECK-DAG:                     InvokeStaticOrDirect [<<Constant>>] loop:none
+## CHECK-DAG:                     InvokeStaticOrDirect [{{i\d+}}] loop:none
 .method public static simpleLoop2(I)I
    .registers 3
    const/16 v0, 42
diff --git a/test/595-profile-saving/profile-saving.cc b/test/595-profile-saving/profile-saving.cc
index bf3d812..0f8dd57 100644
--- a/test/595-profile-saving/profile-saving.cc
+++ b/test/595-profile-saving/profile-saving.cc
@@ -17,7 +17,7 @@
 #include "dex_file.h"
 
 #include "art_method-inl.h"
-#include "jit/offline_profiling_info.h"
+#include "jit/profile_compilation_info.h"
 #include "jit/profile_saver.h"
 #include "jni.h"
 #include "method_reference.h"
diff --git a/test/596-monitor-inflation/expected.txt b/test/596-monitor-inflation/expected.txt
new file mode 100644
index 0000000..2add696
--- /dev/null
+++ b/test/596-monitor-inflation/expected.txt
@@ -0,0 +1,6 @@
+JNI_OnLoad called
+Monitor list grew by at least 4000 monitors
+Monitor list shrank correctly
+Finished first check
+Finished second check
+Total checks: 10000
diff --git a/test/596-monitor-inflation/info.txt b/test/596-monitor-inflation/info.txt
new file mode 100644
index 0000000..81dedb6
--- /dev/null
+++ b/test/596-monitor-inflation/info.txt
@@ -0,0 +1,5 @@
+A simple test that forces many monitors to be inflated, while checking
+that hashcodes are consistently maintained.
+
+This allocates more monitors and hence may exercise the monitor pool
+differently, and with more context, than the monitor_pool_test gtest.
diff --git a/test/596-monitor-inflation/monitor_inflation.cc b/test/596-monitor-inflation/monitor_inflation.cc
new file mode 100644
index 0000000..fb4275b
--- /dev/null
+++ b/test/596-monitor-inflation/monitor_inflation.cc
@@ -0,0 +1,35 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include "gc/heap.h"
+#include "jni.h"
+#include "monitor.h"
+#include "runtime.h"
+#include "thread-inl.h"
+
+namespace art {
+namespace {
+
+extern "C" JNIEXPORT void JNICALL Java_Main_trim(JNIEnv*, jclass) {
+  Runtime::Current()->GetHeap()->Trim(Thread::Current());
+}
+
+extern "C" JNIEXPORT jint JNICALL Java_Main_monitorListSize(JNIEnv*, jclass) {
+  return Runtime::Current()->GetMonitorList()->Size();
+}
+
+}  // namespace
+}  // namespace art
diff --git a/test/596-monitor-inflation/src/Main.java b/test/596-monitor-inflation/src/Main.java
new file mode 100644
index 0000000..d97c766
--- /dev/null
+++ b/test/596-monitor-inflation/src/Main.java
@@ -0,0 +1,79 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+import java.util.IdentityHashMap;
+import dalvik.system.VMRuntime;
+
+public class Main {
+  public static void main(String[] args) {
+    System.loadLibrary(args[0]);
+    int initialSize = monitorListSize();
+    IdentityHashMap<Object, Integer> all = new IdentityHashMap();
+    for (int i = 0; i < 5000; ++i) {
+      Object obj = new Object();
+      synchronized(obj) {
+        // Should force inflation.
+        all.put(obj, obj.hashCode());
+      }
+    }
+    // Since monitor deflation is delayed significantly, we believe that even with an intervening
+    // GC, monitors should remain inflated.  We allow some slop for unrelated concurrent runtime
+    // actions.
+    int inflatedSize = monitorListSize();
+    if (inflatedSize >= initialSize + 4000) {
+        System.out.println("Monitor list grew by at least 4000 monitors");
+    } else {
+        System.out.println("Monitor list did not grow as expected");
+    }
+    // Encourage monitor deflation.
+    // trim() (Heap::Trim()) deflates only in JANK_IMPERCEPTIBLE state.
+    // Some of this mirrors code in ActivityThread.java.
+    final int DALVIK_PROCESS_STATE_JANK_PERCEPTIBLE = 0;
+    final int DALVIK_PROCESS_STATE_JANK_IMPERCEPTIBLE = 1;
+    VMRuntime.getRuntime().updateProcessState(DALVIK_PROCESS_STATE_JANK_IMPERCEPTIBLE);
+    System.gc();
+    System.runFinalization();
+    trim();
+    VMRuntime.getRuntime().updateProcessState(DALVIK_PROCESS_STATE_JANK_PERCEPTIBLE);
+    int finalSize = monitorListSize();
+    if (finalSize > initialSize + 1000) {
+        System.out.println("Monitor list failed to shrink properly");
+    } else {
+        System.out.println("Monitor list shrank correctly");
+    }
+    int j = 0;
+    for (Object obj: all.keySet()) {
+      ++j;
+      if (obj.hashCode() != all.get(obj)) {
+        throw new AssertionError("Failed hashcode test!");
+      }
+    }
+    System.out.println("Finished first check");
+    for (Object obj: all.keySet()) {
+      ++j;
+      synchronized(obj) {
+        if (obj.hashCode() != all.get(obj)) {
+          throw new AssertionError("Failed hashcode test!");
+        }
+      }
+    }
+    System.out.println("Finished second check");
+    System.out.println("Total checks: " + j);
+  }
+
+  private static native void trim();
+
+  private static native int monitorListSize();
+}
diff --git a/test/633-checker-rtp-getclass/expected.txt b/test/633-checker-rtp-getclass/expected.txt
new file mode 100644
index 0000000..a178d04
--- /dev/null
+++ b/test/633-checker-rtp-getclass/expected.txt
@@ -0,0 +1,3 @@
+2
+3
+6
diff --git a/test/633-checker-rtp-getclass/info.txt b/test/633-checker-rtp-getclass/info.txt
new file mode 100644
index 0000000..e98a0ac
--- /dev/null
+++ b/test/633-checker-rtp-getclass/info.txt
@@ -0,0 +1,3 @@
+Regression test for the RTP pass of the compiler, which
+used the wrong block when bounding a type after a obj.getClass()
+check.
diff --git a/test/633-checker-rtp-getclass/src/Main.java b/test/633-checker-rtp-getclass/src/Main.java
new file mode 100644
index 0000000..f29c139
--- /dev/null
+++ b/test/633-checker-rtp-getclass/src/Main.java
@@ -0,0 +1,76 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Main {
+  public static void main(String[] args) {
+    System.out.println($opt$noinline$foo(new Main()));
+    System.out.println($opt$noinline$foo(new SubMain()));
+    System.out.println($opt$noinline$foo(new SubSubMain()));
+  }
+
+
+  // Checker test to make sure the only inlined instruction is
+  // SubMain.bar.
+  /// CHECK-START: int Main.$opt$noinline$foo(Main) inliner (after)
+  /// CHECK-DAG:                InvokeVirtual method_name:Main.foo
+  /// CHECK-DAG: <<Const:i\d+>> IntConstant 3
+  /// CHECK:                    begin_block
+  /// CHECK:                    BoundType klass:SubMain
+  /// CHECK:                    Return [<<Const>>]
+  /// CHECK-NOT:                begin_block
+  /// CHECK:                    end_block
+  public static int $opt$noinline$foo(Main o) {
+    if (doThrow) { throw new Error(); }
+    // To exercise the bug on Jack, we need two getClass compares.
+    if (o.getClass() == Main.class || o.getClass() != SubMain.class) {
+      return o.foo();
+    } else {
+      // We used to wrongly bound the type of o to `Main` here and then realize that's
+      // impossible and mark this branch as dead.
+      return o.bar();
+    }
+  }
+
+  public int bar() {
+    return 1;
+  }
+
+  public int foo() {
+    return 2;
+  }
+
+  public static boolean doThrow = false;
+}
+
+class SubMain extends Main {
+  public int bar() {
+    return 3;
+  }
+
+  public int foo() {
+    return 4;
+  }
+}
+
+class SubSubMain extends SubMain {
+  public int bar() {
+    return 5;
+  }
+
+  public int foo() {
+    return 6;
+  }
+}
diff --git a/test/634-vdex-duplicate/expected.txt b/test/634-vdex-duplicate/expected.txt
new file mode 100644
index 0000000..557db03
--- /dev/null
+++ b/test/634-vdex-duplicate/expected.txt
@@ -0,0 +1 @@
+Hello World
diff --git a/test/634-vdex-duplicate/info.txt b/test/634-vdex-duplicate/info.txt
new file mode 100644
index 0000000..e69de29
--- /dev/null
+++ b/test/634-vdex-duplicate/info.txt
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/634-vdex-duplicate/run
old mode 100755
new mode 100644
similarity index 71%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/634-vdex-duplicate/run
index a9f1822..1ccb841
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/634-vdex-duplicate/run
@@ -1,12 +1,12 @@
 #!/bin/bash
 #
-# Copyright 2016 The Android Open Source Project
+# Copyright (C) 2016 The Android Open Source Project
 #
 # Licensed under the Apache License, Version 2.0 (the "License");
 # you may not use this file except in compliance with the License.
 # You may obtain a copy of the License at
 #
-#      http://www.apache.org/licenses/LICENSE-2.0
+#     http://www.apache.org/licenses/LICENSE-2.0
 #
 # Unless required by applicable law or agreed to in writing, software
 # distributed under the License is distributed on an "AS IS" BASIS,
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+exec ${RUN} -Xcompiler-option --compiler-filter=verify-profile --vdex-filter speed --vdex "${@}"
diff --git a/test/634-vdex-duplicate/src/Main.java b/test/634-vdex-duplicate/src/Main.java
new file mode 100644
index 0000000..2283106
--- /dev/null
+++ b/test/634-vdex-duplicate/src/Main.java
@@ -0,0 +1,21 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Main {
+  public static void main(String[] args) {
+    System.out.println("Hello World");
+  }
+}
diff --git a/test/634-vdex-duplicate/src/sun/misc/Unsafe.java b/test/634-vdex-duplicate/src/sun/misc/Unsafe.java
new file mode 100644
index 0000000..c32868c
--- /dev/null
+++ b/test/634-vdex-duplicate/src/sun/misc/Unsafe.java
@@ -0,0 +1,20 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+package sun.misc;
+
+public class Unsafe {
+}
diff --git a/test/900-hello-plugin/run b/test/900-hello-plugin/run
index 35b0871..50835f8 100755
--- a/test/900-hello-plugin/run
+++ b/test/900-hello-plugin/run
@@ -18,7 +18,5 @@
 if  [[ "$@" == *"-O"* ]]; then
   plugin=libartagent.so
 fi
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --runtime-option -agentpath:${plugin}=test_900 \
+./default-run "$@" --runtime-option -agentpath:${plugin}=test_900 \
                    --android-runtime-option -Xplugin:${plugin}
diff --git a/test/901-hello-ti-agent/basics.cc b/test/901-hello-ti-agent/basics.cc
index 3a475c6..0b17656 100644
--- a/test/901-hello-ti-agent/basics.cc
+++ b/test/901-hello-ti-agent/basics.cc
@@ -22,9 +22,52 @@
 #include "base/macros.h"
 #include "openjdkjvmti/jvmti.h"
 
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
 namespace art {
 namespace Test901HelloTi {
 
+static void EnableEvent(jvmtiEnv* env, jvmtiEvent evt) {
+  jvmtiError error = env->SetEventNotificationMode(JVMTI_ENABLE, evt, nullptr);
+  if (error != JVMTI_ERROR_NONE) {
+    printf("Failed to enable event");
+  }
+}
+
+static void JNICALL VMStartCallback(jvmtiEnv *jenv ATTRIBUTE_UNUSED,
+                                     JNIEnv* jni_env ATTRIBUTE_UNUSED) {
+  printf("VMStart\n");
+}
+
+static void JNICALL VMInitCallback(jvmtiEnv *jvmti_env ATTRIBUTE_UNUSED,
+                                   JNIEnv* jni_env ATTRIBUTE_UNUSED,
+                                   jthread thread ATTRIBUTE_UNUSED) {
+  printf("VMInit\n");
+}
+
+static void JNICALL VMDeatchCallback(jvmtiEnv *jenv ATTRIBUTE_UNUSED,
+                                     JNIEnv* jni_env ATTRIBUTE_UNUSED) {
+  printf("VMDeath\n");
+}
+
+
+static void InstallVMEvents(jvmtiEnv* env) {
+  jvmtiEventCallbacks callbacks;
+  memset(&callbacks, 0, sizeof(jvmtiEventCallbacks));
+  callbacks.VMStart = VMStartCallback;
+  callbacks.VMInit = VMInitCallback;
+  callbacks.VMDeath = VMDeatchCallback;
+  jvmtiError ret = env->SetEventCallbacks(&callbacks, sizeof(callbacks));
+  if (ret != JVMTI_ERROR_NONE) {
+    printf("Failed to install callbacks");
+  }
+
+  EnableEvent(env, JVMTI_EVENT_VM_START);
+  EnableEvent(env, JVMTI_EVENT_VM_INIT);
+  EnableEvent(env, JVMTI_EVENT_VM_DEATH);
+}
+
 jint OnLoad(JavaVM* vm,
             char* options ATTRIBUTE_UNUSED,
             void* reserved ATTRIBUTE_UNUSED) {
@@ -69,12 +112,52 @@
     printf("Unexpected version number!\n");
     return -1;
   }
+
+  InstallVMEvents(env);
+  InstallVMEvents(env2);
+
   CHECK_CALL_SUCCESS(env->DisposeEnvironment());
   CHECK_CALL_SUCCESS(env2->DisposeEnvironment());
 #undef CHECK_CALL_SUCCESS
+
+  if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+    printf("Unable to get jvmti env!\n");
+    return 1;
+  }
+  SetAllCapabilities(jvmti_env);
+
+  jvmtiPhase current_phase;
+  jvmtiError phase_result = jvmti_env->GetPhase(&current_phase);
+  if (phase_result != JVMTI_ERROR_NONE) {
+    printf("Could not get phase");
+    return 1;
+  }
+  if (current_phase != JVMTI_PHASE_ONLOAD) {
+    printf("Wrong phase");
+    return 1;
+  }
+
+  InstallVMEvents(jvmti_env);
+
   return JNI_OK;
 }
 
+extern "C" JNIEXPORT void JNICALL Java_Main_setVerboseFlag(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jint iflag, jboolean val) {
+  jvmtiVerboseFlag flag = static_cast<jvmtiVerboseFlag>(iflag);
+  jvmtiError result = jvmti_env->SetVerboseFlag(flag, val);
+  JvmtiErrorToException(env, result);
+}
+
+extern "C" JNIEXPORT jboolean JNICALL Java_Main_checkLivePhase(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+  jvmtiPhase current_phase;
+  jvmtiError phase_result = jvmti_env->GetPhase(&current_phase);
+  if (JvmtiErrorToException(env, phase_result)) {
+    return JNI_FALSE;
+  }
+  return (current_phase == JVMTI_PHASE_LIVE) ? JNI_TRUE : JNI_FALSE;
+}
 
 }  // namespace Test901HelloTi
 }  // namespace art
diff --git a/test/901-hello-ti-agent/expected.txt b/test/901-hello-ti-agent/expected.txt
index 414eb3b..c4b24cb 100644
--- a/test/901-hello-ti-agent/expected.txt
+++ b/test/901-hello-ti-agent/expected.txt
@@ -1,2 +1,12 @@
 Loaded Agent for test 901-hello-ti-agent
+VMStart
+VMInit
 Hello, world!
+Agent in live phase.
+0
+1
+2
+4
+8
+JVMTI_ERROR_ILLEGAL_ARGUMENT
+VMDeath
diff --git a/test/901-hello-ti-agent/run b/test/901-hello-ti-agent/run
index 4379349..c6e62ae 100755
--- a/test/901-hello-ti-agent/run
+++ b/test/901-hello-ti-agent/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/901-hello-ti-agent/src/Main.java b/test/901-hello-ti-agent/src/Main.java
index 1ef6289..4d62ed3 100644
--- a/test/901-hello-ti-agent/src/Main.java
+++ b/test/901-hello-ti-agent/src/Main.java
@@ -17,5 +17,28 @@
 public class Main {
   public static void main(String[] args) {
     System.out.println("Hello, world!");
+
+    if (checkLivePhase()) {
+      System.out.println("Agent in live phase.");
+    }
+
+    set(0);  // OTHER
+    set(1);  // GC
+    set(2);  // CLASS
+    set(4);  // JNI
+    set(8);  // Error.
   }
+
+  private static void set(int i) {
+    System.out.println(i);
+    try {
+      setVerboseFlag(i, true);
+      setVerboseFlag(i, false);
+    } catch (RuntimeException e) {
+      System.out.println(e.getMessage());
+    }
+  }
+
+  private static native boolean checkLivePhase();
+  private static native void setVerboseFlag(int flag, boolean value);
 }
diff --git a/test/902-hello-transformation/run b/test/902-hello-transformation/run
index 4379349..c6e62ae 100755
--- a/test/902-hello-transformation/run
+++ b/test/902-hello-transformation/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/902-hello-transformation/src/Main.java b/test/902-hello-transformation/src/Main.java
index ec47119..471c82b 100644
--- a/test/902-hello-transformation/src/Main.java
+++ b/test/902-hello-transformation/src/Main.java
@@ -49,7 +49,6 @@
     "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
 
   public static void main(String[] args) {
-    System.loadLibrary(args[1]);
     doTest(new Transform());
   }
 
diff --git a/test/903-hello-tagging/run b/test/903-hello-tagging/run
index 4379349..c6e62ae 100755
--- a/test/903-hello-tagging/run
+++ b/test/903-hello-tagging/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/903-hello-tagging/src/Main.java b/test/903-hello-tagging/src/Main.java
index a8aedb4..2f0365a 100644
--- a/test/903-hello-tagging/src/Main.java
+++ b/test/903-hello-tagging/src/Main.java
@@ -20,7 +20,6 @@
 
 public class Main {
   public static void main(String[] args) {
-    System.loadLibrary(args[1]);
     doTest();
     testGetTaggedObjects();
   }
diff --git a/test/904-object-allocation/run b/test/904-object-allocation/run
index 4379349..c6e62ae 100755
--- a/test/904-object-allocation/run
+++ b/test/904-object-allocation/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/904-object-allocation/src/Main.java b/test/904-object-allocation/src/Main.java
index fc8a112..df59179 100644
--- a/test/904-object-allocation/src/Main.java
+++ b/test/904-object-allocation/src/Main.java
@@ -18,8 +18,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     // Use a list to ensure objects must be allocated.
     ArrayList<Object> l = new ArrayList<>(100);
 
diff --git a/test/905-object-free/run b/test/905-object-free/run
index 4379349..c6e62ae 100755
--- a/test/905-object-free/run
+++ b/test/905-object-free/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/905-object-free/src/Main.java b/test/905-object-free/src/Main.java
index 16dec5d..e41e378 100644
--- a/test/905-object-free/src/Main.java
+++ b/test/905-object-free/src/Main.java
@@ -19,8 +19,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
   }
 
diff --git a/test/906-iterate-heap/run b/test/906-iterate-heap/run
index 4379349..c6e62ae 100755
--- a/test/906-iterate-heap/run
+++ b/test/906-iterate-heap/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/906-iterate-heap/src/Main.java b/test/906-iterate-heap/src/Main.java
index 544a365..cab27be 100644
--- a/test/906-iterate-heap/src/Main.java
+++ b/test/906-iterate-heap/src/Main.java
@@ -19,8 +19,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
   }
 
diff --git a/test/907-get-loaded-classes/run b/test/907-get-loaded-classes/run
index 4379349..c6e62ae 100755
--- a/test/907-get-loaded-classes/run
+++ b/test/907-get-loaded-classes/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/907-get-loaded-classes/src/Main.java b/test/907-get-loaded-classes/src/Main.java
index 468d037..370185a 100644
--- a/test/907-get-loaded-classes/src/Main.java
+++ b/test/907-get-loaded-classes/src/Main.java
@@ -20,8 +20,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
   }
 
diff --git a/test/908-gc-start-finish/run b/test/908-gc-start-finish/run
index 4379349..c6e62ae 100755
--- a/test/908-gc-start-finish/run
+++ b/test/908-gc-start-finish/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/908-gc-start-finish/src/Main.java b/test/908-gc-start-finish/src/Main.java
index 2be0eea..05388c9 100644
--- a/test/908-gc-start-finish/src/Main.java
+++ b/test/908-gc-start-finish/src/Main.java
@@ -18,8 +18,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
   }
 
diff --git a/test/909-attach-agent/run b/test/909-attach-agent/run
index 985341b..0664592 100755
--- a/test/909-attach-agent/run
+++ b/test/909-attach-agent/run
@@ -21,17 +21,11 @@
   plugin=libopenjdkjvmti.so
 fi
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --android-runtime-option -Xplugin:${plugin} \
+./default-run "$@" --android-runtime-option -Xplugin:${plugin} \
                    --android-runtime-option -Xfully-deoptable \
                    --args agent:${agent}=909-attach-agent
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --android-runtime-option -Xfully-deoptable \
+./default-run "$@" --android-runtime-option -Xfully-deoptable \
                    --args agent:${agent}=909-attach-agent
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --args agent:${agent}=909-attach-agent
+./default-run "$@" --args agent:${agent}=909-attach-agent
diff --git a/test/910-methods/run b/test/910-methods/run
index 4379349..c6e62ae 100755
--- a/test/910-methods/run
+++ b/test/910-methods/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/910-methods/src/Main.java b/test/910-methods/src/Main.java
index bf25a0d..932a1ea 100644
--- a/test/910-methods/src/Main.java
+++ b/test/910-methods/src/Main.java
@@ -20,8 +20,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
   }
 
diff --git a/test/911-get-stack-trace/expected.txt b/test/911-get-stack-trace/expected.txt
index dad08c9..2687f85 100644
--- a/test/911-get-stack-trace/expected.txt
+++ b/test/911-get-stack-trace/expected.txt
@@ -22,7 +22,7 @@
  bar (IIILControlData;)J 0 24
  foo (IIILControlData;)I 0 19
  doTest ()V 38 23
- main ([Ljava/lang/String;)V 6 21
+ main ([Ljava/lang/String;)V 3 21
 ---------
  print (Ljava/lang/Thread;II)V 0 34
  printOrWait (IILControlData;)V 6 39
@@ -42,7 +42,7 @@
  bar (IIILControlData;)J 0 24
  foo (IIILControlData;)I 0 19
  doTest ()V 42 24
- main ([Ljava/lang/String;)V 6 21
+ main ([Ljava/lang/String;)V 3 21
 ---------
  getStackTrace (Ljava/lang/Thread;II)[[Ljava/lang/String; -1 -2
  print (Ljava/lang/Thread;II)V 0 34
@@ -57,13 +57,13 @@
  baz (IIILControlData;)Ljava/lang/Object; 9 32
 From bottom
 ---------
- main ([Ljava/lang/String;)V 6 21
+ main ([Ljava/lang/String;)V 3 21
 ---------
  baz (IIILControlData;)Ljava/lang/Object; 9 32
  bar (IIILControlData;)J 0 24
  foo (IIILControlData;)I 0 19
  doTest ()V 65 30
- main ([Ljava/lang/String;)V 6 21
+ main ([Ljava/lang/String;)V 3 21
 ---------
  bar (IIILControlData;)J 0 24
  foo (IIILControlData;)I 0 19
@@ -358,7 +358,7 @@
  getAllStackTraces (I)[[Ljava/lang/Object; -1 -2
  printAll (I)V 0 73
  doTest ()V 102 57
- main ([Ljava/lang/String;)V 30 33
+ main ([Ljava/lang/String;)V 27 33
 
 ---------
 FinalizerDaemon
@@ -590,7 +590,7 @@
  getAllStackTraces (I)[[Ljava/lang/Object; -1 -2
  printAll (I)V 0 73
  doTest ()V 107 59
- main ([Ljava/lang/String;)V 30 33
+ main ([Ljava/lang/String;)V 27 33
 
 
 ########################################
@@ -659,7 +659,7 @@
  getThreadListStackTraces ([Ljava/lang/Thread;I)[[Ljava/lang/Object; -1 -2
  printList ([Ljava/lang/Thread;I)V 0 66
  doTest ()V 96 52
- main ([Ljava/lang/String;)V 38 37
+ main ([Ljava/lang/String;)V 35 37
 
 ---------
 Thread-14
@@ -771,7 +771,7 @@
  getThreadListStackTraces ([Ljava/lang/Thread;I)[[Ljava/lang/Object; -1 -2
  printList ([Ljava/lang/Thread;I)V 0 66
  doTest ()V 101 54
- main ([Ljava/lang/String;)V 38 37
+ main ([Ljava/lang/String;)V 35 37
 
 
 ###################
@@ -782,7 +782,7 @@
 [public static native java.lang.Object[] Frames.getFrameLocation(java.lang.Thread,int), ffffffff]
 [public static void Frames.doTestSameThread(), 38]
 [public static void Frames.doTest() throws java.lang.Exception, 0]
-[public static void Main.main(java.lang.String[]) throws java.lang.Exception, 2e]
+[public static void Main.main(java.lang.String[]) throws java.lang.Exception, 2b]
 JVMTI_ERROR_NO_MORE_FRAMES
 
 ################################
diff --git a/test/911-get-stack-trace/run b/test/911-get-stack-trace/run
index 4379349..c6e62ae 100755
--- a/test/911-get-stack-trace/run
+++ b/test/911-get-stack-trace/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/911-get-stack-trace/src/Main.java b/test/911-get-stack-trace/src/Main.java
index b199033..96a427d 100644
--- a/test/911-get-stack-trace/src/Main.java
+++ b/test/911-get-stack-trace/src/Main.java
@@ -16,7 +16,7 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
+    bindTest911Classes();
 
     SameThread.doTest();
 
@@ -42,4 +42,6 @@
 
     System.out.println("Done");
   }
+
+  private static native void bindTest911Classes();
 }
diff --git a/test/911-get-stack-trace/stack_trace.cc b/test/911-get-stack-trace/stack_trace.cc
index d162e8a..68f6d8d 100644
--- a/test/911-get-stack-trace/stack_trace.cc
+++ b/test/911-get-stack-trace/stack_trace.cc
@@ -34,6 +34,14 @@
 
 using android::base::StringPrintf;
 
+extern "C" JNIEXPORT void JNICALL Java_Main_bindTest911Classes(
+    JNIEnv* env, jclass klass ATTRIBUTE_UNUSED) {
+  BindFunctions(jvmti_env, env, "AllTraces");
+  BindFunctions(jvmti_env, env, "Frames");
+  BindFunctions(jvmti_env, env, "PrintThread");
+  BindFunctions(jvmti_env, env, "ThreadListTraces");
+}
+
 static jint FindLineNumber(jint line_number_count,
                            jvmtiLineNumberEntry* line_number_table,
                            jlocation location) {
diff --git a/test/912-classes/classes.cc b/test/912-classes/classes.cc
index 69301c7..d13436e 100644
--- a/test/912-classes/classes.cc
+++ b/test/912-classes/classes.cc
@@ -20,6 +20,7 @@
 #include "jni.h"
 #include "openjdkjvmti/jvmti.h"
 #include "ScopedLocalRef.h"
+#include "thread-inl.h"
 
 #include "ti-agent/common_helper.h"
 #include "ti-agent/common_load.h"
@@ -222,5 +223,157 @@
   return classloader;
 }
 
+extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getClassLoaderClasses(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jobject jclassloader) {
+  jint count = 0;
+  jclass* classes = nullptr;
+  jvmtiError result = jvmti_env->GetClassLoaderClasses(jclassloader, &count, &classes);
+  if (JvmtiErrorToException(env, result)) {
+    return nullptr;
+  }
+
+  auto callback = [&](jint i) {
+    return classes[i];
+  };
+  jobjectArray ret = CreateObjectArray(env, count, "java/lang/Class", callback);
+  if (classes != nullptr) {
+    jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(classes));
+  }
+  return ret;
+}
+
+extern "C" JNIEXPORT jintArray JNICALL Java_Main_getClassVersion(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jclass klass) {
+  jint major, minor;
+  jvmtiError result = jvmti_env->GetClassVersionNumbers(klass, &minor, &major);
+  if (JvmtiErrorToException(env, result)) {
+    return nullptr;
+  }
+
+  jintArray int_array = env->NewIntArray(2);
+  if (int_array == nullptr) {
+    return nullptr;
+  }
+  jint buf[2] = { major, minor };
+  env->SetIntArrayRegion(int_array, 0, 2, buf);
+
+  return int_array;
+}
+
+static std::string GetClassName(jvmtiEnv* jenv, JNIEnv* jni_env, jclass klass) {
+  char* name;
+  jvmtiError result = jenv->GetClassSignature(klass, &name, nullptr);
+  if (result != JVMTI_ERROR_NONE) {
+    if (jni_env != nullptr) {
+      JvmtiErrorToException(jni_env, result);
+    } else {
+      printf("Failed to get class signature.\n");
+    }
+    return "";
+  }
+
+  std::string tmp(name);
+  jenv->Deallocate(reinterpret_cast<unsigned char*>(name));
+
+  return tmp;
+}
+
+static std::string GetThreadName(jvmtiEnv* jenv, JNIEnv* jni_env, jthread thread) {
+  jvmtiThreadInfo info;
+  jvmtiError result = jenv->GetThreadInfo(thread, &info);
+  if (result != JVMTI_ERROR_NONE) {
+    if (jni_env != nullptr) {
+      JvmtiErrorToException(jni_env, result);
+    } else {
+      printf("Failed to get thread name.\n");
+    }
+    return "";
+  }
+
+  std::string tmp(info.name);
+  jenv->Deallocate(reinterpret_cast<unsigned char*>(info.name));
+  jni_env->DeleteLocalRef(info.context_class_loader);
+  jni_env->DeleteLocalRef(info.thread_group);
+
+  return tmp;
+}
+
+static std::string GetThreadName(Thread* thread) {
+  std::string tmp;
+  thread->GetThreadName(tmp);
+  return tmp;
+}
+
+static void JNICALL ClassPrepareCallback(jvmtiEnv* jenv,
+                                         JNIEnv* jni_env,
+                                         jthread thread,
+                                         jclass klass) {
+  std::string name = GetClassName(jenv, jni_env, klass);
+  if (name == "") {
+    return;
+  }
+  std::string thread_name = GetThreadName(jenv, jni_env, thread);
+  if (thread_name == "") {
+    return;
+  }
+  std::string cur_thread_name = GetThreadName(Thread::Current());
+  printf("Prepare: %s on %s (cur=%s)\n",
+         name.c_str(),
+         thread_name.c_str(),
+         cur_thread_name.c_str());
+}
+
+static void JNICALL ClassLoadCallback(jvmtiEnv* jenv,
+                                      JNIEnv* jni_env,
+                                      jthread thread,
+                                      jclass klass) {
+  std::string name = GetClassName(jenv, jni_env, klass);
+  if (name == "") {
+    return;
+  }
+  std::string thread_name = GetThreadName(jenv, jni_env, thread);
+  if (thread_name == "") {
+    return;
+  }
+  printf("Load: %s on %s\n", name.c_str(), thread_name.c_str());
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_enableClassLoadEvents(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jboolean b) {
+  if (b == JNI_FALSE) {
+    jvmtiError ret = jvmti_env->SetEventNotificationMode(JVMTI_DISABLE,
+                                                         JVMTI_EVENT_CLASS_LOAD,
+                                                         nullptr);
+    if (JvmtiErrorToException(env, ret)) {
+      return;
+    }
+    ret = jvmti_env->SetEventNotificationMode(JVMTI_DISABLE,
+                                              JVMTI_EVENT_CLASS_PREPARE,
+                                              nullptr);
+    JvmtiErrorToException(env, ret);
+    return;
+  }
+
+  jvmtiEventCallbacks callbacks;
+  memset(&callbacks, 0, sizeof(jvmtiEventCallbacks));
+  callbacks.ClassLoad = ClassLoadCallback;
+  callbacks.ClassPrepare = ClassPrepareCallback;
+  jvmtiError ret = jvmti_env->SetEventCallbacks(&callbacks, sizeof(callbacks));
+  if (JvmtiErrorToException(env, ret)) {
+    return;
+  }
+
+  ret = jvmti_env->SetEventNotificationMode(JVMTI_ENABLE,
+                                            JVMTI_EVENT_CLASS_LOAD,
+                                            nullptr);
+  if (JvmtiErrorToException(env, ret)) {
+    return;
+  }
+  ret = jvmti_env->SetEventNotificationMode(JVMTI_ENABLE,
+                                            JVMTI_EVENT_CLASS_PREPARE,
+                                            nullptr);
+  JvmtiErrorToException(env, ret);
+}
+
 }  // namespace Test912Classes
 }  // namespace art
diff --git a/test/912-classes/expected.txt b/test/912-classes/expected.txt
index 44c861a..328216b 100644
--- a/test/912-classes/expected.txt
+++ b/test/912-classes/expected.txt
@@ -29,7 +29,7 @@
 class [Ljava.lang.String; 10000
 class java.lang.Object 111
 class Main$TestForNonInit 11
-class Main$TestForInitFail 1001
+class Main$TestForInitFail 1011
 int []
 class [Ljava.lang.String; []
 class java.lang.Object []
@@ -43,3 +43,51 @@
 class [Ljava.lang.String; null
 interface Main$InfA dalvik.system.PathClassLoader
 class $Proxy0 dalvik.system.PathClassLoader
+
+boot <- src <- src-ex (A,B)
+912-classes-ex.jar+ -> 912-classes.jar+ -> 
+[class A, class B, class java.lang.Object]
+912-classes.jar+ -> 
+[class B, class java.lang.Object]
+
+boot <- src (B) <- src-ex (A, List)
+912-classes-ex.jar+ -> 912-classes.jar+ -> 
+[class A, class java.lang.Object, interface java.util.List]
+912-classes.jar+ -> 
+[class B, class java.lang.Object]
+
+boot <- src+src-ex (A,B)
+912-classes.jar+ -> 
+[class A, class B, class java.lang.Object]
+
+[37, 0]
+
+B, false
+Load: LB; on main
+Prepare: LB; on main (cur=main)
+B, true
+Load: LB; on main
+Prepare: LB; on main (cur=main)
+C, false
+Load: LA; on main
+Prepare: LA; on main (cur=main)
+Load: LC; on main
+Prepare: LC; on main (cur=main)
+A, false
+C, true
+Load: LA; on main
+Prepare: LA; on main (cur=main)
+Load: LC; on main
+Prepare: LC; on main (cur=main)
+A, true
+A, true
+Load: LA; on main
+Prepare: LA; on main (cur=main)
+C, true
+Load: LC; on main
+Prepare: LC; on main (cur=main)
+C, true
+Load: LA; on TestRunner
+Prepare: LA; on TestRunner (cur=TestRunner)
+Load: LC; on TestRunner
+Prepare: LC; on TestRunner (cur=TestRunner)
diff --git a/test/912-classes/run b/test/912-classes/run
index 4379349..f24db40 100755
--- a/test/912-classes/run
+++ b/test/912-classes/run
@@ -14,6 +14,9 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+# This test checks which classes are initiated by a classloader. App images preload classes.
+# In certain configurations, the app images may be valid even in a new classloader. Turn off
+# app images to avoid the issue.
+
+./default-run "$@" --jvmti \
+                   --no-app-image
diff --git a/test/912-classes/src-ex/A.java b/test/912-classes/src-ex/A.java
new file mode 100644
index 0000000..2c43cfb
--- /dev/null
+++ b/test/912-classes/src-ex/A.java
@@ -0,0 +1,18 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class A {
+}
diff --git a/test/912-classes/src-ex/C.java b/test/912-classes/src-ex/C.java
new file mode 100644
index 0000000..97f8021
--- /dev/null
+++ b/test/912-classes/src-ex/C.java
@@ -0,0 +1,18 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class C extends A {
+}
diff --git a/test/912-classes/src/B.java b/test/912-classes/src/B.java
new file mode 100644
index 0000000..52ce4dd
--- /dev/null
+++ b/test/912-classes/src/B.java
@@ -0,0 +1,18 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class B {
+}
diff --git a/test/912-classes/src/Main.java b/test/912-classes/src/Main.java
index e627d42..6ad23a4 100644
--- a/test/912-classes/src/Main.java
+++ b/test/912-classes/src/Main.java
@@ -14,13 +14,13 @@
  * limitations under the License.
  */
 
+import java.lang.reflect.Constructor;
 import java.lang.reflect.Proxy;
 import java.util.Arrays;
+import java.util.Comparator;
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
   }
 
@@ -76,6 +76,16 @@
     testClassLoader(String[].class);
     testClassLoader(InfA.class);
     testClassLoader(getProxyClass());
+
+    testClassLoaderClasses();
+
+    System.out.println();
+
+    testClassVersion();
+
+    System.out.println();
+
+    testClassEvents();
   }
 
   private static Class<?> proxyClass = null;
@@ -151,6 +161,160 @@
     }
   }
 
+  private static void testClassLoaderClasses() throws Exception {
+    ClassLoader boot = ClassLoader.getSystemClassLoader().getParent();
+    while (boot.getParent() != null) {
+      boot = boot.getParent();
+    }
+
+    System.out.println();
+    System.out.println("boot <- src <- src-ex (A,B)");
+    ClassLoader cl1 = create(create(boot, DEX1), DEX2);
+    Class.forName("B", false, cl1);
+    Class.forName("A", false, cl1);
+    printClassLoaderClasses(cl1);
+
+    System.out.println();
+    System.out.println("boot <- src (B) <- src-ex (A, List)");
+    ClassLoader cl2 = create(create(boot, DEX1), DEX2);
+    Class.forName("A", false, cl2);
+    Class.forName("java.util.List", false, cl2);
+    Class.forName("B", false, cl2.getParent());
+    printClassLoaderClasses(cl2);
+
+    System.out.println();
+    System.out.println("boot <- src+src-ex (A,B)");
+    ClassLoader cl3 = create(boot, DEX1, DEX2);
+    Class.forName("B", false, cl3);
+    Class.forName("A", false, cl3);
+    printClassLoaderClasses(cl3);
+
+    // Check that the boot classloader dumps something non-empty.
+    Class<?>[] bootClasses = getClassLoaderClasses(boot);
+    if (bootClasses.length == 0) {
+      throw new RuntimeException("No classes initiated by boot classloader.");
+    }
+    // Check that at least java.util.List is loaded.
+    boolean foundList = false;
+    for (Class<?> c : bootClasses) {
+      if (c == java.util.List.class) {
+        foundList = true;
+        break;
+      }
+    }
+    if (!foundList) {
+      System.out.println(Arrays.toString(bootClasses));
+      throw new RuntimeException("Could not find class java.util.List.");
+    }
+  }
+
+  private static void testClassVersion() {
+    System.out.println(Arrays.toString(getClassVersion(Main.class)));
+  }
+
+  private static void testClassEvents() throws Exception {
+    ClassLoader cl = Main.class.getClassLoader();
+    while (cl.getParent() != null) {
+      cl = cl.getParent();
+    }
+    final ClassLoader boot = cl;
+
+    Runnable r = new Runnable() {
+      @Override
+      public void run() {
+        try {
+          ClassLoader cl6 = create(boot, DEX1, DEX2);
+          System.out.println("C, true");
+          Class.forName("C", true, cl6);
+        } catch (Exception e) {
+          throw new RuntimeException(e);
+        }
+      }
+    };
+
+    Thread dummyThread = new Thread();
+    dummyThread.start();
+    dummyThread.join();
+
+    ensureJitCompiled(Main.class, "testClassEvents");
+
+    enableClassLoadEvents(true);
+
+    ClassLoader cl1 = create(boot, DEX1, DEX2);
+    System.out.println("B, false");
+    Class.forName("B", false, cl1);
+
+    ClassLoader cl2 = create(boot, DEX1, DEX2);
+    System.out.println("B, true");
+    Class.forName("B", true, cl2);
+
+    ClassLoader cl3 = create(boot, DEX1, DEX2);
+    System.out.println("C, false");
+    Class.forName("C", false, cl3);
+    System.out.println("A, false");
+    Class.forName("A", false, cl3);
+
+    ClassLoader cl4 = create(boot, DEX1, DEX2);
+    System.out.println("C, true");
+    Class.forName("C", true, cl4);
+    System.out.println("A, true");
+    Class.forName("A", true, cl4);
+
+    ClassLoader cl5 = create(boot, DEX1, DEX2);
+    System.out.println("A, true");
+    Class.forName("A", true, cl5);
+    System.out.println("C, true");
+    Class.forName("C", true, cl5);
+
+    Thread t = new Thread(r, "TestRunner");
+    t.start();
+    t.join();
+
+    enableClassLoadEvents(false);
+  }
+
+  private static void printClassLoaderClasses(ClassLoader cl) {
+    for (;;) {
+      if (cl == null || !cl.getClass().getName().startsWith("dalvik.system")) {
+        break;
+      }
+
+      ClassLoader saved = cl;
+      for (;;) {
+        if (cl == null || !cl.getClass().getName().startsWith("dalvik.system")) {
+          break;
+        }
+        String s = cl.toString();
+        int index1 = s.indexOf("zip file");
+        int index2 = s.indexOf(']', index1);
+        if (index2 < 0) {
+          throw new RuntimeException("Unexpected classloader " + s);
+        }
+        String zip_file = s.substring(index1, index2);
+        int index3 = zip_file.indexOf('"');
+        int index4 = zip_file.indexOf('"', index3 + 1);
+        if (index4 < 0) {
+          throw new RuntimeException("Unexpected classloader " + s);
+        }
+        String paths = zip_file.substring(index3 + 1, index4);
+        String pathArray[] = paths.split(":");
+        for (String path : pathArray) {
+          int index5 = path.lastIndexOf('/');
+          System.out.print(path.substring(index5 + 1));
+          System.out.print('+');
+        }
+        System.out.print(" -> ");
+        cl = cl.getParent();
+      }
+      System.out.println();
+      Class<?> classes[] = getClassLoaderClasses(saved);
+      Arrays.sort(classes, new ClassNameComparator());
+      System.out.println(Arrays.toString(classes));
+
+      cl = saved.getParent();
+    }
+  }
+
   private static native boolean isModifiableClass(Class<?> c);
   private static native String[] getClassSignature(Class<?> c);
 
@@ -161,12 +325,20 @@
 
   private static native Object[] getClassFields(Class<?> c);
   private static native Object[] getClassMethods(Class<?> c);
-  private static native Class[] getImplementedInterfaces(Class<?> c);
+  private static native Class<?>[] getImplementedInterfaces(Class<?> c);
 
   private static native int getClassStatus(Class<?> c);
 
   private static native Object getClassLoader(Class<?> c);
 
+  private static native Class<?>[] getClassLoaderClasses(ClassLoader cl);
+
+  private static native int[] getClassVersion(Class<?> c);
+
+  private static native void enableClassLoadEvents(boolean b);
+
+  private static native void ensureJitCompiled(Class c, String name);
+
   private static class TestForNonInit {
     public static double dummy = Math.random();  // So it can't be compile-time initialized.
   }
@@ -188,4 +360,23 @@
   }
   public abstract static class ClassC implements InfA, InfC {
   }
+
+  private static final String DEX1 = System.getenv("DEX_LOCATION") + "/912-classes.jar";
+  private static final String DEX2 = System.getenv("DEX_LOCATION") + "/912-classes-ex.jar";
+
+  private static ClassLoader create(ClassLoader parent, String... elements) throws Exception {
+    // Note: We use a PathClassLoader, as we do not care about code performance. We only load
+    //       the classes, and they're empty.
+    Class<?> pathClassLoaderClass = Class.forName("dalvik.system.PathClassLoader");
+    Constructor<?> pathClassLoaderInit = pathClassLoaderClass.getConstructor(String.class,
+                                                                             ClassLoader.class);
+    String path = String.join(":", elements);
+    return (ClassLoader) pathClassLoaderInit.newInstance(path, parent);
+  }
+
+  private static class ClassNameComparator implements Comparator<Class<?>> {
+    public int compare(Class<?> c1, Class<?> c2) {
+      return c1.getName().compareTo(c2.getName());
+    }
+  }
 }
diff --git a/test/913-heaps/run b/test/913-heaps/run
index 4379349..c6e62ae 100755
--- a/test/913-heaps/run
+++ b/test/913-heaps/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/913-heaps/src/Main.java b/test/913-heaps/src/Main.java
index 564596e..5a11a5b 100644
--- a/test/913-heaps/src/Main.java
+++ b/test/913-heaps/src/Main.java
@@ -21,8 +21,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
     doFollowReferencesTest();
   }
diff --git a/test/914-hello-obsolescence/run b/test/914-hello-obsolescence/run
index 4379349..c6e62ae 100755
--- a/test/914-hello-obsolescence/run
+++ b/test/914-hello-obsolescence/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/914-hello-obsolescence/src/Main.java b/test/914-hello-obsolescence/src/Main.java
index 46266ef..8a14716 100644
--- a/test/914-hello-obsolescence/src/Main.java
+++ b/test/914-hello-obsolescence/src/Main.java
@@ -53,7 +53,6 @@
     "AAACIAAAEQAAAKIBAAADIAAAAgAAAJECAAAAIAAAAQAAAJ8CAAAAEAAAAQAAALACAAA=");
 
   public static void main(String[] args) {
-    System.loadLibrary(args[1]);
     doTest(new Transform());
   }
 
diff --git a/test/915-obsolete-2/run b/test/915-obsolete-2/run
index 4379349..c6e62ae 100755
--- a/test/915-obsolete-2/run
+++ b/test/915-obsolete-2/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/915-obsolete-2/src/Main.java b/test/915-obsolete-2/src/Main.java
index bbeb726..0e3145c 100644
--- a/test/915-obsolete-2/src/Main.java
+++ b/test/915-obsolete-2/src/Main.java
@@ -79,7 +79,6 @@
     "IAAAFwAAAD4CAAADIAAABAAAAAgEAAAAIAAAAQAAACYEAAAAEAAAAQAAADwEAAA=");
 
   public static void main(String[] args) {
-    System.loadLibrary(args[1]);
     doTest(new Transform());
   }
 
diff --git a/test/916-obsolete-jit/run b/test/916-obsolete-jit/run
index 9056211..b6d406f 100755
--- a/test/916-obsolete-jit/run
+++ b/test/916-obsolete-jit/run
@@ -21,7 +21,5 @@
 else
   other_args="--jit"
 fi
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   ${other_args} \
+./default-run "$@" ${other_args} \
                    --jvmti
diff --git a/test/916-obsolete-jit/src/Main.java b/test/916-obsolete-jit/src/Main.java
index 74eb003..1b03200 100644
--- a/test/916-obsolete-jit/src/Main.java
+++ b/test/916-obsolete-jit/src/Main.java
@@ -113,7 +113,6 @@
   }
 
   public static void main(String[] args) {
-    System.loadLibrary(args[1]);
     doTest(new Transform(), new TestWatcher());
   }
 
@@ -157,38 +156,13 @@
         doCommonClassRedefinition(Transform.class, CLASS_BYTES, DEX_BYTES);
       }
     };
-    // This does nothing.
-    Runnable noop = () -> {};
     // This just prints something out to show we are running the Runnable.
     Runnable say_nothing = () -> { w.accept("Not doing anything here"); };
-    // This checks to see if we have jitted the methods we are testing.
-    Runnable check_interpreting = () -> {
-      // TODO remove the second check when we remove the doCall function. We need to check that
-      // both of these functions aren't being interpreted because if sayHi is the test doesn't do
-      // anything and if doCall is then there will be a runtime call right above the sayHi
-      // function preventing sayHi from being deoptimized.
-      interpreting = has_jit && (Main.isInterpretedFunction(say_hi_method, true) ||
-                                 Main.isInterpretedFunction(do_call_method, false));
-    };
     do {
-      w.clear();
-      // Wait for the methods to be jitted
-      long j = 0;
-      do {
-        for (int i = 0; i < 10000; i++) {
-          t.sayHi(noop, w);
-          j++;
-          // Clear so that we won't OOM if we go around a few times.
-          w.clear();
-        }
-        t.sayHi(check_interpreting, w);
-        if (j >= 1000000) {
-          System.out.println("FAIL: Could not make sayHi be Jitted!");
-          return;
-        }
-        j++;
-      } while(interpreting);
-      // Clear output. Now we try for real.
+      // Run ensureJitCompiled here since it might get GCd
+      ensureJitCompiled(Transform.class, "sayHi");
+      ensureJitCompiled(Main.class, "doCall");
+      // Clear output.
       w.clear();
       // Try and redefine.
       t.sayHi(say_nothing, w);
@@ -203,6 +177,8 @@
 
   private static native boolean isInterpretedFunction(Method m, boolean require_deoptimizable);
 
+  private static native void ensureJitCompiled(Class c, String name);
+
   // Transforms the class
   private static native void doCommonClassRedefinition(Class<?> target,
                                                        byte[] classfile,
diff --git a/test/917-fields-transformation/run b/test/917-fields-transformation/run
index 4379349..c6e62ae 100755
--- a/test/917-fields-transformation/run
+++ b/test/917-fields-transformation/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/917-fields-transformation/src/Main.java b/test/917-fields-transformation/src/Main.java
index 5378bb7..632a5c8 100644
--- a/test/917-fields-transformation/src/Main.java
+++ b/test/917-fields-transformation/src/Main.java
@@ -55,7 +55,6 @@
     "AAIgAAAMAAAAXAEAAAMgAAACAAAA4QEAAAAgAAABAAAA8AEAAAAQAAABAAAABAIAAA==");
 
   public static void main(String[] args) {
-    System.loadLibrary(args[1]);
     doTest(new Transform("Hello", "Goodbye"),
            new Transform("start", "end"));
   }
diff --git a/test/918-fields/run b/test/918-fields/run
index 4379349..c6e62ae 100755
--- a/test/918-fields/run
+++ b/test/918-fields/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/918-fields/src/Main.java b/test/918-fields/src/Main.java
index 8af6e7b..3ba535b 100644
--- a/test/918-fields/src/Main.java
+++ b/test/918-fields/src/Main.java
@@ -19,8 +19,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
   }
 
diff --git a/test/919-obsolete-fields/run b/test/919-obsolete-fields/run
index 4379349..c6e62ae 100755
--- a/test/919-obsolete-fields/run
+++ b/test/919-obsolete-fields/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/919-obsolete-fields/src/Main.java b/test/919-obsolete-fields/src/Main.java
index 895c7a3..1d893f1 100644
--- a/test/919-obsolete-fields/src/Main.java
+++ b/test/919-obsolete-fields/src/Main.java
@@ -116,7 +116,6 @@
   }
 
   public static void main(String[] args) {
-    System.loadLibrary(args[1]);
     TestWatcher w = new TestWatcher();
     doTest(new Transform(w), w);
   }
diff --git a/test/920-objects/run b/test/920-objects/run
index 4379349..c6e62ae 100755
--- a/test/920-objects/run
+++ b/test/920-objects/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/921-hello-failure/expected.txt b/test/921-hello-failure/expected.txt
index 1c1d4d9..9615e6b 100644
--- a/test/921-hello-failure/expected.txt
+++ b/test/921-hello-failure/expected.txt
@@ -21,3 +21,11 @@
 Transformation error : java.lang.Exception(Failed to redefine classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
 hello - MultiRedef
 hello2 - MultiRedef
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform2;, LTransform;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
+Transformation error : java.lang.Exception(Failed to retransform classes <LTransform;, LTransform2;> due to JVMTI_ERROR_NAMES_DONT_MATCH)
+hello - MultiRetrans
+hello2 - MultiRetrans
diff --git a/test/921-hello-failure/run b/test/921-hello-failure/run
index 3ef4832..8be0ed4 100755
--- a/test/921-hello-failure/run
+++ b/test/921-hello-failure/run
@@ -15,6 +15,4 @@
 # limitations under the License.
 
