Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 1 | /* |
| 2 | * Copyright (C) 2011 The Android Open Source Project |
| 3 | * |
| 4 | * Licensed under the Apache License, Version 2.0 (the "License"); |
| 5 | * you may not use this file except in compliance with the License. |
| 6 | * You may obtain a copy of the License at |
| 7 | * |
| 8 | * http://www.apache.org/licenses/LICENSE-2.0 |
| 9 | * |
| 10 | * Unless required by applicable law or agreed to in writing, software |
| 11 | * distributed under the License is distributed on an "AS IS" BASIS, |
| 12 | * WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. |
| 13 | * See the License for the specific language governing permissions and |
| 14 | * limitations under the License. |
| 15 | */ |
| 16 | |
| 17 | #include "dex_file_verifier.h" |
| 18 | |
Ian Rogers | e63db27 | 2014-07-15 15:36:11 -0700 | [diff] [blame] | 19 | #include "sys/mman.h" |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 20 | #include "zlib.h" |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 21 | #include <functional> |
Ian Rogers | e63db27 | 2014-07-15 15:36:11 -0700 | [diff] [blame] | 22 | #include <memory> |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 23 | |
Ian Rogers | e63db27 | 2014-07-15 15:36:11 -0700 | [diff] [blame] | 24 | #include "base/unix_file/fd_file.h" |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 25 | #include "base/bit_utils.h" |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 26 | #include "base/macros.h" |
Ian Rogers | e63db27 | 2014-07-15 15:36:11 -0700 | [diff] [blame] | 27 | #include "common_runtime_test.h" |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 28 | #include "dex_file-inl.h" |
Andreas Gampe | a5b09a6 | 2016-11-17 15:21:22 -0800 | [diff] [blame] | 29 | #include "dex_file_types.h" |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 30 | #include "leb128.h" |
Mathieu Chartier | 0795f23 | 2016-09-27 18:43:30 -0700 | [diff] [blame] | 31 | #include "scoped_thread_state_change-inl.h" |
Ian Rogers | e63db27 | 2014-07-15 15:36:11 -0700 | [diff] [blame] | 32 | #include "thread-inl.h" |
Alex Light | 9c20a14 | 2016-08-23 15:05:12 -0700 | [diff] [blame] | 33 | #include "utils.h" |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 34 | |
| 35 | namespace art { |
| 36 | |
Alex Light | 0ed0521 | 2016-05-06 17:36:36 -0700 | [diff] [blame] | 37 | // Make the Dex file version 37. |
| 38 | static void MakeDexVersion37(DexFile* dex_file) { |
| 39 | size_t offset = OFFSETOF_MEMBER(DexFile::Header, magic_) + 6; |
| 40 | CHECK_EQ(*(dex_file->Begin() + offset), '5'); |
| 41 | *(const_cast<uint8_t*>(dex_file->Begin()) + offset) = '7'; |
| 42 | } |
| 43 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 44 | static void FixUpChecksum(uint8_t* dex_file) { |
| 45 | DexFile::Header* header = reinterpret_cast<DexFile::Header*>(dex_file); |
| 46 | uint32_t expected_size = header->file_size_; |
| 47 | uint32_t adler_checksum = adler32(0L, Z_NULL, 0); |
| 48 | const uint32_t non_sum = sizeof(DexFile::Header::magic_) + sizeof(DexFile::Header::checksum_); |
| 49 | const uint8_t* non_sum_ptr = dex_file + non_sum; |
| 50 | adler_checksum = adler32(adler_checksum, non_sum_ptr, expected_size - non_sum); |
| 51 | header->checksum_ = adler_checksum; |
| 52 | } |
| 53 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 54 | class DexFileVerifierTest : public CommonRuntimeTest { |
| 55 | protected: |
Aart Bik | 37d6a3b | 2016-06-21 18:30:10 -0700 | [diff] [blame] | 56 | DexFile* GetDexFile(const uint8_t* dex_bytes, size_t length) { |
David Sehr | 733ddb2 | 2016-09-19 15:02:18 -0700 | [diff] [blame] | 57 | return new DexFile(dex_bytes, length, "tmp", 0, nullptr); |
Aart Bik | 37d6a3b | 2016-06-21 18:30:10 -0700 | [diff] [blame] | 58 | } |
| 59 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 60 | void VerifyModification(const char* dex_file_base64_content, |
| 61 | const char* location, |
Andreas Gampe | ca620d7 | 2016-11-08 08:09:33 -0800 | [diff] [blame] | 62 | const std::function<void(DexFile*)>& f, |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 63 | const char* expected_error) { |
Vladimir Marko | 59399ab | 2016-05-03 16:31:52 +0100 | [diff] [blame] | 64 | size_t length; |
Alex Light | 9c20a14 | 2016-08-23 15:05:12 -0700 | [diff] [blame] | 65 | std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(dex_file_base64_content, &length)); |
Vladimir Marko | 59399ab | 2016-05-03 16:31:52 +0100 | [diff] [blame] | 66 | CHECK(dex_bytes != nullptr); |
| 67 | // Note: `dex_file` will be destroyed before `dex_bytes`. |
Aart Bik | 37d6a3b | 2016-06-21 18:30:10 -0700 | [diff] [blame] | 68 | std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length)); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 69 | f(dex_file.get()); |
| 70 | FixUpChecksum(const_cast<uint8_t*>(dex_file->Begin())); |
| 71 | |
Aart Bik | 37d6a3b | 2016-06-21 18:30:10 -0700 | [diff] [blame] | 72 | static constexpr bool kVerifyChecksum = true; |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 73 | std::string error_msg; |
| 74 | bool success = DexFileVerifier::Verify(dex_file.get(), |
| 75 | dex_file->Begin(), |
| 76 | dex_file->Size(), |
| 77 | location, |
Aart Bik | 37d6a3b | 2016-06-21 18:30:10 -0700 | [diff] [blame] | 78 | kVerifyChecksum, |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 79 | &error_msg); |
| 80 | if (expected_error == nullptr) { |
| 81 | EXPECT_TRUE(success) << error_msg; |
| 82 | } else { |
| 83 | EXPECT_FALSE(success) << "Expected " << expected_error; |
| 84 | if (!success) { |
| 85 | EXPECT_NE(error_msg.find(expected_error), std::string::npos) << error_msg; |
| 86 | } |
| 87 | } |
| 88 | } |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 89 | }; |
| 90 | |
Richard Uhler | fbef44d | 2014-12-23 09:48:51 -0800 | [diff] [blame] | 91 | static std::unique_ptr<const DexFile> OpenDexFileBase64(const char* base64, |
| 92 | const char* location, |
| 93 | std::string* error_msg) { |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 94 | // decode base64 |
Mathieu Chartier | 2cebb24 | 2015-04-21 16:50:40 -0700 | [diff] [blame] | 95 | CHECK(base64 != nullptr); |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 96 | size_t length; |
Ian Rogers | 1373595 | 2014-10-08 12:43:28 -0700 | [diff] [blame] | 97 | std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(base64, &length)); |
Mathieu Chartier | 2cebb24 | 2015-04-21 16:50:40 -0700 | [diff] [blame] | 98 | CHECK(dex_bytes.get() != nullptr); |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 99 | |
| 100 | // write to provided file |
| 101 | std::unique_ptr<File> file(OS::CreateEmptyFile(location)); |
Mathieu Chartier | 2cebb24 | 2015-04-21 16:50:40 -0700 | [diff] [blame] | 102 | CHECK(file.get() != nullptr); |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 103 | if (!file->WriteFully(dex_bytes.get(), length)) { |
| 104 | PLOG(FATAL) << "Failed to write base64 as dex file"; |
| 105 | } |
Andreas Gampe | 4303ba9 | 2014-11-06 01:00:46 -0800 | [diff] [blame] | 106 | if (file->FlushCloseOrErase() != 0) { |
| 107 | PLOG(FATAL) << "Could not flush and close test file."; |
| 108 | } |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 109 | file.reset(); |
| 110 | |
| 111 | // read dex file |
| 112 | ScopedObjectAccess soa(Thread::Current()); |
Richard Uhler | fbef44d | 2014-12-23 09:48:51 -0800 | [diff] [blame] | 113 | std::vector<std::unique_ptr<const DexFile>> tmp; |
Aart Bik | 37d6a3b | 2016-06-21 18:30:10 -0700 | [diff] [blame] | 114 | bool success = DexFile::Open(location, location, true, error_msg, &tmp); |
Andreas Gampe | 833a485 | 2014-05-21 18:46:59 -0700 | [diff] [blame] | 115 | CHECK(success) << error_msg; |
| 116 | EXPECT_EQ(1U, tmp.size()); |
Richard Uhler | fbef44d | 2014-12-23 09:48:51 -0800 | [diff] [blame] | 117 | std::unique_ptr<const DexFile> dex_file = std::move(tmp[0]); |
Andreas Gampe | 833a485 | 2014-05-21 18:46:59 -0700 | [diff] [blame] | 118 | EXPECT_EQ(PROT_READ, dex_file->GetPermissions()); |
| 119 | EXPECT_TRUE(dex_file->IsReadOnly()); |
| 120 | return dex_file; |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 121 | } |
| 122 | |
Roland Levillain | 621b5ea | 2016-05-18 11:41:33 +0100 | [diff] [blame] | 123 | // To generate a base64 encoded Dex file (such as kGoodTestDex, below) |
| 124 | // from Smali files, use: |
| 125 | // |
| 126 | // smali -o classes.dex class1.smali [class2.smali ...] |
| 127 | // base64 classes.dex >classes.dex.base64 |
| 128 | |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 129 | // For reference. |
| 130 | static const char kGoodTestDex[] = |
| 131 | "ZGV4CjAzNQDrVbyVkxX1HljTznNf95AglkUAhQuFtmKkAgAAcAAAAHhWNBIAAAAAAAAAAAQCAAAN" |
| 132 | "AAAAcAAAAAYAAACkAAAAAgAAALwAAAABAAAA1AAAAAQAAADcAAAAAQAAAPwAAACIAQAAHAEAAFoB" |
| 133 | "AABiAQAAagEAAIEBAACVAQAAqQEAAL0BAADDAQAAzgEAANEBAADVAQAA2gEAAN8BAAABAAAAAgAA" |
| 134 | "AAMAAAAEAAAABQAAAAgAAAAIAAAABQAAAAAAAAAJAAAABQAAAFQBAAAEAAEACwAAAAAAAAAAAAAA" |
| 135 | "AAAAAAoAAAABAAEADAAAAAIAAAAAAAAAAAAAAAEAAAACAAAAAAAAAAcAAAAAAAAA8wEAAAAAAAAB" |
| 136 | "AAEAAQAAAOgBAAAEAAAAcBADAAAADgACAAAAAgAAAO0BAAAIAAAAYgAAABoBBgBuIAIAEAAOAAEA" |
| 137 | "AAADAAY8aW5pdD4ABkxUZXN0OwAVTGphdmEvaW8vUHJpbnRTdHJlYW07ABJMamF2YS9sYW5nL09i" |
| 138 | "amVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwASTGphdmEvbGFuZy9TeXN0ZW07AARUZXN0AAlUZXN0" |
| 139 | "LmphdmEAAVYAAlZMAANmb28AA291dAAHcHJpbnRsbgABAAcOAAMABw54AAAAAgAAgYAEnAIBCbQC" |
| 140 | "AAAADQAAAAAAAAABAAAAAAAAAAEAAAANAAAAcAAAAAIAAAAGAAAApAAAAAMAAAACAAAAvAAAAAQA" |
| 141 | "AAABAAAA1AAAAAUAAAAEAAAA3AAAAAYAAAABAAAA/AAAAAEgAAACAAAAHAEAAAEQAAABAAAAVAEA" |
| 142 | "AAIgAAANAAAAWgEAAAMgAAACAAAA6AEAAAAgAAABAAAA8wEAAAAQAAABAAAABAIAAA=="; |
| 143 | |
| 144 | TEST_F(DexFileVerifierTest, GoodDex) { |
| 145 | ScratchFile tmp; |
| 146 | std::string error_msg; |
| 147 | std::unique_ptr<const DexFile> raw(OpenDexFileBase64(kGoodTestDex, tmp.GetFilename().c_str(), |
| 148 | &error_msg)); |
| 149 | ASSERT_TRUE(raw.get() != nullptr) << error_msg; |
| 150 | } |
| 151 | |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 152 | TEST_F(DexFileVerifierTest, MethodId) { |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 153 | // Class idx error. |
| 154 | VerifyModification( |
| 155 | kGoodTestDex, |
| 156 | "method_id_class_idx", |
| 157 | [](DexFile* dex_file) { |
| 158 | DexFile::MethodId* method_id = const_cast<DexFile::MethodId*>(&dex_file->GetMethodId(0)); |
Andreas Gampe | a5b09a6 | 2016-11-17 15:21:22 -0800 | [diff] [blame] | 159 | method_id->class_idx_ = dex::TypeIndex(0xFF); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 160 | }, |
| 161 | "could not find declaring class for direct method index 0"); |
| 162 | |
| 163 | // Proto idx error. |
| 164 | VerifyModification( |
| 165 | kGoodTestDex, |
| 166 | "method_id_proto_idx", |
| 167 | [](DexFile* dex_file) { |
| 168 | DexFile::MethodId* method_id = const_cast<DexFile::MethodId*>(&dex_file->GetMethodId(0)); |
| 169 | method_id->proto_idx_ = 0xFF; |
| 170 | }, |
| 171 | "inter_method_id_item proto_idx"); |
| 172 | |
| 173 | // Name idx error. |
| 174 | VerifyModification( |
| 175 | kGoodTestDex, |
| 176 | "method_id_name_idx", |
| 177 | [](DexFile* dex_file) { |
| 178 | DexFile::MethodId* method_id = const_cast<DexFile::MethodId*>(&dex_file->GetMethodId(0)); |