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/921-hello-failure/src/Main.java b/test/921-hello-failure/src/Main.java
index 1fe2599..67ca1e1 100644
--- a/test/921-hello-failure/src/Main.java
+++ b/test/921-hello-failure/src/Main.java
@@ -18,13 +18,13 @@
 public class Main {
 
   public static void main(String[] args) {
-    System.loadLibrary(args[1]);
     NewName.doTest(new Transform());
     DifferentAccess.doTest(new Transform());
     NewInterface.doTest(new Transform2());
     MissingInterface.doTest(new Transform2());
     ReorderInterface.doTest(new Transform2());
     MultiRedef.doTest(new Transform(), new Transform2());
+    MultiRetrans.doTest(new Transform(), new Transform2());
   }
 
   // Transforms the class. This throws an exception if something goes wrong.
@@ -47,7 +47,20 @@
                                    dex_files.toArray(new byte[0][]));
   }
 
+  public static void addMultiTransformationResults(CommonClassDefinition... defs) throws Exception {
+    for (CommonClassDefinition d : defs) {
+      addCommonTransformationResult(d.target.getCanonicalName(),
+                                    d.class_file_bytes,
+                                    d.dex_file_bytes);
+    }
+  }
+
   public static native void doCommonMultiClassRedefinition(Class<?>[] targets,
                                                            byte[][] classfiles,
                                                            byte[][] dexfiles) throws Exception;
+  public static native void doCommonClassRetransformation(Class<?>... target) throws Exception;
+  public static native void enableCommonRetransformation(boolean enable);
+  public static native void addCommonTransformationResult(String target_name,
+                                                          byte[] class_bytes,
+                                                          byte[] dex_bytes);
 }
diff --git a/test/921-hello-failure/src/MultiRetrans.java b/test/921-hello-failure/src/MultiRetrans.java
new file mode 100644
index 0000000..95aaf07
--- /dev/null
+++ b/test/921-hello-failure/src/MultiRetrans.java
@@ -0,0 +1,108 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+
+class MultiRetrans {
+
+  // class NotTransform {
+  //   public void sayHi(String name) {
+  //     throw new Error("Should not be called!");
+  //   }
+  // }
+  private static CommonClassDefinition INVALID_DEFINITION_T1 = new CommonClassDefinition(
+      Transform.class,
+      Base64.getDecoder().decode(
+          "yv66vgAAADQAFQoABgAPBwAQCAARCgACABIHABMHABQBAAY8aW5pdD4BAAMoKVYBAARDb2RlAQAP" +
+          "TGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApTb3VyY2VG" +
+          "aWxlAQARTm90VHJhbnNmb3JtLmphdmEMAAcACAEAD2phdmEvbGFuZy9FcnJvcgEAFVNob3VsZCBu" +
+          "b3QgYmUgY2FsbGVkIQwABwAMAQAMTm90VHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVjdAAgAAUA" +
+          "BgAAAAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAAAEAAQALAAwA" +
+          "AQAJAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEACgAAAAYAAQAAAAMAAQANAAAAAgAO"),
+      Base64.getDecoder().decode(
+          "ZGV4CjAzNQDLV95i5xnv6iUi6uIeDoY5jP5Xe9NP1AiYAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAL" +
+          "AAAAcAAAAAUAAACcAAAAAgAAALAAAAAAAAAAAAAAAAQAAADIAAAAAQAAAOgAAACQAQAACAEAAEoB" +
+          "AABSAQAAYgEAAHUBAACJAQAAnQEAALABAADHAQAAygEAAM4BAADiAQAAAQAAAAIAAAADAAAABAAA" +
+          "AAcAAAAHAAAABAAAAAAAAAAIAAAABAAAAEQBAAAAAAAAAAAAAAAAAQAKAAAAAQABAAAAAAACAAAA" +
+          "AAAAAAAAAAAAAAAAAgAAAAAAAAAFAAAAAAAAAPQBAAAAAAAAAQABAAEAAADpAQAABAAAAHAQAwAA" +
+          "AA4ABAACAAIAAADuAQAACQAAACIAAQAbAQYAAABwIAIAEAAnAAAAAQAAAAMABjxpbml0PgAOTE5v" +
+          "dFRyYW5zZm9ybTsAEUxqYXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZh" +
+          "L2xhbmcvU3RyaW5nOwARTm90VHJhbnNmb3JtLmphdmEAFVNob3VsZCBub3QgYmUgY2FsbGVkIQAB" +
+          "VgACVkwAEmVtaXR0ZXI6IGphY2stNC4yMAAFc2F5SGkAAQAHDgADAQAHDgAAAAEBAICABIgCAQGg" +
+          "AgAADAAAAAAAAAABAAAAAAAAAAEAAAALAAAAcAAAAAIAAAAFAAAAnAAAAAMAAAACAAAAsAAAAAUA" +
+          "AAAEAAAAyAAAAAYAAAABAAAA6AAAAAEgAAACAAAACAEAAAEQAAABAAAARAEAAAIgAAALAAAASgEA" +
+          "AAMgAAACAAAA6QEAAAAgAAABAAAA9AEAAAAQAAABAAAABAIAAA=="));
+
+  // Valid redefinition of Transform2
+  // class Transform2 implements Iface1, Iface2 {
+  //   public void sayHi(String name) {
+  //     throw new Error("Should not be called!");
+  //   }
+  // }
+  private static CommonClassDefinition VALID_DEFINITION_T2 = new CommonClassDefinition(
+      Transform2.class,
+      Base64.getDecoder().decode(
+          "yv66vgAAADQAGQoABgARBwASCAATCgACABQHABUHABYHABcHABgBAAY8aW5pdD4BAAMoKVYBAARD" +
+          "b2RlAQAPTGluZU51bWJlclRhYmxlAQAFc2F5SGkBABUoTGphdmEvbGFuZy9TdHJpbmc7KVYBAApT" +
+          "b3VyY2VGaWxlAQAPVHJhbnNmb3JtMi5qYXZhDAAJAAoBAA9qYXZhL2xhbmcvRXJyb3IBABVTaG91" +
+          "bGQgbm90IGJlIGNhbGxlZCEMAAkADgEAClRyYW5zZm9ybTIBABBqYXZhL2xhbmcvT2JqZWN0AQAG" +
+          "SWZhY2UxAQAGSWZhY2UyACAABQAGAAIABwAIAAAAAgAAAAkACgABAAsAAAAdAAEAAQAAAAUqtwAB" +
+          "sQAAAAEADAAAAAYAAQAAAAEAAQANAA4AAQALAAAAIgADAAIAAAAKuwACWRIDtwAEvwAAAAEADAAA" +
+          "AAYAAQAAAAMAAQAPAAAAAgAQ"),
+      Base64.getDecoder().decode(
+          "ZGV4CjAzNQDSWls05CPkX+gbTGMVRvx9dc9vozzVbu7AAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAN" +
+          "AAAAcAAAAAcAAACkAAAAAgAAAMAAAAAAAAAAAAAAAAQAAADYAAAAAQAAAPgAAACoAQAAGAEAAGIB" +
+          "AABqAQAAdAEAAH4BAACMAQAAnwEAALMBAADHAQAA3gEAAO8BAADyAQAA9gEAAAoCAAABAAAAAgAA" +
+          "AAMAAAAEAAAABQAAAAYAAAAJAAAACQAAAAYAAAAAAAAACgAAAAYAAABcAQAAAgAAAAAAAAACAAEA" +
+          "DAAAAAMAAQAAAAAABAAAAAAAAAACAAAAAAAAAAQAAABUAQAACAAAAAAAAAAcAgAAAAAAAAEAAQAB" +
+          "AAAAEQIAAAQAAABwEAMAAAAOAAQAAgACAAAAFgIAAAkAAAAiAAMAGwEHAAAAcCACABAAJwAAAAIA" +
+          "AAAAAAEAAQAAAAUABjxpbml0PgAITElmYWNlMTsACExJZmFjZTI7AAxMVHJhbnNmb3JtMjsAEUxq" +
+          "YXZhL2xhbmcvRXJyb3I7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAV" +
+          "U2hvdWxkIG5vdCBiZSBjYWxsZWQhAA9UcmFuc2Zvcm0yLmphdmEAAVYAAlZMABJlbWl0dGVyOiBq" +
+          "YWNrLTQuMjAABXNheUhpAAEABw4AAwEABw4AAAABAQCAgASYAgEBsAIAAAwAAAAAAAAAAQAAAAAA" +
+          "AAABAAAADQAAAHAAAAACAAAABwAAAKQAAAADAAAAAgAAAMAAAAAFAAAABAAAANgAAAAGAAAAAQAA" +
+          "APgAAAABIAAAAgAAABgBAAABEAAAAgAAAFQBAAACIAAADQAAAGIBAAADIAAAAgAAABECAAAAIAAA" +
+          "AQAAABwCAAAAEAAAAQAAACwCAAA="));
+
+  public static void doTest(Transform t1, Transform2 t2) {
+    t1.sayHi("MultiRetrans");
+    t2.sayHi("MultiRetrans");
+    try {
+      Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+      Main.enableCommonRetransformation(true);
+      Main.doCommonClassRetransformation(Transform2.class, Transform.class);
+    } catch (Exception e) {
+      System.out.println(
+          "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+    } finally {
+      Main.enableCommonRetransformation(false);
+    }
+    t1.sayHi("MultiRetrans");
+    t2.sayHi("MultiRetrans");
+    try {
+      Main.addMultiTransformationResults(VALID_DEFINITION_T2, INVALID_DEFINITION_T1);
+      Main.enableCommonRetransformation(true);
+      Main.doCommonClassRetransformation(Transform.class, Transform2.class);
+    } catch (Exception e) {
+      System.out.println(
+          "Transformation error : " + e.getClass().getName() + "(" + e.getMessage() + ")");
+    } finally {
+      Main.enableCommonRetransformation(false);
+    }
+    t1.sayHi("MultiRetrans");
+    t2.sayHi("MultiRetrans");
+  }
+}
diff --git a/test/922-properties/run b/test/922-properties/run
index 4379349..c6e62ae 100755
--- a/test/922-properties/run
+++ b/test/922-properties/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/922-properties/src/Main.java b/test/922-properties/src/Main.java
index 6cec6e9..8ad742f 100644
--- a/test/922-properties/src/Main.java
+++ b/test/922-properties/src/Main.java
@@ -19,8 +19,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
   }
 
diff --git a/test/923-monitors/run b/test/923-monitors/run
index 4379349..c6e62ae 100755
--- a/test/923-monitors/run
+++ b/test/923-monitors/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/923-monitors/src/Main.java b/test/923-monitors/src/Main.java
index e35ce12..ef00728 100644
--- a/test/923-monitors/src/Main.java
+++ b/test/923-monitors/src/Main.java
@@ -21,8 +21,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
   }
 
diff --git a/test/924-threads/expected.txt b/test/924-threads/expected.txt
index 5406522..67d20eb 100644
--- a/test/924-threads/expected.txt
+++ b/test/924-threads/expected.txt
@@ -28,3 +28,10 @@
 e1 = ALIVE|WAITING_WITH_TIMEOUT|SLEEPING|WAITING
 5 = ALIVE|RUNNABLE
 2 = TERMINATED
+[Thread[FinalizerDaemon,5,system], Thread[FinalizerWatchdogDaemon,5,system], Thread[HeapTaskDaemon,5,system], Thread[ReferenceQueueDaemon,5,system], Thread[Signal Catcher,5,system], Thread[main,5,main]]
+JVMTI_ERROR_THREAD_NOT_ALIVE
+JVMTI_ERROR_THREAD_NOT_ALIVE
+Constructed thread
+Thread(EventTestThread): start
+Thread(EventTestThread): end
+Thread joined
diff --git a/test/924-threads/run b/test/924-threads/run
index 4379349..c6e62ae 100755
--- a/test/924-threads/run
+++ b/test/924-threads/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/924-threads/src/Main.java b/test/924-threads/src/Main.java
index 0487666..29c4aa3 100644
--- a/test/924-threads/src/Main.java
+++ b/test/924-threads/src/Main.java
@@ -17,6 +17,7 @@
 import java.util.Arrays;
 import java.util.ArrayList;
 import java.util.Collections;
+import java.util.Comparator;
 import java.util.concurrent.CountDownLatch;
 import java.util.HashMap;
 import java.util.List;
@@ -24,8 +25,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
   }
 
@@ -53,6 +52,12 @@
     printThreadInfo(t3);
 
     doStateTests();
+
+    doAllThreadsTests();
+
+    doTLSTests();
+
+    doTestEvents();
   }
 
   private static class Holder {
@@ -155,6 +160,96 @@
     printThreadState(t);
   }
 
+  private static void doAllThreadsTests() {
+    Thread[] threads = getAllThreads();
+    Arrays.sort(threads, THREAD_COMP);
+    System.out.println(Arrays.toString(threads));
+  }
+
+  private static void doTLSTests() throws Exception {
+    doTLSNonLiveTests();
+    doTLSLiveTests();
+  }
+
+  private static void doTLSNonLiveTests() throws Exception {
+    Thread t = new Thread();
+    try {
+      setTLS(t, 1);
+      System.out.println("Expected failure setting TLS for non-live thread");
+    } catch (Exception e) {
+      System.out.println(e.getMessage());
+    }
+    t.start();
+    t.join();
+    try {
+      setTLS(t, 1);
+      System.out.println("Expected failure setting TLS for non-live thread");
+    } catch (Exception e) {
+      System.out.println(e.getMessage());
+    }
+  }
+
+  private static void doTLSLiveTests() throws Exception {
+    setTLS(Thread.currentThread(), 1);
+
+    long l = getTLS(Thread.currentThread());
+    if (l != 1) {
+      throw new RuntimeException("Unexpected TLS value: " + l);
+    };
+
+    final CountDownLatch cdl1 = new CountDownLatch(1);
+    final CountDownLatch cdl2 = new CountDownLatch(1);
+
+    Runnable r = new Runnable() {
+      @Override
+      public void run() {
+        try {
+          cdl1.countDown();
+          cdl2.await();
+          setTLS(Thread.currentThread(), 2);
+          if (getTLS(Thread.currentThread()) != 2) {
+            throw new RuntimeException("Different thread issue");
+          }
+        } catch (Exception e) {
+          throw new RuntimeException(e);
+        }
+      }
+    };
+
+    Thread t = new Thread(r);
+    t.start();
+    cdl1.await();
+    setTLS(Thread.currentThread(), 1);
+    cdl2.countDown();
+
+    t.join();
+    if (getTLS(Thread.currentThread()) != 1) {
+      throw new RuntimeException("Got clobbered");
+    }
+  }
+
+  private static void doTestEvents() throws Exception {
+    enableThreadEvents(true);
+
+    Thread t = new Thread("EventTestThread");
+
+    System.out.println("Constructed thread");
+    Thread.yield();
+
+    t.start();
+    t.join();
+
+    System.out.println("Thread joined");
+
+    enableThreadEvents(false);
+  }
+
+  private final static Comparator<Thread> THREAD_COMP = new Comparator<Thread>() {
+    public int compare(Thread o1, Thread o2) {
+      return o1.getName().compareTo(o2.getName());
+    }
+  };
+
   private final static Map<Integer, String> STATE_NAMES = new HashMap<Integer, String>();
   private final static List<Integer> STATE_KEYS = new ArrayList<Integer>();
   static {
@@ -213,4 +308,8 @@
   private static native Thread getCurrentThread();
   private static native Object[] getThreadInfo(Thread t);
   private static native int getThreadState(Thread t);
+  private static native Thread[] getAllThreads();
+  private static native void setTLS(Thread t, long l);
+  private static native long getTLS(Thread t);
+  private static native void enableThreadEvents(boolean b);
 }
diff --git a/test/924-threads/threads.cc b/test/924-threads/threads.cc
index 4abf8fc..0380433 100644
--- a/test/924-threads/threads.cc
+++ b/test/924-threads/threads.cc
@@ -100,5 +100,108 @@
   return state;
 }
 
+extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getAllThreads(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+  jint thread_count;
+  jthread* threads;
+
+  jvmtiError result = jvmti_env->GetAllThreads(&thread_count, &threads);
+  if (JvmtiErrorToException(env, result)) {
+    return nullptr;
+  }
+
+  auto callback = [&](jint index) {
+    return threads[index];
+  };
+  jobjectArray ret = CreateObjectArray(env, thread_count, "java/lang/Thread", callback);
+
+  jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(threads));
+
+  return ret;
+}
+
+extern "C" JNIEXPORT jlong JNICALL Java_Main_getTLS(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jthread thread) {
+  void* tls;
+  jvmtiError result = jvmti_env->GetThreadLocalStorage(thread, &tls);
+  if (JvmtiErrorToException(env, result)) {
+    return 0;
+  }
+  return static_cast<jlong>(reinterpret_cast<uintptr_t>(tls));
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_setTLS(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jthread thread, jlong val) {
+  const void* tls = reinterpret_cast<void*>(static_cast<uintptr_t>(val));
+  jvmtiError result = jvmti_env->SetThreadLocalStorage(thread, tls);
+  JvmtiErrorToException(env, result);
+}
+
+static void JNICALL ThreadEvent(jvmtiEnv* jvmti_env,
+                                JNIEnv* jni_env,
+                                jthread thread,
+                                bool is_start) {
+  jvmtiThreadInfo info;
+  jvmtiError result = jvmti_env->GetThreadInfo(thread, &info);
+  if (result != JVMTI_ERROR_NONE) {
+    printf("Error getting thread info");
+    return;
+  }
+  printf("Thread(%s): %s\n", info.name, is_start ? "start" : "end");
+
+  jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(info.name));
+  jni_env->DeleteLocalRef(info.thread_group);
+  jni_env->DeleteLocalRef(info.context_class_loader);
+}
+
+static void JNICALL ThreadStart(jvmtiEnv* jvmti_env,
+                                JNIEnv* jni_env,
+                                jthread thread) {
+  ThreadEvent(jvmti_env, jni_env, thread, true);
+}
+
+static void JNICALL ThreadEnd(jvmtiEnv* jvmti_env,
+                              JNIEnv* jni_env,
+                              jthread thread) {
+  ThreadEvent(jvmti_env, jni_env, thread, false);
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_enableThreadEvents(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jboolean b) {
+  if (b == JNI_FALSE) {
+    jvmtiError ret = jvmti_env->SetEventNotificationMode(JVMTI_DISABLE,
+                                                         JVMTI_EVENT_THREAD_START,
+                                                         nullptr);
+    if (JvmtiErrorToException(env, ret)) {
+      return;
+    }
+    ret = jvmti_env->SetEventNotificationMode(JVMTI_DISABLE,
+                                              JVMTI_EVENT_THREAD_END,
+                                              nullptr);
+    JvmtiErrorToException(env, ret);
+    return;
+  }
+
+  jvmtiEventCallbacks callbacks;
+  memset(&callbacks, 0, sizeof(jvmtiEventCallbacks));
+  callbacks.ThreadStart = ThreadStart;
+  callbacks.ThreadEnd = ThreadEnd;
+  jvmtiError ret = jvmti_env->SetEventCallbacks(&callbacks, sizeof(callbacks));
+  if (JvmtiErrorToException(env, ret)) {
+    return;
+  }
+
+  ret = jvmti_env->SetEventNotificationMode(JVMTI_ENABLE,
+                                            JVMTI_EVENT_THREAD_START,
+                                            nullptr);
+  if (JvmtiErrorToException(env, ret)) {
+    return;
+  }
+  ret = jvmti_env->SetEventNotificationMode(JVMTI_ENABLE,
+                                            JVMTI_EVENT_THREAD_END,
+                                            nullptr);
+  JvmtiErrorToException(env, ret);
+}
+
 }  // namespace Test924Threads
 }  // namespace art
diff --git a/test/925-threadgroups/run b/test/925-threadgroups/run
index 4379349..c6e62ae 100755
--- a/test/925-threadgroups/run
+++ b/test/925-threadgroups/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/925-threadgroups/src/Main.java b/test/925-threadgroups/src/Main.java
index f16c0d6..3d7a4ca 100644
--- a/test/925-threadgroups/src/Main.java
+++ b/test/925-threadgroups/src/Main.java
@@ -19,8 +19,6 @@
 
 public class Main {
   public static void main(String[] args) throws Exception {
-    System.loadLibrary(args[1]);
-
     doTest();
   }
 
@@ -42,6 +40,8 @@
     printThreadGroupInfo(curGroup);
     printThreadGroupInfo(rootGroup);
 
+    waitGroupChildren(rootGroup, 5 /* # daemons */, 30 /* timeout in seconds */);
+
     checkChildren(curGroup);
   }
 
@@ -75,6 +75,23 @@
     }
   }
 
+  private static void waitGroupChildren(ThreadGroup tg, int expectedChildCount, int timeoutS)
+      throws Exception {
+    for (int i = 0; i <  timeoutS; i++) {
+      Object[] data = getThreadGroupChildren(tg);
+      Thread[] threads = (Thread[])data[0];
+      if (threads.length == expectedChildCount) {
+        return;
+      }
+      Thread.sleep(1000);
+    }
+
+    Object[] data = getThreadGroupChildren(tg);
+    Thread[] threads = (Thread[])data[0];
+    System.out.println(Arrays.toString(threads));
+    throw new RuntimeException("Waited unsuccessfully for " + expectedChildCount + " children.");
+  }
+
   private final static Comparator<Thread> THREAD_COMP = new Comparator<Thread>() {
     public int compare(Thread o1, Thread o2) {
       return o1.getName().compareTo(o2.getName());
diff --git a/test/926-multi-obsolescence/run b/test/926-multi-obsolescence/run
index 4379349..c6e62ae 100755
--- a/test/926-multi-obsolescence/run
+++ b/test/926-multi-obsolescence/run
@@ -14,6 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-./default-run "$@" --experimental agents \
-                   --experimental runtime-plugins \
-                   --jvmti
+./default-run "$@" --jvmti
diff --git a/test/926-multi-obsolescence/src/Main.java b/test/926-multi-obsolescence/src/Main.java
index 8a6cf84..6d9f96c 100644
--- a/test/926-multi-obsolescence/src/Main.java
+++ b/test/926-multi-obsolescence/src/Main.java
@@ -92,7 +92,6 @@
         "AACUAQAAAiAAABEAAACiAQAAAyAAAAIAAACXAgAAACAAAAEAAAClAgAAABAAAAEAAAC0AgAA"));
 
   public static void main(String[] args) {
-    System.loadLibrary(args[1]);
     doTest(new Transform(), new Transform2());
   }
 
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/927-timers/build
similarity index 86%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/927-timers/build
index a9f1822..898e2e5 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/927-timers/build
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/927-timers/expected.txt b/test/927-timers/expected.txt
new file mode 100644
index 0000000..a4ef442
--- /dev/null
+++ b/test/927-timers/expected.txt
@@ -0,0 +1,3 @@
+availableProcessors OK
+[-1, true, true, 32]
+Time OK
diff --git a/test/927-timers/info.txt b/test/927-timers/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/927-timers/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/927-timers/run
similarity index 87%
rename from test/954-invoke-polymorphic-verifier/run
rename to test/927-timers/run
index a9f1822..c6e62ae 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/927-timers/run
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-run "$@" --jvmti
diff --git a/test/927-timers/src/Main.java b/test/927-timers/src/Main.java
new file mode 100644
index 0000000..b67f66d
--- /dev/null
+++ b/test/927-timers/src/Main.java
@@ -0,0 +1,60 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+
+public class Main {
+  public static void main(String[] args) throws Exception {
+    doTest();
+  }
+
+  private static void doTest() {
+    int all1 = Runtime.getRuntime().availableProcessors();
+    int all2 = getAvailableProcessors();
+    if (all1 != all2) {
+      throw new RuntimeException("Available processors doesn't match: " + all1 + " vs " + all2);
+    }
+    System.out.println("availableProcessors OK");
+
+    Object info[] = getTimerInfo();
+    System.out.println(Arrays.toString(info));
+
+    // getTime checks.
+    // Note: there isn't really much to check independent from the implementation. So we check
+    //       a few details of the ART implementation. This may fail on other runtimes.
+    long time1 = getTime();
+    long time2 = getTime();
+
+    // Under normal circumstances, time1 <= time2.
+    if (time2 < time1) {
+      throw new RuntimeException("Time unexpectedly decreased: " + time1 + " vs " + time2);
+    }
+
+    long time3 = System.nanoTime();
+    long time4 = getTime();
+
+    final long MINUTE = 60l * 1000 * 1000 * 1000;
+    if (time4 < time3 || (time4 - time3 > MINUTE)) {
+      throw new RuntimeException("Time unexpectedly divergent: " + time3 + " vs " + time4);
+    }
+
+    System.out.println("Time OK");
+  }
+
+  private static native int getAvailableProcessors();
+  private static native Object[] getTimerInfo();
+  private static native long getTime();
+}
diff --git a/test/927-timers/timers.cc b/test/927-timers/timers.cc
new file mode 100644
index 0000000..58d5c27
--- /dev/null
+++ b/test/927-timers/timers.cc
@@ -0,0 +1,84 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <inttypes.h>
+
+#include "android-base/stringprintf.h"
+#include "base/logging.h"
+#include "base/macros.h"
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test926Timers {
+
+extern "C" JNIEXPORT jint JNICALL Java_Main_getAvailableProcessors(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+  jint count;
+  jvmtiError result = jvmti_env->GetAvailableProcessors(&count);
+  if (JvmtiErrorToException(env, result)) {
+    return -1;
+  }
+  return count;
+}
+
+extern "C" JNIEXPORT jlong JNICALL Java_Main_getTime(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+  jlong time;
+  jvmtiError result = jvmti_env->GetTime(&time);
+  if (JvmtiErrorToException(env, result)) {
+    return -1;
+  }
+  return time;
+}
+
+extern "C" JNIEXPORT jobjectArray JNICALL Java_Main_getTimerInfo(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+  jvmtiTimerInfo info;
+  jvmtiError result = jvmti_env->GetTimerInfo(&info);
+  if (JvmtiErrorToException(env, result)) {
+    return nullptr;
+  }
+
+  auto callback = [&](jint index) -> jobject {
+    switch (index) {
+      // Max value.
+      case 0:
+        return env->NewStringUTF(android::base::StringPrintf("%" PRId64, info.max_value).c_str());
+
+      // Skip forward.
+      case 1:
+        return env->NewStringUTF(info.may_skip_forward == JNI_TRUE ? "true" : "false");
+      // Skip backward.
+      case 2:
+        return env->NewStringUTF(info.may_skip_forward == JNI_TRUE ? "true" : "false");
+
+      // The kind.
+      case 3:
+        return env->NewStringUTF(
+            android::base::StringPrintf("%d", static_cast<jint>(info.kind)).c_str());
+    }
+    LOG(FATAL) << "Should not reach here";
+    UNREACHABLE();
+  };
+  return CreateObjectArray(env, 4, "java/lang/Object", callback);
+}
+
+}  // namespace Test926Timers
+}  // namespace art
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/928-jni-table/build
similarity index 86%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/928-jni-table/build
index a9f1822..898e2e5 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/928-jni-table/build
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/928-jni-table/expected.txt b/test/928-jni-table/expected.txt
new file mode 100644
index 0000000..a965a70
--- /dev/null
+++ b/test/928-jni-table/expected.txt
@@ -0,0 +1 @@
+Done
diff --git a/test/928-jni-table/info.txt b/test/928-jni-table/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/928-jni-table/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/928-jni-table/jni_table.cc b/test/928-jni-table/jni_table.cc
new file mode 100644
index 0000000..5123d3a
--- /dev/null
+++ b/test/928-jni-table/jni_table.cc
@@ -0,0 +1,89 @@
+/*
+ * Copyright (C) 2013 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <stdio.h>
+
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+
+#include "base/logging.h"
+#include "base/macros.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test927JNITable {
+
+// This test is equivalent to the jni_internal_test JNIEnvExtTableOverride.
+
+static size_t gGlobalRefCount = 0;
+static JNINativeInterface* gOriginalEnv = nullptr;
+
+static jobject CountNewGlobalRef(JNIEnv* env, jobject o) {
+  ++gGlobalRefCount;
+  return gOriginalEnv->NewGlobalRef(env, o);
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_doJNITableTest(
+    JNIEnv* env, jclass klass) {
+  // Get the current table, as the delegate.
+  jvmtiError getorig_result = jvmti_env->GetJNIFunctionTable(&gOriginalEnv);
+  if (JvmtiErrorToException(env, getorig_result)) {
+    return;
+  }
+
+  // Get the current table, as the override we'll install.
+  JNINativeInterface* env_override;
+  jvmtiError getoverride_result = jvmti_env->GetJNIFunctionTable(&env_override);
+  if (JvmtiErrorToException(env, getoverride_result)) {
+    return;
+  }
+
+  env_override->NewGlobalRef = CountNewGlobalRef;
+  gGlobalRefCount = 0;
+
+  // Install the override.
+  jvmtiError setoverride_result = jvmti_env->SetJNIFunctionTable(env_override);
+  if (JvmtiErrorToException(env, setoverride_result)) {
+    return;
+  }
+
+  jobject global = env->NewGlobalRef(klass);
+  CHECK_EQ(1u, gGlobalRefCount);
+  env->DeleteGlobalRef(global);
+
+  // Install the "original." There is no real reset.
+  jvmtiError setoverride2_result = jvmti_env->SetJNIFunctionTable(gOriginalEnv);
+  if (JvmtiErrorToException(env, setoverride2_result)) {
+    return;
+  }
+
+  jobject global2 = env->NewGlobalRef(klass);
+  CHECK_EQ(1u, gGlobalRefCount);
+  env->DeleteGlobalRef(global2);
+
+  // Try to install null. Should return NULL_POINTER error.
+  jvmtiError setoverride3_result = jvmti_env->SetJNIFunctionTable(nullptr);
+  if (setoverride3_result != JVMTI_ERROR_NULL_POINTER) {
+    LOG(FATAL) << "Didn't receive NULL_POINTER";
+  }
+
+  jvmti_env->Deallocate(reinterpret_cast<unsigned char*>(env_override));
+}
+
+}  // namespace Test927JNITable
+}  // namespace art
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/928-jni-table/run
similarity index 87%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/928-jni-table/run
index a9f1822..c6e62ae 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/928-jni-table/run
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-run "$@" --jvmti
diff --git a/test/928-jni-table/src/Main.java b/test/928-jni-table/src/Main.java
new file mode 100644
index 0000000..fd61b7d
--- /dev/null
+++ b/test/928-jni-table/src/Main.java
@@ -0,0 +1,25 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Main {
+  public static void main(String[] args) throws Exception {
+    doJNITableTest();
+
+    System.out.println("Done");
+  }
+
+  public static native void doJNITableTest();
+}
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/929-search/build
similarity index 86%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/929-search/build
index a9f1822..898e2e5 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/929-search/build
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/929-search/expected.txt b/test/929-search/expected.txt
new file mode 100644
index 0000000..a965a70
--- /dev/null
+++ b/test/929-search/expected.txt
@@ -0,0 +1 @@
+Done
diff --git a/test/929-search/info.txt b/test/929-search/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/929-search/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/956-methodhandles/run b/test/929-search/run
similarity index 71%
rename from test/956-methodhandles/run
rename to test/929-search/run
index a9f1822..67923a7 100755
--- a/test/956-methodhandles/run
+++ b/test/929-search/run
@@ -14,7 +14,8 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
+# This test checks whether dex files can be injected into parent classloaders. App images preload
+# classes, which will make the injection moot. Turn off app images to avoid the issue.
 
-./default-run "$@" --experimental method-handles
+./default-run "$@" --jvmti \
+                   --no-app-image
diff --git a/test/929-search/search.cc b/test/929-search/search.cc
new file mode 100644
index 0000000..d1c6984
--- /dev/null
+++ b/test/929-search/search.cc
@@ -0,0 +1,53 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <inttypes.h>
+
+#include "android-base/stringprintf.h"
+#include "base/logging.h"
+#include "base/macros.h"
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+#include "ScopedUtfChars.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test929Search {
+
+extern "C" JNIEXPORT void JNICALL Java_Main_addToBootClassLoader(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jstring segment) {
+  ScopedUtfChars utf(env, segment);
+  if (utf.c_str() == nullptr) {
+    return;
+  }
+  jvmtiError result = jvmti_env->AddToBootstrapClassLoaderSearch(utf.c_str());
+  JvmtiErrorToException(env, result);
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_addToSystemClassLoader(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED, jstring segment) {
+  ScopedUtfChars utf(env, segment);
+  if (utf.c_str() == nullptr) {
+    return;
+  }
+  jvmtiError result = jvmti_env->AddToSystemClassLoaderSearch(utf.c_str());
+  JvmtiErrorToException(env, result);
+}
+
+}  // namespace Test929Search
+}  // namespace art
diff --git a/test/929-search/src-ex/A.java b/test/929-search/src-ex/A.java
new file mode 100644
index 0000000..64acb2f
--- /dev/null
+++ b/test/929-search/src-ex/A.java
@@ -0,0 +1,18 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class A {
+}
\ No newline at end of file
diff --git a/test/929-search/src/B.java b/test/929-search/src/B.java
new file mode 100644
index 0000000..f1458c3
--- /dev/null
+++ b/test/929-search/src/B.java
@@ -0,0 +1,18 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class B {
+}
\ No newline at end of file
diff --git a/test/929-search/src/Main.java b/test/929-search/src/Main.java
new file mode 100644
index 0000000..bbeb081
--- /dev/null
+++ b/test/929-search/src/Main.java
@@ -0,0 +1,52 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+
+public class Main {
+  public static void main(String[] args) throws Exception {
+    doTest();
+  }
+
+  private static void doTest() throws Exception {
+    doTest(true, DEX1, "B");
+    doTest(false, DEX2, "A");
+    System.out.println("Done");
+  }
+
+  private static void doTest(boolean boot, String segment, String className) throws Exception {
+    ClassLoader expectedClassLoader;
+    if (boot) {
+      expectedClassLoader = Object.class.getClassLoader();
+      addToBootClassLoader(segment);
+    } else {
+      expectedClassLoader = ClassLoader.getSystemClassLoader();
+      addToSystemClassLoader(segment);
+    }
+
+    Class<?> c = Class.forName(className);
+    if (c.getClassLoader() != expectedClassLoader) {
+      throw new RuntimeException(className + "(" + boot + "/" + segment + "): " +
+          c.getClassLoader() + " vs " + expectedClassLoader);
+    }
+  }
+
+  private static native void addToBootClassLoader(String s);
+  private static native void addToSystemClassLoader(String s);
+
+  private static final String DEX1 = System.getenv("DEX_LOCATION") + "/929-search.jar";
+  private static final String DEX2 = System.getenv("DEX_LOCATION") + "/929-search-ex.jar";
+}
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/930-hello-retransform/build
similarity index 86%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/930-hello-retransform/build
index a9f1822..898e2e5 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/930-hello-retransform/build
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/930-hello-retransform/expected.txt b/test/930-hello-retransform/expected.txt
new file mode 100644
index 0000000..4774b81
--- /dev/null
+++ b/test/930-hello-retransform/expected.txt
@@ -0,0 +1,2 @@
+hello
+Goodbye
diff --git a/test/930-hello-retransform/info.txt b/test/930-hello-retransform/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/930-hello-retransform/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/930-hello-retransform/run
similarity index 87%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/930-hello-retransform/run
index a9f1822..c6e62ae 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/930-hello-retransform/run
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-run "$@" --jvmti
diff --git a/test/930-hello-retransform/src/Main.java b/test/930-hello-retransform/src/Main.java
new file mode 100644
index 0000000..0063c82
--- /dev/null
+++ b/test/930-hello-retransform/src/Main.java
@@ -0,0 +1,69 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+
+  /**
+   * base64 encoded class/dex file for
+   * class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+    "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+  public static void main(String[] args) {
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    t.sayHi();
+    addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
+    enableCommonRetransformation(true);
+    doCommonClassRetransformation(Transform.class);
+    t.sayHi();
+  }
+
+  // Transforms the class
+  private static native void doCommonClassRetransformation(Class<?>... target);
+  private static native void enableCommonRetransformation(boolean enable);
+  private static native void addCommonTransformationResult(String target_name,
+                                                           byte[] class_bytes,
+                                                           byte[] dex_bytes);
+}
diff --git a/test/930-hello-retransform/src/Transform.java b/test/930-hello-retransform/src/Transform.java
new file mode 100644
index 0000000..8e8af35
--- /dev/null
+++ b/test/930-hello-retransform/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+  public void sayHi() {
+    // Use lower 'h' to make sure the string will have a different string id
+    // than the transformation (the transformation code is the same except
+    // the actual printed String, which was making the test inacurately passing
+    // in JIT mode when loading the string from the dex cache, as the string ids
+    // of the two different strings were the same).
+    // We know the string ids will be different because lexicographically:
+    // "Goodbye" < "LTransform;" < "hello".
+    System.out.println("hello");
+  }
+}
diff --git a/test/931-agent-thread/agent_thread.cc b/test/931-agent-thread/agent_thread.cc
new file mode 100644
index 0000000..6ace4ce
--- /dev/null
+++ b/test/931-agent-thread/agent_thread.cc
@@ -0,0 +1,132 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <inttypes.h>
+
+#include "barrier.h"
+#include "base/logging.h"
+#include "base/macros.h"
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+#include "runtime.h"
+#include "ScopedLocalRef.h"
+#include "thread-inl.h"
+#include "well_known_classes.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test930AgentThread {
+
+struct AgentData {
+  AgentData() : main_thread(nullptr),
+                jvmti_env(nullptr),
+                b(2) {
+  }
+
+  jthread main_thread;
+  jvmtiEnv* jvmti_env;
+  Barrier b;
+  jint priority;
+};
+
+static void AgentMain(jvmtiEnv* jenv, JNIEnv* env, void* arg) {
+  AgentData* data = reinterpret_cast<AgentData*>(arg);
+
+  // Check some basics.
+  // This thread is not the main thread.
+  jthread this_thread;
+  jvmtiError this_thread_result = jenv->GetCurrentThread(&this_thread);
+  CHECK(!JvmtiErrorToException(env, this_thread_result));
+  CHECK(!env->IsSameObject(this_thread, data->main_thread));
+
+  // The thread is a daemon.
+  jvmtiThreadInfo info;
+  jvmtiError info_result = jenv->GetThreadInfo(this_thread, &info);
+  CHECK(!JvmtiErrorToException(env, info_result));
+  CHECK(info.is_daemon);
+
+  // The thread has the requested priority.
+  // TODO: Our thread priorities do not work on the host.
+  // CHECK_EQ(info.priority, data->priority);
+
+  // Check further parts of the thread:
+  jint thread_count;
+  jthread* threads;
+  jvmtiError threads_result = jenv->GetAllThreads(&thread_count, &threads);
+  CHECK(!JvmtiErrorToException(env, threads_result));
+  bool found = false;
+  for (jint i = 0; i != thread_count; ++i) {
+    if (env->IsSameObject(threads[i], this_thread)) {
+      found = true;
+      break;
+    }
+  }
+  CHECK(found);
+
+  // Done, let the main thread progress.
+  data->b.Pass(Thread::Current());
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_testAgentThread(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+  // Create a Thread object.
+  ScopedLocalRef<jobject> thread_name(env,
+                                      env->NewStringUTF("Agent Thread"));
+  if (thread_name.get() == nullptr) {
+    return;
+  }
+
+  ScopedLocalRef<jobject> thread(env, env->AllocObject(WellKnownClasses::java_lang_Thread));
+  if (thread.get() == nullptr) {
+    return;
+  }
+
+  env->CallNonvirtualVoidMethod(thread.get(),
+                                WellKnownClasses::java_lang_Thread,
+                                WellKnownClasses::java_lang_Thread_init,
+                                Runtime::Current()->GetMainThreadGroup(),
+                                thread_name.get(),
+                                kMinThreadPriority,
+                                JNI_FALSE);
+  if (env->ExceptionCheck()) {
+    return;
+  }
+
+  jthread main_thread;
+  jvmtiError main_thread_result = jvmti_env->GetCurrentThread(&main_thread);
+  if (JvmtiErrorToException(env, main_thread_result)) {
+    return;
+  }
+
+  AgentData data;
+  data.main_thread = env->NewGlobalRef(main_thread);
+  data.jvmti_env = jvmti_env;
+  data.priority = JVMTI_THREAD_MIN_PRIORITY;
+
+  jvmtiError result = jvmti_env->RunAgentThread(thread.get(), AgentMain, &data, data.priority);
+  if (JvmtiErrorToException(env, result)) {
+    return;
+  }
+
+  data.b.Wait(Thread::Current());
+
+  env->DeleteGlobalRef(data.main_thread);
+}
+
+}  // namespace Test930AgentThread
+}  // namespace art
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/931-agent-thread/build
similarity index 86%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/931-agent-thread/build
index a9f1822..898e2e5 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/931-agent-thread/build
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/931-agent-thread/expected.txt b/test/931-agent-thread/expected.txt
new file mode 100644
index 0000000..a965a70
--- /dev/null
+++ b/test/931-agent-thread/expected.txt
@@ -0,0 +1 @@
+Done
diff --git a/test/931-agent-thread/info.txt b/test/931-agent-thread/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/931-agent-thread/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/956-methodhandles/run b/test/931-agent-thread/run
similarity index 71%
copy from test/956-methodhandles/run
copy to test/931-agent-thread/run
index a9f1822..67923a7 100755
--- a/test/956-methodhandles/run
+++ b/test/931-agent-thread/run
@@ -14,7 +14,8 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
+# This test checks whether dex files can be injected into parent classloaders. App images preload
+# classes, which will make the injection moot. Turn off app images to avoid the issue.
 
-./default-run "$@" --experimental method-handles
+./default-run "$@" --jvmti \
+                   --no-app-image
diff --git a/test/931-agent-thread/src/Main.java b/test/931-agent-thread/src/Main.java
new file mode 100644
index 0000000..a7639fb
--- /dev/null
+++ b/test/931-agent-thread/src/Main.java
@@ -0,0 +1,27 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Arrays;
+
+public class Main {
+  public static void main(String[] args) throws Exception {
+    testAgentThread();
+
+    System.out.println("Done");
+  }
+
+  private static native void testAgentThread();
+}
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/932-transform-saves/build
similarity index 86%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/932-transform-saves/build
index a9f1822..898e2e5 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/932-transform-saves/build
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/932-transform-saves/expected.txt b/test/932-transform-saves/expected.txt
new file mode 100644
index 0000000..5097771
--- /dev/null
+++ b/test/932-transform-saves/expected.txt
@@ -0,0 +1,3 @@
+hello
+Goodbye
+hello
diff --git a/test/932-transform-saves/info.txt b/test/932-transform-saves/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/932-transform-saves/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/932-transform-saves/run
similarity index 87%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/932-transform-saves/run
index a9f1822..c6e62ae 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/932-transform-saves/run
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-run "$@" --jvmti
diff --git a/test/932-transform-saves/src/Main.java b/test/932-transform-saves/src/Main.java
new file mode 100644
index 0000000..d960322
--- /dev/null
+++ b/test/932-transform-saves/src/Main.java
@@ -0,0 +1,115 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+  /**
+   * base64 encoded class/dex file for
+   * class Transform {
+   *   public void sayHi() {
+   *    System.out.println("hello");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES_A = Base64.getDecoder().decode(
+      "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+      "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+      "BwAIBwAWDAAXABgBAAVoZWxsbwcAGQwAGgAbAQAJVHJhbnNmb3JtAQAQamF2YS9sYW5nL09iamVj" +
+      "dAEAEGphdmEvbGFuZy9TeXN0ZW0BAANvdXQBABVMamF2YS9pby9QcmludFN0cmVhbTsBABNqYXZh" +
+      "L2lvL1ByaW50U3RyZWFtAQAHcHJpbnRsbgEAFShMamF2YS9sYW5nL1N0cmluZzspVgAgAAUABgAA" +
+      "AAAAAgAAAAcACAABAAkAAAAdAAEAAQAAAAUqtwABsQAAAAEACgAAAAYAAQAAABEAAQALAAgAAQAJ" +
+      "AAAAJQACAAEAAAAJsgACEgO2AASxAAAAAQAKAAAACgACAAAAGgAIABsAAQAMAAAAAgAN");
+  private static final byte[] DEX_BYTES_A = Base64.getDecoder().decode(
+      "ZGV4CjAzNQC6XWInnnDd1H4NdQ3P3inH8eCVmQI6W7LMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+      "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+      "AABqAQAAdwEAAI4BAACiAQAAtgEAAMoBAADaAQAA3QEAAOEBAAD1AQAA/AEAAAECAAAKAgAAAQAA" +
+      "AAIAAAADAAAABAAAAAUAAAAHAAAABwAAAAUAAAAAAAAACAAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+      "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAGAAAAAAAAABwCAAAA" +
+      "AAAAAQABAAEAAAARAgAABAAAAHAQAwAAAA4AAwABAAIAAAAWAgAACQAAAGIAAAAbAQoAAABuIAIA" +
+      "EAAOAAAAAQAAAAMABjxpbml0PgALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwAS" +
+      "TGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xhbmcvU3lzdGVt" +
+      "OwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTQuMjIABWhlbGxvAANvdXQA" +
+      "B3ByaW50bG4ABXNheUhpABEABw4AGgAHDocAAAABAQCAgASgAgEBuAIAAA0AAAAAAAAAAQAAAAAA" +
+      "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+      "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+      "AgAAABECAAAAIAAAAQAAABwCAAAAEAAAAQAAACwCAAA=");
+
+  /**
+   * base64 encoded class/dex file for
+   * class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES_B = Base64.getDecoder().decode(
+    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+    "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+  private static final byte[] DEX_BYTES_B = Base64.getDecoder().decode(
+    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+  public static void main(String[] args) {
+    doTest(new Transform());
+  }
+
+  public static void doTest(Transform t) {
+    // TODO We currently need to do this transform call since we don't have any way to make the
+    // original-dex-file a single-class dex-file letting us restore it easily. We should use the
+    // manipulation library that is being made when we store the original dex file.
+    // TODO REMOVE this theoretically does nothing but it ensures the original-dex-file we have set
+    // is one we can return to unaltered.
+    doCommonClassRedefinition(Transform.class, CLASS_BYTES_A, DEX_BYTES_A);
+    t.sayHi();
+
+    // Now turn it into DEX_BYTES_B so it says 'Goodbye'
+    addCommonTransformationResult("Transform", CLASS_BYTES_B, DEX_BYTES_B);
+    enableCommonRetransformation(true);
+    doCommonClassRetransformation(Transform.class);
+    t.sayHi();
+
+    // Now turn it back to normal by removing the load-hook and transforming again.
+    enableCommonRetransformation(false);
+    doCommonClassRetransformation(Transform.class);
+    t.sayHi();
+  }
+
+  // Transforms the class
+  private static native void doCommonClassRedefinition(Class<?> target,
+                                                       byte[] class_bytes,
+                                                       byte[] dex_bytes);
+  private static native void doCommonClassRetransformation(Class<?>... target);
+  private static native void enableCommonRetransformation(boolean enable);
+  private static native void addCommonTransformationResult(String target_name,
+                                                           byte[] class_bytes,
+                                                           byte[] dex_bytes);
+}
diff --git a/test/932-transform-saves/src/Transform.java b/test/932-transform-saves/src/Transform.java
new file mode 100644
index 0000000..8e8af35
--- /dev/null
+++ b/test/932-transform-saves/src/Transform.java
@@ -0,0 +1,28 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+  public void sayHi() {
+    // Use lower 'h' to make sure the string will have a different string id
+    // than the transformation (the transformation code is the same except
+    // the actual printed String, which was making the test inacurately passing
+    // in JIT mode when loading the string from the dex cache, as the string ids
+    // of the two different strings were the same).
+    // We know the string ids will be different because lexicographically:
+    // "Goodbye" < "LTransform;" < "hello".
+    System.out.println("hello");
+  }
+}
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/933-misc-events/build
similarity index 86%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/933-misc-events/build
index a9f1822..898e2e5 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/933-misc-events/build
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/933-misc-events/expected.txt b/test/933-misc-events/expected.txt
new file mode 100644
index 0000000..024c560
--- /dev/null
+++ b/test/933-misc-events/expected.txt
@@ -0,0 +1,2 @@
+Received dump request.
+Done
diff --git a/test/933-misc-events/info.txt b/test/933-misc-events/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/933-misc-events/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/933-misc-events/misc_events.cc b/test/933-misc-events/misc_events.cc
new file mode 100644
index 0000000..860d4b5
--- /dev/null
+++ b/test/933-misc-events/misc_events.cc
@@ -0,0 +1,72 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+#include <atomic>
+#include <signal.h>
+#include <sys/types.h>
+
+#include "base/logging.h"
+#include "base/macros.h"
+#include "jni.h"
+#include "openjdkjvmti/jvmti.h"
+
+#include "ti-agent/common_helper.h"
+#include "ti-agent/common_load.h"
+
+namespace art {
+namespace Test933MiscEvents {
+
+static std::atomic<bool> saw_dump_request(false);
+
+static void DumpRequestCallback(jvmtiEnv* jenv ATTRIBUTE_UNUSED) {
+  printf("Received dump request.\n");
+  saw_dump_request.store(true, std::memory_order::memory_order_relaxed);
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_testSigQuit(
+    JNIEnv* env, jclass Main_klass ATTRIBUTE_UNUSED) {
+  jvmtiEventCallbacks callbacks;
+  memset(&callbacks, 0, sizeof(jvmtiEventCallbacks));
+  callbacks.DataDumpRequest = DumpRequestCallback;
+  jvmtiError ret = jvmti_env->SetEventCallbacks(&callbacks, sizeof(callbacks));
+  if (JvmtiErrorToException(env, ret)) {
+    return;
+  }
+
+  ret = jvmti_env->SetEventNotificationMode(JVMTI_ENABLE,
+                                            JVMTI_EVENT_DATA_DUMP_REQUEST,
+                                            nullptr);
+  if (JvmtiErrorToException(env, ret)) {
+    return;
+  }
+
+  // Send sigquit to self.
+  kill(getpid(), SIGQUIT);
+
+  // Busy-wait for request.
+  for (;;) {
+    sleep(1);
+    if (saw_dump_request.load(std::memory_order::memory_order_relaxed)) {
+      break;
+    }
+  }
+
+  ret = jvmti_env->SetEventNotificationMode(JVMTI_DISABLE, JVMTI_EVENT_DATA_DUMP_REQUEST, nullptr);
+  JvmtiErrorToException(env, ret);
+}
+
+}  // namespace Test933MiscEvents
+}  // namespace art
diff --git a/test/956-methodhandles/run b/test/933-misc-events/run
similarity index 71%
copy from test/956-methodhandles/run
copy to test/933-misc-events/run
index a9f1822..67923a7 100755
--- a/test/956-methodhandles/run
+++ b/test/933-misc-events/run
@@ -14,7 +14,8 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
+# This test checks whether dex files can be injected into parent classloaders. App images preload
+# classes, which will make the injection moot. Turn off app images to avoid the issue.
 
-./default-run "$@" --experimental method-handles
+./default-run "$@" --jvmti \
+                   --no-app-image
diff --git a/test/933-misc-events/src/Main.java b/test/933-misc-events/src/Main.java
new file mode 100644
index 0000000..89801a3
--- /dev/null
+++ b/test/933-misc-events/src/Main.java
@@ -0,0 +1,25 @@
+/*
+ * Copyright (C) 2017 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+public class Main {
+  public static void main(String[] args) throws Exception {
+    testSigQuit();
+
+    System.out.println("Done");
+  }
+
+  private static native void testSigQuit();
+}
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/934-load-transform/build
similarity index 86%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/934-load-transform/build
index a9f1822..898e2e5 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/934-load-transform/build
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/934-load-transform/expected.txt b/test/934-load-transform/expected.txt
new file mode 100644
index 0000000..2b60207
--- /dev/null
+++ b/test/934-load-transform/expected.txt
@@ -0,0 +1 @@
+Goodbye
diff --git a/test/934-load-transform/info.txt b/test/934-load-transform/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/934-load-transform/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/934-load-transform/run
similarity index 87%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/934-load-transform/run
index a9f1822..c6e62ae 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/934-load-transform/run
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-run "$@" --jvmti
diff --git a/test/934-load-transform/src/Main.java b/test/934-load-transform/src/Main.java
new file mode 100644
index 0000000..0b7f2689
--- /dev/null
+++ b/test/934-load-transform/src/Main.java
@@ -0,0 +1,66 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.util.Base64;
+public class Main {
+
+  /**
+   * base64 encoded class/dex file for
+   * class Transform {
+   *   public void sayHi() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAHAoABgAOCQAPABAIABEKABIAEwcAFAcAFQEABjxpbml0PgEAAygpVgEABENvZGUB" +
+    "AA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEAClNvdXJjZUZpbGUBAA5UcmFuc2Zvcm0uamF2YQwA" +
+    "BwAIBwAWDAAXABgBAAdHb29kYnllBwAZDAAaABsBAAlUcmFuc2Zvcm0BABBqYXZhL2xhbmcvT2Jq" +
+    "ZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxqYXZhL2lvL1ByaW50U3RyZWFtOwEAE2ph" +
+    "dmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExqYXZhL2xhbmcvU3RyaW5nOylWACAABQAG" +
+    "AAAAAAACAAAABwAIAAEACQAAAB0AAQABAAAABSq3AAGxAAAAAQAKAAAABgABAAAAEQABAAsACAAB" +
+    "AAkAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAoAAAAKAAIAAAATAAgAFAABAAwAAAACAA0=");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQCLXSBQ5FiS3f16krSYZFF8xYZtFVp0GRXMAgAAcAAAAHhWNBIAAAAAAAAAACwCAAAO" +
+    "AAAAcAAAAAYAAACoAAAAAgAAAMAAAAABAAAA2AAAAAQAAADgAAAAAQAAAAABAACsAQAAIAEAAGIB" +
+    "AABqAQAAcwEAAIABAACXAQAAqwEAAL8BAADTAQAA4wEAAOYBAADqAQAA/gEAAAMCAAAMAgAAAgAA" +
+    "AAMAAAAEAAAABQAAAAYAAAAIAAAACAAAAAUAAAAAAAAACQAAAAUAAABcAQAABAABAAsAAAAAAAAA" +
+    "AAAAAAAAAAANAAAAAQABAAwAAAACAAAAAAAAAAAAAAAAAAAAAgAAAAAAAAAHAAAAAAAAAB4CAAAA" +
+    "AAAAAQABAAEAAAATAgAABAAAAHAQAwAAAA4AAwABAAIAAAAYAgAACQAAAGIAAAAbAQEAAABuIAIA" +
+    "EAAOAAAAAQAAAAMABjxpbml0PgAHR29vZGJ5ZQALTFRyYW5zZm9ybTsAFUxqYXZhL2lvL1ByaW50" +
+    "U3RyZWFtOwASTGphdmEvbGFuZy9PYmplY3Q7ABJMamF2YS9sYW5nL1N0cmluZzsAEkxqYXZhL2xh" +
+    "bmcvU3lzdGVtOwAOVHJhbnNmb3JtLmphdmEAAVYAAlZMABJlbWl0dGVyOiBqYWNrLTMuMzYAA291" +
+    "dAAHcHJpbnRsbgAFc2F5SGkAEQAHDgATAAcOhQAAAAEBAICABKACAQG4Ag0AAAAAAAAAAQAAAAAA" +
+    "AAABAAAADgAAAHAAAAACAAAABgAAAKgAAAADAAAAAgAAAMAAAAAEAAAAAQAAANgAAAAFAAAABAAA" +
+    "AOAAAAAGAAAAAQAAAAABAAABIAAAAgAAACABAAABEAAAAQAAAFwBAAACIAAADgAAAGIBAAADIAAA" +
+    "AgAAABMCAAAAIAAAAQAAAB4CAAAAEAAAAQAAACwCAAA=");
+
+  public static void main(String[] args) {
+    doTest();
+  }
+
+  public static void doTest() {
+    addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
+    enableCommonRetransformation(true);
+    new Transform().sayHi();
+  }
+
+  // Transforms the class
+  private static native void enableCommonRetransformation(boolean enable);
+  private static native void addCommonTransformationResult(String target_name,
+                                                           byte[] class_bytes,
+                                                           byte[] dex_bytes);
+}
diff --git a/test/934-load-transform/src/Transform.java b/test/934-load-transform/src/Transform.java
new file mode 100644
index 0000000..f624c3a
--- /dev/null
+++ b/test/934-load-transform/src/Transform.java
@@ -0,0 +1,21 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+  public void sayHi() {
+    throw new Error("Should not be called!");
+  }
+}
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/935-non-retransformable/build
similarity index 86%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/935-non-retransformable/build
index a9f1822..898e2e5 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/935-non-retransformable/build
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-build "$@" --experimental agents
diff --git a/test/935-non-retransformable/expected.txt b/test/935-non-retransformable/expected.txt
new file mode 100644
index 0000000..ccd50a6
--- /dev/null
+++ b/test/935-non-retransformable/expected.txt
@@ -0,0 +1,6 @@
+Hello
+Hello
+Goodbye
+Hello
+Hello
+Goodbye
diff --git a/test/935-non-retransformable/info.txt b/test/935-non-retransformable/info.txt
new file mode 100644
index 0000000..875a5f6
--- /dev/null
+++ b/test/935-non-retransformable/info.txt
@@ -0,0 +1 @@
+Tests basic functions in the jvmti plugin.
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/935-non-retransformable/run
similarity index 87%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/935-non-retransformable/run
index a9f1822..c6e62ae 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/935-non-retransformable/run
@@ -14,7 +14,4 @@
 # See the License for the specific language governing permissions and
 # limitations under the License.
 