Andreas Gampe | 8a0128a | 2016-11-28 07:38:35 -0800 | [diff] [blame] | 179 | method_id->name_idx_ = dex::StringIndex(0xFF); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 180 | }, |
| 181 | "String index not available for method flags verification"); |
| 182 | } |
| 183 | |
| 184 | // Method flags test class generated from the following smali code. The declared-synchronized |
| 185 | // flags are there to enforce a 3-byte uLEB128 encoding so we don't have to relayout |
| 186 | // the code, but we need to remove them before doing tests. |
| 187 | // |
| 188 | // .class public LMethodFlags; |
| 189 | // .super Ljava/lang/Object; |
| 190 | // |
| 191 | // .method public static constructor <clinit>()V |
| 192 | // .registers 1 |
| 193 | // return-void |
| 194 | // .end method |
| 195 | // |
| 196 | // .method public constructor <init>()V |
| 197 | // .registers 1 |
| 198 | // return-void |
| 199 | // .end method |
| 200 | // |
| 201 | // .method private declared-synchronized foo()V |
| 202 | // .registers 1 |
| 203 | // return-void |
| 204 | // .end method |
| 205 | // |
| 206 | // .method public declared-synchronized bar()V |
| 207 | // .registers 1 |
| 208 | // return-void |
| 209 | // .end method |
| 210 | |
| 211 | static const char kMethodFlagsTestDex[] = |
| 212 | "ZGV4CjAzNQCyOQrJaDBwiIWv5MIuYKXhxlLLsQcx5SwgAgAAcAAAAHhWNBIAAAAAAAAAAJgBAAAH" |
| 213 | "AAAAcAAAAAMAAACMAAAAAQAAAJgAAAAAAAAAAAAAAAQAAACkAAAAAQAAAMQAAAA8AQAA5AAAAOQA" |
| 214 | "AADuAAAA9gAAAAUBAAAZAQAAHAEAACEBAAACAAAAAwAAAAQAAAAEAAAAAgAAAAAAAAAAAAAAAAAA" |
| 215 | "AAAAAAABAAAAAAAAAAUAAAAAAAAABgAAAAAAAAABAAAAAQAAAAAAAAD/////AAAAAHoBAAAAAAAA" |
| 216 | "CDxjbGluaXQ+AAY8aW5pdD4ADUxNZXRob2RGbGFnczsAEkxqYXZhL2xhbmcvT2JqZWN0OwABVgAD" |
| 217 | "YmFyAANmb28AAAAAAAAAAQAAAAAAAAAAAAAAAQAAAA4AAAABAAEAAAAAAAAAAAABAAAADgAAAAEA" |
| 218 | "AQAAAAAAAAAAAAEAAAAOAAAAAQABAAAAAAAAAAAAAQAAAA4AAAADAQCJgASsAgGBgATAAgKCgAjU" |
| 219 | "AgKBgAjoAgAACwAAAAAAAAABAAAAAAAAAAEAAAAHAAAAcAAAAAIAAAADAAAAjAAAAAMAAAABAAAA" |
| 220 | "mAAAAAUAAAAEAAAApAAAAAYAAAABAAAAxAAAAAIgAAAHAAAA5AAAAAMQAAABAAAAKAEAAAEgAAAE" |
| 221 | "AAAALAEAAAAgAAABAAAAegEAAAAQAAABAAAAmAEAAA=="; |
| 222 | |
| 223 | // Find the method data for the first method with the given name (from class 0). Note: the pointer |
| 224 | // is to the access flags, so that the caller doesn't have to handle the leb128-encoded method-index |
| 225 | // delta. |
Vladimir Marko | 59399ab | 2016-05-03 16:31:52 +0100 | [diff] [blame] | 226 | static const uint8_t* FindMethodData(const DexFile* dex_file, |
| 227 | const char* name, |
| 228 | /*out*/ uint32_t* method_idx = nullptr) { |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 229 | const DexFile::ClassDef& class_def = dex_file->GetClassDef(0); |
| 230 | const uint8_t* class_data = dex_file->GetClassData(class_def); |
| 231 | |
| 232 | ClassDataItemIterator it(*dex_file, class_data); |
| 233 | |
| 234 | const uint8_t* trailing = class_data; |
| 235 | // Need to manually decode the four entries. DataPointer() doesn't work for this, as the first |
| 236 | // element has already been loaded into the iterator. |
| 237 | DecodeUnsignedLeb128(&trailing); |
| 238 | DecodeUnsignedLeb128(&trailing); |
| 239 | DecodeUnsignedLeb128(&trailing); |
| 240 | DecodeUnsignedLeb128(&trailing); |
| 241 | |
| 242 | // Skip all fields. |
| 243 | while (it.HasNextStaticField() || it.HasNextInstanceField()) { |
| 244 | trailing = it.DataPointer(); |
| 245 | it.Next(); |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 246 | } |
| 247 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 248 | while (it.HasNextDirectMethod() || it.HasNextVirtualMethod()) { |
| 249 | uint32_t method_index = it.GetMemberIndex(); |
Andreas Gampe | 8a0128a | 2016-11-28 07:38:35 -0800 | [diff] [blame] | 250 | dex::StringIndex name_index = dex_file->GetMethodId(method_index).name_idx_; |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 251 | const DexFile::StringId& string_id = dex_file->GetStringId(name_index); |
| 252 | const char* str = dex_file->GetStringData(string_id); |
| 253 | if (strcmp(name, str) == 0) { |
Vladimir Marko | 59399ab | 2016-05-03 16:31:52 +0100 | [diff] [blame] | 254 | if (method_idx != nullptr) { |
| 255 | *method_idx = method_index; |
| 256 | } |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 257 | DecodeUnsignedLeb128(&trailing); |
| 258 | return trailing; |
| 259 | } |
| 260 | |
| 261 | trailing = it.DataPointer(); |
| 262 | it.Next(); |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 263 | } |
| 264 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 265 | return nullptr; |
| 266 | } |
| 267 | |
| 268 | // Set the method flags to the given value. |
| 269 | static void SetMethodFlags(DexFile* dex_file, const char* method, uint32_t mask) { |
| 270 | uint8_t* method_flags_ptr = const_cast<uint8_t*>(FindMethodData(dex_file, method)); |
| 271 | CHECK(method_flags_ptr != nullptr) << method; |
| 272 | |
| 273 | // Unroll this, as we only have three bytes, anyways. |
| 274 | uint8_t base1 = static_cast<uint8_t>(mask & 0x7F); |
| 275 | *(method_flags_ptr++) = (base1 | 0x80); |
| 276 | mask >>= 7; |
| 277 | |
| 278 | uint8_t base2 = static_cast<uint8_t>(mask & 0x7F); |
| 279 | *(method_flags_ptr++) = (base2 | 0x80); |
| 280 | mask >>= 7; |
| 281 | |
| 282 | uint8_t base3 = static_cast<uint8_t>(mask & 0x7F); |
| 283 | *method_flags_ptr = base3; |
| 284 | } |
| 285 | |
| 286 | static uint32_t GetMethodFlags(DexFile* dex_file, const char* method) { |
| 287 | const uint8_t* method_flags_ptr = const_cast<uint8_t*>(FindMethodData(dex_file, method)); |
| 288 | CHECK(method_flags_ptr != nullptr) << method; |
| 289 | return DecodeUnsignedLeb128(&method_flags_ptr); |
| 290 | } |
| 291 | |
| 292 | // Apply the given mask to method flags. |
| 293 | static void ApplyMaskToMethodFlags(DexFile* dex_file, const char* method, uint32_t mask) { |
| 294 | uint32_t value = GetMethodFlags(dex_file, method); |
| 295 | value &= mask; |
| 296 | SetMethodFlags(dex_file, method, value); |
| 297 | } |
| 298 | |
| 299 | // Apply the given mask to method flags. |
| 300 | static void OrMaskToMethodFlags(DexFile* dex_file, const char* method, uint32_t mask) { |
| 301 | uint32_t value = GetMethodFlags(dex_file, method); |
| 302 | value |= mask; |
| 303 | SetMethodFlags(dex_file, method, value); |
| 304 | } |
| 305 | |
| 306 | // Set code_off to 0 for the method. |
| 307 | static void RemoveCode(DexFile* dex_file, const char* method) { |
| 308 | const uint8_t* ptr = FindMethodData(dex_file, method); |
| 309 | // Next is flags, pass. |
| 310 | DecodeUnsignedLeb128(&ptr); |
| 311 | |
| 312 | // Figure out how many bytes the code_off is. |
| 313 | const uint8_t* tmp = ptr; |
| 314 | DecodeUnsignedLeb128(&tmp); |
| 315 | size_t bytes = tmp - ptr; |
| 316 | |
| 317 | uint8_t* mod = const_cast<uint8_t*>(ptr); |
| 318 | for (size_t i = 1; i < bytes; ++i) { |
| 319 | *(mod++) = 0x80; |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 320 | } |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 321 | *mod = 0x00; |
| 322 | } |
| 323 | |
| 324 | TEST_F(DexFileVerifierTest, MethodAccessFlagsBase) { |
| 325 | // Check that it's OK when the wrong declared-synchronized flag is removed from "foo." |
| 326 | VerifyModification( |
| 327 | kMethodFlagsTestDex, |
| 328 | "method_flags_ok", |
| 329 | [](DexFile* dex_file) { |
| 330 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 331 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 332 | }, |
| 333 | nullptr); |
| 334 | } |
| 335 | |
| 336 | TEST_F(DexFileVerifierTest, MethodAccessFlagsConstructors) { |
| 337 | // Make sure we still accept constructors without their flags. |
| 338 | VerifyModification( |
| 339 | kMethodFlagsTestDex, |
| 340 | "method_flags_missing_constructor_tag_ok", |
| 341 | [](DexFile* dex_file) { |
| 342 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 343 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 344 | |
| 345 | ApplyMaskToMethodFlags(dex_file, "<init>", ~kAccConstructor); |
| 346 | ApplyMaskToMethodFlags(dex_file, "<clinit>", ~kAccConstructor); |
| 347 | }, |
| 348 | nullptr); |
| 349 | |
| 350 | constexpr const char* kConstructors[] = { "<clinit>", "<init>"}; |
| 351 | for (size_t i = 0; i < 2; ++i) { |
| 352 | // Constructor with code marked native. |
| 353 | VerifyModification( |
| 354 | kMethodFlagsTestDex, |
| 355 | "method_flags_constructor_native", |
| 356 | [&](DexFile* dex_file) { |
| 357 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 358 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 359 | |
| 360 | OrMaskToMethodFlags(dex_file, kConstructors[i], kAccNative); |
| 361 | }, |
| 362 | "has code, but is marked native or abstract"); |
| 363 | // Constructor with code marked abstract. |
| 364 | VerifyModification( |
| 365 | kMethodFlagsTestDex, |
| 366 | "method_flags_constructor_abstract", |
| 367 | [&](DexFile* dex_file) { |
| 368 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 369 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 370 | |
| 371 | OrMaskToMethodFlags(dex_file, kConstructors[i], kAccAbstract); |
| 372 | }, |
| 373 | "has code, but is marked native or abstract"); |
| 374 | // Constructor as-is without code. |
| 375 | VerifyModification( |
| 376 | kMethodFlagsTestDex, |
| 377 | "method_flags_constructor_nocode", |
| 378 | [&](DexFile* dex_file) { |
| 379 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 380 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 381 | |
| 382 | RemoveCode(dex_file, kConstructors[i]); |
| 383 | }, |
| 384 | "has no code, but is not marked native or abstract"); |
| 385 | // Constructor without code marked native. |
| 386 | VerifyModification( |
| 387 | kMethodFlagsTestDex, |
| 388 | "method_flags_constructor_native_nocode", |
| 389 | [&](DexFile* dex_file) { |
Alex Light | 0ed0521 | 2016-05-06 17:36:36 -0700 | [diff] [blame] | 390 | MakeDexVersion37(dex_file); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 391 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 392 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 393 | |
| 394 | OrMaskToMethodFlags(dex_file, kConstructors[i], kAccNative); |
| 395 | RemoveCode(dex_file, kConstructors[i]); |
| 396 | }, |
| 397 | "must not be abstract or native"); |
| 398 | // Constructor without code marked abstract. |
| 399 | VerifyModification( |
| 400 | kMethodFlagsTestDex, |
| 401 | "method_flags_constructor_abstract_nocode", |
| 402 | [&](DexFile* dex_file) { |
Alex Light | 0ed0521 | 2016-05-06 17:36:36 -0700 | [diff] [blame] | 403 | MakeDexVersion37(dex_file); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 404 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 405 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 406 | |
| 407 | OrMaskToMethodFlags(dex_file, kConstructors[i], kAccAbstract); |
| 408 | RemoveCode(dex_file, kConstructors[i]); |
| 409 | }, |
| 410 | "must not be abstract or native"); |
| 411 | } |
| 412 | // <init> may only have (modulo ignored): |
| 413 | // kAccPrivate | kAccProtected | kAccPublic | kAccStrict | kAccVarargs | kAccSynthetic |
| 414 | static constexpr uint32_t kInitAllowed[] = { |
| 415 | 0, |
| 416 | kAccPrivate, |
| 417 | kAccProtected, |
| 418 | kAccPublic, |
| 419 | kAccStrict, |
| 420 | kAccVarargs, |
| 421 | kAccSynthetic |
| 422 | }; |
| 423 | for (size_t i = 0; i < arraysize(kInitAllowed); ++i) { |
| 424 | VerifyModification( |
| 425 | kMethodFlagsTestDex, |
| 426 | "init_allowed_flags", |
| 427 | [&](DexFile* dex_file) { |
| 428 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 429 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 430 | |
| 431 | ApplyMaskToMethodFlags(dex_file, "<init>", ~kAccPublic); |
| 432 | OrMaskToMethodFlags(dex_file, "<init>", kInitAllowed[i]); |
| 433 | }, |
| 434 | nullptr); |
| 435 | } |
| 436 | // Only one of public-private-protected. |
| 437 | for (size_t i = 1; i < 8; ++i) { |
| 438 | if (POPCOUNT(i) < 2) { |
| 439 | continue; |
| 440 | } |
| 441 | // Technically the flags match, but just be defensive here. |
| 442 | uint32_t mask = ((i & 1) != 0 ? kAccPrivate : 0) | |
| 443 | ((i & 2) != 0 ? kAccProtected : 0) | |
| 444 | ((i & 4) != 0 ? kAccPublic : 0); |
| 445 | VerifyModification( |
| 446 | kMethodFlagsTestDex, |
| 447 | "init_one_of_ppp", |
| 448 | [&](DexFile* dex_file) { |
| 449 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 450 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 451 | |
| 452 | ApplyMaskToMethodFlags(dex_file, "<init>", ~kAccPublic); |
| 453 | OrMaskToMethodFlags(dex_file, "<init>", mask); |
| 454 | }, |
| 455 | "Method may have only one of public/protected/private"); |
| 456 | } |
| 457 | // <init> doesn't allow |
| 458 | // kAccStatic | kAccFinal | kAccSynchronized | kAccBridge |
| 459 | // Need to handle static separately as it has its own error message. |
| 460 | VerifyModification( |
| 461 | kMethodFlagsTestDex, |
| 462 | "init_not_allowed_flags", |
| 463 | [&](DexFile* dex_file) { |
Alex Light | 0ed0521 | 2016-05-06 17:36:36 -0700 | [diff] [blame] | 464 | MakeDexVersion37(dex_file); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 465 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 466 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 467 | |
| 468 | ApplyMaskToMethodFlags(dex_file, "<init>", ~kAccPublic); |
| 469 | OrMaskToMethodFlags(dex_file, "<init>", kAccStatic); |
| 470 | }, |
Andreas Gampe | c9f0ba1 | 2016-02-09 09:21:04 -0800 | [diff] [blame] | 471 | "Constructor 1(LMethodFlags;.<init>) is not flagged correctly wrt/ static"); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 472 | static constexpr uint32_t kInitNotAllowed[] = { |
| 473 | kAccFinal, |
| 474 | kAccSynchronized, |
| 475 | kAccBridge |
| 476 | }; |
| 477 | for (size_t i = 0; i < arraysize(kInitNotAllowed); ++i) { |
| 478 | VerifyModification( |
| 479 | kMethodFlagsTestDex, |
| 480 | "init_not_allowed_flags", |
| 481 | [&](DexFile* dex_file) { |
| 482 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 483 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 484 | |
| 485 | ApplyMaskToMethodFlags(dex_file, "<init>", ~kAccPublic); |
| 486 | OrMaskToMethodFlags(dex_file, "<init>", kInitNotAllowed[i]); |
| 487 | }, |
Andreas Gampe | c9f0ba1 | 2016-02-09 09:21:04 -0800 | [diff] [blame] | 488 | "Constructor 1(LMethodFlags;.<init>) flagged inappropriately"); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 489 | } |
| 490 | } |
| 491 | |
| 492 | TEST_F(DexFileVerifierTest, MethodAccessFlagsMethods) { |
| 493 | constexpr const char* kMethods[] = { "foo", "bar"}; |
| 494 | for (size_t i = 0; i < arraysize(kMethods); ++i) { |
| 495 | // Make sure we reject non-constructors marked as constructors. |
| 496 | VerifyModification( |
| 497 | kMethodFlagsTestDex, |
| 498 | "method_flags_non_constructor", |
| 499 | [&](DexFile* dex_file) { |
| 500 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 501 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 502 | |
| 503 | OrMaskToMethodFlags(dex_file, kMethods[i], kAccConstructor); |
| 504 | }, |
| 505 | "is marked constructor, but doesn't match name"); |
| 506 | |
| 507 | VerifyModification( |
| 508 | kMethodFlagsTestDex, |
| 509 | "method_flags_native_with_code", |
| 510 | [&](DexFile* dex_file) { |
| 511 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 512 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 513 | |
| 514 | OrMaskToMethodFlags(dex_file, kMethods[i], kAccNative); |
| 515 | }, |
| 516 | "has code, but is marked native or abstract"); |
| 517 | |
| 518 | VerifyModification( |
| 519 | kMethodFlagsTestDex, |
| 520 | "method_flags_abstract_with_code", |
| 521 | [&](DexFile* dex_file) { |
| 522 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 523 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 524 | |
| 525 | OrMaskToMethodFlags(dex_file, kMethods[i], kAccAbstract); |
| 526 | }, |
| 527 | "has code, but is marked native or abstract"); |
| 528 | |
| 529 | VerifyModification( |
| 530 | kMethodFlagsTestDex, |
| 531 | "method_flags_non_abstract_native_no_code", |
| 532 | [&](DexFile* dex_file) { |
| 533 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 534 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 535 | |
| 536 | RemoveCode(dex_file, kMethods[i]); |
| 537 | }, |
| 538 | "has no code, but is not marked native or abstract"); |
| 539 | |
| 540 | // Abstract methods may not have the following flags. |
| 541 | constexpr uint32_t kAbstractDisallowed[] = { |
| 542 | kAccPrivate, |
| 543 | kAccStatic, |
| 544 | kAccFinal, |
| 545 | kAccNative, |
| 546 | kAccStrict, |
| 547 | kAccSynchronized, |
| 548 | }; |
| 549 | for (size_t j = 0; j < arraysize(kAbstractDisallowed); ++j) { |
| 550 | VerifyModification( |
| 551 | kMethodFlagsTestDex, |
| 552 | "method_flags_abstract_and_disallowed_no_code", |
| 553 | [&](DexFile* dex_file) { |
| 554 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 555 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 556 | |
| 557 | RemoveCode(dex_file, kMethods[i]); |
| 558 | |
| 559 | // Can't check private and static with foo, as it's in the virtual list and gives a |
| 560 | // different error. |
| 561 | if (((GetMethodFlags(dex_file, kMethods[i]) & kAccPublic) != 0) && |
| 562 | ((kAbstractDisallowed[j] & (kAccPrivate | kAccStatic)) != 0)) { |
| 563 | // Use another breaking flag. |
| 564 | OrMaskToMethodFlags(dex_file, kMethods[i], kAccAbstract | kAccFinal); |
| 565 | } else { |
| 566 | OrMaskToMethodFlags(dex_file, kMethods[i], kAccAbstract | kAbstractDisallowed[j]); |
| 567 | } |
| 568 | }, |
| 569 | "has disallowed access flags"); |
| 570 | } |
| 571 | |
| 572 | // Only one of public-private-protected. |
| 573 | for (size_t j = 1; j < 8; ++j) { |
| 574 | if (POPCOUNT(j) < 2) { |
| 575 | continue; |
| 576 | } |
| 577 | // Technically the flags match, but just be defensive here. |
| 578 | uint32_t mask = ((j & 1) != 0 ? kAccPrivate : 0) | |
| 579 | ((j & 2) != 0 ? kAccProtected : 0) | |
| 580 | ((j & 4) != 0 ? kAccPublic : 0); |
| 581 | VerifyModification( |
| 582 | kMethodFlagsTestDex, |
| 583 | "method_flags_one_of_ppp", |
| 584 | [&](DexFile* dex_file) { |
| 585 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 586 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 587 | |
| 588 | ApplyMaskToMethodFlags(dex_file, kMethods[i], ~kAccPublic); |
| 589 | OrMaskToMethodFlags(dex_file, kMethods[i], mask); |
| 590 | }, |
| 591 | "Method may have only one of public/protected/private"); |
| 592 | } |
| 593 | } |
| 594 | } |
| 595 | |
| 596 | TEST_F(DexFileVerifierTest, MethodAccessFlagsIgnoredOK) { |
| 597 | constexpr const char* kMethods[] = { "<clinit>", "<init>", "foo", "bar"}; |
| 598 | for (size_t i = 0; i < arraysize(kMethods); ++i) { |
| 599 | // All interesting method flags, other flags are to be ignored. |
| 600 | constexpr uint32_t kAllMethodFlags = |
| 601 | kAccPublic | |
| 602 | kAccPrivate | |
| 603 | kAccProtected | |
| 604 | kAccStatic | |
| 605 | kAccFinal | |
| 606 | kAccSynchronized | |
| 607 | kAccBridge | |
| 608 | kAccVarargs | |
| 609 | kAccNative | |
| 610 | kAccAbstract | |
| 611 | kAccStrict | |
| 612 | kAccSynthetic; |
| 613 | constexpr uint32_t kIgnoredMask = ~kAllMethodFlags & 0xFFFF; |
| 614 | VerifyModification( |
| 615 | kMethodFlagsTestDex, |
| 616 | "method_flags_ignored", |
| 617 | [&](DexFile* dex_file) { |
| 618 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 619 | ApplyMaskToMethodFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 620 | |
| 621 | OrMaskToMethodFlags(dex_file, kMethods[i], kIgnoredMask); |
| 622 | }, |
| 623 | nullptr); |
| 624 | } |
| 625 | } |
| 626 | |
Vladimir Marko | 59399ab | 2016-05-03 16:31:52 +0100 | [diff] [blame] | 627 | TEST_F(DexFileVerifierTest, B28552165) { |
| 628 | // Regression test for bad error string retrieval in different situations. |
| 629 | // Using invalid access flags to trigger the error. |
| 630 | VerifyModification( |
| 631 | kMethodFlagsTestDex, |
| 632 | "b28552165", |
| 633 | [](DexFile* dex_file) { |
| 634 | OrMaskToMethodFlags(dex_file, "foo", kAccPublic | kAccProtected); |
Vladimir Marko | 59399ab | 2016-05-03 16:31:52 +0100 | [diff] [blame] | 635 | }, |
Orion Hodson | 6c4921b | 2016-09-21 15:41:06 +0100 | [diff] [blame^] | 636 | "Method may have only one of public/protected/private, LMethodFlags;.foo"); |
Vladimir Marko | 59399ab | 2016-05-03 16:31:52 +0100 | [diff] [blame] | 637 | } |
| 638 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 639 | // Set of dex files for interface method tests. As it's not as easy to mutate method names, it's |
| 640 | // just easier to break up bad cases. |
| 641 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 642 | // Standard interface. Use declared-synchronized again for 3B encoding. |
| 643 | // |
| 644 | // .class public interface LInterfaceMethodFlags; |
| 645 | // .super Ljava/lang/Object; |
| 646 | // |
| 647 | // .method public static constructor <clinit>()V |
| 648 | // .registers 1 |
| 649 | // return-void |
| 650 | // .end method |
| 651 | // |
| 652 | // .method public abstract declared-synchronized foo()V |
| 653 | // .end method |
| 654 | static const char kMethodFlagsInterface[] = |
| 655 | "ZGV4CjAzNQCOM0odZ5bws1d9GSmumXaK5iE/7XxFpOm8AQAAcAAAAHhWNBIAAAAAAAAAADQBAAAF" |
| 656 | "AAAAcAAAAAMAAACEAAAAAQAAAJAAAAAAAAAAAAAAAAIAAACcAAAAAQAAAKwAAADwAAAAzAAAAMwA" |
| 657 | "AADWAAAA7gAAAAIBAAAFAQAAAQAAAAIAAAADAAAAAwAAAAIAAAAAAAAAAAAAAAAAAAAAAAAABAAA" |
| 658 | "AAAAAAABAgAAAQAAAAAAAAD/////AAAAACIBAAAAAAAACDxjbGluaXQ+ABZMSW50ZXJmYWNlTWV0" |
| 659 | "aG9kRmxhZ3M7ABJMamF2YS9sYW5nL09iamVjdDsAAVYAA2ZvbwAAAAAAAAABAAAAAAAAAAAAAAAB" |
| 660 | "AAAADgAAAAEBAImABJACAYGICAAAAAALAAAAAAAAAAEAAAAAAAAAAQAAAAUAAABwAAAAAgAAAAMA" |
| 661 | "AACEAAAAAwAAAAEAAACQAAAABQAAAAIAAACcAAAABgAAAAEAAACsAAAAAiAAAAUAAADMAAAAAxAA" |
| 662 | "AAEAAAAMAQAAASAAAAEAAAAQAQAAACAAAAEAAAAiAQAAABAAAAEAAAA0AQAA"; |
| 663 | |
| 664 | // To simplify generation of interesting "sub-states" of src_value, allow a "simple" mask to apply |
| 665 | // to a src_value, such that mask bit 0 applies to the lowest set bit in src_value, and so on. |
| 666 | static uint32_t ApplyMaskShifted(uint32_t src_value, uint32_t mask) { |
| 667 | uint32_t result = 0; |
| 668 | uint32_t mask_index = 0; |
| 669 | while (src_value != 0) { |
| 670 | uint32_t index = CTZ(src_value); |
| 671 | if (((src_value & (1 << index)) != 0) && |
| 672 | ((mask & (1 << mask_index)) != 0)) { |
| 673 | result |= (1 << index); |
| 674 | } |
| 675 | src_value &= ~(1 << index); |
| 676 | mask_index++; |
| 677 | } |
| 678 | return result; |
| 679 | } |
| 680 | |