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
+./default-run "$@" --jvmti
diff --git a/test/935-non-retransformable/src/Main.java b/test/935-non-retransformable/src/Main.java
new file mode 100644
index 0000000..d9cc329
--- /dev/null
+++ b/test/935-non-retransformable/src/Main.java
@@ -0,0 +1,95 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.reflect.Method;
+import java.util.Base64;
+
+public class Main {
+
+  /**
+   * base64 encoded class/dex file for
+   * class Transform {
+   *   public void sayHi() {
+   *     System.out.println("Hello");
+   *   }
+   *   public void sayGoodbye() {
+   *    System.out.println("Goodbye");
+   *   }
+   * }
+   */
+  private static final byte[] CLASS_BYTES = Base64.getDecoder().decode(
+    "yv66vgAAADQAHwoABwAQCQARABIIABMKABQAFQgAFgcAFwcAGAEABjxpbml0PgEAAygpVgEABENv" +
+    "ZGUBAA9MaW5lTnVtYmVyVGFibGUBAAVzYXlIaQEACnNheUdvb2RieWUBAApTb3VyY2VGaWxlAQAO" +
+    "VHJhbnNmb3JtLmphdmEMAAgACQcAGQwAGgAbAQAFSGVsbG8HABwMAB0AHgEAB0dvb2RieWUBAAlU" +
+    "cmFuc2Zvcm0BABBqYXZhL2xhbmcvT2JqZWN0AQAQamF2YS9sYW5nL1N5c3RlbQEAA291dAEAFUxq" +
+    "YXZhL2lvL1ByaW50U3RyZWFtOwEAE2phdmEvaW8vUHJpbnRTdHJlYW0BAAdwcmludGxuAQAVKExq" +
+    "YXZhL2xhbmcvU3RyaW5nOylWACAABgAHAAAAAAADAAAACAAJAAEACgAAAB0AAQABAAAABSq3AAGx" +
+    "AAAAAQALAAAABgABAAAAAQABAAwACQABAAoAAAAlAAIAAQAAAAmyAAISA7YABLEAAAABAAsAAAAK" +
+    "AAIAAAADAAgABAABAA0ACQABAAoAAAAlAAIAAQAAAAmyAAISBbYABLEAAAABAAsAAAAKAAIAAAAG" +
+    "AAgABwABAA4AAAACAA8=");
+  private static final byte[] DEX_BYTES = Base64.getDecoder().decode(
+    "ZGV4CjAzNQDpaN+7jX/ZLl9Jr0HAEV7nqL1YDuakKakgAwAAcAAAAHhWNBIAAAAAAAAAAIACAAAQ" +
+    "AAAAcAAAAAYAAACwAAAAAgAAAMgAAAABAAAA4AAAAAUAAADoAAAAAQAAABABAADwAQAAMAEAAJYB" +
+    "AACeAQAApwEAAK4BAAC7AQAA0gEAAOYBAAD6AQAADgIAAB4CAAAhAgAAJQIAADkCAAA+AgAARwIA" +
+    "AFMCAAADAAAABAAAAAUAAAAGAAAABwAAAAkAAAAJAAAABQAAAAAAAAAKAAAABQAAAJABAAAEAAEA" +
+    "DAAAAAAAAAAAAAAAAAAAAA4AAAAAAAAADwAAAAEAAQANAAAAAgAAAAAAAAAAAAAAAAAAAAIAAAAA" +
+    "AAAACAAAAAAAAABrAgAAAAAAAAEAAQABAAAAWgIAAAQAAABwEAQAAAAOAAMAAQACAAAAXwIAAAkA" +
+    "AABiAAAAGwEBAAAAbiADABAADgAAAAMAAQACAAAAZQIAAAkAAABiAAAAGwECAAAAbiADABAADgAA" +
+    "AAEAAAADAAY8aW5pdD4AB0dvb2RieWUABUhlbGxvAAtMVHJhbnNmb3JtOwAVTGphdmEvaW8vUHJp" +
+    "bnRTdHJlYW07ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEv" +
+    "bGFuZy9TeXN0ZW07AA5UcmFuc2Zvcm0uamF2YQABVgACVkwAEmVtaXR0ZXI6IGphY2stNC4yMgAD" +
+    "b3V0AAdwcmludGxuAApzYXlHb29kYnllAAVzYXlIaQABAAcOAAYABw6HAAMABw6HAAAAAQIAgIAE" +
+    "sAIBAcgCAQHsAgAAAA0AAAAAAAAAAQAAAAAAAAABAAAAEAAAAHAAAAACAAAABgAAALAAAAADAAAA" +
+    "AgAAAMgAAAAEAAAAAQAAAOAAAAAFAAAABQAAAOgAAAAGAAAAAQAAABABAAABIAAAAwAAADABAAAB" +
+    "EAAAAQAAAJABAAACIAAAEAAAAJYBAAADIAAAAwAAAFoCAAAAIAAAAQAAAGsCAAAAEAAAAQAAAIAC" +
+    "AAA=");
+
+  public static void main(String[] args) {
+    doTest();
+  }
+
+  public static void doTest() {
+    addCommonTransformationResult("Transform", CLASS_BYTES, DEX_BYTES);
+    enableCommonRetransformation(true);
+    // Actually load the class.
+    Transform t = new Transform();
+    try {
+      // Call functions with reflection. Since the sayGoodbye function does not exist in the
+      // LTransform; when we compile this for the first time we need to use reflection.
+      Method hi = Transform.class.getMethod("sayHi");
+      Method bye = Transform.class.getMethod("sayGoodbye");
+      hi.invoke(t);
+      t.sayHi();
+      bye.invoke(t);
+      // Make sure we don't get called for transformation again.
+      addCommonTransformationResult("Transform", new byte[0], new byte[0]);
+      doCommonClassRetransformation(Transform.class);
+      hi.invoke(t);
+      t.sayHi();
+      bye.invoke(t);
+    } catch (Exception e) {
+      System.out.println("Unexpected error occured! " + e.toString());
+      e.printStackTrace();
+    }
+  }
+
+  // Transforms the class
+  private static native void doCommonClassRetransformation(Class<?>... klasses);
+  private static native void enableCommonRetransformation(boolean enable);
+  private static native void addCommonTransformationResult(String target_name,
+                                                           byte[] class_bytes,
+                                                           byte[] dex_bytes);
+}
diff --git a/test/935-non-retransformable/src/Transform.java b/test/935-non-retransformable/src/Transform.java
new file mode 100644
index 0000000..f624c3a
--- /dev/null
+++ b/test/935-non-retransformable/src/Transform.java
@@ -0,0 +1,21 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class Transform {
+  public void sayHi() {
+    throw new Error("Should not be called!");
+  }
+}
diff --git a/test/954-invoke-polymorphic-verifier/run b/test/953-invoke-polymorphic-compiler/build
similarity index 81%
copy from test/954-invoke-polymorphic-verifier/run
copy to test/953-invoke-polymorphic-compiler/build
index a9f1822..a423ca6 100755
--- a/test/954-invoke-polymorphic-verifier/run
+++ b/test/953-invoke-polymorphic-compiler/build
@@ -17,4 +17,9 @@
 # make us exit on a failure
 set -e
 
-./default-run "$@" --experimental method-handles
+if [[ $@ != *"--jvm"* ]]; then
+  # Don't do anything with jvm.
+  export USE_JACK=true
+fi
+
+./default-build "$@" --experimental method-handles
diff --git a/test/953-invoke-polymorphic-compiler/expected.txt b/test/953-invoke-polymorphic-compiler/expected.txt
new file mode 100644
index 0000000..f47ee23
--- /dev/null
+++ b/test/953-invoke-polymorphic-compiler/expected.txt
@@ -0,0 +1,25 @@
+Running Main.Min2Print2([33, -4])
+Running Main.Min2Print2([-4, 33])
+Running Main.Min2Print3([33, -4, 17])
+Running Main.Min2Print3([-4, 17, 33])
+Running Main.Min2Print3([17, 33, -4])
+Running Main.Min2Print6([33, -4, 77, 88, 99, 111])
+Running Main.Min2Print6([-4, 77, 88, 99, 111, 33])
+Running Main.Min2Print6([77, 88, 99, 111, 33, -4])
+Running Main.Min2Print6([88, 99, 111, 33, -4, 77])
+Running Main.Min2Print6([99, 111, 33, -4, 77, 88])
+Running Main.Min2Print6([111, 33, -4, 77, 88, 99])
+Running Main.Min2Print26([0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25])
+Running Main.Min2Print26([25, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24])
+Running Main.Min2Print26([24, 25, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23])
+BasicTest done.
+$opt$ReturnBooleanTest done.
+$opt$ReturnCharTest done.
+$opt$ReturnByteTest done.
+$opt$ReturnShortTest done.
+$opt$ReturnIntTest done.
+$opt$ReturnLongTest done.
+$opt$ReturnFloatTest done.
+$opt$ReturnDoubleTest done.
+$opt$ReturnStringTest done.
+ReturnValuesTest done.
diff --git a/test/953-invoke-polymorphic-compiler/info.txt b/test/953-invoke-polymorphic-compiler/info.txt
new file mode 100644
index 0000000..f1dbb61
--- /dev/null
+++ b/test/953-invoke-polymorphic-compiler/info.txt
@@ -0,0 +1,3 @@
+Tests for method handle invocations.
+
+NOTE: needs to run under ART or a Java 8 Language runtime and compiler.
diff --git a/test/953-invoke-polymorphic-compiler/src/Main.java b/test/953-invoke-polymorphic-compiler/src/Main.java
new file mode 100644
index 0000000..20a8fec
--- /dev/null
+++ b/test/953-invoke-polymorphic-compiler/src/Main.java
@@ -0,0 +1,374 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+import java.lang.invoke.MethodHandle;
+import java.lang.invoke.MethodHandles;
+import java.lang.invoke.MethodHandles.Lookup;
+import java.lang.invoke.MethodType;
+import java.lang.invoke.WrongMethodTypeException;
+import java.lang.reflect.Constructor;
+import java.lang.reflect.Field;
+import java.lang.reflect.Method;
+import java.nio.charset.Charset;
+import java.nio.charset.StandardCharsets;
+import java.util.ArrayList;
+import java.util.Arrays;
+import java.util.List;
+
+public class Main {
+  public static void assertTrue(boolean value) {
+    if (!value) {
+      throw new AssertionError("assertTrue value: " + value);
+    }
+  }
+
+  public static void assertFalse(boolean value) {
+    if (value) {
+      throw new AssertionError("assertTrue value: " + value);
+    }
+  }
+
+  public static void assertEquals(int i1, int i2) {
+    if (i1 == i2) { return; }
+    throw new AssertionError("assertEquals i1: " + i1 + ", i2: " + i2);
+  }
+
+  public static void assertEquals(long i1, long i2) {
+    if (i1 == i2) { return; }
+    throw new AssertionError("assertEquals l1: " + i1 + ", l2: " + i2);
+  }
+
+  public static void assertEquals(Object o, Object p) {
+    if (o == p) { return; }
+    if (o != null && p != null && o.equals(p)) { return; }
+    throw new AssertionError("assertEquals: o1: " + o + ", o2: " + p);
+  }
+
+  public static void assertEquals(String s1, String s2) {
+    if (s1 == s2) {
+      return;
+    }
+
+    if (s1 != null && s2 != null && s1.equals(s2)) {
+      return;
+    }
+
+    throw new AssertionError("assertEquals s1: " + s1 + ", s2: " + s2);
+  }
+
+  public static void fail() {
+    System.err.println("fail");
+    Thread.dumpStack();
+  }
+
+  public static void fail(String message) {
+    System.err.println("fail: " + message);
+    Thread.dumpStack();
+  }
+
+  public static int Min2Print2(int a, int b) {
+    int[] values = new int[] { a, b };
+    System.err.println("Running Main.Min2Print2(" + Arrays.toString(values) + ")");
+    return a > b ? a : b;
+  }
+
+  public static int Min2Print3(int a, int b, int c) {
+    int[] values = new int[] { a, b, c };
+    System.err.println("Running Main.Min2Print3(" + Arrays.toString(values) + ")");
+    return a > b ? a : b;
+  }
+
+  public static int Min2Print6(int a, int b, int c, int d, int e, int f) {
+    int[] values = new int[] { a, b, c, d, e, f };
+    System.err.println("Running Main.Min2Print6(" + Arrays.toString(values) + ")");
+    return a > b ? a : b;
+  }
+
+  public static int Min2Print26(int a, int b, int c, int d,
+                                int e, int f, int g, int h,
+                                int i, int j, int k, int l,
+                                int m, int n, int o, int p,
+                                int q, int r, int s, int t,
+                                int u, int v, int w, int x,
+                                int y, int z) {
+    int[] values = new int[] { a, b, c, d, e, f, g, h, i, j, k, l, m,
+                               n, o, p, q, r, s, t, u, v, w, x, y, z };
+    System.err.println("Running Main.Min2Print26(" + Arrays.toString(values) + ")");
+    return a > b ? a : b;
+  }
+
+  public static void $opt$BasicTest() throws Throwable {
+    MethodHandle mh;
+    mh = MethodHandles.lookup().findStatic(
+        Main.class, "Min2Print2", MethodType.methodType(int.class, int.class, int.class));
+    assertEquals((int) mh.invokeExact(33, -4), 33);
+    assertEquals((int) mh.invokeExact(-4, 33), 33);
+
+    mh = MethodHandles.lookup().findStatic(
+        Main.class, "Min2Print3",
+        MethodType.methodType(int.class, int.class, int.class, int.class));
+    assertEquals((int) mh.invokeExact(33, -4, 17), 33);
+    assertEquals((int) mh.invokeExact(-4, 17, 33), 17);
+    assertEquals((int) mh.invokeExact(17, 33, -4), 33);
+
+    mh = MethodHandles.lookup().findStatic(
+        Main.class, "Min2Print6",
+        MethodType.methodType(
+            int.class, int.class, int.class, int.class, int.class, int.class, int.class));
+    assertEquals((int) mh.invokeExact(33, -4, 77, 88, 99, 111), 33);
+    try {
+        // Too few arguments
+        assertEquals((int) mh.invokeExact(33, -4, 77, 88), 33);
+        fail("No WMTE for too few arguments");
+    } catch (WrongMethodTypeException e) {}
+    try {
+        // Too many arguments
+        assertEquals((int) mh.invokeExact(33, -4, 77, 88, 89, 90, 91), 33);
+        fail("No WMTE for too many arguments");
+    } catch (WrongMethodTypeException e) {}
+    assertEquals((int) mh.invokeExact(-4, 77, 88, 99, 111, 33), 77);
+    assertEquals((int) mh.invokeExact(77, 88, 99, 111, 33, -4), 88);
+    assertEquals((int) mh.invokeExact(88, 99, 111, 33, -4, 77), 99);
+    assertEquals((int) mh.invokeExact(99, 111, 33, -4, 77, 88), 111);
+    assertEquals((int) mh.invokeExact(111, 33, -4, 77, 88, 99), 111);
+
+    // A preposterous number of arguments.
+    mh = MethodHandles.lookup().findStatic(
+        Main.class, "Min2Print26",
+        MethodType.methodType(
+            // Return-type
+            int.class,
+            // Arguments
+            int.class, int.class, int.class, int.class, int.class, int.class, int.class, int.class,
+            int.class, int.class, int.class, int.class, int.class, int.class, int.class, int.class,
+            int.class, int.class, int.class, int.class, int.class, int.class, int.class, int.class,
+            int.class, int.class));
+    assertEquals(1, (int) mh.invokeExact(0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
+                                         13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25));
+    assertEquals(25, (int) mh.invokeExact(25, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
+                                         13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24));
+    assertEquals(25, (int) mh.invokeExact(24, 25, 0, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,
+                                         13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23));
+
+    try {
+        // Wrong argument type
+        mh.invokeExact("a");
+        fail("No WMTE for wrong arguments");
+    } catch (WrongMethodTypeException wmte) {}
+
+    try {
+        // Invoke on null handle.
+        MethodHandle mh0 = null;
+        mh0.invokeExact("bad");
+        fail("No NPE for you");
+    } catch (NullPointerException npe) {}
+
+    System.err.println("BasicTest done.");
+  }
+
+  private static boolean And(boolean lhs, boolean rhs) {
+    return lhs & rhs;
+  }
+
+  private static boolean Xor(boolean lhs, boolean rhs) {
+    return lhs ^ rhs;
+  }
+
+  private static String Multiply(String value, int n) {
+    String result = "";
+    for (int i = 0; i < n; ++i) {
+      result = value + result;
+    }
+    return result;
+  }
+
+  private static byte Multiply(byte value, byte n) {
+    return (byte)(value * n);
+  }
+
+  private static short Multiply(short value, short n) {
+    return (short)(value * n);
+  }
+
+  private static int Multiply(int value, int n) {
+    return value * n;
+  }
+
+  private static long Multiply(long value, long n) {
+    return value * n;
+  }
+
+  private static float Multiply(float value, float n) {
+    return value * n;
+  }
+
+  private static double Multiply(double value, double n) {
+    return value * n;
+  }
+
+  private static char Next(char c) {
+    return (char)(c + 1);
+  }
+
+  public static void $opt$ReturnBooleanTest() throws Throwable {
+    MethodHandles.Lookup lookup = MethodHandles.lookup();
+    MethodHandle mh =
+            lookup.findStatic(Main.class, "And",
+                              MethodType.methodType(boolean.class, boolean.class, boolean.class));
+    assertEquals(true, (boolean) mh.invokeExact(true, true));
+    assertEquals(false, (boolean) mh.invokeExact(true, false));
+    assertEquals(false, (boolean) mh.invokeExact(false, true));
+    assertEquals(false, (boolean) mh.invokeExact(false, false));
+    assertEquals(true, (boolean) mh.invoke(true, true));
+    assertEquals(false, (boolean) mh.invoke(true, false));
+    assertEquals(false, (boolean) mh.invoke(false, true));
+    assertEquals(false, (boolean) mh.invoke(false, false));
+
+    mh = lookup.findStatic(Main.class, "Xor",
+                           MethodType.methodType(boolean.class, boolean.class, boolean.class));
+    assertEquals(false, (boolean) mh.invokeExact(true, true));
+    assertEquals(true, (boolean) mh.invokeExact(true, false));
+    assertEquals(true, (boolean) mh.invokeExact(false, true));
+    assertEquals(false, (boolean) mh.invokeExact(false, false));
+    assertEquals(false, (boolean) mh.invoke(true, true));
+    assertEquals(true, (boolean) mh.invoke(true, false));
+    assertEquals(true, (boolean) mh.invoke(false, true));
+    assertEquals(false, (boolean) mh.invoke(false, false));
+
+    System.err.println("$opt$ReturnBooleanTest done.");
+  }
+
+  public static void $opt$ReturnCharTest() throws Throwable {
+    MethodHandles.Lookup lookup = MethodHandles.lookup();
+    MethodHandle mh = lookup.findStatic(Main.class, "Next",
+                           MethodType.methodType(char.class, char.class));
+    assertEquals('B', (char) mh.invokeExact('A'));
+    assertEquals((char) -55, (char) mh.invokeExact((char) -56));
+    System.err.println("$opt$ReturnCharTest done.");
+  }
+
+  public static void $opt$ReturnByteTest() throws Throwable {
+    MethodHandles.Lookup lookup = MethodHandles.lookup();
+    MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+                                         MethodType.methodType(byte.class, byte.class, byte.class));
+    assertEquals((byte) 30, (byte) mh.invokeExact((byte) 10, (byte) 3));
+    assertEquals((byte) -90, (byte) mh.invoke((byte) -10, (byte) 9));
+    System.err.println("$opt$ReturnByteTest done.");
+  }
+
+  public static void $opt$ReturnShortTest() throws Throwable {
+    MethodHandles.Lookup lookup = MethodHandles.lookup();
+    MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+                           MethodType.methodType(short.class, short.class, short.class));
+    assertEquals((short) 3000, (short) mh.invokeExact((short) 1000, (short) 3));
+    assertEquals((short) -3000, (short) mh.invoke((short) -1000, (short) 3));
+    System.err.println("$opt$ReturnShortTest done.");
+  }
+
+  public static void $opt$ReturnIntTest() throws Throwable {
+    MethodHandles.Lookup lookup = MethodHandles.lookup();
+    MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+                           MethodType.methodType(int.class, int.class, int.class));
+    assertEquals(3_000_000, (int) mh.invokeExact(1_000_000, 3));
+    assertEquals(-3_000_000, (int) mh.invoke(-1_000, 3_000));
+    System.err.println("$opt$ReturnIntTest done.");
+  }
+
+  public static void $opt$ReturnLongTest() throws Throwable {
+    MethodHandles.Lookup lookup = MethodHandles.lookup();
+    MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+                           MethodType.methodType(long.class, long.class, long.class));
+    assertEquals(4_294_967_295_000L, (long) mh.invokeExact(1000L, 4_294_967_295L));
+    assertEquals(-4_294_967_295_000L, (long) mh.invoke(-1000L, 4_294_967_295L));
+    System.err.println("$opt$ReturnLongTest done.");
+  }
+
+  public static void $opt$ReturnFloatTest() throws Throwable {
+    MethodHandles.Lookup lookup = MethodHandles.lookup();
+    MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+                           MethodType.methodType(float.class, float.class, float.class));
+    assertEquals(3.0F, (float) mh.invokeExact(1000.0F, 3e-3F));
+    assertEquals(-3.0F, (float) mh.invoke(-1000.0F, 3e-3F));
+    System.err.println("$opt$ReturnFloatTest done.");
+  }
+
+  public static void $opt$ReturnDoubleTest() throws Throwable {
+    MethodHandles.Lookup lookup = MethodHandles.lookup();
+    MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+                           MethodType.methodType(double.class, double.class, double.class));
+    assertEquals(3033000.0, (double) mh.invokeExact(1000.0, 3.033e3));
+    assertEquals(-3033000.0, (double) mh.invoke(-1000.0, 3.033e3));
+    System.err.println("$opt$ReturnDoubleTest done.");
+  }
+
+  public static void $opt$ReturnStringTest() throws Throwable {
+    MethodHandles.Lookup lookup = MethodHandles.lookup();
+    MethodHandle mh = lookup.findStatic(Main.class, "Multiply",
+                           MethodType.methodType(String.class, String.class, int.class));
+    assertEquals("100010001000", (String) mh.invokeExact("1000", 3));
+    assertEquals("100010001000", (String) mh.invoke("1000", 3));
+    System.err.println("$opt$ReturnStringTest done.");
+  }
+
+  public static void ReturnValuesTest() throws Throwable {
+    $opt$ReturnBooleanTest();
+    $opt$ReturnCharTest();
+    $opt$ReturnByteTest();
+    $opt$ReturnShortTest();
+    $opt$ReturnIntTest();
+    $opt$ReturnLongTest();
+    $opt$ReturnFloatTest();
+    $opt$ReturnDoubleTest();
+    $opt$ReturnStringTest();
+    System.err.println("ReturnValuesTest done.");
+  }
+
+  static class ValueHolder {
+    public boolean m_z;
+    public static boolean s_z;
+  }
+
+  public static void $opt$AccessorsTest() throws Throwable {
+    ValueHolder valueHolder = new ValueHolder();
+    MethodHandles.Lookup lookup = MethodHandles.lookup();
+
+    MethodHandle setMember = lookup.findSetter(ValueHolder.class, "m_z", boolean.class);
+    MethodHandle getMember = lookup.findGetter(ValueHolder.class, "m_z", boolean.class);
+    MethodHandle setStatic = lookup.findStaticSetter(ValueHolder.class, "s_z", boolean.class);
+    MethodHandle getStatic = lookup.findStaticGetter(ValueHolder.class, "s_z", boolean.class);
+
+    boolean [] values = { false, true, false, true, false };
+    for (boolean value : values) {
+      assertEquals((boolean) getStatic.invoke(), ValueHolder.s_z);
+      setStatic.invoke(value);
+      ValueHolder.s_z = value;
+      assertEquals(ValueHolder.s_z, value);
+      assertEquals((boolean) getStatic.invoke(), value);
+
+      assertEquals((boolean) getMember.invoke(valueHolder), valueHolder.m_z);
+      setMember.invoke(valueHolder, value);
+      valueHolder.m_z = value;
+      assertEquals(valueHolder.m_z, value);
+      assertEquals((boolean) getMember.invoke(valueHolder), value);
+    }
+  }
+
+  public static void main(String[] args) throws Throwable {
+    $opt$BasicTest();
+    ReturnValuesTest();
+    $opt$AccessorsTest();
+  }
+}
diff --git a/test/955-methodhandles-smali/run b/test/955-methodhandles-smali/run
deleted file mode 100755
index a9f1822..0000000
--- a/test/955-methodhandles-smali/run
+++ /dev/null
@@ -1,20 +0,0 @@
-#!/bin/bash
-#
-# Copyright 2016 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-#      http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
diff --git a/test/956-methodhandles/src/Main.java b/test/956-methodhandles/src/Main.java
index 17b56b4..f8daba6 100644
--- a/test/956-methodhandles/src/Main.java
+++ b/test/956-methodhandles/src/Main.java
@@ -76,6 +76,7 @@
     testStringConstructors();
     testReturnValueConversions();
     testVariableArity();
+    testVariableArity_MethodHandles_bind();
   }
 
   public static void testfindSpecial_invokeSuperBehaviour() throws Throwable {
@@ -1466,4 +1467,23 @@
       fail();
     } catch (WrongMethodTypeException e) {}
   }
+
+  // The same tests as the above, except that we use use MethodHandles.bind instead of
+  // MethodHandle.bindTo.
+  public static void testVariableArity_MethodHandles_bind() throws Throwable {
+    VariableArityTester vat = new VariableArityTester();
+    MethodHandle mh = MethodHandles.lookup().bind(vat, "update",
+            MethodType.methodType(String.class, boolean[].class));
+    assertTrue(mh.isVarargsCollector());
+
+    assertEquals("[]", mh.invoke());
+    assertEquals("[true, false, true]", mh.invoke(true, false, true));
+    assertEquals("[true, false, true]", mh.invoke(new boolean[] { true, false, true}));
+    assertEquals("[false, true]", mh.invoke(Boolean.valueOf(false), Boolean.valueOf(true)));
+
+    try {
+      mh.invoke(true, true, 0);
+      fail();
+    } catch (WrongMethodTypeException e) {}
+  }
 }
diff --git a/test/957-methodhandle-transforms/expected.txt b/test/957-methodhandle-transforms/expected.txt
index 7540ef7..05b80e7 100644
--- a/test/957-methodhandle-transforms/expected.txt
+++ b/test/957-methodhandle-transforms/expected.txt
@@ -16,3 +16,46 @@
 fallback: fallback, 42, 56
 target: target, 42, 56
 target: target, 42, 56
+a: a, b:b, c: c
+a: a, b:b, c: c
+a: a, b:b, c: c
+a: a, b:b, c: c
+a: a, b:b, c: c
+a: a, b:b, c: c
+a: a, b:b, c: c
+a: a, b:43
+a: a, b:43
+a: a, b:43
+a: a, b:43
+a: a, b:43
+a: a, b:b, c: c
+a: a, b:b, c: c
+a: a, b:b, c: c
+a: a, b:true, c: false
+a: a, b:true, c: false
+a: a, b:1, c: 2, d: 3, e: 4, f:5, g: 6.0, h: 7.0
+a: a, b:1, c: 2, d: 3, e: 4, f:5, g: 6.0, h: 7.0
+a: a, b:1, c: 2, d: 51, e: 52, f:53.0, g: 54.0
+a: a, b:1, c: 2, d: 51, e: 52, f:53.0, g: 54.0
+a: a, b:1, c: 2, d: 3, e: 4, f:5.0, g:6.0
+a: a, b:1, c: 2, d: 3, e: 4, f:5.0, g:6.0
+a: a, b:1, c: 2, d: 3, e: 4.0, f:5.0
+a: a, b:1, c: 2, d: 3, e: 4.0, f:5.0
+a: a, b:1, c: 2, d: 3.0, e: 4.0
+a: a, b:1, c: 2, d: 3.0, e: 4.0
+a: a, b:1.0, c: 2.0, d: 3.0
+a: a, b:1.0, c: 2.0, d: 3.0
+a: a, b:1.0, c: 2.0
+a: a, b:1.0, c: 2.0
+a: a, b:b, c: c
+a: a, b:b, c: c
+a: a, b:43
+a: a, b:b, c: c
+a: a, b:true, c: false
+a: a, b:1, c: 2
+a: a, b:a, c: b
+a: a, b:3, c: 4
+a: a, b:42, c: 43
+a: a, b:100, c: 99
+a: a, b:8.9, c: 9.1
+a: a, b:6.7, c: 7.8
diff --git a/test/957-methodhandle-transforms/run b/test/957-methodhandle-transforms/run
deleted file mode 100755
index a9f1822..0000000
--- a/test/957-methodhandle-transforms/run
+++ /dev/null
@@ -1,20 +0,0 @@
-#!/bin/bash
-#
-# Copyright 2016 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-#      http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
diff --git a/test/957-methodhandle-transforms/src/Main.java b/test/957-methodhandle-transforms/src/Main.java
index 5806509..4035857 100644
--- a/test/957-methodhandle-transforms/src/Main.java
+++ b/test/957-methodhandle-transforms/src/Main.java
@@ -33,6 +33,11 @@
     testBindTo();
     testFilterReturnValue();
     testPermuteArguments();
+    testInvokers();
+    testSpreaders_reference();
+    testSpreaders_primitive();
+    testInvokeWithArguments();
+    testAsCollector();
   }
 
   public static void testThrowException() throws Throwable {
@@ -40,17 +45,17 @@
         IllegalArgumentException.class);
 
     if (handle.type().returnType() != String.class) {
-      System.out.println("Unexpected return type for handle: " + handle +
+      fail("Unexpected return type for handle: " + handle +
           " [ " + handle.type() + "]");
     }
 
     final IllegalArgumentException iae = new IllegalArgumentException("boo!");
     try {
       handle.invoke(iae);
-      System.out.println("Expected an exception of type: java.lang.IllegalArgumentException");
+      fail("Expected an exception of type: java.lang.IllegalArgumentException");
     } catch (IllegalArgumentException expected) {
       if (expected != iae) {
-        System.out.println("Wrong exception: expected " + iae + " but was " + expected);
+        fail("Wrong exception: expected " + iae + " but was " + expected);
       }
     }
   }
@@ -262,7 +267,7 @@
       array[0] = 42;
       int value = (int) getter.invoke(array, 0);
       if (value != 42) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
 
       try {
@@ -284,7 +289,7 @@
       array[0] = 42;
       long value = (long) getter.invoke(array, 0);
       if (value != 42l) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -294,7 +299,7 @@
       array[0] = 42;
       short value = (short) getter.invoke(array, 0);
       if (value != 42l) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -304,7 +309,7 @@
       array[0] = 42;
       char value = (char) getter.invoke(array, 0);
       if (value != 42l) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -314,7 +319,7 @@
       array[0] = (byte) 0x8;
       byte value = (byte) getter.invoke(array, 0);
       if (value != (byte) 0x8) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -324,7 +329,7 @@
       array[0] = true;
       boolean value = (boolean) getter.invoke(array, 0);
       if (!value) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -334,7 +339,7 @@
       array[0] = 42.0f;
       float value = (float) getter.invoke(array, 0);
       if (value != 42.0f) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -344,7 +349,7 @@
       array[0] = 42.0;
       double value = (double) getter.invoke(array, 0);
       if (value != 42.0) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -372,10 +377,10 @@
       setter.invoke(array, 1, 43);
 
       if (array[0] != 42) {
-        System.out.println("Unexpected value: " + array[0]);
+        fail("Unexpected value: " + array[0]);
       }
       if (array[1] != 43) {
-        System.out.println("Unexpected value: " + array[1]);
+        fail("Unexpected value: " + array[1]);
       }
 
       try {
@@ -396,7 +401,7 @@
       long[] array = new long[1];
       setter.invoke(array, 0, 42l);
       if (array[0] != 42l) {
-        System.out.println("Unexpected value: " + array[0]);
+        fail("Unexpected value: " + array[0]);
       }
     }
 