| 681 | TEST_F(DexFileVerifierTest, MethodAccessFlagsInterfaces) { |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 682 | VerifyModification( |
| 683 | kMethodFlagsInterface, |
| 684 | "method_flags_interface_ok", |
| 685 | [](DexFile* dex_file) { |
| 686 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 687 | }, |
| 688 | nullptr); |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 689 | VerifyModification( |
| 690 | kMethodFlagsInterface, |
| 691 | "method_flags_interface_ok37", |
| 692 | [](DexFile* dex_file) { |
| 693 | MakeDexVersion37(dex_file); |
| 694 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 695 | }, |
| 696 | nullptr); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 697 | |
| 698 | VerifyModification( |
| 699 | kMethodFlagsInterface, |
| 700 | "method_flags_interface_non_public", |
| 701 | [](DexFile* dex_file) { |
| 702 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 703 | |
| 704 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccPublic); |
| 705 | }, |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 706 | nullptr); // Should be allowed in older dex versions for backwards compatibility. |
| 707 | VerifyModification( |
| 708 | kMethodFlagsInterface, |
| 709 | "method_flags_interface_non_public", |
| 710 | [](DexFile* dex_file) { |
| 711 | MakeDexVersion37(dex_file); |
| 712 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 713 | |
| 714 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccPublic); |
| 715 | }, |
Alex Light | d7c10c2 | 2016-03-31 10:03:07 -0700 | [diff] [blame] | 716 | "Interface virtual method 1(LInterfaceMethodFlags;.foo) is not public"); |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 717 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 718 | VerifyModification( |
| 719 | kMethodFlagsInterface, |
| 720 | "method_flags_interface_non_abstract", |
| 721 | [](DexFile* dex_file) { |
| 722 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 723 | |
| 724 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccAbstract); |
| 725 | }, |
Andreas Gampe | c9f0ba1 | 2016-02-09 09:21:04 -0800 | [diff] [blame] | 726 | "Method 1(LInterfaceMethodFlags;.foo) has no code, but is not marked native or abstract"); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 727 | |
| 728 | VerifyModification( |
| 729 | kMethodFlagsInterface, |
| 730 | "method_flags_interface_static", |
| 731 | [](DexFile* dex_file) { |
| 732 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 733 | |
| 734 | OrMaskToMethodFlags(dex_file, "foo", kAccStatic); |
| 735 | }, |
Andreas Gampe | c9f0ba1 | 2016-02-09 09:21:04 -0800 | [diff] [blame] | 736 | "Direct/virtual method 1(LInterfaceMethodFlags;.foo) not in expected list 0"); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 737 | VerifyModification( |
| 738 | kMethodFlagsInterface, |
| 739 | "method_flags_interface_private", |
| 740 | [](DexFile* dex_file) { |
| 741 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 742 | |
| 743 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccPublic); |
| 744 | OrMaskToMethodFlags(dex_file, "foo", kAccPrivate); |
| 745 | }, |
Andreas Gampe | c9f0ba1 | 2016-02-09 09:21:04 -0800 | [diff] [blame] | 746 | "Direct/virtual method 1(LInterfaceMethodFlags;.foo) not in expected list 0"); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 747 | |
| 748 | VerifyModification( |
| 749 | kMethodFlagsInterface, |
| 750 | "method_flags_interface_non_public", |
| 751 | [](DexFile* dex_file) { |
| 752 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 753 | |
| 754 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccPublic); |
| 755 | }, |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 756 | nullptr); // Should be allowed in older dex versions for backwards compatibility. |
| 757 | VerifyModification( |
| 758 | kMethodFlagsInterface, |
| 759 | "method_flags_interface_non_public", |
| 760 | [](DexFile* dex_file) { |
| 761 | MakeDexVersion37(dex_file); |
| 762 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 763 | |
| 764 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccPublic); |
| 765 | }, |
Alex Light | d7c10c2 | 2016-03-31 10:03:07 -0700 | [diff] [blame] | 766 | "Interface virtual method 1(LInterfaceMethodFlags;.foo) is not public"); |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 767 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 768 | VerifyModification( |
| 769 | kMethodFlagsInterface, |
| 770 | "method_flags_interface_protected", |
| 771 | [](DexFile* dex_file) { |
| 772 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 773 | |
| 774 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccPublic); |
| 775 | OrMaskToMethodFlags(dex_file, "foo", kAccProtected); |
| 776 | }, |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 777 | nullptr); // Should be allowed in older dex versions for backwards compatibility. |
| 778 | VerifyModification( |
| 779 | kMethodFlagsInterface, |
| 780 | "method_flags_interface_protected", |
| 781 | [](DexFile* dex_file) { |
| 782 | MakeDexVersion37(dex_file); |
| 783 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 784 | |
| 785 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccPublic); |
| 786 | OrMaskToMethodFlags(dex_file, "foo", kAccProtected); |
| 787 | }, |
Alex Light | d7c10c2 | 2016-03-31 10:03:07 -0700 | [diff] [blame] | 788 | "Interface virtual method 1(LInterfaceMethodFlags;.foo) is not public"); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 789 | |
| 790 | constexpr uint32_t kAllMethodFlags = |
| 791 | kAccPublic | |
| 792 | kAccPrivate | |
| 793 | kAccProtected | |
| 794 | kAccStatic | |
| 795 | kAccFinal | |
| 796 | kAccSynchronized | |
| 797 | kAccBridge | |
| 798 | kAccVarargs | |
| 799 | kAccNative | |
| 800 | kAccAbstract | |
| 801 | kAccStrict | |
| 802 | kAccSynthetic; |
| 803 | constexpr uint32_t kInterfaceMethodFlags = |
| 804 | kAccPublic | kAccAbstract | kAccVarargs | kAccBridge | kAccSynthetic; |
| 805 | constexpr uint32_t kInterfaceDisallowed = kAllMethodFlags & |
| 806 | ~kInterfaceMethodFlags & |
| 807 | // Already tested, needed to be separate. |
| 808 | ~kAccStatic & |
| 809 | ~kAccPrivate & |
| 810 | ~kAccProtected; |
| 811 | static_assert(kInterfaceDisallowed != 0, "There should be disallowed flags."); |
| 812 | |
| 813 | uint32_t bits = POPCOUNT(kInterfaceDisallowed); |
| 814 | for (uint32_t i = 1; i < (1u << bits); ++i) { |
| 815 | VerifyModification( |
| 816 | kMethodFlagsInterface, |
| 817 | "method_flags_interface_non_abstract", |
| 818 | [&](DexFile* dex_file) { |
| 819 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 820 | |
| 821 | uint32_t mask = ApplyMaskShifted(kInterfaceDisallowed, i); |
| 822 | if ((mask & kAccProtected) != 0) { |
| 823 | mask &= ~kAccProtected; |
| 824 | ApplyMaskToMethodFlags(dex_file, "foo", ~kAccPublic); |
| 825 | } |
| 826 | OrMaskToMethodFlags(dex_file, "foo", mask); |
| 827 | }, |
Andreas Gampe | c9f0ba1 | 2016-02-09 09:21:04 -0800 | [diff] [blame] | 828 | "Abstract method 1(LInterfaceMethodFlags;.foo) has disallowed access flags"); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 829 | } |
| 830 | } |
| 831 | |
| 832 | /////////////////////////////////////////////////////////////////// |
| 833 | |
| 834 | // Field flags. |
| 835 | |
| 836 | // Find the method data for the first method with the given name (from class 0). Note: the pointer |
| 837 | // is to the access flags, so that the caller doesn't have to handle the leb128-encoded method-index |
| 838 | // delta. |
| 839 | static const uint8_t* FindFieldData(const DexFile* dex_file, const char* name) { |
| 840 | const DexFile::ClassDef& class_def = dex_file->GetClassDef(0); |
| 841 | const uint8_t* class_data = dex_file->GetClassData(class_def); |
| 842 | |
| 843 | ClassDataItemIterator it(*dex_file, class_data); |
| 844 | |
| 845 | const uint8_t* trailing = class_data; |
| 846 | // Need to manually decode the four entries. DataPointer() doesn't work for this, as the first |
| 847 | // element has already been loaded into the iterator. |
| 848 | DecodeUnsignedLeb128(&trailing); |
| 849 | DecodeUnsignedLeb128(&trailing); |
| 850 | DecodeUnsignedLeb128(&trailing); |
| 851 | DecodeUnsignedLeb128(&trailing); |
| 852 | |
| 853 | while (it.HasNextStaticField() || it.HasNextInstanceField()) { |
| 854 | uint32_t field_index = it.GetMemberIndex(); |
Andreas Gampe | 8a0128a | 2016-11-28 07:38:35 -0800 | [diff] [blame] | 855 | dex::StringIndex name_index = dex_file->GetFieldId(field_index).name_idx_; |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 856 | const DexFile::StringId& string_id = dex_file->GetStringId(name_index); |
| 857 | const char* str = dex_file->GetStringData(string_id); |
| 858 | if (strcmp(name, str) == 0) { |
| 859 | DecodeUnsignedLeb128(&trailing); |
| 860 | return trailing; |
| 861 | } |
| 862 | |
| 863 | trailing = it.DataPointer(); |
| 864 | it.Next(); |
| 865 | } |
| 866 | |
| 867 | return nullptr; |
| 868 | } |
| 869 | |
| 870 | // Set the method flags to the given value. |
| 871 | static void SetFieldFlags(DexFile* dex_file, const char* field, uint32_t mask) { |
| 872 | uint8_t* field_flags_ptr = const_cast<uint8_t*>(FindFieldData(dex_file, field)); |
| 873 | CHECK(field_flags_ptr != nullptr) << field; |
| 874 | |
| 875 | // Unroll this, as we only have three bytes, anyways. |
| 876 | uint8_t base1 = static_cast<uint8_t>(mask & 0x7F); |
| 877 | *(field_flags_ptr++) = (base1 | 0x80); |
| 878 | mask >>= 7; |
| 879 | |
| 880 | uint8_t base2 = static_cast<uint8_t>(mask & 0x7F); |
| 881 | *(field_flags_ptr++) = (base2 | 0x80); |
| 882 | mask >>= 7; |
| 883 | |
| 884 | uint8_t base3 = static_cast<uint8_t>(mask & 0x7F); |
| 885 | *field_flags_ptr = base3; |
| 886 | } |
| 887 | |
| 888 | static uint32_t GetFieldFlags(DexFile* dex_file, const char* field) { |
| 889 | const uint8_t* field_flags_ptr = const_cast<uint8_t*>(FindFieldData(dex_file, field)); |
| 890 | CHECK(field_flags_ptr != nullptr) << field; |
| 891 | return DecodeUnsignedLeb128(&field_flags_ptr); |
| 892 | } |
| 893 | |
| 894 | // Apply the given mask to method flags. |
| 895 | static void ApplyMaskToFieldFlags(DexFile* dex_file, const char* field, uint32_t mask) { |
| 896 | uint32_t value = GetFieldFlags(dex_file, field); |
| 897 | value &= mask; |
| 898 | SetFieldFlags(dex_file, field, value); |
| 899 | } |
| 900 | |
| 901 | // Apply the given mask to method flags. |
| 902 | static void OrMaskToFieldFlags(DexFile* dex_file, const char* field, uint32_t mask) { |
| 903 | uint32_t value = GetFieldFlags(dex_file, field); |
| 904 | value |= mask; |
| 905 | SetFieldFlags(dex_file, field, value); |
| 906 | } |
| 907 | |
| 908 | // Standard class. Use declared-synchronized again for 3B encoding. |
| 909 | // |
| 910 | // .class public LFieldFlags; |
| 911 | // .super Ljava/lang/Object; |
| 912 | // |
| 913 | // .field declared-synchronized public foo:I |
| 914 | // |
| 915 | // .field declared-synchronized public static bar:I |
| 916 | |
| 917 | static const char kFieldFlagsTestDex[] = |
| 918 | "ZGV4CjAzNQBtLw7hydbfv4TdXidZyzAB70W7w3vnYJRwAQAAcAAAAHhWNBIAAAAAAAAAAAABAAAF" |
| 919 | "AAAAcAAAAAMAAACEAAAAAAAAAAAAAAACAAAAkAAAAAAAAAAAAAAAAQAAAKAAAACwAAAAwAAAAMAA" |
| 920 | "AADDAAAA0QAAAOUAAADqAAAAAAAAAAEAAAACAAAAAQAAAAMAAAABAAAABAAAAAEAAAABAAAAAgAA" |
| 921 | "AAAAAAD/////AAAAAPQAAAAAAAAAAUkADExGaWVsZEZsYWdzOwASTGphdmEvbGFuZy9PYmplY3Q7" |
| 922 | "AANiYXIAA2ZvbwAAAAAAAAEBAAAAiYAIAYGACAkAAAAAAAAAAQAAAAAAAAABAAAABQAAAHAAAAAC" |
| 923 | "AAAAAwAAAIQAAAAEAAAAAgAAAJAAAAAGAAAAAQAAAKAAAAACIAAABQAAAMAAAAADEAAAAQAAAPAA" |
| 924 | "AAAAIAAAAQAAAPQAAAAAEAAAAQAAAAABAAA="; |
| 925 | |
| 926 | TEST_F(DexFileVerifierTest, FieldAccessFlagsBase) { |
| 927 | // Check that it's OK when the wrong declared-synchronized flag is removed from "foo." |
| 928 | VerifyModification( |
| 929 | kFieldFlagsTestDex, |
| 930 | "field_flags_ok", |
| 931 | [](DexFile* dex_file) { |
| 932 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 933 | ApplyMaskToFieldFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 934 | }, |
| 935 | nullptr); |
| 936 | } |
| 937 | |
| 938 | TEST_F(DexFileVerifierTest, FieldAccessFlagsWrongList) { |
| 939 | // Mark the field so that it should appear in the opposite list (instance vs static). |
| 940 | VerifyModification( |
| 941 | kFieldFlagsTestDex, |
| 942 | "field_flags_wrong_list", |
| 943 | [](DexFile* dex_file) { |
| 944 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 945 | ApplyMaskToFieldFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 946 | |
| 947 | OrMaskToFieldFlags(dex_file, "foo", kAccStatic); |
| 948 | }, |
| 949 | "Static/instance field not in expected list"); |
| 950 | VerifyModification( |
| 951 | kFieldFlagsTestDex, |
| 952 | "field_flags_wrong_list", |
| 953 | [](DexFile* dex_file) { |
| 954 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 955 | ApplyMaskToFieldFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 956 | |
| 957 | ApplyMaskToFieldFlags(dex_file, "bar", ~kAccStatic); |
| 958 | }, |
| 959 | "Static/instance field not in expected list"); |
| 960 | } |
| 961 | |
| 962 | TEST_F(DexFileVerifierTest, FieldAccessFlagsPPP) { |
| 963 | static const char* kFields[] = { "foo", "bar" }; |
| 964 | for (size_t i = 0; i < arraysize(kFields); ++i) { |
| 965 | // Should be OK to remove public. |
| 966 | VerifyModification( |
| 967 | kFieldFlagsTestDex, |
| 968 | "field_flags_non_public", |
| 969 | [&](DexFile* dex_file) { |
| 970 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 971 | ApplyMaskToFieldFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 972 | |
| 973 | ApplyMaskToFieldFlags(dex_file, kFields[i], ~kAccPublic); |
| 974 | }, |
| 975 | nullptr); |
| 976 | constexpr uint32_t kAccFlags = kAccPublic | kAccPrivate | kAccProtected; |
| 977 | uint32_t bits = POPCOUNT(kAccFlags); |
| 978 | for (uint32_t j = 1; j < (1u << bits); ++j) { |
| 979 | if (POPCOUNT(j) < 2) { |
| 980 | continue; |
| 981 | } |
| 982 | VerifyModification( |
| 983 | kFieldFlagsTestDex, |
| 984 | "field_flags_ppp", |
| 985 | [&](DexFile* dex_file) { |
| 986 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 987 | ApplyMaskToFieldFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 988 | |
| 989 | ApplyMaskToFieldFlags(dex_file, kFields[i], ~kAccPublic); |
| 990 | uint32_t mask = ApplyMaskShifted(kAccFlags, j); |
| 991 | OrMaskToFieldFlags(dex_file, kFields[i], mask); |
| 992 | }, |
| 993 | "Field may have only one of public/protected/private"); |
| 994 | } |
| 995 | } |
| 996 | } |
| 997 | |
| 998 | TEST_F(DexFileVerifierTest, FieldAccessFlagsIgnoredOK) { |
| 999 | constexpr const char* kFields[] = { "foo", "bar"}; |
| 1000 | for (size_t i = 0; i < arraysize(kFields); ++i) { |
| 1001 | // All interesting method flags, other flags are to be ignored. |
| 1002 | constexpr uint32_t kAllFieldFlags = |
| 1003 | kAccPublic | |
| 1004 | kAccPrivate | |
| 1005 | kAccProtected | |
| 1006 | kAccStatic | |
| 1007 | kAccFinal | |
| 1008 | kAccVolatile | |
| 1009 | kAccTransient | |
| 1010 | kAccSynthetic | |
| 1011 | kAccEnum; |
| 1012 | constexpr uint32_t kIgnoredMask = ~kAllFieldFlags & 0xFFFF; |
| 1013 | VerifyModification( |
| 1014 | kFieldFlagsTestDex, |
| 1015 | "field_flags_ignored", |
| 1016 | [&](DexFile* dex_file) { |
| 1017 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1018 | ApplyMaskToFieldFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 1019 | |
| 1020 | OrMaskToFieldFlags(dex_file, kFields[i], kIgnoredMask); |
| 1021 | }, |
| 1022 | nullptr); |
| 1023 | } |
| 1024 | } |
| 1025 | |
| 1026 | TEST_F(DexFileVerifierTest, FieldAccessFlagsVolatileFinal) { |
| 1027 | constexpr const char* kFields[] = { "foo", "bar"}; |
| 1028 | for (size_t i = 0; i < arraysize(kFields); ++i) { |
| 1029 | VerifyModification( |
| 1030 | kFieldFlagsTestDex, |
| 1031 | "field_flags_final_and_volatile", |
| 1032 | [&](DexFile* dex_file) { |
| 1033 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1034 | ApplyMaskToFieldFlags(dex_file, "bar", ~kAccDeclaredSynchronized); |
| 1035 | |
| 1036 | OrMaskToFieldFlags(dex_file, kFields[i], kAccVolatile | kAccFinal); |
| 1037 | }, |
| 1038 | "Fields may not be volatile and final"); |
| 1039 | } |
| 1040 | } |
| 1041 | |
| 1042 | // Standard interface. Needs to be separate from class as interfaces do not allow instance fields. |
| 1043 | // Use declared-synchronized again for 3B encoding. |
| 1044 | // |
| 1045 | // .class public interface LInterfaceFieldFlags; |
| 1046 | // .super Ljava/lang/Object; |
| 1047 | // |
| 1048 | // .field declared-synchronized public static final foo:I |
| 1049 | |
| 1050 | static const char kFieldFlagsInterfaceTestDex[] = |
| 1051 | "ZGV4CjAzNQCVMHfEimR1zZPk6hl6O9GPAYqkl3u0umFkAQAAcAAAAHhWNBIAAAAAAAAAAPQAAAAE" |
| 1052 | "AAAAcAAAAAMAAACAAAAAAAAAAAAAAAABAAAAjAAAAAAAAAAAAAAAAQAAAJQAAACwAAAAtAAAALQA" |
| 1053 | "AAC3AAAAzgAAAOIAAAAAAAAAAQAAAAIAAAABAAAAAwAAAAEAAAABAgAAAgAAAAAAAAD/////AAAA" |
| 1054 | "AOwAAAAAAAAAAUkAFUxJbnRlcmZhY2VGaWVsZEZsYWdzOwASTGphdmEvbGFuZy9PYmplY3Q7AANm" |
| 1055 | "b28AAAAAAAABAAAAAJmACAkAAAAAAAAAAQAAAAAAAAABAAAABAAAAHAAAAACAAAAAwAAAIAAAAAE" |
| 1056 | "AAAAAQAAAIwAAAAGAAAAAQAAAJQAAAACIAAABAAAALQAAAADEAAAAQAAAOgAAAAAIAAAAQAAAOwA" |
| 1057 | "AAAAEAAAAQAAAPQAAAA="; |
| 1058 | |
| 1059 | TEST_F(DexFileVerifierTest, FieldAccessFlagsInterface) { |
| 1060 | VerifyModification( |
| 1061 | kFieldFlagsInterfaceTestDex, |
| 1062 | "field_flags_interface", |
| 1063 | [](DexFile* dex_file) { |
| 1064 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1065 | }, |
| 1066 | nullptr); |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 1067 | VerifyModification( |
| 1068 | kFieldFlagsInterfaceTestDex, |
| 1069 | "field_flags_interface", |
| 1070 | [](DexFile* dex_file) { |
| 1071 | MakeDexVersion37(dex_file); |
| 1072 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1073 | }, |
| 1074 | nullptr); |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 1075 | |
| 1076 | VerifyModification( |
| 1077 | kFieldFlagsInterfaceTestDex, |
| 1078 | "field_flags_interface_non_public", |
| 1079 | [](DexFile* dex_file) { |
| 1080 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1081 | |
| 1082 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccPublic); |
| 1083 | }, |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 1084 | nullptr); // Should be allowed in older dex versions for backwards compatibility. |
| 1085 | VerifyModification( |
| 1086 | kFieldFlagsInterfaceTestDex, |
| 1087 | "field_flags_interface_non_public", |
| 1088 | [](DexFile* dex_file) { |
| 1089 | MakeDexVersion37(dex_file); |
| 1090 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1091 | |
| 1092 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccPublic); |
| 1093 | }, |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 1094 | "Interface field is not public final static"); |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 1095 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 1096 | VerifyModification( |
| 1097 | kFieldFlagsInterfaceTestDex, |
| 1098 | "field_flags_interface_non_final", |
| 1099 | [](DexFile* dex_file) { |
| 1100 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1101 | |
| 1102 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccFinal); |
| 1103 | }, |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 1104 | nullptr); // Should be allowed in older dex versions for backwards compatibility. |
| 1105 | VerifyModification( |
| 1106 | kFieldFlagsInterfaceTestDex, |
| 1107 | "field_flags_interface_non_final", |
| 1108 | [](DexFile* dex_file) { |
| 1109 | MakeDexVersion37(dex_file); |
| 1110 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1111 | |
| 1112 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccFinal); |
| 1113 | }, |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 1114 | "Interface field is not public final static"); |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 1115 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 1116 | VerifyModification( |
| 1117 | kFieldFlagsInterfaceTestDex, |
| 1118 | "field_flags_interface_protected", |
| 1119 | [](DexFile* dex_file) { |
| 1120 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1121 | |
| 1122 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccPublic); |
| 1123 | OrMaskToFieldFlags(dex_file, "foo", kAccProtected); |
| 1124 | }, |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 1125 | nullptr); // Should be allowed in older dex versions for backwards compatibility. |
| 1126 | VerifyModification( |
| 1127 | kFieldFlagsInterfaceTestDex, |
| 1128 | "field_flags_interface_protected", |
| 1129 | [](DexFile* dex_file) { |
| 1130 | MakeDexVersion37(dex_file); |
| 1131 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1132 | |
| 1133 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccPublic); |
| 1134 | OrMaskToFieldFlags(dex_file, "foo", kAccProtected); |
| 1135 | }, |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 1136 | "Interface field is not public final static"); |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 1137 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 1138 | VerifyModification( |
| 1139 | kFieldFlagsInterfaceTestDex, |
| 1140 | "field_flags_interface_private", |
| 1141 | [](DexFile* dex_file) { |
| 1142 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1143 | |
| 1144 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccPublic); |
| 1145 | OrMaskToFieldFlags(dex_file, "foo", kAccPrivate); |
| 1146 | }, |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 1147 | nullptr); // Should be allowed in older dex versions for backwards compatibility. |
| 1148 | VerifyModification( |
| 1149 | kFieldFlagsInterfaceTestDex, |
| 1150 | "field_flags_interface_private", |
| 1151 | [](DexFile* dex_file) { |
| 1152 | MakeDexVersion37(dex_file); |
| 1153 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1154 | |
| 1155 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccPublic); |
| 1156 | OrMaskToFieldFlags(dex_file, "foo", kAccPrivate); |
| 1157 | }, |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 1158 | "Interface field is not public final static"); |
| 1159 | |
| 1160 | VerifyModification( |
| 1161 | kFieldFlagsInterfaceTestDex, |
| 1162 | "field_flags_interface_synthetic", |
| 1163 | [](DexFile* dex_file) { |
| 1164 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1165 | |
| 1166 | OrMaskToFieldFlags(dex_file, "foo", kAccSynthetic); |
| 1167 | }, |
| 1168 | nullptr); |
| 1169 | |
| 1170 | constexpr uint32_t kAllFieldFlags = |
| 1171 | kAccPublic | |
| 1172 | kAccPrivate | |
| 1173 | kAccProtected | |
| 1174 | kAccStatic | |
| 1175 | kAccFinal | |
| 1176 | kAccVolatile | |