@@ -405,7 +410,7 @@
       short[] array = new short[1];
       setter.invoke(array, 0, (short) 42);
       if (array[0] != 42l) {
-        System.out.println("Unexpected value: " + array[0]);
+        fail("Unexpected value: " + array[0]);
       }
     }
 
@@ -414,7 +419,7 @@
       char[] array = new char[1];
       setter.invoke(array, 0, (char) 42);
       if (array[0] != 42) {
-        System.out.println("Unexpected value: " + array[0]);
+        fail("Unexpected value: " + array[0]);
       }
     }
 
@@ -423,7 +428,7 @@
       byte[] array = new byte[1];
       setter.invoke(array, 0, (byte) 0x8);
       if (array[0] != (byte) 0x8) {
-        System.out.println("Unexpected value: " + array[0]);
+        fail("Unexpected value: " + array[0]);
       }
     }
 
@@ -432,7 +437,7 @@
       boolean[] array = new boolean[1];
       setter.invoke(array, 0, true);
       if (!array[0]) {
-        System.out.println("Unexpected value: " + array[0]);
+        fail("Unexpected value: " + array[0]);
       }
     }
 
@@ -441,7 +446,7 @@
       float[] array = new float[1];
       setter.invoke(array, 0, 42.0f);
       if (array[0] != 42.0f) {
-        System.out.println("Unexpected value: " + array[0]);
+        fail("Unexpected value: " + array[0]);
       }
     }
 
@@ -450,7 +455,7 @@
       double[] array = new double[1];
       setter.invoke(array, 0, 42.0);
       if (array[0] != 42.0) {
-        System.out.println("Unexpected value: " + array[0]);
+        fail("Unexpected value: " + array[0]);
       }
     }
 
@@ -471,7 +476,7 @@
       MethodHandle identity = MethodHandles.identity(boolean.class);
       boolean value = (boolean) identity.invoke(false);
       if (value) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -479,7 +484,7 @@
       MethodHandle identity = MethodHandles.identity(byte.class);
       byte value = (byte) identity.invoke((byte) 0x8);
       if (value != (byte) 0x8) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -487,7 +492,7 @@
       MethodHandle identity = MethodHandles.identity(char.class);
       char value = (char) identity.invoke((char) -56);
       if (value != (char) -56) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -495,7 +500,7 @@
       MethodHandle identity = MethodHandles.identity(short.class);
       short value = (short) identity.invoke((short) -59);
       if (value != (short) -59) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + Short.toString(value));
       }
     }
 
@@ -503,7 +508,7 @@
       MethodHandle identity = MethodHandles.identity(int.class);
       int value = (int) identity.invoke(52);
       if (value != 52) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -511,7 +516,7 @@
       MethodHandle identity = MethodHandles.identity(long.class);
       long value = (long) identity.invoke(-76l);
       if (value != (long) -76) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -519,7 +524,7 @@
       MethodHandle identity = MethodHandles.identity(float.class);
       float value = (float) identity.invoke(56.0f);
       if (value != (float) 56.0f) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -527,7 +532,7 @@
       MethodHandle identity = MethodHandles.identity(double.class);
       double value = (double) identity.invoke((double) 72.0);
       if (value != (double) 72.0) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -544,28 +549,28 @@
       MethodHandle constant = MethodHandles.constant(int.class, 56);
       int value = (int) constant.invoke();
       if (value != 56) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
 
       // short constant values are converted to int.
       constant = MethodHandles.constant(int.class, (short) 52);
       value = (int) constant.invoke();
       if (value != 52) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
 
       // char constant values are converted to int.
       constant = MethodHandles.constant(int.class, (char) 'b');
       value = (int) constant.invoke();
       if (value != (int) 'b') {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
 
       // int constant values are converted to int.
       constant = MethodHandles.constant(int.class, (byte) 0x1);
       value = (int) constant.invoke();
       if (value != 1) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
 
       // boolean, float, double and long primitive constants are not convertible
@@ -600,13 +605,13 @@
       MethodHandle constant = MethodHandles.constant(long.class, 56l);
       long value = (long) constant.invoke();
       if (value != 56l) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
 
       constant = MethodHandles.constant(long.class, (int) 56);
       value = (long) constant.invoke();
       if (value != 56l) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -615,7 +620,7 @@
       MethodHandle constant = MethodHandles.constant(byte.class, (byte) 0x12);
       byte value = (byte) constant.invoke();
       if (value != (byte) 0x12) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -624,7 +629,7 @@
       MethodHandle constant = MethodHandles.constant(boolean.class, true);
       boolean value = (boolean) constant.invoke();
       if (!value) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -633,7 +638,7 @@
       MethodHandle constant = MethodHandles.constant(char.class, 'f');
       char value = (char) constant.invoke();
       if (value != 'f') {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -642,7 +647,7 @@
       MethodHandle constant = MethodHandles.constant(short.class, (short) 123);
       short value = (short) constant.invoke();
       if (value != (short) 123) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -651,7 +656,7 @@
       MethodHandle constant = MethodHandles.constant(float.class, 56.0f);
       float value = (float) constant.invoke();
       if (value != 56.0f) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -660,7 +665,7 @@
       MethodHandle constant = MethodHandles.constant(double.class, 256.0);
       double value = (double) constant.invoke();
       if (value != 256.0) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -678,13 +683,13 @@
 
     char value = (char) stringCharAt.invoke("foo", 0);
     if (value != 'f') {
-      System.out.println("Unexpected value: " + value);
+      fail("Unexpected value: " + value);
     }
 
     MethodHandle bound = stringCharAt.bindTo("foo");
     value = (char) bound.invoke(0);
     if (value != 'f') {
-      System.out.println("Unexpected value: " + value);
+      fail("Unexpected value: " + value);
     }
 
     try {
@@ -706,7 +711,7 @@
     bound = integerParseInt.bindTo("78452");
     int intValue = (int) bound.invoke();
     if (intValue != 78452) {
-      System.out.println("Unexpected value: " + intValue);
+      fail("Unexpected value: " + intValue);
     }
   }
 
@@ -745,11 +750,11 @@
 
       boolean value = (boolean) adapter.invoke((int) 42);
       if (!value) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
       value = (boolean) adapter.invoke((int) 43);
       if (value) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -764,7 +769,7 @@
 
       int value = (int) adapter.invoke("56");
       if (value != 57) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
 
@@ -779,7 +784,7 @@
 
       int value = (int) adapter.invoke();
       if (value != 42) {
-        System.out.println("Unexpected value: " + value);
+        fail("Unexpected value: " + value);
       }
     }
   }
@@ -791,7 +796,7 @@
       return;
     }
 
-    System.out.println("Unexpected arguments: " + a + ", " + b + ", " + c
+    fail("Unexpected arguments: " + a + ", " + b + ", " + c
         + ", " + d + ", " + e + ", " + f + ", " + g + ", " + h);
   }
 
@@ -800,7 +805,7 @@
       return;
     }
 
-    System.out.println("Unexpected arguments: " + a + ", " + b);
+    fail("Unexpected arguments: " + a + ", " + b);
   }
 
   public static void testPermuteArguments() throws Throwable {
@@ -888,11 +893,501 @@
     }
   }
 
+  private static Object returnBar() {
+    return "bar";
+  }
+
+  public static void testInvokers() throws Throwable {
+    final MethodType targetType = MethodType.methodType(String.class, String.class);
+    final MethodHandle target = MethodHandles.lookup().findVirtual(
+        String.class, "concat", targetType);
+
+    MethodHandle invoker = MethodHandles.invoker(target.type());
+    assertEquals("barbar", (String) invoker.invoke(target, "bar", "bar"));
+    assertEquals("barbar", (String) invoker.invoke(target, (Object) returnBar(), "bar"));
+    try {
+      String foo = (String) invoker.invoke(target, "bar", "bar", 24);
+      fail();
+    } catch (WrongMethodTypeException expected) {
+    }
+
+    MethodHandle exactInvoker = MethodHandles.exactInvoker(target.type());
+    assertEquals("barbar", (String) exactInvoker.invoke(target, "bar", "bar"));
+    try {
+      String foo = (String) exactInvoker.invoke(target, (Object) returnBar(), "bar");
+      fail();
+    } catch (WrongMethodTypeException expected) {
+    }
+    try {
+      String foo = (String) exactInvoker.invoke(target, "bar", "bar", 24);
+      fail();
+    } catch (WrongMethodTypeException expected) {
+    }
+  }
+
+  public static int spreadReferences(String a, String b, String c) {
+    System.out.println("a: " + a + ", b:" + b + ", c: " + c);
+    return 42;
+  }
+
+  public static int spreadReferences_Unbox(String a, int b) {
+    System.out.println("a: " + a + ", b:" + b);
+    return 43;
+  }
+
+  public static void testSpreaders_reference() throws Throwable {
+    MethodType methodType = MethodType.methodType(int.class,
+        new Class<?>[] { String.class, String.class, String.class });
+    MethodHandle delegate = MethodHandles.lookup().findStatic(
+        Main.class, "spreadReferences", methodType);
+
+    // Basic checks on array lengths.
+    //
+    // Array size = 0
+    MethodHandle mhAsSpreader = delegate.asSpreader(String[].class, 0);
+    int ret = (int) mhAsSpreader.invoke("a", "b", "c", new String[] {});
+    assertEquals(42, ret);
+    // Array size = 1
+    mhAsSpreader = delegate.asSpreader(String[].class, 1);
+    ret = (int) mhAsSpreader.invoke("a", "b", new String[] { "c" });
+    assertEquals(42, ret);
+    // Array size = 2
+    mhAsSpreader = delegate.asSpreader(String[].class, 2);
+    ret = (int) mhAsSpreader.invoke("a", new String[] { "b", "c" });
+    assertEquals(42, ret);
+    // Array size = 3
+    mhAsSpreader = delegate.asSpreader(String[].class, 3);
+    ret = (int) mhAsSpreader.invoke(new String[] { "a", "b", "c"});
+    assertEquals(42, ret);
+
+    // Exception case, array size = 4 is illegal.
+    try {
+      delegate.asSpreader(String[].class, 4);
+      fail();
+    } catch (IllegalArgumentException expected) {
+    }
+
+    // Exception case, calling with an arg of the wrong size.
+    // Array size = 3
+    mhAsSpreader = delegate.asSpreader(String[].class, 3);
+    try {
+      ret = (int) mhAsSpreader.invoke(new String[] { "a", "b"});
+    } catch (IllegalArgumentException expected) {
+    }
+
+    // Various other hijinks, pass as Object[] arrays, Object etc.
+    mhAsSpreader = delegate.asSpreader(Object[].class, 2);
+    ret = (int) mhAsSpreader.invoke("a", new String[] { "b", "c" });
+    assertEquals(42, ret);
+
+    mhAsSpreader = delegate.asSpreader(Object[].class, 2);
+    ret = (int) mhAsSpreader.invoke("a", new Object[] { "b", "c" });
+    assertEquals(42, ret);
+
+    mhAsSpreader = delegate.asSpreader(Object[].class, 2);
+    ret = (int) mhAsSpreader.invoke("a", (Object) new Object[] { "b", "c" });
+    assertEquals(42, ret);
+
+    // Test implicit unboxing.
+    MethodType methodType2 = MethodType.methodType(int.class,
+        new Class<?>[] { String.class, int.class });
+    MethodHandle delegate2 = MethodHandles.lookup().findStatic(
+        Main.class, "spreadReferences_Unbox", methodType2);
+
+    // .. with an Integer[] array.
+    mhAsSpreader = delegate2.asSpreader(Integer[].class, 1);
+    ret = (int) mhAsSpreader.invoke("a", new Integer[] { 43 });
+    assertEquals(43, ret);
+
+    // .. with an Integer[] array declared as an Object[] argument type.
+    mhAsSpreader = delegate2.asSpreader(Object[].class, 1);
+    ret = (int) mhAsSpreader.invoke("a", new Integer[] { 43 });
+    assertEquals(43, ret);
+
+    // .. with an Object[] array.
+    mhAsSpreader = delegate2.asSpreader(Object[].class, 1);
+    ret = (int) mhAsSpreader.invoke("a", new Object[] { Integer.valueOf(43)});
+    assertEquals(43, ret);
+
+    // -- Part 2--
+    // Run a subset of these tests on MethodHandles.spreadInvoker, which only accepts
+    // a trailing argument type of Object[].
+    MethodHandle spreadInvoker = MethodHandles.spreadInvoker(methodType2, 1);
+    ret = (int) spreadInvoker.invoke(delegate2, "a", new Object[] { Integer.valueOf(43)});
+    assertEquals(43, ret);
+
+    ret = (int) spreadInvoker.invoke(delegate2, "a", new Integer[] { 43 });
+    assertEquals(43, ret);
+
+    // NOTE: Annoyingly, the second argument here is leadingArgCount and not
+    // arrayLength.
+    spreadInvoker = MethodHandles.spreadInvoker(methodType, 3);
+    ret = (int) spreadInvoker.invoke(delegate, "a", "b", "c", new String[] {});
+    assertEquals(42, ret);
+
+    spreadInvoker = MethodHandles.spreadInvoker(methodType, 0);
+    ret = (int) spreadInvoker.invoke(delegate, new String[] { "a", "b", "c" });
+    assertEquals(42, ret);
+
+    // Exact invokes: Double check that the expected parameter type is
+    // Object[] and not T[].
+    try {
+      spreadInvoker.invokeExact(delegate, new String[] { "a", "b", "c" });
+      fail();
+    } catch (WrongMethodTypeException expected) {
+    }
+
+    ret = (int) spreadInvoker.invoke(delegate, new Object[] { "a", "b", "c" });
+    assertEquals(42, ret);
+  }
+
+  public static int spreadBoolean(String a, Boolean b, boolean c) {
+    System.out.println("a: " + a + ", b:" + b + ", c: " + c);
+    return 44;
+  }
+
+  public static int spreadByte(String a, Byte b, byte c,
+      short d, int e, long f, float g, double h) {
+    System.out.println("a: " + a + ", b:" + b + ", c: " + c +
+        ", d: " + d + ", e: " + e + ", f:" + f + ", g: " + g +
+        ", h: " + h);
+    return 45;
+  }
+
+  public static int spreadChar(String a, Character b, char c,
+      int d, long e, float f, double g) {
+    System.out.println("a: " + a + ", b:" + b + ", c: " + c +
+        ", d: " + d + ", e: " + e + ", f:" + f + ", g: " + g);
+    return 46;
+  }
+
+  public static int spreadShort(String a, Short b, short c,
+      int d, long e, float f, double g) {
+    System.out.println("a: " + a + ", b:" + b + ", c: " + c +
+        ", d: " + d + ", e: " + e + ", f:" + f + ", g:" + g);
+    return 47;
+  }
+
+  public static int spreadInt(String a, Integer b, int c,
+      long d, float e, double f) {
+    System.out.println("a: " + a + ", b:" + b + ", c: " + c +
+        ", d: " + d + ", e: " + e + ", f:" + f);
+    return 48;
+  }
+
+  public static int spreadLong(String a, Long b, long c, float d, double e) {
+    System.out.println("a: " + a + ", b:" + b + ", c: " + c +
+        ", d: " + d + ", e: " + e);
+    return 49;
+  }
+
+  public static int spreadFloat(String a, Float b, float c, double d) {
+    System.out.println("a: " + a + ", b:" + b + ", c: " + c + ", d: " + d);
+    return 50;
+  }
+
+  public static int spreadDouble(String a, Double b, double c) {
+    System.out.println("a: " + a + ", b:" + b + ", c: " + c);
+    return 51;
+  }
+
+  public static void testSpreaders_primitive() throws Throwable {
+    // boolean[]
+    // ---------------------
+    MethodType type = MethodType.methodType(int.class,
+        new Class<?>[] { String.class, Boolean.class, boolean.class });
+    MethodHandle delegate = MethodHandles.lookup().findStatic(
+        Main.class, "spreadBoolean", type);
+
+    MethodHandle spreader = delegate.asSpreader(boolean[].class, 2);
+    int ret = (int) spreader.invokeExact("a", new boolean[] { true, false });
+    assertEquals(44, ret);
+    ret = (int) spreader.invoke("a", new boolean[] { true, false });
+    assertEquals(44, ret);
+
+    // boolean can't be cast to String (the first argument to the method).
+    try {
+      delegate.asSpreader(boolean[].class, 3);
+      fail();
+    } catch (WrongMethodTypeException expected) {
+    }
+
+    // int can't be cast to boolean to supply the last argument to the method.
+    try {
+      delegate.asSpreader(int[].class, 1);
+      fail();
+    } catch (WrongMethodTypeException expected) {
+    }
+
+    // byte[]
+    // ---------------------
+    type = MethodType.methodType(int.class,
+        new Class<?>[] {
+          String.class, Byte.class, byte.class,
+          short.class, int.class, long.class,
+          float.class, double.class });
+    delegate = MethodHandles.lookup().findStatic(Main.class, "spreadByte", type);
+
+    spreader = delegate.asSpreader(byte[].class, 7);
+    ret = (int) spreader.invokeExact("a",
+        new byte[] { 0x1, 0x2, 0x3, 0x4, 0x5, 0x6, 0x7 });
+    assertEquals(45, ret);
+    ret = (int) spreader.invoke("a",
+        new byte[] { 0x1, 0x2, 0x3, 0x4, 0x5, 0x6, 0x7 });
+    assertEquals(45, ret);
+
+    // char[]
+    // ---------------------
+    type = MethodType.methodType(int.class,
+        new Class<?>[] {
+          String.class, Character.class,char.class,
+          int.class, long.class, float.class, double.class });
+    delegate = MethodHandles.lookup().findStatic(Main.class, "spreadChar", type);
+
+    spreader = delegate.asSpreader(char[].class, 6);
+    ret = (int) spreader.invokeExact("a",
+        new char[] { '1', '2', '3', '4', '5', '6' });
+    assertEquals(46, ret);
+    ret = (int) spreader.invokeExact("a",
+        new char[] { '1', '2', '3', '4', '5', '6' });
+    assertEquals(46, ret);
+
+    // short[]
+    // ---------------------
+    type = MethodType.methodType(int.class,
+        new Class<?>[] {
+          String.class, Short.class, short.class,
+          int.class, long.class, float.class, double.class });
+    delegate = MethodHandles.lookup().findStatic(Main.class, "spreadShort", type);
+
+    spreader = delegate.asSpreader(short[].class, 6);
+    ret = (int) spreader.invokeExact("a",
+        new short[] { 0x1, 0x2, 0x3, 0x4, 0x5, 0x6 });
+    assertEquals(47, ret);
+    ret = (int) spreader.invoke("a",
+        new short[] { 0x1, 0x2, 0x3, 0x4, 0x5, 0x6 });
+    assertEquals(47, ret);
+
+    // int[]
+    // ---------------------
+    type = MethodType.methodType(int.class,
+        new Class<?>[] {
+          String.class, Integer.class, int.class,
+          long.class, float.class, double.class });
+    delegate = MethodHandles.lookup().findStatic(Main.class, "spreadInt", type);
+
+    spreader = delegate.asSpreader(int[].class, 5);
+    ret = (int) spreader.invokeExact("a", new int[] { 1, 2, 3, 4, 5 });
+    assertEquals(48, ret);
+    ret = (int) spreader.invokeExact("a", new int[] { 1, 2, 3, 4, 5 });
+    assertEquals(48, ret);
+
+    // long[]
+    // ---------------------
+    type = MethodType.methodType(int.class,
+        new Class<?>[] {
+          String.class, Long.class, long.class, float.class, double.class });
+    delegate = MethodHandles.lookup().findStatic(Main.class, "spreadLong", type);
+
+    spreader = delegate.asSpreader(long[].class, 4);
+    ret = (int) spreader.invokeExact("a",
+        new long[] { 0x1, 0x2, 0x3, 0x4 });
+    assertEquals(49, ret);
+    ret = (int) spreader.invoke("a",
+        new long[] { 0x1, 0x2, 0x3, 0x4 });
+    assertEquals(49, ret);
+
+    // float[]
+    // ---------------------
+    type = MethodType.methodType(int.class,
+        new Class<?>[] {
+          String.class, Float.class, float.class, double.class });
+    delegate = MethodHandles.lookup().findStatic(Main.class, "spreadFloat", type);
+
+    spreader = delegate.asSpreader(float[].class, 3);
+    ret = (int) spreader.invokeExact("a",
+        new float[] { 1.0f, 2.0f, 3.0f });
+    assertEquals(50, ret);
+    ret = (int) spreader.invokeExact("a",
+        new float[] { 1.0f, 2.0f, 3.0f });
+    assertEquals(50, ret);
+
+    // double[]
+    // ---------------------
+    type = MethodType.methodType(int.class,
+        new Class<?>[] { String.class, Double.class, double.class });
+    delegate = MethodHandles.lookup().findStatic(Main.class, "spreadDouble", type);
+
+    spreader = delegate.asSpreader(double[].class, 2);
+    ret = (int) spreader.invokeExact("a", new double[] { 1.0, 2.0 });
+    assertEquals(51, ret);
+    ret = (int) spreader.invokeExact("a", new double[] { 1.0, 2.0 });
+    assertEquals(51, ret);
+  }
+
+  public static void testInvokeWithArguments() throws Throwable {
+    MethodType methodType = MethodType.methodType(int.class,
+        new Class<?>[] { String.class, String.class, String.class });
+    MethodHandle handle = MethodHandles.lookup().findStatic(
+        Main.class, "spreadReferences", methodType);
+
+    Object ret = handle.invokeWithArguments(new Object[] { "a", "b", "c"});
+    assertEquals(42, (int) ret);
+    handle.invokeWithArguments(new String[] { "a", "b", "c" });
+    assertEquals(42, (int) ret);
+
+    // Pass in an array that's too small. Should throw an IAE.
+    try {
+      handle.invokeWithArguments(new Object[] { "a", "b" });
+      fail();
+    } catch (IllegalArgumentException expected) {
+    } catch (WrongMethodTypeException expected) {
+    }
+
+    // Test implicit unboxing.
+    MethodType methodType2 = MethodType.methodType(int.class,
+        new Class<?>[] { String.class, int.class });
+    MethodHandle handle2 = MethodHandles.lookup().findStatic(
+        Main.class, "spreadReferences_Unbox", methodType2);
+
+    ret = (int) handle2.invokeWithArguments(new Object[] { "a", 43 });
+    assertEquals(43, (int) ret);
+  }
+
+  public static int collectBoolean(String a, boolean[] b) {
+    System.out.println("a: " + a + ", b:" + b[0] + ", c: " + b[1]);
+    return 44;
+  }
+
+  public static int collectByte(String a, byte[] b) {
+    System.out.println("a: " + a + ", b:" + b[0] + ", c: " + b[1]);
+    return 45;
+  }
+
+  public static int collectChar(String a, char[] b) {
+    System.out.println("a: " + a + ", b:" + b[0] + ", c: " + b[1]);
+    return 46;
+  }
+
+  public static int collectShort(String a, short[] b) {
+    System.out.println("a: " + a + ", b:" + b[0] + ", c: " + b[1]);
+    return 47;
+  }
+
+  public static int collectInt(String a, int[] b) {
+    System.out.println("a: " + a + ", b:" + b[0] + ", c: " + b[1]);
+    return 48;
+  }
+
+  public static int collectLong(String a, long[] b) {
+    System.out.println("a: " + a + ", b:" + b[0] + ", c: " + b[1]);
+    return 49;
+  }
+
+  public static int collectFloat(String a, float[] b) {
+    System.out.println("a: " + a + ", b:" + b[0] + ", c: " + b[1]);
+    return 50;
+  }
+
+  public static int collectDouble(String a, double[] b) {
+    System.out.println("a: " + a + ", b:" + b[0] + ", c: " + b[1]);
+    return 51;
+  }
+
+  public static int collectCharSequence(String a, CharSequence[] b) {
+    System.out.println("a: " + a + ", b:" + b[0] + ", c: " + b[1]);
+    return 99;
+  }
+
+  public static void testAsCollector() throws Throwable {
+    // Reference arrays.
+    // -------------------
+    MethodHandle trailingRef = MethodHandles.lookup().findStatic(
+        Main.class, "collectCharSequence",
+        MethodType.methodType(int.class, String.class, CharSequence[].class));
+
+    // int[] is not convertible to CharSequence[].class.
+    try {
+      trailingRef.asCollector(int[].class, 1);
+      fail();
+    } catch (IllegalArgumentException expected) {
+    }
+
+    // Object[] is not convertible to CharSequence[].class.
+    try {
+      trailingRef.asCollector(Object[].class, 1);
+      fail();
+    } catch (IllegalArgumentException expected) {
+    }
+
+    // String[].class is convertible to CharSequence.class
+    MethodHandle collector = trailingRef.asCollector(String[].class, 2);
+    assertEquals(99, (int) collector.invoke("a", "b", "c"));
+
+    // Too few arguments should fail with a WMTE.
+    try {
+      collector.invoke("a", "b");
+      fail();
+    } catch (WrongMethodTypeException expected) {
+    }
+
+    // Too many arguments should fail with a WMTE.
+    try {
+      collector.invoke("a", "b", "c", "d");
+      fail();
+    } catch (WrongMethodTypeException expected) {
+    }
+
+    // Sanity checks on other array types.
+
+    MethodHandle target = MethodHandles.lookup().findStatic(
+        Main.class, "collectBoolean",
+        MethodType.methodType(int.class, String.class, boolean[].class));
+    assertEquals(44, (int) target.asCollector(boolean[].class, 2).invoke("a", true, false));
+
+    target = MethodHandles.lookup().findStatic(Main.class, "collectByte",
+        MethodType.methodType(int.class, String.class, byte[].class));
+    assertEquals(45, (int) target.asCollector(byte[].class, 2).invoke("a", (byte) 1, (byte) 2));
+
+    target = MethodHandles.lookup().findStatic(Main.class, "collectChar",
+        MethodType.methodType(int.class, String.class, char[].class));
+    assertEquals(46, (int) target.asCollector(char[].class, 2).invoke("a", 'a', 'b'));
+
+    target = MethodHandles.lookup().findStatic(Main.class, "collectShort",
+        MethodType.methodType(int.class, String.class, short[].class));
+    assertEquals(47, (int) target.asCollector(short[].class, 2).invoke("a", (short) 3, (short) 4));
+
+    target = MethodHandles.lookup().findStatic(Main.class, "collectInt",
+        MethodType.methodType(int.class, String.class, int[].class));
+    assertEquals(48, (int) target.asCollector(int[].class, 2).invoke("a", 42, 43));
+
+    target = MethodHandles.lookup().findStatic(Main.class, "collectLong",
+        MethodType.methodType(int.class, String.class, long[].class));
+    assertEquals(49, (int) target.asCollector(long[].class, 2).invoke("a", 100, 99));
+
+    target = MethodHandles.lookup().findStatic(Main.class, "collectFloat",
+        MethodType.methodType(int.class, String.class, float[].class));
+    assertEquals(50, (int) target.asCollector(float[].class, 2).invoke("a", 8.9f, 9.1f));
+
+    target = MethodHandles.lookup().findStatic(Main.class, "collectDouble",
+        MethodType.methodType(int.class, String.class, double[].class));
+    assertEquals(51, (int) target.asCollector(double[].class, 2).invoke("a", 6.7, 7.8));
+  }
+
   public static void fail() {
     System.out.println("FAIL");
     Thread.dumpStack();
   }
 