| 1177 | kAccTransient | |
| 1178 | kAccSynthetic | |
| 1179 | kAccEnum; |
| 1180 | constexpr uint32_t kInterfaceFieldFlags = kAccPublic | kAccStatic | kAccFinal | kAccSynthetic; |
| 1181 | constexpr uint32_t kInterfaceDisallowed = kAllFieldFlags & |
| 1182 | ~kInterfaceFieldFlags & |
| 1183 | ~kAccProtected & |
| 1184 | ~kAccPrivate; |
| 1185 | static_assert(kInterfaceDisallowed != 0, "There should be disallowed flags."); |
| 1186 | |
| 1187 | uint32_t bits = POPCOUNT(kInterfaceDisallowed); |
| 1188 | for (uint32_t i = 1; i < (1u << bits); ++i) { |
| 1189 | VerifyModification( |
| 1190 | kFieldFlagsInterfaceTestDex, |
| 1191 | "field_flags_interface_disallowed", |
| 1192 | [&](DexFile* dex_file) { |
| 1193 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1194 | |
| 1195 | uint32_t mask = ApplyMaskShifted(kInterfaceDisallowed, i); |
| 1196 | if ((mask & kAccProtected) != 0) { |
| 1197 | mask &= ~kAccProtected; |
| 1198 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccPublic); |
| 1199 | } |
| 1200 | OrMaskToFieldFlags(dex_file, "foo", mask); |
| 1201 | }, |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 1202 | nullptr); // Should be allowed in older dex versions for backwards compatibility. |
| 1203 | VerifyModification( |
| 1204 | kFieldFlagsInterfaceTestDex, |
| 1205 | "field_flags_interface_disallowed", |
| 1206 | [&](DexFile* dex_file) { |
| 1207 | MakeDexVersion37(dex_file); |
| 1208 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1209 | |
| 1210 | uint32_t mask = ApplyMaskShifted(kInterfaceDisallowed, i); |
| 1211 | if ((mask & kAccProtected) != 0) { |
| 1212 | mask &= ~kAccProtected; |
| 1213 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccPublic); |
| 1214 | } |
| 1215 | OrMaskToFieldFlags(dex_file, "foo", mask); |
| 1216 | }, |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 1217 | "Interface field has disallowed flag"); |
| 1218 | } |
| 1219 | } |
| 1220 | |
| 1221 | // Standard bad interface. Needs to be separate from class as interfaces do not allow instance |
| 1222 | // fields. Use declared-synchronized again for 3B encoding. |
| 1223 | // |
| 1224 | // .class public interface LInterfaceFieldFlags; |
| 1225 | // .super Ljava/lang/Object; |
| 1226 | // |
| 1227 | // .field declared-synchronized public final foo:I |
| 1228 | |
| 1229 | static const char kFieldFlagsInterfaceBadTestDex[] = |
| 1230 | "ZGV4CjAzNQByMUnqYKHBkUpvvNp+9CnZ2VyDkKnRN6VkAQAAcAAAAHhWNBIAAAAAAAAAAPQAAAAE" |
| 1231 | "AAAAcAAAAAMAAACAAAAAAAAAAAAAAAABAAAAjAAAAAAAAAAAAAAAAQAAAJQAAACwAAAAtAAAALQA" |
| 1232 | "AAC3AAAAzgAAAOIAAAAAAAAAAQAAAAIAAAABAAAAAwAAAAEAAAABAgAAAgAAAAAAAAD/////AAAA" |
| 1233 | "AOwAAAAAAAAAAUkAFUxJbnRlcmZhY2VGaWVsZEZsYWdzOwASTGphdmEvbGFuZy9PYmplY3Q7AANm" |
| 1234 | "b28AAAAAAAAAAQAAAJGACAkAAAAAAAAAAQAAAAAAAAABAAAABAAAAHAAAAACAAAAAwAAAIAAAAAE" |
| 1235 | "AAAAAQAAAIwAAAAGAAAAAQAAAJQAAAACIAAABAAAALQAAAADEAAAAQAAAOgAAAAAIAAAAQAAAOwA" |
| 1236 | "AAAAEAAAAQAAAPQAAAA="; |
| 1237 | |
| 1238 | TEST_F(DexFileVerifierTest, FieldAccessFlagsInterfaceNonStatic) { |
| 1239 | VerifyModification( |
| 1240 | kFieldFlagsInterfaceBadTestDex, |
| 1241 | "field_flags_interface_non_static", |
| 1242 | [](DexFile* dex_file) { |
| 1243 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1244 | }, |
Andreas Gampe | 76ed99d | 2016-03-28 18:31:29 -0700 | [diff] [blame] | 1245 | nullptr); // Should be allowed in older dex versions for backwards compatibility. |
| 1246 | VerifyModification( |
| 1247 | kFieldFlagsInterfaceBadTestDex, |
| 1248 | "field_flags_interface_non_static", |
| 1249 | [](DexFile* dex_file) { |
| 1250 | MakeDexVersion37(dex_file); |
| 1251 | ApplyMaskToFieldFlags(dex_file, "foo", ~kAccDeclaredSynchronized); |
| 1252 | }, |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 1253 | "Interface field is not public final static"); |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 1254 | } |
| 1255 | |
Logan Chien | dd3208d | 2015-04-19 23:27:52 +0800 | [diff] [blame] | 1256 | // Generated from: |
| 1257 | // |
| 1258 | // .class public LTest; |
| 1259 | // .super Ljava/lang/Object; |
| 1260 | // .source "Test.java" |
| 1261 | // |
| 1262 | // .method public constructor <init>()V |
| 1263 | // .registers 1 |
| 1264 | // |
| 1265 | // .prologue |
| 1266 | // .line 1 |
| 1267 | // invoke-direct {p0}, Ljava/lang/Object;-><init>()V |
| 1268 | // |
| 1269 | // return-void |
| 1270 | // .end method |
| 1271 | // |
| 1272 | // .method public static main()V |
| 1273 | // .registers 2 |
| 1274 | // |
| 1275 | // const-string v0, "a" |
| 1276 | // const-string v0, "b" |
| 1277 | // const-string v0, "c" |
| 1278 | // const-string v0, "d" |
| 1279 | // const-string v0, "e" |
| 1280 | // const-string v0, "f" |
| 1281 | // const-string v0, "g" |
| 1282 | // const-string v0, "h" |
| 1283 | // const-string v0, "i" |
| 1284 | // const-string v0, "j" |
| 1285 | // const-string v0, "k" |
| 1286 | // |
| 1287 | // .local v1, "local_var":Ljava/lang/String; |
| 1288 | // const-string v1, "test" |
| 1289 | // .end method |
| 1290 | |
| 1291 | static const char kDebugInfoTestDex[] = |
| 1292 | "ZGV4CjAzNQCHRkHix2eIMQgvLD/0VGrlllZLo0Rb6VyUAgAAcAAAAHhWNBIAAAAAAAAAAAwCAAAU" |
| 1293 | "AAAAcAAAAAQAAADAAAAAAQAAANAAAAAAAAAAAAAAAAMAAADcAAAAAQAAAPQAAACAAQAAFAEAABQB" |
| 1294 | "AAAcAQAAJAEAADgBAABMAQAAVwEAAFoBAABdAQAAYAEAAGMBAABmAQAAaQEAAGwBAABvAQAAcgEA" |
| 1295 | "AHUBAAB4AQAAewEAAIYBAACMAQAAAQAAAAIAAAADAAAABQAAAAUAAAADAAAAAAAAAAAAAAAAAAAA" |
| 1296 | "AAAAABIAAAABAAAAAAAAAAAAAAABAAAAAQAAAAAAAAAEAAAAAAAAAPwBAAAAAAAABjxpbml0PgAG" |
| 1297 | "TFRlc3Q7ABJMamF2YS9sYW5nL09iamVjdDsAEkxqYXZhL2xhbmcvU3RyaW5nOwAJVGVzdC5qYXZh" |
| 1298 | "AAFWAAFhAAFiAAFjAAFkAAFlAAFmAAFnAAFoAAFpAAFqAAFrAAlsb2NhbF92YXIABG1haW4ABHRl" |
| 1299 | "c3QAAAABAAcOAAAAARYDARIDAAAAAQABAAEAAACUAQAABAAAAHAQAgAAAA4AAgAAAAAAAACZAQAA" |
| 1300 | "GAAAABoABgAaAAcAGgAIABoACQAaAAoAGgALABoADAAaAA0AGgAOABoADwAaABAAGgETAAAAAgAA" |
| 1301 | "gYAEpAMBCbwDAAALAAAAAAAAAAEAAAAAAAAAAQAAABQAAABwAAAAAgAAAAQAAADAAAAAAwAAAAEA" |
| 1302 | "AADQAAAABQAAAAMAAADcAAAABgAAAAEAAAD0AAAAAiAAABQAAAAUAQAAAyAAAAIAAACUAQAAASAA" |
| 1303 | "AAIAAACkAQAAACAAAAEAAAD8AQAAABAAAAEAAAAMAgAA"; |
| 1304 | |
| 1305 | TEST_F(DexFileVerifierTest, DebugInfoTypeIdxTest) { |
| 1306 | { |
| 1307 | // The input dex file should be good before modification. |
| 1308 | ScratchFile tmp; |
| 1309 | std::string error_msg; |
| 1310 | std::unique_ptr<const DexFile> raw(OpenDexFileBase64(kDebugInfoTestDex, |
| 1311 | tmp.GetFilename().c_str(), |
| 1312 | &error_msg)); |
| 1313 | ASSERT_TRUE(raw.get() != nullptr) << error_msg; |
| 1314 | } |
| 1315 | |
Andreas Gampe | e6215c0 | 2015-08-31 18:54:38 -0700 | [diff] [blame] | 1316 | // Modify the debug information entry. |
| 1317 | VerifyModification( |
| 1318 | kDebugInfoTestDex, |
| 1319 | "debug_start_type_idx", |
| 1320 | [](DexFile* dex_file) { |
| 1321 | *(const_cast<uint8_t*>(dex_file->Begin()) + 416) = 0x14U; |
| 1322 | }, |
| 1323 | "DBG_START_LOCAL type_idx"); |
Logan Chien | dd3208d | 2015-04-19 23:27:52 +0800 | [diff] [blame] | 1324 | } |
| 1325 | |
Andreas Gampe | b512c0e | 2016-02-19 19:45:34 -0800 | [diff] [blame] | 1326 | TEST_F(DexFileVerifierTest, SectionAlignment) { |
| 1327 | { |
| 1328 | // The input dex file should be good before modification. Any file is fine, as long as it |
| 1329 | // uses all sections. |
| 1330 | ScratchFile tmp; |
| 1331 | std::string error_msg; |
| 1332 | std::unique_ptr<const DexFile> raw(OpenDexFileBase64(kGoodTestDex, |
| 1333 | tmp.GetFilename().c_str(), |
| 1334 | &error_msg)); |
| 1335 | ASSERT_TRUE(raw.get() != nullptr) << error_msg; |
| 1336 | } |
| 1337 | |
| 1338 | // Modify all section offsets to be unaligned. |
| 1339 | constexpr size_t kSections = 7; |
| 1340 | for (size_t i = 0; i < kSections; ++i) { |
| 1341 | VerifyModification( |
| 1342 | kGoodTestDex, |
| 1343 | "section_align", |
| 1344 | [&](DexFile* dex_file) { |
| 1345 | DexFile::Header* header = const_cast<DexFile::Header*>( |
| 1346 | reinterpret_cast<const DexFile::Header*>(dex_file->Begin())); |
| 1347 | uint32_t* off_ptr; |
| 1348 | switch (i) { |
| 1349 | case 0: |
| 1350 | off_ptr = &header->map_off_; |
| 1351 | break; |
| 1352 | case 1: |
| 1353 | off_ptr = &header->string_ids_off_; |
| 1354 | break; |
| 1355 | case 2: |
| 1356 | off_ptr = &header->type_ids_off_; |
| 1357 | break; |
| 1358 | case 3: |
| 1359 | off_ptr = &header->proto_ids_off_; |
| 1360 | break; |
| 1361 | case 4: |
| 1362 | off_ptr = &header->field_ids_off_; |
| 1363 | break; |
| 1364 | case 5: |
| 1365 | off_ptr = &header->method_ids_off_; |
| 1366 | break; |
| 1367 | case 6: |
| 1368 | off_ptr = &header->class_defs_off_; |
| 1369 | break; |
| 1370 | |
| 1371 | static_assert(kSections == 7, "kSections is wrong"); |
| 1372 | default: |
| 1373 | LOG(FATAL) << "Unexpected section"; |
| 1374 | UNREACHABLE(); |
| 1375 | } |
| 1376 | ASSERT_TRUE(off_ptr != nullptr); |
| 1377 | ASSERT_NE(*off_ptr, 0U) << i; // Should already contain a value (in use). |
| 1378 | (*off_ptr)++; // Add one, which should misalign it (all the sections |
| 1379 | // above are aligned by 4). |
| 1380 | }, |
| 1381 | "should be aligned by 4 for"); |
| 1382 | } |
| 1383 | } |
| 1384 | |
Vladimir Marko | 0ca8add | 2016-05-03 17:17:50 +0100 | [diff] [blame] | 1385 | // Generated from |
| 1386 | // |
| 1387 | // .class LOverloading; |
| 1388 | // |
| 1389 | // .super Ljava/lang/Object; |
| 1390 | // |
| 1391 | // .method public static foo()V |
| 1392 | // .registers 1 |
| 1393 | // return-void |
| 1394 | // .end method |
| 1395 | // |
| 1396 | // .method public static foo(I)V |
| 1397 | // .registers 1 |
| 1398 | // return-void |
| 1399 | // .end method |
| 1400 | static const char kProtoOrderingTestDex[] = |
| 1401 | "ZGV4CjAzNQA1L+ABE6voQ9Lr4Ci//efB53oGnDr5PinsAQAAcAAAAHhWNBIAAAAAAAAAAFgBAAAG" |
| 1402 | "AAAAcAAAAAQAAACIAAAAAgAAAJgAAAAAAAAAAAAAAAIAAACwAAAAAQAAAMAAAAAMAQAA4AAAAOAA" |
| 1403 | "AADjAAAA8gAAAAYBAAAJAQAADQEAAAAAAAABAAAAAgAAAAMAAAADAAAAAwAAAAAAAAAEAAAAAwAA" |
| 1404 | "ABQBAAABAAAABQAAAAEAAQAFAAAAAQAAAAAAAAACAAAAAAAAAP////8AAAAASgEAAAAAAAABSQAN" |
| 1405 | "TE92ZXJsb2FkaW5nOwASTGphdmEvbGFuZy9PYmplY3Q7AAFWAAJWSQADZm9vAAAAAQAAAAAAAAAA" |
| 1406 | "AAAAAAAAAAEAAAAAAAAAAAAAAAEAAAAOAAAAAQABAAAAAAAAAAAAAQAAAA4AAAACAAAJpAIBCbgC" |
| 1407 | "AAAMAAAAAAAAAAEAAAAAAAAAAQAAAAYAAABwAAAAAgAAAAQAAACIAAAAAwAAAAIAAACYAAAABQAA" |
| 1408 | "AAIAAACwAAAABgAAAAEAAADAAAAAAiAAAAYAAADgAAAAARAAAAEAAAAUAQAAAxAAAAIAAAAcAQAA" |
| 1409 | "ASAAAAIAAAAkAQAAACAAAAEAAABKAQAAABAAAAEAAABYAQAA"; |
| 1410 | |
| 1411 | TEST_F(DexFileVerifierTest, ProtoOrdering) { |
| 1412 | { |
| 1413 | // The input dex file should be good before modification. |
| 1414 | ScratchFile tmp; |
| 1415 | std::string error_msg; |
| 1416 | std::unique_ptr<const DexFile> raw(OpenDexFileBase64(kProtoOrderingTestDex, |
| 1417 | tmp.GetFilename().c_str(), |
| 1418 | &error_msg)); |
| 1419 | ASSERT_TRUE(raw.get() != nullptr) << error_msg; |
| 1420 | } |
| 1421 | |
| 1422 | // Modify the order of the ProtoIds for two overloads of "foo" with the |
| 1423 | // same return type and one having longer parameter list than the other. |
| 1424 | for (size_t i = 0; i != 2; ++i) { |
| 1425 | VerifyModification( |
| 1426 | kProtoOrderingTestDex, |
| 1427 | "proto_ordering", |
| 1428 | [i](DexFile* dex_file) { |
| 1429 | uint32_t method_idx; |
| 1430 | const uint8_t* data = FindMethodData(dex_file, "foo", &method_idx); |
| 1431 | CHECK(data != nullptr); |
| 1432 | // There should be 2 methods called "foo". |
| 1433 | CHECK_LT(method_idx + 1u, dex_file->NumMethodIds()); |
| 1434 | CHECK_EQ(dex_file->GetMethodId(method_idx).name_idx_, |
| 1435 | dex_file->GetMethodId(method_idx + 1).name_idx_); |
| 1436 | CHECK_EQ(dex_file->GetMethodId(method_idx).proto_idx_ + 1u, |
| 1437 | dex_file->GetMethodId(method_idx + 1).proto_idx_); |
| 1438 | // Their return types should be the same. |
| 1439 | uint32_t proto1_idx = dex_file->GetMethodId(method_idx).proto_idx_; |
| 1440 | const DexFile::ProtoId& proto1 = dex_file->GetProtoId(proto1_idx); |
| 1441 | const DexFile::ProtoId& proto2 = dex_file->GetProtoId(proto1_idx + 1u); |
| 1442 | CHECK_EQ(proto1.return_type_idx_, proto2.return_type_idx_); |
| 1443 | // And the first should not have any parameters while the second should have some. |
| 1444 | CHECK(!DexFileParameterIterator(*dex_file, proto1).HasNext()); |
| 1445 | CHECK(DexFileParameterIterator(*dex_file, proto2).HasNext()); |
| 1446 | if (i == 0) { |
| 1447 | // Swap the proto parameters and shorties to break the ordering. |
| 1448 | std::swap(const_cast<uint32_t&>(proto1.parameters_off_), |
| 1449 | const_cast<uint32_t&>(proto2.parameters_off_)); |
Andreas Gampe | 8a0128a | 2016-11-28 07:38:35 -0800 | [diff] [blame] | 1450 | std::swap(const_cast<dex::StringIndex&>(proto1.shorty_idx_), |
| 1451 | const_cast<dex::StringIndex&>(proto2.shorty_idx_)); |
Vladimir Marko | 0ca8add | 2016-05-03 17:17:50 +0100 | [diff] [blame] | 1452 | } else { |
| 1453 | // Copy the proto parameters and shorty to create duplicate proto id. |
| 1454 | const_cast<uint32_t&>(proto1.parameters_off_) = proto2.parameters_off_; |
Andreas Gampe | 8a0128a | 2016-11-28 07:38:35 -0800 | [diff] [blame] | 1455 | const_cast<dex::StringIndex&>(proto1.shorty_idx_) = proto2.shorty_idx_; |
Vladimir Marko | 0ca8add | 2016-05-03 17:17:50 +0100 | [diff] [blame] | 1456 | } |
| 1457 | }, |
| 1458 | "Out-of-order proto_id arguments"); |
| 1459 | } |
| 1460 | } |
| 1461 | |
Roland Levillain | 621b5ea | 2016-05-18 11:41:33 +0100 | [diff] [blame] | 1462 | // To generate a base64 encoded Dex file version 037 from Smali files, use: |
| 1463 | // |
| 1464 | // smali --api-level 24 -o classes.dex class1.smali [class2.smali ...] |
| 1465 | // base64 classes.dex >classes.dex.base64 |
| 1466 | |
| 1467 | // Dex file version 037 generated from: |
| 1468 | // |
| 1469 | // .class public LB28685551; |
| 1470 | // .super LB28685551; |
| 1471 | |
| 1472 | static const char kClassExtendsItselfTestDex[] = |
| 1473 | "ZGV4CjAzNwDeGbgRg1kb6swszpcTWrrOAALB++F4OPT0AAAAcAAAAHhWNBIAAAAAAAAAAKgAAAAB" |
| 1474 | "AAAAcAAAAAEAAAB0AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQAAAHgAAABcAAAAmAAAAJgA" |
| 1475 | "AAAAAAAAAAAAAAEAAAAAAAAAAAAAAP////8AAAAAAAAAAAAAAAALTEIyODY4NTU1MTsAAAAABgAA" |
| 1476 | "AAAAAAABAAAAAAAAAAEAAAABAAAAcAAAAAIAAAABAAAAdAAAAAYAAAABAAAAeAAAAAIgAAABAAAA" |
| 1477 | "mAAAAAAQAAABAAAAqAAAAA=="; |
| 1478 | |
| 1479 | TEST_F(DexFileVerifierTest, ClassExtendsItself) { |
| 1480 | VerifyModification( |
| 1481 | kClassExtendsItselfTestDex, |
| 1482 | "class_extends_itself", |
| 1483 | [](DexFile* dex_file ATTRIBUTE_UNUSED) { /* empty */ }, |
| 1484 | "Class with same type idx as its superclass: '0'"); |
| 1485 | } |
| 1486 | |
| 1487 | // Dex file version 037 generated from: |
| 1488 | // |
| 1489 | // .class public LFoo; |
| 1490 | // .super LBar; |
| 1491 | // |
| 1492 | // and: |
| 1493 | // |
| 1494 | // .class public LBar; |
| 1495 | // .super LFoo; |
| 1496 | |
| 1497 | static const char kClassesExtendOneAnotherTestDex[] = |
| 1498 | "ZGV4CjAzNwBXHSrwpDMwRBkg+L+JeQCuFNRLhQ86duEcAQAAcAAAAHhWNBIAAAAAAAAAANAAAAAC" |
| 1499 | "AAAAcAAAAAIAAAB4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAgAAAIAAAABcAAAAwAAAAMAA" |
| 1500 | "AADHAAAAAAAAAAEAAAABAAAAAQAAAAAAAAAAAAAA/////wAAAAAAAAAAAAAAAAAAAAABAAAAAQAA" |
| 1501 | "AAAAAAD/////AAAAAAAAAAAAAAAABUxCYXI7AAVMRm9vOwAAAAYAAAAAAAAAAQAAAAAAAAABAAAA" |
| 1502 | "AgAAAHAAAAACAAAAAgAAAHgAAAAGAAAAAgAAAIAAAAACIAAAAgAAAMAAAAAAEAAAAQAAANAAAAA="; |
| 1503 | |
| 1504 | TEST_F(DexFileVerifierTest, ClassesExtendOneAnother) { |
| 1505 | VerifyModification( |
| 1506 | kClassesExtendOneAnotherTestDex, |
| 1507 | "classes_extend_one_another", |
| 1508 | [](DexFile* dex_file ATTRIBUTE_UNUSED) { /* empty */ }, |
| 1509 | "Invalid class definition ordering: class with type idx: '1' defined before" |
| 1510 | " superclass with type idx: '0'"); |
| 1511 | } |
| 1512 | |
| 1513 | // Dex file version 037 generated from: |
| 1514 | // |
| 1515 | // .class public LAll; |
| 1516 | // .super LYour; |
| 1517 | // |
| 1518 | // and: |
| 1519 | // |
| 1520 | // .class public LYour; |
| 1521 | // .super LBase; |
| 1522 | // |
| 1523 | // and: |
| 1524 | // |
| 1525 | // .class public LBase; |
| 1526 | // .super LAll; |
| 1527 | |
| 1528 | static const char kCircularClassInheritanceTestDex[] = |
| 1529 | "ZGV4CjAzNwBMJxgP0SJz6oLXnKfl+J7lSEORLRwF5LNMAQAAcAAAAHhWNBIAAAAAAAAAAAABAAAD" |
| 1530 | "AAAAcAAAAAMAAAB8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAIgAAABkAAAA6AAAAOgA" |
| 1531 | "AADvAAAA9wAAAAAAAAABAAAAAgAAAAEAAAABAAAAAAAAAAAAAAD/////AAAAAAAAAAAAAAAAAgAA" |
| 1532 | "AAEAAAABAAAAAAAAAP////8AAAAAAAAAAAAAAAAAAAAAAQAAAAIAAAAAAAAA/////wAAAAAAAAAA" |
| 1533 | "AAAAAAVMQWxsOwAGTEJhc2U7AAZMWW91cjsAAAYAAAAAAAAAAQAAAAAAAAABAAAAAwAAAHAAAAAC" |
| 1534 | "AAAAAwAAAHwAAAAGAAAAAwAAAIgAAAACIAAAAwAAAOgAAAAAEAAAAQAAAAABAAA="; |
| 1535 | |
| 1536 | TEST_F(DexFileVerifierTest, CircularClassInheritance) { |
| 1537 | VerifyModification( |
| 1538 | kCircularClassInheritanceTestDex, |
| 1539 | "circular_class_inheritance", |
| 1540 | [](DexFile* dex_file ATTRIBUTE_UNUSED) { /* empty */ }, |
| 1541 | "Invalid class definition ordering: class with type idx: '1' defined before" |
| 1542 | " superclass with type idx: '0'"); |
| 1543 | } |
| 1544 | |
| 1545 | // Dex file version 037 generated from: |
| 1546 | // |
| 1547 | // .class public abstract interface LInterfaceImplementsItself; |
| 1548 | // .super Ljava/lang/Object; |
| 1549 | // .implements LInterfaceImplementsItself; |
| 1550 | |
| 1551 | static const char kInterfaceImplementsItselfTestDex[] = |
| 1552 | "ZGV4CjAzNwCKKrjatp8XbXl5S/bEVJnqaBhjZkQY4440AQAAcAAAAHhWNBIAAAAAAAAAANwAAAAC" |
| 1553 | "AAAAcAAAAAIAAAB4AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAQAAAIAAAACUAAAAoAAAAKAA" |
| 1554 | "AAC9AAAAAAAAAAEAAAAAAAAAAQYAAAEAAADUAAAA/////wAAAAAAAAAAAAAAABtMSW50ZXJmYWNl" |
| 1555 | "SW1wbGVtZW50c0l0c2VsZjsAEkxqYXZhL2xhbmcvT2JqZWN0OwAAAAABAAAAAAAAAAcAAAAAAAAA" |
| 1556 | "AQAAAAAAAAABAAAAAgAAAHAAAAACAAAAAgAAAHgAAAAGAAAAAQAAAIAAAAACIAAAAgAAAKAAAAAB" |
| 1557 | "EAAAAQAAANQAAAAAEAAAAQAAANwAAAA="; |
| 1558 | |
| 1559 | TEST_F(DexFileVerifierTest, InterfaceImplementsItself) { |
| 1560 | VerifyModification( |
| 1561 | kInterfaceImplementsItselfTestDex, |
| 1562 | "interface_implements_itself", |
| 1563 | [](DexFile* dex_file ATTRIBUTE_UNUSED) { /* empty */ }, |
| 1564 | "Class with same type idx as implemented interface: '0'"); |
| 1565 | } |
| 1566 | |
| 1567 | // Dex file version 037 generated from: |
| 1568 | // |
| 1569 | // .class public abstract interface LPing; |
| 1570 | // .super Ljava/lang/Object; |
| 1571 | // .implements LPong; |
| 1572 | // |
| 1573 | // and: |
| 1574 | // |
| 1575 | // .class public abstract interface LPong; |
| 1576 | // .super Ljava/lang/Object; |
| 1577 | // .implements LPing; |
| 1578 | |
| 1579 | static const char kInterfacesImplementOneAnotherTestDex[] = |
| 1580 | "ZGV4CjAzNwD0Kk9sxlYdg3Dy1Cff0gQCuJAQfEP6ohZUAQAAcAAAAHhWNBIAAAAAAAAAAPwAAAAD" |
| 1581 | "AAAAcAAAAAMAAAB8AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAgAAAIgAAACMAAAAyAAAAMgA" |
| 1582 | "AADQAAAA2AAAAAAAAAABAAAAAgAAAAEAAAABBgAAAgAAAOwAAAD/////AAAAAAAAAAAAAAAAAAAA" |
| 1583 | "AAEGAAACAAAA9AAAAP////8AAAAAAAAAAAAAAAAGTFBpbmc7AAZMUG9uZzsAEkxqYXZhL2xhbmcv" |
| 1584 | "T2JqZWN0OwABAAAAAAAAAAEAAAABAAAABwAAAAAAAAABAAAAAAAAAAEAAAADAAAAcAAAAAIAAAAD" |
| 1585 | "AAAAfAAAAAYAAAACAAAAiAAAAAIgAAADAAAAyAAAAAEQAAACAAAA7AAAAAAQAAABAAAA/AAAAA=="; |
| 1586 | |
| 1587 | TEST_F(DexFileVerifierTest, InterfacesImplementOneAnother) { |
| 1588 | VerifyModification( |
| 1589 | kInterfacesImplementOneAnotherTestDex, |
| 1590 | "interfaces_implement_one_another", |
| 1591 | [](DexFile* dex_file ATTRIBUTE_UNUSED) { /* empty */ }, |
| 1592 | "Invalid class definition ordering: class with type idx: '1' defined before" |
| 1593 | " implemented interface with type idx: '0'"); |
| 1594 | } |
| 1595 | |
| 1596 | // Dex file version 037 generated from: |
| 1597 | // |
| 1598 | // .class public abstract interface LA; |
| 1599 | // .super Ljava/lang/Object; |
| 1600 | // .implements LB; |
| 1601 | // |
| 1602 | // and: |
| 1603 | // |
| 1604 | // .class public abstract interface LB; |
| 1605 | // .super Ljava/lang/Object; |
| 1606 | // .implements LC; |
| 1607 | // |
| 1608 | // and: |
| 1609 | // |
| 1610 | // .class public abstract interface LC; |
| 1611 | // .super Ljava/lang/Object; |
| 1612 | // .implements LA; |
| 1613 | |
| 1614 | static const char kCircularInterfaceImplementationTestDex[] = |
| 1615 | "ZGV4CjAzNwCzKmD5Fol6XAU6ichYHcUTIP7Z7MdTcEmEAQAAcAAAAHhWNBIAAAAAAAAAACwBAAAE" |
| 1616 | "AAAAcAAAAAQAAACAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAwAAAJAAAACUAAAA8AAAAPAA" |
| 1617 | "AAD1AAAA+gAAAP8AAAAAAAAAAQAAAAIAAAADAAAAAgAAAAEGAAADAAAAHAEAAP////8AAAAAAAAA" |
| 1618 | "AAAAAAABAAAAAQYAAAMAAAAUAQAA/////wAAAAAAAAAAAAAAAAAAAAABBgAAAwAAACQBAAD/////" |
| 1619 | "AAAAAAAAAAAAAAAAA0xBOwADTEI7AANMQzsAEkxqYXZhL2xhbmcvT2JqZWN0OwAAAQAAAAIAAAAB" |
| 1620 | "AAAAAAAAAAEAAAABAAAABwAAAAAAAAABAAAAAAAAAAEAAAAEAAAAcAAAAAIAAAAEAAAAgAAAAAYA" |
| 1621 | "AAADAAAAkAAAAAIgAAAEAAAA8AAAAAEQAAADAAAAFAEAAAAQAAABAAAALAEAAA=="; |
| 1622 | |
| 1623 | TEST_F(DexFileVerifierTest, CircularInterfaceImplementation) { |
| 1624 | VerifyModification( |
| 1625 | kCircularInterfaceImplementationTestDex, |
| 1626 | "circular_interface_implementation", |
| 1627 | [](DexFile* dex_file ATTRIBUTE_UNUSED) { /* empty */ }, |
| 1628 | "Invalid class definition ordering: class with type idx: '2' defined before" |
| 1629 | " implemented interface with type idx: '0'"); |
| 1630 | } |
| 1631 | |
Aart Bik | 37d6a3b | 2016-06-21 18:30:10 -0700 | [diff] [blame] | 1632 | TEST_F(DexFileVerifierTest, Checksum) { |
| 1633 | size_t length; |
Alex Light | 9c20a14 | 2016-08-23 15:05:12 -0700 | [diff] [blame] | 1634 | std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kGoodTestDex, &length)); |
Aart Bik | 37d6a3b | 2016-06-21 18:30:10 -0700 | [diff] [blame] | 1635 | CHECK(dex_bytes != nullptr); |
| 1636 | // Note: `dex_file` will be destroyed before `dex_bytes`. |
| 1637 | std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length)); |
| 1638 | std::string error_msg; |
| 1639 | |
| 1640 | // Good checksum: all pass. |
| 1641 | EXPECT_TRUE(DexFileVerifier::Verify(dex_file.get(), |
| 1642 | dex_file->Begin(), |
| 1643 | dex_file->Size(), |
| 1644 | "good checksum, no verify", |
| 1645 | /*verify_checksum*/ false, |
| 1646 | &error_msg)); |
| 1647 | EXPECT_TRUE(DexFileVerifier::Verify(dex_file.get(), |
| 1648 | dex_file->Begin(), |
| 1649 | dex_file->Size(), |
| 1650 | "good checksum, verify", |