+  public static void fail(String message) {
+    System.out.println("fail: " + message);
+    Thread.dumpStack();
+  }
+
+  public static void assertEquals(int i1, int i2) {
+    if (i1 != i2) throw new AssertionError("Expected: " + i1 + " was " + i2);
+  }
+
   public static void assertEquals(String s1, String s2) {
     if (s1 == s2) {
       return;
diff --git a/test/958-methodhandle-emulated-stackframe/run b/test/958-methodhandle-emulated-stackframe/run
deleted file mode 100755
index a9f1822..0000000
--- a/test/958-methodhandle-emulated-stackframe/run
+++ /dev/null
@@ -1,20 +0,0 @@
-#!/bin/bash
-#
-# Copyright 2016 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-#      http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
diff --git a/test/959-invoke-polymorphic-accessors/run b/test/959-invoke-polymorphic-accessors/run
deleted file mode 100644
index a9f1822..0000000
--- a/test/959-invoke-polymorphic-accessors/run
+++ /dev/null
@@ -1,20 +0,0 @@
-#!/bin/bash
-#
-# Copyright 2016 The Android Open Source Project
-#
-# Licensed under the Apache License, Version 2.0 (the "License");
-# you may not use this file except in compliance with the License.
-# You may obtain a copy of the License at
-#
-#      http://www.apache.org/licenses/LICENSE-2.0
-#
-# Unless required by applicable law or agreed to in writing, software
-# distributed under the License is distributed on an "AS IS" BASIS,
-# WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
-# See the License for the specific language governing permissions and
-# limitations under the License.
-
-# make us exit on a failure
-set -e
-
-./default-run "$@" --experimental method-handles
diff --git a/test/Android.bp b/test/Android.bp
index 00c2a68..287df13 100644
--- a/test/Android.bp
+++ b/test/Android.bp
@@ -173,12 +173,13 @@
     whole_static_libs: [
         "libart-compiler-gtest",
         "libart-runtime-gtest",
-        "libgtest",
+        "libgtest"
     ],
     shared_libs: [
         "libartd",
         "libartd-compiler",
         "libbase",
+        "libbacktrace"
     ],
     target: {
         android: {
@@ -266,6 +267,11 @@
         "923-monitors/monitors.cc",
         "924-threads/threads.cc",
         "925-threadgroups/threadgroups.cc",
+        "927-timers/timers.cc",
+        "928-jni-table/jni_table.cc",
+        "929-search/search.cc",
+        "931-agent-thread/agent_thread.cc",
+        "933-misc-events/misc_events.cc",
     ],
     shared_libs: [
         "libbase",
@@ -312,6 +318,7 @@
         "141-class-unload/jni_unload.cc",
         "148-multithread-gc-annotations/gc_coverage.cc",
         "149-suspend-all-stress/suspend_all.cc",
+        "154-gc-loop/heap_interface.cc",
         "454-get-vreg/get_vreg_jni.cc",
         "457-regs/regs_jni.cc",
         "461-get-reference-vreg/get_reference_vreg_jni.cc",
@@ -322,6 +329,7 @@
         "570-checker-osr/osr.cc",
         "595-profile-saving/profile-saving.cc",
         "596-app-images/app_images.cc",
+        "596-monitor-inflation/monitor_inflation.cc",
         "597-deopt-new-string/deopt.cc",
         "626-const-class-linking/clear_dex_cache_types.cc",
     ],
diff --git a/test/Android.run-test.mk b/test/Android.run-test.mk
index 4243370..e494f21 100644
--- a/test/Android.run-test.mk
+++ b/test/Android.run-test.mk
@@ -228,9 +228,15 @@
 
 # Disable 153-reference-stress temporarily until a fix arrives. b/33389022.
 # Disable 080-oom-fragmentation due to flakes. b/33795328
+# Disable 497-inlining-and-class-loader and 542-unresolved-access-check until
+#     they are rewritten. These tests use a broken class loader that tries to
+#     register a dex file that's already registered with a different loader.
+#     b/34193123
 ART_TEST_RUN_TEST_SKIP += \
   153-reference-stress \
-  080-oom-fragmentation
+  080-oom-fragmentation \
+  497-inlining-and-class-loader \
+  542-unresolved-access-check
 
 ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \
         $(COMPILER_TYPES),$(RELOCATE_TYPES),$(TRACE_TYPES),$(GC_TYPES),$(JNI_TYPES), \
@@ -271,35 +277,6 @@
   147-stripped-dex-fallback \
   569-checker-pattern-replacement
 
-# These 9** tests are not supported in current form due to linker
-# restrictions. See b/31681198
-TEST_ART_BROKEN_TARGET_TESTS += \
-  902-hello-transformation \
-  903-hello-tagging \
-  904-object-allocation \
-  905-object-free \
-  906-iterate-heap \
-  907-get-loaded-classes \
-  908-gc-start-finish \
-  909-attach-agent \
-  910-methods \
-  911-get-stack-trace \
-  912-classes \
-  913-heaps \
-  914-hello-obsolescence \
-  915-obsolete-2 \
-  916-obsolete-jit \
-  917-fields-transformation \
-  918-fields \
-  919-obsolete-fields \
-  920-objects \
-  921-hello-failure \
-  922-properties \
-  923-monitors \
-  924-threads \
-  925-threadgroups \
-  926-multi-obsolescence \
-
 ifneq (,$(filter target,$(TARGET_TYPES)))
   ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,target,$(RUN_TYPES),$(PREBUILD_TYPES), \
       $(COMPILER_TYPES),$(RELOCATE_TYPES),$(TRACE_TYPES),$(GC_TYPES),$(JNI_TYPES), \
@@ -380,9 +357,12 @@
 
 # Temporarily disable some broken tests when forcing access checks in interpreter b/22414682
 # 629 requires compilation.
+# 934 & 935 are broken due to dex2dex issues and app-images
 TEST_ART_BROKEN_INTERPRETER_ACCESS_CHECK_TESTS := \
   137-cfi \
-  629-vdex-speed
+  629-vdex-speed \
+  934-load-transform \
+  935-non-retransformable \
 
 ifneq (,$(filter interp-ac,$(COMPILER_TYPES)))
   ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \
@@ -402,6 +382,7 @@
 #   slows down allocations significantly which these tests do a lot.
 TEST_ART_BROKEN_GCSTRESS_RUN_TESTS := \
   137-cfi \
+  154-gc-loop \
   908-gc-start-finish \
   913-heaps \
   961-default-iface-resolution-gen \
@@ -447,6 +428,7 @@
 # 147-stripped-dex-fallback is disabled because it requires --prebuild.
 # 554-jit-profile-file is disabled because it needs a primary oat file to know what it should save.
 # 629-vdex-speed requires compiled code.
+# 934 & 935 are broken due to dex2dex issues and app-images
 TEST_ART_BROKEN_FALLBACK_RUN_TESTS := \
   116-nodex2oat \
   117-nopatchoat \
@@ -456,13 +438,17 @@
   138-duplicate-classes-check2 \
   147-stripped-dex-fallback \
   554-jit-profile-file \
-  629-vdex-speed
+  629-vdex-speed \
+  934-load-transform \
+  935-non-retransformable \
 
 # This test fails without an image.
-# 964 often times out due to the large number of classes it tries to compile.
+# 018, 961, 964 often time out. b/34369284
 TEST_ART_BROKEN_NO_IMAGE_RUN_TESTS := \
   137-cfi \
   138-duplicate-classes-check \
+  018-stack-overflow \
+  961-default-iface-resolution-gen \
   964-default-iface-init
 
 ifneq (,$(filter no-dex2oat,$(PREBUILD_TYPES)))
@@ -532,10 +518,13 @@
 # Known broken tests for the interpreter.
 # CFI unwinding expects managed frames.
 # 629 requires compilation.
+# 934 and 935 are broken due to the PreDefine hook not yet inserting them into the classpath. This should be fixed shortly
 TEST_ART_BROKEN_INTERPRETER_RUN_TESTS := \
   137-cfi \
   554-jit-profile-file \
-  629-vdex-speed
+  629-vdex-speed \
+  934-load-transform \
+  935-non-retransformable \
 
 ifneq (,$(filter interpreter,$(COMPILER_TYPES)))
   ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \
@@ -557,17 +546,22 @@
 # flaky as JIT tests. This should be fixed once b/33630159 or b/33616143 are
 # resolved but until then just disable them. Test 916 already checks this
 # feature for JIT use cases in a way that is resilient to the jit frames.
+# 912: b/34655682
+# 934 and 935 are broken due to the PreDefine hook not yet inserting them into the classpath. This should be fixed shortly
 TEST_ART_BROKEN_JIT_RUN_TESTS := \
   137-cfi \
   629-vdex-speed \
   902-hello-transformation \
   904-object-allocation \
   906-iterate-heap \
+  912-classes \
   914-hello-obsolescence \
   915-obsolete-2 \
   917-fields-transformation \
   919-obsolete-fields \
   926-multi-obsolescence \
+  934-load-transform \
+  935-non-retransformable \
 
 ifneq (,$(filter jit,$(COMPILER_TYPES)))
   ART_TEST_KNOWN_BROKEN += $(call all-run-test-names,$(TARGET_TYPES),$(RUN_TYPES),$(PREBUILD_TYPES), \
diff --git a/test/ErroneousInit/ErroneousInit.java b/test/ErroneousInit/ErroneousInit.java
new file mode 100644
index 0000000..67b7b20
--- /dev/null
+++ b/test/ErroneousInit/ErroneousInit.java
@@ -0,0 +1,23 @@
+/*
+ * Copyright (C) 2016 The Android Open Source Project
+ *
+ * Licensed under the Apache License, Version 2.0 (the "License");
+ * you may not use this file except in compliance with the License.
+ * You may obtain a copy of the License at
+ *
+ *      http://www.apache.org/licenses/LICENSE-2.0
+ *
+ * Unless required by applicable law or agreed to in writing, software
+ * distributed under the License is distributed on an "AS IS" BASIS,
+ * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
+ * See the License for the specific language governing permissions and
+ * limitations under the License.
+ */
+
+class ErroneousInit {
+    static {
+        if (true) {
+            throw new Error();
+        }
+    }
+}
diff --git a/test/XandY/Y.java b/test/XandY/Y.java
index ecead6e..2a1f036 100644
--- a/test/XandY/Y.java
+++ b/test/XandY/Y.java
@@ -14,4 +14,8 @@
  * limitations under the License.
  */
 
-class Y extends X {}
+class Y extends X {
+  static Z z = new Z();
+  static class Z {
+  }
+}
diff --git a/test/common/runtime_state.cc b/test/common/runtime_state.cc
index 1b6fc70..a841f9e 100644
--- a/test/common/runtime_state.cc
+++ b/test/common/runtime_state.cc
@@ -33,12 +33,18 @@
 
 // public static native boolean hasJit();
 
-extern "C" JNIEXPORT jboolean JNICALL Java_Main_hasJit(JNIEnv*, jclass) {
+static jit::Jit* GetJitIfEnabled() {
   Runtime* runtime = Runtime::Current();
-  return runtime != nullptr
+  bool can_jit =
+      runtime != nullptr
       && runtime->GetJit() != nullptr
       && runtime->GetInstrumentation()->GetCurrentInstrumentationLevel() !=
             instrumentation::Instrumentation::InstrumentationLevel::kInstrumentWithInterpreter;
+  return can_jit ? runtime->GetJit() : nullptr;
+}
+
+extern "C" JNIEXPORT jboolean JNICALL Java_Main_hasJit(JNIEnv*, jclass) {
+  return GetJitIfEnabled() != nullptr;
 }
 
 // public static native boolean hasOatFile();
@@ -152,7 +158,7 @@
                                                              jclass,
                                                              jclass cls,
                                                              jstring method_name) {
-  jit::Jit* jit = Runtime::Current()->GetJit();
+  jit::Jit* jit = GetJitIfEnabled();
   if (jit == nullptr) {
     return;
   }
@@ -166,6 +172,11 @@
     CHECK(chars.c_str() != nullptr);
     method = soa.Decode<mirror::Class>(cls)->FindDeclaredDirectMethodByName(
         chars.c_str(), kRuntimePointerSize);
+    if (method == nullptr) {
+      method = soa.Decode<mirror::Class>(cls)->FindDeclaredVirtualMethodByName(
+          chars.c_str(), kRuntimePointerSize);
+    }
+    DCHECK(method != nullptr) << "Unable to find method called " << chars.c_str();
   }
 
   jit::JitCodeCache* code_cache = jit->GetCodeCache();
diff --git a/test/etc/run-test-jar b/test/etc/run-test-jar
index 4794f6b..28fa130 100755
--- a/test/etc/run-test-jar
+++ b/test/etc/run-test-jar
@@ -44,7 +44,7 @@
 SECONDARY_DEX=""
 TIME_OUT="gdb"  # "n" (disabled), "timeout" (use timeout), "gdb" (use gdb)
 # Value in seconds
-if [ "$ART_USE_READ_BARRIER" = "true" ]; then
+if [ "$ART_USE_READ_BARRIER" != "false" ]; then
   TIME_OUT_VALUE=2400  # 40 minutes.
 else
   TIME_OUT_VALUE=1200  # 20 minutes.
@@ -62,6 +62,7 @@
 TEST_VDEX="n"
 TEST_IS_NDEBUG="n"
 APP_IMAGE="y"
+VDEX_FILTER=""
 
 while true; do
     if [ "x$1" = "x--quiet" ]; then
@@ -256,6 +257,11 @@
     elif [ "x$1" = "x--vdex" ]; then
         TEST_VDEX="y"
         shift
+    elif [ "x$1" = "x--vdex-filter" ]; then
+        shift
+        option="$1"
+        VDEX_FILTER="--compiler-filter=$option"
+        shift
     elif expr "x$1" : "x--" >/dev/null 2>&1; then
         echo "unknown $0 option: $1" 1>&2
         exit 1
@@ -514,7 +520,7 @@
     dex2oat_cmdline="timeout -k 1m -s SIGRTMIN+2 1m ${dex2oat_cmdline}"
   fi
   if [ "$TEST_VDEX" = "y" ]; then
-    vdex_cmdline="${dex2oat_cmdline} --input-vdex=$DEX_LOCATION/oat/$ISA/$TEST_NAME.vdex"
+    vdex_cmdline="${dex2oat_cmdline} ${VDEX_FILTER} --input-vdex=$DEX_LOCATION/oat/$ISA/$TEST_NAME.vdex"
   fi
 fi
 
diff --git a/test/run-test b/test/run-test
index abe73c3..a228789 100755
--- a/test/run-test
+++ b/test/run-test
@@ -131,6 +131,7 @@
 multi_image_suffix=""
 android_root="/system"
 bisection_search="no"
+suspend_timeout="500000"
 # By default we will use optimizing.
 image_args=""
 image_suffix=""
@@ -219,6 +220,10 @@
         basic_verify="true"
         gc_stress="true"
         shift
+    elif [ "x$1" = "x--suspend-timeout" ]; then
+        shift
+        suspend_timeout="$1"
+        shift
     elif [ "x$1" = "x--image" ]; then
         shift
         image="$1"
@@ -354,6 +359,11 @@
     elif [ "x$1" = "x--vdex" ]; then
         run_args="${run_args} --vdex"
         shift
+    elif [ "x$1" = "x--vdex-filter" ]; then
+        shift
+        filter=$1
+        run_args="${run_args} --vdex-filter $filter"
+        shift
     elif expr "x$1" : "x--" >/dev/null 2>&1; then
         echo "unknown $0 option: $1" 1>&2
         usage="yes"
@@ -397,6 +407,11 @@
 tmp_dir="`cd $oldwd ; python -c "import os; print os.path.realpath('$tmp_dir')"`"
 mkdir -p $tmp_dir
 
+# Add thread suspend timeout flag
+if [ ! "$runtime" = "jvm" ]; then
+  run_args="${run_args} --runtime-option -XX:ThreadSuspendTimeout=$suspend_timeout"
+fi
+
 if [ "$basic_verify" = "true" ]; then
   # Set HspaceCompactForOOMMinIntervalMs to zero to run hspace compaction for OOM more frequently in tests.
   run_args="${run_args} --runtime-option -Xgc:preverify --runtime-option -Xgc:postverify --runtime-option -XX:HspaceCompactForOOMMinIntervalMs=0"
@@ -644,6 +659,7 @@
         echo "    --quiet               Don't print anything except failure messages"
         echo "    --bisection-search    Perform bisection bug search."
         echo "    --vdex                Test using vdex as in input to dex2oat. Only works with --prebuild."
+        echo "    --suspend-timeout     Change thread suspend timeout ms (default 500000)."
     ) 1>&2  # Direct to stderr so usage is not printed if --quiet is set.
     exit 1
 fi
@@ -717,7 +733,7 @@
     #
     # TODO: Enable Checker when read barrier support is added to more
     # architectures (b/12687968).
-    if [ "x$ART_USE_READ_BARRIER" = xtrue ]                    \
+    if [ "x$ART_USE_READ_BARRIER" != xfalse ]                  \
        && (([ "x$host_mode" = "xyes" ]                         \
             && ! arch_supports_read_barrier "$host_arch_name") \
            || ([ "x$target_mode" = "xyes" ]                    \
diff --git a/test/ti-agent/common_helper.cc b/test/ti-agent/common_helper.cc
index 2c6d3ed..ed82bb0 100644
--- a/test/ti-agent/common_helper.cc
+++ b/test/ti-agent/common_helper.cc
@@ -16,13 +16,18 @@
 
 #include "ti-agent/common_helper.h"
 
+#include <dlfcn.h>
 #include <stdio.h>
 #include <sstream>
+#include <deque>
 
+#include "android-base/stringprintf.h"
 #include "art_method.h"
 #include "jni.h"
+#include "jni_internal.h"
 #include "openjdkjvmti/jvmti.h"
 #include "scoped_thread_state_change-inl.h"
+#include "ScopedLocalRef.h"
 #include "stack.h"
 #include "ti-agent/common_load.h"
 #include "utils.h"
@@ -60,17 +65,17 @@
   return true;
 }
 
-namespace common_redefine {
 
-static void throwRedefinitionError(jvmtiEnv* jvmti,
-                                   JNIEnv* env,
-                                   jint num_targets,
-                                   jclass* target,
-                                   jvmtiError res) {
+template <bool is_redefine>
+static void throwCommonRedefinitionError(jvmtiEnv* jvmti,
+                                         JNIEnv* env,
+                                         jint num_targets,
+                                         jclass* target,
+                                         jvmtiError res) {
   std::stringstream err;
   char* error = nullptr;
   jvmti->GetErrorName(res, &error);
-  err << "Failed to redefine class";
+  err << "Failed to " << (is_redefine ? "redefine" : "retransform") << " class";
   if (num_targets > 1) {
     err << "es";
   }
@@ -92,6 +97,16 @@
   env->ThrowNew(env->FindClass("java/lang/Exception"), message.c_str());
 }
 
+namespace common_redefine {
+
+static void throwRedefinitionError(jvmtiEnv* jvmti,
+                                   JNIEnv* env,
+                                   jint num_targets,
+                                   jclass* target,
+                                   jvmtiError res) {
+  return throwCommonRedefinitionError<true>(jvmti, env, num_targets, target, res);
+}
+
 static void DoMultiClassRedefine(jvmtiEnv* jvmti_env,
                                  JNIEnv* env,
                                  jint num_redefines,
@@ -161,7 +176,164 @@
                               dex_files.data());
 }
 
-// Don't do anything
+// Get all capabilities except those related to retransformation.
+jint OnLoad(JavaVM* vm,
+            char* options ATTRIBUTE_UNUSED,
+            void* reserved ATTRIBUTE_UNUSED) {
+  if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+    printf("Unable to get jvmti env!\n");
+    return 1;
+  }
+  jvmtiCapabilities caps;
+  jvmti_env->GetPotentialCapabilities(&caps);
+  caps.can_retransform_classes = 0;
+  caps.can_retransform_any_class = 0;
+  jvmti_env->AddCapabilities(&caps);
+  return 0;
+}
+
+}  // namespace common_redefine
+
+namespace common_retransform {
+
+struct CommonTransformationResult {
+  std::vector<unsigned char> class_bytes;
+  std::vector<unsigned char> dex_bytes;
+
+  CommonTransformationResult(size_t class_size, size_t dex_size)
+      : class_bytes(class_size), dex_bytes(dex_size) {}
+
+  CommonTransformationResult() = default;
+  CommonTransformationResult(CommonTransformationResult&&) = default;
+  CommonTransformationResult(CommonTransformationResult&) = default;
+};
+
+// Map from class name to transformation result.
+std::map<std::string, std::deque<CommonTransformationResult>> gTransformations;
+
+extern "C" JNIEXPORT void JNICALL Java_Main_addCommonTransformationResult(JNIEnv* env,
+                                                                          jclass,
+                                                                          jstring class_name,
+                                                                          jbyteArray class_array,
+                                                                          jbyteArray dex_array) {
+  const char* name_chrs = env->GetStringUTFChars(class_name, nullptr);
+  std::string name_str(name_chrs);
+  env->ReleaseStringUTFChars(class_name, name_chrs);
+  CommonTransformationResult trans(env->GetArrayLength(class_array),
+                                   env->GetArrayLength(dex_array));
+  if (env->ExceptionOccurred()) {
+    return;
+  }
+  env->GetByteArrayRegion(class_array,
+                          0,
+                          env->GetArrayLength(class_array),
+                          reinterpret_cast<jbyte*>(trans.class_bytes.data()));
+  if (env->ExceptionOccurred()) {
+    return;
+  }
+  env->GetByteArrayRegion(dex_array,
+                          0,
+                          env->GetArrayLength(dex_array),
+                          reinterpret_cast<jbyte*>(trans.dex_bytes.data()));
+  if (env->ExceptionOccurred()) {
+    return;
+  }
+  if (gTransformations.find(name_str) == gTransformations.end()) {
+    std::deque<CommonTransformationResult> list;
+    gTransformations[name_str] = std::move(list);
+  }
+  gTransformations[name_str].push_back(std::move(trans));
+}
+
+// The hook we are using.
+void JNICALL CommonClassFileLoadHookRetransformable(jvmtiEnv* jvmti_env,
+                                                    JNIEnv* jni_env ATTRIBUTE_UNUSED,
+                                                    jclass class_being_redefined ATTRIBUTE_UNUSED,
+                                                    jobject loader ATTRIBUTE_UNUSED,
+                                                    const char* name,
+                                                    jobject protection_domain ATTRIBUTE_UNUSED,
+                                                    jint class_data_len ATTRIBUTE_UNUSED,
+                                                    const unsigned char* class_dat ATTRIBUTE_UNUSED,
+                                                    jint* new_class_data_len,
+                                                    unsigned char** new_class_data) {
+  std::string name_str(name);
+  if (gTransformations.find(name_str) != gTransformations.end() &&
+      gTransformations[name_str].size() > 0) {
+    CommonTransformationResult& res = gTransformations[name_str][0];
+    const std::vector<unsigned char>& desired_array = IsJVM() ? res.class_bytes : res.dex_bytes;
+    unsigned char* new_data;
+    CHECK_EQ(JVMTI_ERROR_NONE, jvmti_env->Allocate(desired_array.size(), &new_data));
+    memcpy(new_data, desired_array.data(), desired_array.size());
+    *new_class_data = new_data;
+    *new_class_data_len = desired_array.size();
+    gTransformations[name_str].pop_front();
+  }
+}
+
+extern "C" JNIEXPORT void Java_Main_enableCommonRetransformation(JNIEnv* env,
+                                                                 jclass,
+                                                                 jboolean enable) {
+  jvmtiError res = jvmti_env->SetEventNotificationMode(enable ? JVMTI_ENABLE : JVMTI_DISABLE,
+                                                       JVMTI_EVENT_CLASS_FILE_LOAD_HOOK,
+                                                       nullptr);
+  if (res != JVMTI_ERROR_NONE) {
+    JvmtiErrorToException(env, res);
+  }
+}
+
+static void throwRetransformationError(jvmtiEnv* jvmti,
+                                       JNIEnv* env,
+                                       jint num_targets,
+                                       jclass* targets,
+                                       jvmtiError res) {
+  return throwCommonRedefinitionError<false>(jvmti, env, num_targets, targets, res);
+}
+
+static void DoClassRetransformation(jvmtiEnv* jvmti_env, JNIEnv* env, jobjectArray targets) {
+  std::vector<jclass> classes;
+  jint len = env->GetArrayLength(targets);
+  for (jint i = 0; i < len; i++) {
+    classes.push_back(static_cast<jclass>(env->GetObjectArrayElement(targets, i)));
+  }
+  jvmtiError res = jvmti_env->RetransformClasses(len, classes.data());
+  if (res != JVMTI_ERROR_NONE) {
+    throwRetransformationError(jvmti_env, env, len, classes.data(), res);
+  }
+}
+
+extern "C" JNIEXPORT void JNICALL Java_Main_doCommonClassRetransformation(JNIEnv* env,
+                                                                          jclass,
+                                                                          jobjectArray targets) {
+  jvmtiCapabilities caps;
+  jvmtiError caps_err = jvmti_env->GetCapabilities(&caps);
+  if (caps_err != JVMTI_ERROR_NONE) {
+    env->ThrowNew(env->FindClass("java/lang/Exception"),
+                  "Unable to get current jvmtiEnv capabilities");
+    return;
+  }
+
+  // Allocate a new environment if we don't have the can_retransform_classes capability needed to
+  // call the RetransformClasses function.
+  jvmtiEnv* real_env = nullptr;
+  if (caps.can_retransform_classes != 1) {
+    JavaVM* vm = nullptr;
+    if (env->GetJavaVM(&vm) != 0 ||
+        vm->GetEnv(reinterpret_cast<void**>(&real_env), JVMTI_VERSION_1_0) != 0) {
+      env->ThrowNew(env->FindClass("java/lang/Exception"),
+                    "Unable to create temporary jvmtiEnv for RetransformClasses call.");
+      return;
+    }
+    SetAllCapabilities(real_env);
+  } else {
+    real_env = jvmti_env;
+  }
+  DoClassRetransformation(real_env, env, targets);
+  if (caps.can_retransform_classes != 1) {
+    real_env->DisposeEnvironment();
+  }
+}
+
+// Get all capabilities except those related to retransformation.
 jint OnLoad(JavaVM* vm,
             char* options ATTRIBUTE_UNUSED,
             void* reserved ATTRIBUTE_UNUSED) {
@@ -170,9 +342,181 @@
     return 1;
   }
   SetAllCapabilities(jvmti_env);
+  jvmtiEventCallbacks cb;
+  memset(&cb, 0, sizeof(cb));
+  cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
+  if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
+    printf("Unable to set class file load hook cb!\n");
+    return 1;
+  }
   return 0;
 }
 