| 1651 | /*verify_checksum*/ true, |
| 1652 | &error_msg)); |
| 1653 | |
| 1654 | // Bad checksum: !verify_checksum passes verify_checksum fails. |
| 1655 | DexFile::Header* header = reinterpret_cast<DexFile::Header*>( |
| 1656 | const_cast<uint8_t*>(dex_file->Begin())); |
| 1657 | header->checksum_ = 0; |
| 1658 | EXPECT_TRUE(DexFileVerifier::Verify(dex_file.get(), |
| 1659 | dex_file->Begin(), |
| 1660 | dex_file->Size(), |
| 1661 | "bad checksum, no verify", |
| 1662 | /*verify_checksum*/ false, |
| 1663 | &error_msg)); |
| 1664 | EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(), |
| 1665 | dex_file->Begin(), |
| 1666 | dex_file->Size(), |
| 1667 | "bad checksum, verify", |
| 1668 | /*verify_checksum*/ true, |
| 1669 | &error_msg)); |
| 1670 | EXPECT_NE(error_msg.find("Bad checksum"), std::string::npos) << error_msg; |
| 1671 | } |
| 1672 | |
Orion Hodson | 6c4921b | 2016-09-21 15:41:06 +0100 | [diff] [blame^] | 1673 | TEST_F(DexFileVerifierTest, BadStaticMethodName) { |
| 1674 | // Generated DEX file version (037) from: |
| 1675 | // |
| 1676 | // .class public LBadName; |
| 1677 | // .super Ljava/lang/Object; |
| 1678 | // |
| 1679 | // .method public static <bad_name> (II)V |
| 1680 | // .registers 2 |
| 1681 | // .prologue |
| 1682 | // return-void |
| 1683 | // .end method |
| 1684 | // |
| 1685 | // .method public constructor <init>()V |
| 1686 | // .registers 1 |
| 1687 | // .prologue |
| 1688 | // .line 1 |
| 1689 | // invoke-direct {p0}, Ljava/lang/Object;-><init>()V |
| 1690 | // return-void |
| 1691 | // .end method |
| 1692 | // |
| 1693 | static const char kDexBase64[] = |
| 1694 | "ZGV4CjAzNwC2NYlwyxEc/h6hv+hMeUVQPtiX6MQBcfgwAgAAcAAAAHhWNBIAAAAAAAAAAJABAAAI" |
| 1695 | "AAAAcAAAAAQAAACQAAAAAgAAAKAAAAAAAAAAAAAAAAMAAAC4AAAAAQAAANAAAABAAQAA8AAAAPAA" |
| 1696 | "AAD8AAAABAEAABIBAAAVAQAAIAEAADQBAAA3AQAAAwAAAAQAAAAFAAAABgAAAAYAAAADAAAAAAAA" |
| 1697 | "AAcAAAADAAAAPAEAAAEAAQAAAAAAAQAAAAEAAAACAAAAAQAAAAEAAAABAAAAAgAAAAAAAAACAAAA" |
| 1698 | "AAAAAIABAAAAAAAACjxiYWRfbmFtZT4ABjxpbml0PgAMQmFkTmFtZS5qYXZhAAFJAAlMQmFkTmFt" |
| 1699 | "ZTsAEkxqYXZhL2xhbmcvT2JqZWN0OwABVgADVklJAAIAAAAAAAAAAAAAAAACAAAHAAEABw4AAAIA" |
| 1700 | "AgAAAAAASAEAAAEAAAAOAAAAAQABAAEAAABOAQAABAAAAHAQAgAAAA4AAAACAAAJ1AIBgYAE6AIA" |
| 1701 | "AA0AAAAAAAAAAQAAAAAAAAABAAAACAAAAHAAAAACAAAABAAAAJAAAAADAAAAAgAAAKAAAAAFAAAA" |
| 1702 | "AwAAALgAAAAGAAAAAQAAANAAAAACIAAACAAAAPAAAAABEAAAAQAAADwBAAADEAAAAQAAAEQBAAAD" |
| 1703 | "IAAAAgAAAEgBAAABIAAAAgAAAFQBAAAAIAAAAQAAAIABAAAAEAAAAQAAAJABAAA="; |
| 1704 | |
| 1705 | size_t length; |
| 1706 | std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length)); |
| 1707 | CHECK(dex_bytes != nullptr); |
| 1708 | // Note: `dex_file` will be destroyed before `dex_bytes`. |
| 1709 | std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length)); |
| 1710 | std::string error_msg; |
| 1711 | EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(), |
| 1712 | dex_file->Begin(), |
| 1713 | dex_file->Size(), |
| 1714 | "bad static method name", |
| 1715 | /*verify_checksum*/ true, |
| 1716 | &error_msg)); |
| 1717 | } |
| 1718 | |
| 1719 | TEST_F(DexFileVerifierTest, BadVirtualMethodName) { |
| 1720 | // Generated DEX file version (037) from: |
| 1721 | // |
| 1722 | // .class public LBadVirtualName; |
| 1723 | // .super Ljava/lang/Object; |
| 1724 | // |
| 1725 | // .method public <bad_name> (II)V |
| 1726 | // .registers 2 |
| 1727 | // return-void |
| 1728 | // .end method |
| 1729 | // |
| 1730 | // .method public constructor <init>()V |
| 1731 | // .registers 1 |
| 1732 | // invoke-direct {p0}, Ljava/lang/Object;-><init>()V |
| 1733 | // return-void |
| 1734 | // .end method |
| 1735 | // |
| 1736 | static const char kDexBase64[] = |
| 1737 | "ZGV4CjAzNwDcPC8B2E7kYTZmeHX2u2IqrpWV9EXBHpE8AgAAcAAAAHhWNBIAAAAAAAAAAJwBAAAI" |
| 1738 | "AAAAcAAAAAQAAACQAAAAAgAAAKAAAAAAAAAAAAAAAAMAAAC4AAAAAQAAANAAAABMAQAA8AAAAPAA" |
| 1739 | "AAD8AAAABAEAABkBAAAcAQAALgEAAEIBAABFAQAAAwAAAAQAAAAFAAAABgAAAAYAAAADAAAAAAAA" |
| 1740 | "AAcAAAADAAAATAEAAAEAAQAAAAAAAQAAAAEAAAACAAAAAQAAAAEAAAABAAAAAgAAAAAAAAACAAAA" |
| 1741 | "AAAAAI4BAAAAAAAACjxiYWRfbmFtZT4ABjxpbml0PgATQmFkVmlydHVhbE5hbWUuamF2YQABSQAQ" |
| 1742 | "TEJhZFZpcnR1YWxOYW1lOwASTGphdmEvbGFuZy9PYmplY3Q7AAFWAANWSUkAAAACAAAAAAAAAAAA" |
| 1743 | "AAABAAcOAAACAAAHAAABAAEAAQAAAFgBAAAEAAAAcBACAAAADgADAAMAAAAAAF0BAAABAAAADgAA" |
| 1744 | "AAEBAYGABOQCAAH8Ag0AAAAAAAAAAQAAAAAAAAABAAAACAAAAHAAAAACAAAABAAAAJAAAAADAAAA" |
| 1745 | "AgAAAKAAAAAFAAAAAwAAALgAAAAGAAAAAQAAANAAAAACIAAACAAAAPAAAAABEAAAAQAAAEwBAAAD" |
| 1746 | "EAAAAQAAAFQBAAADIAAAAgAAAFgBAAABIAAAAgAAAGQBAAAAIAAAAQAAAI4BAAAAEAAAAQAAAJwB" |
| 1747 | "AAA="; |
| 1748 | |
| 1749 | size_t length; |
| 1750 | std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length)); |
| 1751 | CHECK(dex_bytes != nullptr); |
| 1752 | // Note: `dex_file` will be destroyed before `dex_bytes`. |
| 1753 | std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length)); |
| 1754 | std::string error_msg; |
| 1755 | EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(), |
| 1756 | dex_file->Begin(), |
| 1757 | dex_file->Size(), |
| 1758 | "bad virtual method name", |
| 1759 | /*verify_checksum*/ true, |
| 1760 | &error_msg)); |
| 1761 | } |
| 1762 | |
| 1763 | TEST_F(DexFileVerifierTest, BadClinitSignature) { |
| 1764 | // Generated DEX file version (037) from: |
| 1765 | // |
| 1766 | // .class public LOneClinitBadSig; |
| 1767 | // .super Ljava/lang/Object; |
| 1768 | // |
| 1769 | // .method public static constructor <clinit>(II)V |
| 1770 | // .registers 2 |
| 1771 | // return-void |
| 1772 | // .end method |
| 1773 | // |
| 1774 | // .method public constructor <init>()V |
| 1775 | // .registers 1 |
| 1776 | // invoke-direct {p0}, Ljava/lang/Object;-><init>()V |
| 1777 | // return-void |
| 1778 | // .end method |
| 1779 | // |
| 1780 | static const char kDexBase64[] = |
| 1781 | "ZGV4CjAzNwBNOwTbfJmWq5eMOlxUY4EICGiEGJMVg8RAAgAAcAAAAHhWNBIAAAAAAAAAAKABAAAI" |
| 1782 | "AAAAcAAAAAQAAACQAAAAAgAAAKAAAAAAAAAAAAAAAAMAAAC4AAAAAQAAANAAAABQAQAA8AAAAPAA" |
| 1783 | "AAD6AAAAAgEAAAUBAAAYAQAALAEAAEIBAABFAQAAAgAAAAMAAAAEAAAABgAAAAYAAAADAAAAAAAA" |
| 1784 | "AAcAAAADAAAATAEAAAEAAQAAAAAAAQAAAAEAAAACAAAAAQAAAAEAAAABAAAAAgAAAAAAAAAFAAAA" |
| 1785 | "AAAAAJABAAAAAAAACDxjbGluaXQ+AAY8aW5pdD4AAUkAEUxPbmVDbGluaXRCYWRTaWc7ABJMamF2" |
| 1786 | "YS9sYW5nL09iamVjdDsAFE9uZUNsaW5pdEJhZFNpZy5qYXZhAAFWAANWSUkAAAACAAAAAAAAAAAA" |
| 1787 | "AAAAAgAABwABAAcOAAACAAIAAAAAAFgBAAABAAAADgAAAAEAAQABAAAAXgEAAAQAAABwEAIAAAAO" |
| 1788 | "AAAAAgAAiYAE5AIBgYAE+AINAAAAAAAAAAEAAAAAAAAAAQAAAAgAAABwAAAAAgAAAAQAAACQAAAA" |
| 1789 | "AwAAAAIAAACgAAAABQAAAAMAAAC4AAAABgAAAAEAAADQAAAAAiAAAAgAAADwAAAAARAAAAEAAABM" |
| 1790 | "AQAAAxAAAAEAAABUAQAAAyAAAAIAAABYAQAAASAAAAIAAABkAQAAACAAAAEAAACQAQAAABAAAAEA" |
| 1791 | "AACgAQAA"; |
| 1792 | |
| 1793 | size_t length; |
| 1794 | std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length)); |
| 1795 | CHECK(dex_bytes != nullptr); |
| 1796 | // Note: `dex_file` will be destroyed before `dex_bytes`. |
| 1797 | std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length)); |
| 1798 | std::string error_msg; |
| 1799 | EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(), |
| 1800 | dex_file->Begin(), |
| 1801 | dex_file->Size(), |
| 1802 | "bad clinit signature", |
| 1803 | /*verify_checksum*/ true, |
| 1804 | &error_msg)); |
| 1805 | } |
| 1806 | |
| 1807 | TEST_F(DexFileVerifierTest, BadClinitSignatureAgain) { |
| 1808 | // Generated DEX file version (037) from: |
| 1809 | // |
| 1810 | // .class public LOneClinitBadSigAgain; |
| 1811 | // .super Ljava/lang/Object; |
| 1812 | // |
| 1813 | // .method public static constructor <clinit>()I |
| 1814 | // .registers 1 |
| 1815 | // const/4 v0, 1 |
| 1816 | // return v0 |
| 1817 | // .end method |
| 1818 | // |
| 1819 | // .method public constructor <init>()V |
| 1820 | // .registers 1 |
| 1821 | // invoke-direct {p0}, Ljava/lang/Object;-><init>()V |
| 1822 | // return-void |
| 1823 | // .end method |
| 1824 | // |
| 1825 | static const char kDexBase64[] = |
| 1826 | "ZGV4CjAzNwBfPcPu5NVwKUqZIu/YR8xqVlVD5UzTk0gEAgAAcAAAAHhWNBIAAAAAAAAAAIgBAAAH" |
| 1827 | "AAAAcAAAAAQAAACMAAAAAgAAAJwAAAAAAAAAAAAAAAMAAAC0AAAAAQAAAMwAAAAYAQAA7AAAAOwA" |
| 1828 | "AAD2AAAA/gAAAAEBAAAZAQAALQEAAEgBAAACAAAAAwAAAAQAAAAGAAAAAgAAAAAAAAAAAAAABgAA" |
| 1829 | "AAMAAAAAAAAAAQAAAAAAAAABAAEAAQAAAAIAAQABAAAAAQAAAAEAAAACAAAAAAAAAAUAAAAAAAAA" |
| 1830 | "eAEAAAAAAAAIPGNsaW5pdD4ABjxpbml0PgABSQAWTE9uZUNsaW5pdEJhZFNpZ0FnYWluOwASTGph" |
| 1831 | "dmEvbGFuZy9PYmplY3Q7ABlPbmVDbGluaXRCYWRTaWdBZ2Fpbi5qYXZhAAFWAAABAAAAAAAAAAAA" |
| 1832 | "AAACAAAAEhAPAAEAAQABAAAAAAAAAAQAAABwEAIAAAAOAAAAAgAAiYAEzAIBgYAE4AIKAAAAAAAA" |
| 1833 | "AAEAAAAAAAAAAQAAAAcAAABwAAAAAgAAAAQAAACMAAAAAwAAAAIAAACcAAAABQAAAAMAAAC0AAAA" |
| 1834 | "BgAAAAEAAADMAAAAAiAAAAcAAADsAAAAASAAAAIAAABMAQAAACAAAAEAAAB4AQAAABAAAAEAAACI" |
| 1835 | "AQAA"; |
| 1836 | |
| 1837 | size_t length; |
| 1838 | std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length)); |
| 1839 | CHECK(dex_bytes != nullptr); |
| 1840 | // Note: `dex_file` will be destroyed before `dex_bytes`. |
| 1841 | std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length)); |
| 1842 | std::string error_msg; |
| 1843 | EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(), |
| 1844 | dex_file->Begin(), |
| 1845 | dex_file->Size(), |
| 1846 | "bad clinit signature", |
| 1847 | /*verify_checksum*/ true, |
| 1848 | &error_msg)); |
| 1849 | } |
| 1850 | |
| 1851 | TEST_F(DexFileVerifierTest, BadInitSignature) { |
| 1852 | // Generated DEX file version (037) from: |
| 1853 | // |
| 1854 | // .class public LBadInitSig; |
| 1855 | // .super Ljava/lang/Object; |
| 1856 | // |
| 1857 | // .method public constructor <init>()I |
| 1858 | // .registers 1 |
| 1859 | // invoke-direct {p0}, Ljava/lang/Object;-><init>()V |
| 1860 | // const v0, 1 |
| 1861 | // return v0 |
| 1862 | // .end method |
| 1863 | // |
| 1864 | static const char kDexBase64[] = |
| 1865 | "ZGV4CjAzNwCdMdeh1KoHWamF2Prq32LF39YZ78fV7q+wAQAAcAAAAHhWNBIAAAAAAAAAADQBAAAF" |
| 1866 | "AAAAcAAAAAQAAACEAAAAAgAAAJQAAAAAAAAAAAAAAAIAAACsAAAAAQAAALwAAADUAAAA3AAAANwA" |
| 1867 | "AADkAAAA5wAAAPUAAAAJAQAAAQAAAAIAAAADAAAABAAAAAEAAAAAAAAAAAAAAAQAAAADAAAAAAAA" |
| 1868 | "AAEAAAAAAAAAAgABAAAAAAABAAAAAQAAAAIAAAAAAAAA/////wAAAAAqAQAAAAAAAAY8aW5pdD4A" |
| 1869 | "AUkADExCYWRJbml0U2lnOwASTGphdmEvbGFuZy9PYmplY3Q7AAFWAAEAAQABAAAAAAAAAAcAAABw" |
| 1870 | "EAEAAAAUAAEAAAAPAAAAAQAAgYAEjAIKAAAAAAAAAAEAAAAAAAAAAQAAAAUAAABwAAAAAgAAAAQA" |
| 1871 | "AACEAAAAAwAAAAIAAACUAAAABQAAAAIAAACsAAAABgAAAAEAAAC8AAAAAiAAAAUAAADcAAAAASAA" |
| 1872 | "AAEAAAAMAQAAACAAAAEAAAAqAQAAABAAAAEAAAA0AQAA"; |
| 1873 | |
| 1874 | size_t length; |
| 1875 | std::unique_ptr<uint8_t[]> dex_bytes(DecodeBase64(kDexBase64, &length)); |
| 1876 | CHECK(dex_bytes != nullptr); |
| 1877 | // Note: `dex_file` will be destroyed before `dex_bytes`. |
| 1878 | std::unique_ptr<DexFile> dex_file(GetDexFile(dex_bytes.get(), length)); |
| 1879 | std::string error_msg; |
| 1880 | EXPECT_FALSE(DexFileVerifier::Verify(dex_file.get(), |
| 1881 | dex_file->Begin(), |
| 1882 | dex_file->Size(), |
| 1883 | "bad init signature", |
| 1884 | /*verify_checksum*/ true, |
| 1885 | &error_msg)); |
| 1886 | } |
| 1887 | |
Andreas Gampe | df10b32 | 2014-06-11 21:46:05 -0700 | [diff] [blame] | 1888 | } // namespace art |