-}  // namespace common_redefine
+}  // namespace common_retransform
+
+namespace common_transform {
+
+using art::common_retransform::CommonClassFileLoadHookRetransformable;
+
+// Get all capabilities except those related to retransformation.
+jint OnLoad(JavaVM* vm,
+            char* options ATTRIBUTE_UNUSED,
+            void* reserved ATTRIBUTE_UNUSED) {
+  if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+    printf("Unable to get jvmti env!\n");
+    return 1;
+  }
+  // Don't set the retransform caps
+  jvmtiCapabilities caps;
+  jvmti_env->GetPotentialCapabilities(&caps);
+  caps.can_retransform_classes = 0;
+  caps.can_retransform_any_class = 0;
+  jvmti_env->AddCapabilities(&caps);
+
+  // Use the same callback as the retransform test.
+  jvmtiEventCallbacks cb;
+  memset(&cb, 0, sizeof(cb));
+  cb.ClassFileLoadHook = CommonClassFileLoadHookRetransformable;
+  if (jvmti_env->SetEventCallbacks(&cb, sizeof(cb)) != JVMTI_ERROR_NONE) {
+    printf("Unable to set class file load hook cb!\n");
+    return 1;
+  }
+  return 0;
+}
+
+}  // namespace common_transform
+
+static void BindMethod(jvmtiEnv* jenv,
+                       JNIEnv* env,
+                       jclass klass,
+                       jmethodID method) {
+  char* name;
+  char* signature;
+  jvmtiError name_result = jenv->GetMethodName(method, &name, &signature, nullptr);
+  if (name_result != JVMTI_ERROR_NONE) {
+    LOG(FATAL) << "Could not get methods";
+  }
+
+  std::string names[2];
+  if (IsJVM()) {
+    // TODO Get the JNI long name
+    char* klass_name;
+    jvmtiError klass_result = jenv->GetClassSignature(klass, &klass_name, nullptr);
+    if (klass_result == JVMTI_ERROR_NONE) {
+      std::string name_str(name);
+      std::string klass_str(klass_name);
+      names[0] = GetJniShortName(klass_str, name_str);
+      jenv->Deallocate(reinterpret_cast<unsigned char*>(klass_name));
+    } else {
+      LOG(FATAL) << "Could not get class name!";
+    }
+  } else {
+    ScopedObjectAccess soa(Thread::Current());
+    ArtMethod* m = jni::DecodeArtMethod(method);
+    names[0] = m->JniShortName();
+    names[1] = m->JniLongName();
+  }
+  for (const std::string& mangled_name : names) {
+    if (mangled_name == "") {
+      continue;
+    }
+    void* sym = dlsym(RTLD_DEFAULT, mangled_name.c_str());
+    if (sym == nullptr) {
+      continue;
+    }
+
+    JNINativeMethod native_method;
+    native_method.fnPtr = sym;
+    native_method.name = name;
+    native_method.signature = signature;
+
+    env->RegisterNatives(klass, &native_method, 1);
+
+    jenv->Deallocate(reinterpret_cast<unsigned char*>(name));
+    jenv->Deallocate(reinterpret_cast<unsigned char*>(signature));
+    return;
+  }
+
+  LOG(FATAL) << "Could not find " << names[0];
+}
+
+static jclass FindClassWithSystemClassLoader(JNIEnv* env, const char* class_name) {
+  // Find the system classloader.
+  ScopedLocalRef<jclass> cl_klass(env, env->FindClass("java/lang/ClassLoader"));
+  if (cl_klass.get() == nullptr) {
+    return nullptr;
+  }
+  jmethodID getsystemclassloader_method = env->GetStaticMethodID(cl_klass.get(),
+                                                                 "getSystemClassLoader",
+                                                                 "()Ljava/lang/ClassLoader;");
+  if (getsystemclassloader_method == nullptr) {
+    return nullptr;
+  }
+  ScopedLocalRef<jobject> cl(env, env->CallStaticObjectMethod(cl_klass.get(),
+                                                              getsystemclassloader_method));
+  if (cl.get() == nullptr) {
+    return nullptr;
+  }
+
+  // Create a String of the name.
+  std::string descriptor = android::base::StringPrintf("L%s;", class_name);
+  std::string dot_name = DescriptorToDot(descriptor.c_str());
+  ScopedLocalRef<jstring> name_str(env, env->NewStringUTF(dot_name.c_str()));
+
+  // Call Class.forName with it.
+  ScopedLocalRef<jclass> c_klass(env, env->FindClass("java/lang/Class"));
+  if (c_klass.get() == nullptr) {
+    return nullptr;
+  }
+  jmethodID forname_method = env->GetStaticMethodID(
+      c_klass.get(),
+      "forName",
+      "(Ljava/lang/String;ZLjava/lang/ClassLoader;)Ljava/lang/Class;");
+  if (forname_method == nullptr) {
+    return nullptr;
+  }
+
+  return reinterpret_cast<jclass>(env->CallStaticObjectMethod(c_klass.get(),
+                                                              forname_method,
+                                                              name_str.get(),
+                                                              JNI_FALSE,
+                                                              cl.get()));
+}
+
+void BindFunctions(jvmtiEnv* jenv, JNIEnv* env, const char* class_name) {
+  // Use JNI to load the class.
+  ScopedLocalRef<jclass> klass(env, env->FindClass(class_name));
+  if (klass.get() == nullptr) {
+    // We may be called with the wrong classloader. Try explicitly using the system classloader.
+    env->ExceptionClear();
+    klass.reset(FindClassWithSystemClassLoader(env, class_name));
+    if (klass.get() == nullptr) {
+      LOG(FATAL) << "Could not load " << class_name;
+    }
+  }
+
+  // Use JVMTI to get the methods.
+  jint method_count;
+  jmethodID* methods;
+  jvmtiError methods_result = jenv->GetClassMethods(klass.get(), &method_count, &methods);
+  if (methods_result != JVMTI_ERROR_NONE) {
+    LOG(FATAL) << "Could not get methods";
+  }
+
+  // Check each method.
+  for (jint i = 0; i < method_count; ++i) {
+    jint modifiers;
+    jvmtiError mod_result = jenv->GetMethodModifiers(methods[i], &modifiers);
+    if (mod_result != JVMTI_ERROR_NONE) {
+      LOG(FATAL) << "Could not get methods";
+    }
+    constexpr jint kNative = static_cast<jint>(kAccNative);
+    if ((modifiers & kNative) != 0) {
+      BindMethod(jenv, env, klass.get(), methods[i]);
+    }
+  }
+
+  jenv->Deallocate(reinterpret_cast<unsigned char*>(methods));
+}
 
 }  // namespace art
diff --git a/test/ti-agent/common_helper.h b/test/ti-agent/common_helper.h
index 642ca03..0318501 100644
--- a/test/ti-agent/common_helper.h
+++ b/test/ti-agent/common_helper.h
@@ -28,6 +28,15 @@
 
 }  // namespace common_redefine
 
+namespace common_retransform {
+jint OnLoad(JavaVM* vm, char* options, void* reserved);
+}  // namespace common_retransform
+
+namespace common_transform {
+jint OnLoad(JavaVM* vm, char* options, void* reserved);
+}  // namespace common_transform
+
+
 extern bool RuntimeIsJVM;
 
 bool IsJVM();
@@ -67,6 +76,12 @@
 
 bool JvmtiErrorToException(JNIEnv* env, jvmtiError error);
 
+// Load the class through JNI. Inspect it, find all native methods. Construct the corresponding
+// mangled name, run dlsym and bind the method.
+//
+// This will abort on failure.
+void BindFunctions(jvmtiEnv* jvmti_env, JNIEnv* env, const char* class_name);
+
 }  // namespace art
 
 #endif  // ART_TEST_TI_AGENT_COMMON_HELPER_H_
diff --git a/test/ti-agent/common_load.cc b/test/ti-agent/common_load.cc
index 521e672..f507451 100644
--- a/test/ti-agent/common_load.cc
+++ b/test/ti-agent/common_load.cc
@@ -14,6 +14,8 @@
  * limitations under the License.
  */
 
+#include "common_load.h"
+
 #include <jni.h>
 #include <stdio.h>
 // TODO I don't know?
@@ -22,7 +24,6 @@
 #include "art_method-inl.h"
 #include "base/logging.h"
 #include "base/macros.h"
-#include "common_load.h"
 #include "common_helper.h"
 
 #include "901-hello-ti-agent/basics.h"
@@ -32,6 +33,8 @@
 
 jvmtiEnv* jvmti_env;
 
+namespace {
+
 using OnLoad   = jint (*)(JavaVM* vm, char* options, void* reserved);
 using OnAttach = jint (*)(JavaVM* vm, char* options, void* reserved);
 
@@ -41,11 +44,50 @@
   OnAttach attach;
 };
 
+static void JNICALL VMInitCallback(jvmtiEnv *jvmti_env,
+                                   JNIEnv* jni_env,
+                                   jthread thread ATTRIBUTE_UNUSED) {
+  // Bind Main native methods.
+  BindFunctions(jvmti_env, jni_env, "Main");
+}
+
+// Install a phase callback that will bind JNI functions on VMInit.
+bool InstallBindCallback(JavaVM* vm) {
+  // Use a new jvmtiEnv. Otherwise we might collide with table changes.
+  jvmtiEnv* install_env;
+  if (vm->GetEnv(reinterpret_cast<void**>(&install_env), JVMTI_VERSION_1_0) != 0) {
+    return false;
+  }
+  SetAllCapabilities(install_env);
+
+  {
+    jvmtiEventCallbacks callbacks;
+    memset(&callbacks, 0, sizeof(jvmtiEventCallbacks));
+    callbacks.VMInit = VMInitCallback;
+
+    jvmtiError install_error = install_env->SetEventCallbacks(&callbacks, sizeof(callbacks));
+    if (install_error != JVMTI_ERROR_NONE) {
+      return false;
+    }
+  }
+
+  {
+    jvmtiError enable_error = install_env->SetEventNotificationMode(JVMTI_ENABLE,
+                                                                    JVMTI_EVENT_VM_INIT,
+                                                                    nullptr);
+    if (enable_error != JVMTI_ERROR_NONE) {
+      return false;
+    }
+  }
+
+  return true;
+}
+
 // A trivial OnLoad implementation that only initializes the global jvmti_env.
 static jint MinimalOnLoad(JavaVM* vm,
                           char* options ATTRIBUTE_UNUSED,
                           void* reserved ATTRIBUTE_UNUSED) {
-  if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0)) {
+  if (vm->GetEnv(reinterpret_cast<void**>(&jvmti_env), JVMTI_VERSION_1_0) != 0) {
     printf("Unable to get jvmti env!\n");
     return 1;
   }
@@ -55,7 +97,7 @@
 
 // A list of all non-standard the agents we have for testing. All other agents will use
 // MinimalOnLoad.
-AgentLib agents[] = {
+static AgentLib agents[] = {
   { "901-hello-ti-agent", Test901HelloTi::OnLoad, nullptr },
   { "902-hello-transformation", common_redefine::OnLoad, nullptr },
   { "909-attach-agent", nullptr, Test909AttachAgent::OnAttach },
@@ -64,8 +106,12 @@
   { "916-obsolete-jit", common_redefine::OnLoad, nullptr },
   { "917-fields-transformation", common_redefine::OnLoad, nullptr },
   { "919-obsolete-fields", common_redefine::OnLoad, nullptr },
-  { "921-hello-failure", common_redefine::OnLoad, nullptr },
+  { "921-hello-failure", common_retransform::OnLoad, nullptr },
   { "926-multi-obsolescence", common_redefine::OnLoad, nullptr },
+  { "930-hello-retransform", common_retransform::OnLoad, nullptr },
+  { "932-transform-saves", common_retransform::OnLoad, nullptr },
+  { "934-load-transform", common_retransform::OnLoad, nullptr },
+  { "935-non-retransformable", common_transform::OnLoad, nullptr },
 };
 
 static AgentLib* FindAgent(char* name) {
@@ -99,6 +145,28 @@
   RuntimeIsJVM = strncmp(options, "jvm", 3) == 0;
 }
 
+static bool BindFunctionsAttached(JavaVM* vm, const char* class_name) {
+  // Get a JNIEnv. As the thread is attached, we must not destroy it.
+  JNIEnv* env;
+  if (vm->GetEnv(reinterpret_cast<void**>(&env), JNI_VERSION_1_6) != 0) {
+    printf("Unable to get JNI env!\n");
+    return false;
+  }
+
+  jvmtiEnv* jenv;
+  if (vm->GetEnv(reinterpret_cast<void**>(&jenv), JVMTI_VERSION_1_0) != 0) {
+    printf("Unable to get jvmti env!\n");
+    return false;
+  }
+  SetAllCapabilities(jenv);
+
+  BindFunctions(jenv, env, class_name);
+
+  return true;
+}
+
+}  // namespace
+
 extern "C" JNIEXPORT jint JNICALL Agent_OnLoad(JavaVM* vm, char* options, void* reserved) {
   char* remaining_options = nullptr;
   char* name_option = nullptr;
@@ -109,6 +177,10 @@
 
   SetIsJVM(remaining_options);
 
+  if (!InstallBindCallback(vm)) {
+    return 1;
+  }
+
   AgentLib* lib = FindAgent(name_option);
   OnLoad fn = nullptr;
   if (lib == nullptr) {
@@ -130,6 +202,9 @@
     printf("Unable to find agent name in options: %s\n", options);
     return -1;
   }
+
+  BindFunctionsAttached(vm, "Main");
+
   AgentLib* lib = FindAgent(name_option);
   if (lib == nullptr) {
     printf("Unable to find agent named: %s, add it to the list in test/ti-agent/common_load.cc\n",
diff --git a/test/ti-agent/common_load.h b/test/ti-agent/common_load.h
index fac94b4..d254421 100644
--- a/test/ti-agent/common_load.h
+++ b/test/ti-agent/common_load.h
@@ -17,6 +17,7 @@
 #ifndef ART_TEST_TI_AGENT_COMMON_LOAD_H_
 #define ART_TEST_TI_AGENT_COMMON_LOAD_H_
 
+#include "jni.h"
 #include "openjdkjvmti/jvmti.h"
 
 namespace art {
diff --git a/test/valgrind-suppressions.txt b/test/valgrind-suppressions.txt
index fd3c331..c775f98 100644
--- a/test/valgrind-suppressions.txt
+++ b/test/valgrind-suppressions.txt
@@ -22,3 +22,50 @@
    ...
    fun:_ZN3art7Runtime17InitNativeMethodsEv
 }
+
+# SigQuit runs libbacktrace
+{
+   BackTraceReading64
+   Memcheck:Addr8
+   fun:access_mem_unrestricted
+   fun:_Uelf64_memory_read
+   fun:_Uelf64_valid_object_memory
+   fun:map_create_list
+   fun:unw_map_local_create
+   fun:_ZN14UnwindMapLocal5BuildEv
+   fun:_ZN12BacktraceMap6CreateEib
+}
+{
+   BackTraceReading32
+   Memcheck:Addr4
+   fun:access_mem_unrestricted
+   fun:_Uelf32_memory_read
+   fun:_Uelf32_valid_object_memory
+   fun:map_create_list
+   fun:unw_map_local_create
+   fun:_ZN14UnwindMapLocal5BuildEv
+   fun:_ZN12BacktraceMap6CreateEib
+}
+{
+   BackTraceReading64
+   Memcheck:Addr8
+   fun:access_mem_unrestricted
+   fun:_Uelf64_memory_read
+   fun:_Uelf64_get_load_base
+   fun:map_create_list
+   fun:unw_map_local_create
+   fun:_ZN14UnwindMapLocal5BuildEv
+   fun:_ZN12BacktraceMap6CreateEib
+}
+{
+   BackTraceReading32
+   Memcheck:Addr4
+   fun:access_mem_unrestricted
+   fun:_Uelf32_memory_read
+   fun:_Uelf32_get_load_base
+   fun:map_create_list
+   fun:unw_map_local_create
+   fun:_ZN14UnwindMapLocal5BuildEv
+   fun:_ZN12BacktraceMap6CreateEib
+}
+
diff --git a/tools/cpp-define-generator/offset_dexcache.def b/tools/cpp-define-generator/offset_dexcache.def
index abb5e1e..43f9434 100644
--- a/tools/cpp-define-generator/offset_dexcache.def
+++ b/tools/cpp-define-generator/offset_dexcache.def
@@ -34,7 +34,6 @@
 
 //                         New macro suffix          Method Name (of the Offset method)
 DEFINE_ART_METHOD_OFFSET_SIZED(DEX_CACHE_METHODS,    DexCacheResolvedMethods)
-DEFINE_ART_METHOD_OFFSET_SIZED(DEX_CACHE_TYPES,      DexCacheResolvedTypes)
 DEFINE_ART_METHOD_OFFSET_SIZED(JNI,                  EntryPointFromJni)
 DEFINE_ART_METHOD_OFFSET_SIZED(QUICK_CODE,           EntryPointFromQuickCompiledCode)
 DEFINE_ART_METHOD_OFFSET(DECLARING_CLASS,            DeclaringClass)
diff --git a/tools/dexfuzz/README b/tools/dexfuzz/README
index c1cdf1e..78f73f5 100644
--- a/tools/dexfuzz/README
+++ b/tools/dexfuzz/README
@@ -98,7 +98,7 @@
 Timed Out  - mutated files that timed out for one or more backends.
              Current timeouts are:
                Optimizing - 5 seconds
-               Intepreter - 30 seconds
+               Interpreter - 30 seconds
               (use --short-timeouts to set all backends to 2 seconds.)
 Successful - mutated files that executed and all backends agreed on the resulting
              output. NB: if all backends crashed with the same output, this would
diff --git a/tools/dexfuzz/src/dexfuzz/Options.java b/tools/dexfuzz/src/dexfuzz/Options.java
index 99e03e8..af8a05c 100644
--- a/tools/dexfuzz/src/dexfuzz/Options.java
+++ b/tools/dexfuzz/src/dexfuzz/Options.java
@@ -50,6 +50,7 @@
   public static String deviceName = "";
   public static boolean usingSpecificDevice = false;
   public static int repeat = 1;
+  public static int divergenceRetry = 10;
   public static String executeDirectory = "/data/art-test";
   public static String androidRoot = "";
   public static String dumpMutationsFile = "mutations.dump";
@@ -118,6 +119,8 @@
     Log.always("    --repeat=<n>         : Fuzz N programs, executing each one.");
     Log.always("    --short-timeouts     : Shorten timeouts (faster; use if");
     Log.always("                           you want to focus on output divergences)");
+    Log.always("    --divergence-retry=<n> : Number of retries when checking if test is");
+    Log.always("                           self-divergent. (Default: 10)");
     Log.always("  --seed=<seed>          : RNG seed to use");
     Log.always("  --method-mutations=<n> : Maximum number of mutations to perform on each method.");
     Log.always("                           (Default: 3)");
@@ -239,6 +242,8 @@
       maxMethods = Integer.parseInt(value);
     } else if (key.equals("repeat")) {
       repeat = Integer.parseInt(value);
+    } else if (key.equals("divergence-retry")) {
+      divergenceRetry = Integer.parseInt(value);
     } else if (key.equals("log")) {
       Log.setLoggingLevel(LogTag.valueOf(value.toUpperCase()));
     } else if (key.equals("likelihoods")) {
@@ -360,6 +365,10 @@
       Log.error("--repeat must be at least 1!");
       return false;
     }
+    if (divergenceRetry < 0) {
+      Log.error("--divergence-retry cannot be negative!");
+      return false;
+    }
     if (usingProvidedSeed && repeat > 1) {
       Log.error("Cannot use --repeat with --seed");
       return false;
diff --git a/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java b/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java
index 1797d90..ccc426c 100644
--- a/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java
+++ b/tools/dexfuzz/src/dexfuzz/fuzzers/Fuzzer.java
@@ -298,13 +298,13 @@
   }
 
   private boolean checkGoldenExecutorForSelfDivergence(String programName) {
-    // Run golden executor 5 times, make sure it always produces
+    // Run golden executor multiple times, make sure it always produces
     // the same output, otherwise report that it is self-divergent.
 
     // TODO: Instead, produce a list of acceptable outputs, and see if the divergent
     // outputs of the backends fall within this set of outputs.
     String seenOutput = null;
-    for (int i = 0; i < 5; i++) {
+    for (int i = 0; i < Options.divergenceRetry + 1; i++) {
       goldenExecutor.reset();
       goldenExecutor.execute(programName);
       String output = goldenExecutor.getResult().getFlattenedOutput();
diff --git a/tools/jfuzz/run_dex_fuzz_test.py b/tools/jfuzz/run_dex_fuzz_test.py
index 50c4f20..34a92f6 100755
--- a/tools/jfuzz/run_dex_fuzz_test.py
+++ b/tools/jfuzz/run_dex_fuzz_test.py
@@ -19,7 +19,7 @@
 import shutil
 import sys
 
-from subprocess import check_call
+from subprocess import call
 from tempfile import mkdtemp
 
 sys.path.append(os.path.dirname(os.path.dirname(
@@ -75,6 +75,9 @@
     top = GetEnvVariableOrError('ANDROID_BUILD_TOP')
     self._dexfuzz_env['PATH'] = (top + '/art/tools/bisection_search:' +
                                  self._dexfuzz_env['PATH'])
+    android_root = GetEnvVariableOrError('ANDROID_HOST_OUT')
+    self._dexfuzz_env['ANDROID_ROOT'] = android_root
+    self._dexfuzz_env['LD_LIBRARY_PATH'] = android_root + '/lib'
     os.chdir(self._dexfuzz_dir)
     os.mkdir('divergent_programs')
     os.mkdir('bisection_outputs')
@@ -119,24 +122,30 @@
   def RunDexFuzz(self):
     """Starts the DexFuzz testing."""
     os.chdir(self._dexfuzz_dir)
-    dexfuzz_args = ['--inputs=' + self._inputs_dir, '--execute',
-                    '--execute-class=Test', '--repeat=' + str(self._num_tests),
-                    '--dump-output', '--interpreter', '--optimizing',
+    dexfuzz_args = ['--inputs=' + self._inputs_dir,
+                    '--execute',
+                    '--execute-class=Test',
+                    '--repeat=' + str(self._num_tests),
+                    '--dump-output', '--dump-verify',
+                    '--interpreter', '--optimizing',
                     '--bisection-search']
     if self._device is not None:
       dexfuzz_args += ['--device=' + self._device, '--allarm']
     else:
       dexfuzz_args += ['--host']  # Assume host otherwise.
-    check_call(['dexfuzz'] + dexfuzz_args, env=self._dexfuzz_env)
-    # TODO: summarize findings.
+    cmd = ['dexfuzz'] + dexfuzz_args
+    print('**** Running ****\n\n', cmd, '\n')
+    call(cmd, env=self._dexfuzz_env)
+    print('\n**** Results (report.log) ****\n')
+    call(['tail', '-n 24', 'report.log'])
 
 
 def main():
   # Handle arguments.
   parser = argparse.ArgumentParser()
-  parser.add_argument('--num_tests', default=10000,
+  parser.add_argument('--num_tests', default=1000,
                       type=int, help='number of tests to run')
-  parser.add_argument('--num_inputs', default=50,
+  parser.add_argument('--num_inputs', default=10,
                       type=int, help='number of JFuzz program to generate')
   parser.add_argument('--device', help='target device serial number')
   args = parser.parse_args()
diff --git a/tools/jfuzz/run_jfuzz_test_nightly.py b/tools/jfuzz/run_jfuzz_test_nightly.py
index 29595f2..a9f8365 100755
--- a/tools/jfuzz/run_jfuzz_test_nightly.py
+++ b/tools/jfuzz/run_jfuzz_test_nightly.py
@@ -26,9 +26,6 @@
 from tempfile import mkdtemp
 from tempfile import TemporaryFile
 
-# Default arguments for run_jfuzz_test.py.
-DEFAULT_ARGS = ['--num_tests=20000']
-
 # run_jfuzz_test.py success string.
 SUCCESS_STRING = 'success (no divergences)'
 
@@ -36,17 +33,22 @@
 NOT_FOUND = -1
 
 def main(argv):
+  # Set up.
   cwd = os.path.dirname(os.path.realpath(__file__))
-  cmd = [cwd + '/run_jfuzz_test.py'] + DEFAULT_ARGS
+  cmd = [cwd + '/run_jfuzz_test.py']
   parser = argparse.ArgumentParser()
   parser.add_argument('--num_proc', default=8,
                       type=int, help='number of processes to run')
   # Unknown arguments are passed to run_jfuzz_test.py.
   (args, unknown_args) = parser.parse_known_args()
+  # Run processes.
+  cmd = cmd + unknown_args
+  print('\n**** Running ****\n\n', cmd, '\n')
   output_files = [TemporaryFile('wb+') for _ in range(args.num_proc)]
   processes = []
-  for output_file in output_files:
-    processes.append(subprocess.Popen(cmd + unknown_args, stdout=output_file,
+  for i, output_file in enumerate(output_files):
+    print('Tester', i)
+    processes.append(subprocess.Popen(cmd, stdout=output_file,
                                       stderr=subprocess.STDOUT))
   try:
     # Wait for processes to terminate.
@@ -56,6 +58,7 @@
     for proc in processes:
       proc.kill()
   # Output results.
+  print('\n**** Results ****\n')
   output_dirs = []
   for i, output_file in enumerate(output_files):
     output_file.seek(0)
@@ -65,20 +68,24 @@
     directory_match = re.search(r'Directory[^:]*: ([^\n]+)\n', output_str)
     if directory_match:
       output_dirs.append(directory_match.group(1))
-    print('Tester', i)
     if output_str.find(SUCCESS_STRING) == NOT_FOUND:
-      print(output_str)
+      print('Tester', i, output_str)
     else:
-      print(SUCCESS_STRING)
+      print('Tester', i, SUCCESS_STRING)
   # Gather divergences.
   global_out_dir = mkdtemp('jfuzz_nightly')
-  divergence_nr = 1
+  divergence_nr = 0
   for out_dir in output_dirs:
     for divergence_dir in glob(out_dir + '/divergence*/'):
+      divergence_nr += 1
       shutil.copytree(divergence_dir,
                       global_out_dir + '/divergence' + str(divergence_nr))
-      divergence_nr += 1
-  print('Global output directory:', global_out_dir)
+  if divergence_nr > 0:
+    print('\n!!!! Divergences !!!!', divergence_nr)
+  else:
+    print ('\nSuccess')
+  print('\nGlobal output directory:', global_out_dir)
+  print()
 
 if __name__ == '__main__':
   main(sys.argv)
diff --git a/tools/stream-trace-converter.py b/tools/stream-trace-converter.py
index 951b05b..7e341f2 100755
--- a/tools/stream-trace-converter.py
+++ b/tools/stream-trace-converter.py
@@ -124,12 +124,20 @@
     self._threads.append('%d\t%s\n' % (tid, str))
     print 'New thread: %d/%s' % (tid, str)
 
+  def ProcessTraceSummary(self, input):
+    summaryLength = ReadIntLE(input)
+    str = input.read(summaryLength)
+    self._summary = str
+    print 'Summary: \"%s\"' % str
+
   def ProcessSpecial(self, input):
     code = ord(input.read(1))
     if code == 1:
       self.ProcessMethod(input)
     elif code == 2:
       self.ProcessThread(input)
+    elif code == 3:
+      self.ProcessTraceSummary(input)
     else:
       raise MyException("Unknown special!")
 
@@ -147,9 +155,24 @@
       print 'Buffer underrun, file was probably truncated. Results should still be usable.'
 
   def Finalize(self, header):
-    header.write('*threads\n')
-    for t in self._threads:
-      header.write(t)
+    # If the summary is present in the input file, use it as the header except
+    # for the methods section which is emtpy in the input file. If not present,
+    # apppend header with the threads that are recorded in the input stream.
+    if (self._summary):
+      # Erase the contents that's already written earlier by PrintHeader.
+      header.seek(0)
+      header.truncate()
+      # Copy the lines from the input summary to the output header until
+      # the methods section is seen.
+      for line in self._summary.splitlines(True):
+        if line == "*methods\n":
+          break
+        else:
+          header.write(line)
+    else:
+      header.write('*threads\n')
+      for t in self._threads:
+        header.write(t)
     header.write('*methods\n')
     for m in self._methods:
       header.write(m)
@@ -166,6 +189,7 @@
 
     self._methods = []
     self._threads = []
+    self._summary = None
     self.Process(input, body)
 
     self.Finalize(header)